Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
Data Discovery with IBM Watson
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
NASA Airline Operations Research Center
Mogford, Richard H.
2016-01-01
This is a PowerPoint presentation NASA airline operations center (AOC) research. It includes information on using IBM Watson in the AOC. It also reviews a dispatcher decision support tool call the Flight Awareness Collaboration Tool (FACT). FACT gathers information about winter weather onto one screen and includes predictive abilities. It should prove to be useful for airline dispatchers and airport personnel when they manage winter storms and their effect on air traffic. This material is very similar to other previously approved presentations with the same title.
Weighted Watson-Crick automata
Energy Technology Data Exchange (ETDEWEB)
Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)
2014-07-10
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
Weighted Watson-Crick automata
International Nuclear Information System (INIS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-01-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power
Closure properties of Watson-Crick grammars
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities
Kidd, Gary R.
2004-05-01
Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
Rilling, M
2000-01-01
Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.
Distributional Watson transforms
Dijksma, A.; Snoo, H.S.V. de
1974-01-01
For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.
Multi-head Watson-Crick automata
Chatterjee, Kingshuk; Ray, Kumar Sankar
2015-01-01
Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
78 FR 43198 - Watson Cogeneration Company; Notice of Filing
2013-07-19
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
A conversation with Geoff Watson
Beran, R. J.; Fisher, N. I.
1998-01-01
Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...
Energy Technology Data Exchange (ETDEWEB)
CHRIST,N.; DAVENPORT,J.; DENG,Y.; GARA,A.; GLIMM,J.; MAWHINNEY,R.; MCFADDEN,E.; PESKIN,A.; PULLEYBLANK,W.
2003-03-11
Staff of Brookhaven National Laboratory, Columbia University, IBM and the RIKEN BNL Research Center organized a one-day workshop held on February 28, 2003 at Brookhaven to promote the following goals: (1) To explore areas other than QCD applications where the QCDOC and BlueGene/L machines can be applied to good advantage, (2) To identify areas where collaboration among the sponsoring institutions can be fruitful, and (3) To expose scientists to the emerging software architecture. This workshop grew out of an informal visit last fall by BNL staff to the IBM Thomas J. Watson Research Center that resulted in a continuing dialog among participants on issues common to these two related supercomputers. The workshop was divided into three sessions, addressing the hardware and software status of each system, prospective applications, and future directions.
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
The multiple personalities of Watson and Crick strands
Directory of Open Access Journals (Sweden)
Graur Dan
2011-02-01
Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Training IBM Watson using Automatically Generated Question-Answer Pairs
Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh
2016-01-01
IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...
Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje
Stojić, Igor
2016-01-01
Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
Building Watson: An Overview of the DeepQA Project
Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris
2010-01-01
IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...
2006-01-01
Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
2013-03-20
... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
2013-10-25
... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...
Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory
International Nuclear Information System (INIS)
Geltman, S.
1996-01-01
Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society
On the scaling limits of Galton Watson processes in varying environment
Bansaye, V.; Simatos, F.
2011-01-01
Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition
Sommerfeld-Watson transformation for nuclear fission
International Nuclear Information System (INIS)
Alexandru, G.
1978-01-01
It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)
Vergo, John; Karat, Clare-Marie; Karat, John; Pinhanez, Claudio; Arora, Renee; Cofino, Thomas; Riecken, Doug; Podlaseck, Mark
This paper summarizes a 10-month long research project conducted at the IBM T.J. Watson Research Center aimed at developing the design concept of a multi-institutional art and culture web site. The work followed a user-centered design (UCD) approach, where interaction with prototypes and feedback from potential users of the web site were sought…
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2005-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-12-01
Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.
Graham Watson: Eesti vajab enam riigi sekkumist majandusse
Watson, Graham
2009-01-01
18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Did John B. Watson Really "Found" Behaviorism?
Malone, John C
2014-05-01
Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season
Directory of Open Access Journals (Sweden)
Lina Affifatusholihah
2017-04-01
In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
A history of the term radical behaviorism: From Watson to Skinner
Schneider, Susan M.; Morris, Edward K.
1987-01-01
This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958
Watson's theorem and resonant pion photoproduction amplitude in the delta channel
International Nuclear Information System (INIS)
Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.
1984-01-01
The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)
Watson's behaviorism: a comparison of the two editions (1925 and 1930).
Carpintero, Helio
2004-05-01
J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Elementary? Question Answering, IBM's Watson, and the Jeopardy ...
Indian Academy of Sciences (India)
IAS Admin
One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...
Relativistic generalisation of the Kroll-Watson formula
International Nuclear Information System (INIS)
Kaminski, J.Z.
1985-01-01
The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
International Nuclear Information System (INIS)
Fargher, H.E.; Roberts, M.J.
1983-01-01
Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)
International Nuclear Information System (INIS)
Catalan, G.; Roberts, M.J.
1979-01-01
A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)
O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante
Directory of Open Access Journals (Sweden)
Cláudio Ivan de Oliveira
Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.
A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3
International Nuclear Information System (INIS)
Roberts, M.J.
1988-01-01
Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)
The Game is aFoot, Watson: DeepQA systems and the future of HCI
Keates, Simeon; Varker, Philip
2012-01-01
In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
Meijer, Rob R.
I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
Watson-Crick hydrogen bonding of unlocked nucleic acids
DEFF Research Database (Denmark)
Langkjær, Niels; Wengel, Jesper; Pasternak, Anna
2015-01-01
We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....
Watson, Skinner y Algunas Disputas dentro del Conductismo
Directory of Open Access Journals (Sweden)
RICARDO PELLÓN SUÁREZ DE PUGA
2013-01-01
Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-01-01
Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
Directory of Open Access Journals (Sweden)
Katy Shaw
2016-04-01
Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.
Watson: A new link in the IIE iron chain
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Tehran Nuclear Research Center
International Nuclear Information System (INIS)
Taherzadeh, M.
1977-01-01
The Tehran Nuclear Research Center was formerly managed by the University of Tehran. This Center, after its transformation to the AEOI, has now become a focal point for basic research in the area of Nuclear Energy in Iran
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
Research and technology, 1991. Langley Research Center
1992-01-01
The mission of the NASA Langley Research Center is to increase the knowledge and capability of the United States in a full range of aeronautics disciplines and in selected space disciplines. This mission will be accomplished by performing innovative research relevant to national needs and Agency goals, transferring technology to users in a timely manner, and providing development support to other United States Government agencies, industry, and other NASA centers. Highlights are given of the major accomplishments and applications that have been made during the past year. The highlights illustrate both the broad range of the research and technology (R&T) activities at NASA Langley Research Center and the contributions of this work toward maintaining United States leadership in aeronautics and space research.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland
DEFF Research Database (Denmark)
Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.
2013-01-01
For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
A Computational Architecture for Programmable Automation Research
Taylor, Russell H.; Korein, James U.; Maier, Georg E.; Durfee, Lawrence F.
1987-03-01
This short paper describes recent work at the IBM T. J. Watson Research Center directed at developing a highly flexible computational architecture for research on sensor-based programmable automation. The system described here has been designed with a focus on dynamic configurability, layered user inter-faces and incorporation of sensor-based real time operations into new commands. It is these features which distinguish it from earlier work. The system is cur-rently being implemented at IBM for research purposes and internal use and is an outgrowth of programmable automation research which has been ongoing since 1972 [e.g., 1, 2, 3, 4, 5, 6] .
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Production and Distribution Research Center
1986-05-01
Steel, Coca Cola , Standard Oil of Ohio, and Martin Marietta have been involved in joint research with members of the Center. The number of Faculty...permitted the establishment of the Center and supports its continuing development. The Center has also received research sponsorship from the Joint...published relating to results developed within the PDRC under Offce of Naval Research sponsorship . These reports are listed in Appendix A. Many of these
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix
Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E
Czech Academy of Sciences Publication Activity Database
Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří
2003-01-01
Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003
Impact parameter representation from the Watson-Sommerfeld transform
International Nuclear Information System (INIS)
Islam, M.M.
1976-01-01
Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)
Center for Prostate Disease Research
Federal Laboratory Consortium — The Center for Prostate Disease Research is the only free-standing prostate cancer research center in the U.S. This 20,000 square foot state-of-the-art basic science...
Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration
Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell
2018-01-01
Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.
Nuclear energy research in Germany 2008. Research centers and universities
International Nuclear Information System (INIS)
Tromm, Walter
2009-01-01
This summary report presents nuclear energy research at research centers and universities in Germany in 2008. Activities are explained on the basis of examples of research projects and a description of the situation of research and teaching in general. Participants are the - Karlsruhe Research Center, - Juelich Research Center (FZJ), - Dresden-Rossendorf Research Center (FZD), - Verein fuer Kernverfahrenstechnik und Analytik Rossendorf e.V. (VKTA), - Technical University of Dresden, - University of Applied Sciences, Zittau/Goerlitz, - Institute for Nuclear Energy and Energy Systems (IKE) at the University of Stuttgart, - Reactor Simulation and Reactor Safety Working Group at the Bochum Ruhr University. (orig.)
Some Econometric Results for the Blanchard-Watson Bubble Model
DEFF Research Database (Denmark)
Johansen, Soren; Lange, Theis
The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
1993-01-27
Fetterman , University of California, Los Angeles M. Fischetti, IBM T. J. Watson Research Center D. Grischkowski, IBM T. J. Watson Research Center E. P. Ippen...Spectroscopy System ............................. 112 Jeffrey S. Bostak, Daniel W. Van Der Weide, Ikuro Aoki, Bertram A. Aul" and David M. Bloom Sub-Picosecond...Martin, F. K. Oshita, and H. R. Fetterman ix On-Wafer Optoelectronic Techniques for Millimeter-Wave Generation, Control, and Circuit Characterization
Bringing Precision Medicine to Community Oncologists.
2017-01-01
Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Thaís Schossler
2008-01-01
Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.
Rao, B J; Radding, C M
1994-01-01
Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.
2006-01-01
Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues? In...
When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.
Malone, John C; García-Penagos, Andrés
2014-07-25
Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
On the extension of the Fermi-Watson Theorem to high energy diffraction
International Nuclear Information System (INIS)
Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati
1995-12-01
The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition
"Elementary, my dear Watson". Per una falsa citazione
Directory of Open Access Journals (Sweden)
Irene Minella
2014-12-01
Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto
2016-01-01
In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...
Engineer Research and Development Center's Materials Testing Center (MTC)
Federal Laboratory Consortium — The Engineer Research and Development Center's Materials Testing Center (MTC) is committed to quality testing and inspection services that are delivered on time and...
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-04-24
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that
Activity report of Computing Research Center
Energy Technology Data Exchange (ETDEWEB)
1997-07-01
On April 1997, National Laboratory for High Energy Physics (KEK), Institute of Nuclear Study, University of Tokyo (INS), and Meson Science Laboratory, Faculty of Science, University of Tokyo began to work newly as High Energy Accelerator Research Organization after reconstructing and converting their systems, under aiming at further development of a wide field of accelerator science using a high energy accelerator. In this Research Organization, Applied Research Laboratory is composed of four Centers to execute assistance of research actions common to one of the Research Organization and their relating research and development (R and D) by integrating the present four centers and their relating sections in Tanashi. What is expected for the assistance of research actions is not only its general assistance but also its preparation and R and D of a system required for promotion and future plan of the research. Computer technology is essential to development of the research and can communize for various researches in the Research Organization. On response to such expectation, new Computing Research Center is required for promoting its duty by coworking and cooperating with every researchers at a range from R and D on data analysis of various experiments to computation physics acting under driving powerful computer capacity such as supercomputer and so forth. Here were described on report of works and present state of Data Processing Center of KEK at the first chapter and of the computer room of INS at the second chapter and on future problems for the Computing Research Center. (G.K.)
2011-01-01
On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano. var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');
Directory of Open Access Journals (Sweden)
Luciane Favero
2009-01-01
producciones referidas al tema de estudio, que ella puede ser aplicada en los niveles de atención primaria, secundaria y terciaria y que el 64,7% de las producciones utilizan los factores de cuidado propuestos por Jean Watson en 1979. Surge la necesidad de perfeccionamiento de las investigaciones respecto a la transformación ocurrida en la Teoría del Cuidado Transpersonal, con abordaje del Proceso Clinical Caritas, no obstante como son escasos los estudios referentes a esta temática, dificultan su utilización práctica.This systematic review aimed to describe and analyze the use of Jean Watson's Theory of Human Caring in Brazilian studies in the last ten years. A literature search using MEDLINE (MEDLARS - Medical Literature Analysis and Retrieval System, LILACS (Latin American and Caribbean Health Science Literature BDENF (Nursing Database, and SciELO (Scientific Electronic Library Online databases was conducted. A sample of 34 publications met the systematic review inclusion criteria. The results showed that 61.8% of the studies were conducted in the south of Brazil, and these studies suggested that the Theory of Human Caring could be used in the three levels of care: primary, secondary, and tertiary. The majority of publications (64.7% used the carative factors proposed by Jean Watson in 1979. There is a need for research approaches in respect to changes occurred in the Theory of Human Caring that evolved into the clinical caritas processes. Few studies have tested these new processes. This fact makes difficulty to use them in clinical practice.
NASA's engineering research centers and interdisciplinary education
Johnston, Gordon I.
1990-01-01
A new program of interactive education between NASA and the academic community aims to improve research and education, provide long-term, stable funding, and support cross-disciplinary and multi-disciplinary research. The mission of NASA's Office of Aeronautics, Exploration and Technology (OAET) is discussed and it is pointed out that the OAET conducts about 10 percent of its total R&D program at U.S. universities. Other NASA university-based programs are listed including the Office of Commercial Programs Centers for the Commercial Development of Space (CCDS) and the National Space Grant program. The importance of university space engineering centers and the selection of the nine current centers are discussed. A detailed composite description is provided of the University Space Engineering Research Centers. Other specialized centers are described such as the Center for Space Construction, the Mars Mission Research Center, and the Center for Intelligent Robotic Systems for Space Exploration. Approaches to educational outreach are discussed.
Center for Computing Research Summer Research Proceedings 2015.
Energy Technology Data Exchange (ETDEWEB)
Bradley, Andrew Michael [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Parks, Michael L. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2015-12-18
The Center for Computing Research (CCR) at Sandia National Laboratories organizes a summer student program each summer, in coordination with the Computer Science Research Institute (CSRI) and Cyber Engineering Research Institute (CERI).
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
DEFF Research Database (Denmark)
Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent
2014-01-01
–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
AVE bond index in the H-bond of the Watson-Crick pairs
International Nuclear Information System (INIS)
Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.
1981-01-01
The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt
Center for Information Systems Research Research Briefings 2002
ROSS, JEANNE W.
2003-01-01
This paper is comprised of research briefings from the MIT Sloan School of Management's Center for Information Systems Research (CISR). CISR's mission is to perform practical empirical research on how firms generate business value from IT.
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Center for Rehabilitation Sciences Research
Federal Laboratory Consortium — The Center for Rehabilitation Sciences Research (CRSR) was established as a research organization to promote successful return to duty and community reintegration of...
Water Resources Research Center
Untitled Document à Search Welcome to the University of Hawai'i at Manoa Water Resources Research Center At WRRC we concentrate on addressing the unique water and wastewater management problems and issues elsewhere by researching water-related issues distinctive to these areas. We are Hawaii's link in a network
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
National Rehabilitation Hospital Assistive Technology Research Center
1995-10-01
Shoulder-Arm Orthoses Several years ago, the Rehabilitation Engineering Research Center (RERC) on Rehabilitation Robotics in Delaware1 identified a... exoskeletal applications for persons with disabilities. 2. Create a center of expertise in rehabilitation technology transfer that benefits persons with...AD COOPERATIVE AGREEMENT NUMBER: DAMD17-94-V-4036 TITLE: National Rehabilitation Hospital Assistive Technology- Research Center PRINCIPAL
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
NASA Langley Research Center outreach in astronautical education
Duberg, J. E.
1976-01-01
The Langley Research Center has traditionally maintained an active relationship with the academic community, especially at the graduate level, to promote the Center's research program and to make graduate education available to its staff. Two new institutes at the Center - the Joint Institute for Acoustics and Flight Sciences, and the Institute for Computer Applications - are discussed. Both provide for research activity at the Center by university faculties. The American Society of Engineering Education Summer Faculty Fellowship Program and the NASA-NRC Postdoctoral Resident Research Associateship Program are also discussed.
Directory of Open Access Journals (Sweden)
Mei-Yu LEE
2014-11-01
Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson
The McLean-Watson line strength formula and its implementation
International Nuclear Information System (INIS)
Hey, J D
2009-01-01
We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the
University of Kentucky Center for Applied Energy Research
University of Kentucky Center for Applied Energy Research Search Help Research Our Expertise University of Kentucky Center for Applied Energy Research | An Equal Opportunity University All Rights Remediation Power Generation CAER TechFacts CAER Factsheets CAER Affiliations Research Contacts Publications
70 Years of Aeropropulsion Research at NASA Glenn Research Center
Reddy, Dhanireddy R.
2013-01-01
This paper presents a brief overview of air-breathing propulsion research conducted at the NASA Glenn Research Center (GRC) over the past 70 years. It includes a historical perspective of the center and its various stages of propulsion research in response to the countrys different periods of crises and growth opportunities. GRCs research and technology development covered a broad spectrum, from a short-term focus on improving the energy efficiency of aircraft engines to advancing the frontier technologies of high-speed aviation in the supersonic and hypersonic speed regimes. This paper highlights major research programs, showing their impact on industry and aircraft propulsion, and briefly discusses current research programs and future aeropropulsion technology trends in related areas
Colorado Learning Disabilities Research Center.
DeFries, J. C.; And Others
1997-01-01
Results obtained from the center's six research projects are reviewed, including research on psychometric assessment of twins with reading disabilities, reading and language processes, attention deficit-hyperactivity disorder and executive functions, linkage analysis and physical mapping, computer-based remediation of reading disabilities, and…
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
2013-06-14
The Assistant Secretary for Special Education and Rehabilitative Services announces a priority for a Rehabilitation Engineering Research Center (RERC) on Universal Interfaces and Information Technology Access under the Disability and Rehabilitation Research Projects and Centers Program administered by the National Institute on Disability and Rehabilitation Research (NIDRR). The Assistant Secretary may use this priority for a competition in fiscal year (FY) 2013 and later years. We take this action to focus research attention on areas of national need. We intend to use this priority to improve outcomes for individuals with disabilities.
Unique life sciences research facilities at NASA Ames Research Center
Mulenburg, G. M.; Vasques, M.; Caldwell, W. F.; Tucker, J.
1994-01-01
The Life Science Division at NASA's Ames Research Center has a suite of specialized facilities that enable scientists to study the effects of gravity on living systems. This paper describes some of these facilities and their use in research. Seven centrifuges, each with its own unique abilities, allow testing of a variety of parameters on test subjects ranging from single cells through hardware to humans. The Vestibular Research Facility allows the study of both centrifugation and linear acceleration on animals and humans. The Biocomputation Center uses computers for 3D reconstruction of physiological systems, and interactive research tools for virtual reality modeling. Psycophysiological, cardiovascular, exercise physiology, and biomechanical studies are conducted in the 12 bed Human Research Facility and samples are analyzed in the certified Central Clinical Laboratory and other laboratories at Ames. Human bedrest, water immersion and lower body negative pressure equipment are also available to study physiological changes associated with weightlessness. These and other weightlessness models are used in specialized laboratories for the study of basic physiological mechanisms, metabolism and cell biology. Visual-motor performance, perception, and adaptation are studied using ground-based models as well as short term weightlessness experiments (parabolic flights). The unique combination of Life Science research facilities, laboratories, and equipment at Ames Research Center are described in detail in relation to their research contributions.
The prevention research centers' managing epilepsy well network.
DiIorio, Colleen K; Bamps, Yvan A; Edwards, Ariele L; Escoffery, Cam; Thompson, Nancy J; Begley, Charles E; Shegog, Ross; Clark, Noreen M; Selwa, Linda; Stoll, Shelley C; Fraser, Robert T; Ciechanowski, Paul; Johnson, Erica K; Kobau, Rosemarie; Price, Patricia H
2010-11-01
The Managing Epilepsy Well (MEW) Network was created in 2007 by the Centers for Disease Control and Prevention's (CDC) Prevention Research Centers and Epilepsy Program to promote epilepsy self-management research and to improve the quality of life for people with epilepsy. MEW Network membership comprises four collaborating centers (Emory University, University of Texas Health Science Center at Houston, University of Michigan, and University of Washington), representatives from CDC, affiliate members, and community stakeholders. This article describes the MEW Network's background, mission statement, research agenda, and structure. Exploratory and intervention studies conducted by individual collaborating centers are described, as are Network collaborative projects, including a multisite depression prevention intervention and the development of a standard measure of epilepsy self-management. Communication strategies and examples of research translation programs are discussed. The conclusion outlines the Network's role in the future development and dissemination of evidence-based epilepsy self-management programs. Copyright © 2010 Elsevier Inc. All rights reserved.
Multi-Institution Research Centers: Planning and Management Challenges
Spooner, Catherine; Lavey, Lisa; Mukuka, Chilandu; Eames-Brown, Rosslyn
2016-01-01
Funding multi-institution centers of research excellence (CREs) has become a common means of supporting collaborative partnerships to address specific research topics. However, there is little guidance for those planning or managing a multi-institution CRE, which faces specific challenges not faced by single-institution research centers. We…
Transportation Research & Analysis Computing Center
Federal Laboratory Consortium — The technical objectives of the TRACC project included the establishment of a high performance computing center for use by USDOT research teams, including those from...
Louisiana Transportation Research Center : Annual report, 2016-2017
2017-10-11
This publication is a report of the transportation research, technology transfer, education, and training activities of the Louisiana Transportation Research Center for July 1, 2016 - June 30, 2017. The center is sponsored jointly by the Louisiana De...
CCR Interns | Center for Cancer Research
The Cancer Research Interns (CRI) Summer Program was inaugurated in 2004 to provide an open door for students looking for an initial training opportunity. The goal is to enhance diversity within the CCR (Center for Cancer Research) training program and we have placed 338 students from 2004 to 2017, in labs and branches across the division. The CCR and the Center for Cancer Training’s Office of Training and Education provide stipend support, some Service & Supply funds, and travel support for those students who meet the financial eligibility criteria (
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Illinois Accelerator Research Center
Kroc, Thomas K.; Cooper, Charlie A.
The Illinois Accelerator Research Center (IARC) hosts a new accelerator development program at Fermi National Accelerator Laboratory. IARC provides access to Fermi's state-of-the-art facilities and technologies for research, development and industrialization of particle accelerator technology. In addition to facilitating access to available existing Fermi infrastructure, the IARC Campus has a dedicated 36,000 ft2 Heavy Assembly Building (HAB) with all the infrastructure needed to develop, commission and operate new accelerators. Connected to the HAB is a 47,000 ft2 Office, Technology and Engineering (OTE) building, paid for by the state, that has office, meeting, and light technical space. The OTE building, which contains the Accelerator Physics Center, and nearby Accelerator and Technical divisions provide IARC collaborators with unique access to world class expertise in a wide array of accelerator technologies. At IARC scientists and engineers from Fermilab and academia work side by side with industrial partners to develop breakthroughs in accelerator science and translate them into applications for the nation's health, wealth and security.
Research Centers: Ecstasies & Agonies [in HRD].
1995
These four papers are from a symposium facilitated by Gene Roth on research centers at the 1995 Academy of Human Resource Development (HRD) conference. "Research: The Thin Blue Line between Rigor and Reality" (Michael Leimbach) discusses the need for HRD research to increase its speed and rigor and help organizations focus on capability…
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
Information on the Karlsruhe Nuclear Research Center
International Nuclear Information System (INIS)
Reuter, H.H.
1980-01-01
A short overview is given about the origins of Karlsruhe Nuclear Research Center. The historical development of the different companies operating the Center is shown. Because the original task assigned to the Center was the construction and testing of the first German reactor exclusively built by German companies, a detailed description of this reactor and the changes made afterwards is presented. Next, today's organizational structure of the Center is outlined and the development of the Center's financing since its foundation is shown. A short overview about the structure of employees from the Center's beginning up to now is also included as well as a short description of today's main activities. (orig.)
Investigation of Nanophase Materials for Thermoelectric Applications
National Research Council Canada - National Science Library
Stokes, Kevin
2004-01-01
.... Watson Research Center. Our major accomplishments include the chemical synthesis of nanoparticles, nanorods and nanowires of lead chalcogenide, bismuth calcogenide and bismuth antimony materials...
2013-06-11
The Assistant Secretary for Special Education and Rehabilitative Services announces priorities under the Disability and Rehabilitation Research Projects and Centers Program administered by the National Institute on Disability and Rehabilitation Research (NIDRR). Specifically, we announce priorities for a Rehabilitation Engineering Research Center (RERC) on Rehabilitation Strategies, Techniques, and Interventions (Priority 1), Information and Communication Technologies Access (Priority 2), Individual Mobility and Manipulation (Priority 3), and Physical Access and Transportation (Priority 4). The Assistant Secretary may use one or more of these priorities for competitions in fiscal year (FY) 2013 and later years. We take this action to focus research attention on areas of national need. We intend these priorities to improve community living and participation, health and function, and employment outcomes of individuals with disabilities.
DOE - BES Nanoscale Science Research Centers (NSRCs)
Energy Technology Data Exchange (ETDEWEB)
Beecher, Cathy Jo [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2016-11-14
These are slides from a powerpoint shown to guests during tours of Center for Integrated Nanotechnologies (CINT) at Los Alamos National Laboratory. It shows the five DOE-BES nanoscale science research centers (NSRCs), which are located at different national laboratories throughout the country. Then it goes into detail specifically about the Center for Integrated Nanotechnologies at LANL, including statistics on its user community and CINT's New Mexico industrial users.
Pursuing Personal Passion: Learner-Centered Research Mentoring.
Phillips, William R
2018-01-01
New researchers often face difficulty finding and focusing research questions. I describe a new tool for research mentoring, the Pursuing Personal Passion (P3) interview, and a systematic approach to help learners organize their curiosity and develop researchable questions aligned with their personal and professional priorities. The learner-centered P3 research interview parallels the patient-centered clinical interview. This paper reviews experience with 27 research mentees over the years 2009 to 2016, using the P3 approach to identify their initial research topics, classify their underlying passions and track the evolution into their final research questions. These researchers usually identified one of three personal passions that provided lenses to focus their research: problem, person, or process. Initial research topics focused on: problem (24%, 6), person (48%, 12) and process (28%, 7). Final research questions evolved into: problem (20%, 5), person (32%, 8) and process (48%, 12). Identification of the underlying passion can lead researchers who start with one general topic to develop it into very different research questions. Using this P3 approach, mentors can help new researchers focus their interests into researchable questions, successful studies, and organized programs of scholarship.
Directory of Open Access Journals (Sweden)
Siddharth Jain
Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.
Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia
Directory of Open Access Journals (Sweden)
Roberta Maria Savieto
2016-03-01
Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.
International Nuclear Information System (INIS)
Burns, Peter
2011-01-01
'Energy Frontier Research Center Materials Science of Actinides' was submitted by the EFRC for Materials Science of Actinides (MSA) to the 'Life at the Frontiers of Energy Research' video contest at the 2011 Science for Our Nation's Energy Future: Energy Frontier Research Centers (EFRCs) Summit and Forum. Twenty-six EFRCs created short videos to highlight their mission and their work. MSA is directed by Peter Burns at the University of Notre Dame, and is a partnership of scientists from ten institutions.The Office of Basic Energy Sciences in the U.S. Department of Energy's Office of Science established the 46 Energy Frontier Research Centers (EFRCs) in 2009. These collaboratively-organized centers conduct fundamental research focused on 'grand challenges' and use-inspired 'basic research needs' recently identified in major strategic planning efforts by the scientific community. The overall purpose is to accelerate scientific progress toward meeting the nation's critical energy challenges.
Accelerator Center for Energy Research (ACER)
Federal Laboratory Consortium — The Accelerator Center for Energy Research (ACER) exploits radiation chemistry techniques to study chemical reactions (and other phenomena) by subjecting samples to...
Senior Computational Scientist | Center for Cancer Research
The Basic Science Program (BSP) pursues independent, multidisciplinary research in basic and applied molecular biology, immunology, retrovirology, cancer biology, and human genetics. Research efforts and support are an integral part of the Center for Cancer Research (CCR) at the Frederick National Laboratory for Cancer Research (FNLCR). The Cancer & Inflammation Program (CIP),
Karlsruhe nuclear research center. Main activities
International Nuclear Information System (INIS)
The article reports on problems of securing the fuel supply for nuclear power generation, on reprocessing and ultimate storage of radioactive material, on the safety of nuclear facilities, on new technologies and basic research, and on the infrastructure of the Karlsruhe nuclear research center, as well as finance and administration. (HK) [de
The Role of Computers in Research and Development at Langley Research Center
Wieseman, Carol D. (Compiler)
1994-01-01
This document is a compilation of presentations given at a workshop on the role cf computers in research and development at the Langley Research Center. The objectives of the workshop were to inform the Langley Research Center community of the current software systems and software practices in use at Langley. The workshop was organized in 10 sessions: Software Engineering; Software Engineering Standards, methods, and CASE tools; Solutions of Equations; Automatic Differentiation; Mosaic and the World Wide Web; Graphics and Image Processing; System Design Integration; CAE Tools; Languages; and Advanced Topics.
1992-04-30
defects in crystalline silicon B.G. Svensson and M.O. Aboelfotoh PL .0 Interaction of a copper-induced defect with shallow acceptors and deep centers in...Electronics P.O. Box 1298, S-164 28 Kista-Stockholm, Sweden M.O. Aboelfotoh IBM Research Division, TJ. Watson Research Center P.O. Box 218, Yorktown Heights
Johns Hopkins Particulate Matter Research Center
Federal Laboratory Consortium — The Johns Hopkins Particulate Matter Research Center will map health risks of PM across the US based on analyses of national databases on air pollution, mortality,...
Center for Drug Evaluation and Research
Federal Laboratory Consortium — The Center for Drug Evaluation and Research(CDER) performs an essential public health task by making sure that safe and effective drugs are available to improve the...
Lai, Steven H.-Y.
1992-01-01
This report documents the efforts and outcomes of our research and educational programs at NASA-CORE in NCA&TSU. The goal of the center was to establish a quality aerospace research base and to develop an educational program to increase the participation of minority faculty and students in the areas of aerospace engineering. The major accomplishments of this center in the first year are summarized in terms of three different areas, namely, the center's research programs area, the center's educational programs area, and the center's management area. In the center's research programs area, we focus on developing capabilities needed to support the development of the aerospace plane and high speed civil transportation system technologies. In the educational programs area, we developed an aerospace engineering option program ready for university approval.
Bolivia. The new nuclear research center in El Alto
International Nuclear Information System (INIS)
Nogarin, Mauro
2016-01-01
Research reactors in Latin America have become a priority in public policy in the last decade. Bolivia wants to become the 8th country to implement peaceful nuclear technology in this area with the new Center for Research and Development in the Nuclear Technology. The Center will be the most advanced in Latin America. It will provide for a wide use of radiation technologies in agriculture, medicine, and industry. After several negotiations Bolivia and the Russian Federation signed the Intergovernmental Agreement on cooperation in the peaceful use of atomic energy and the construction of the Nuclear Research and Technology Center.
Bolivia. The new nuclear research center in El Alto
Energy Technology Data Exchange (ETDEWEB)
Nogarin, Mauro
2016-05-15
Research reactors in Latin America have become a priority in public policy in the last decade. Bolivia wants to become the 8th country to implement peaceful nuclear technology in this area with the new Center for Research and Development in the Nuclear Technology. The Center will be the most advanced in Latin America. It will provide for a wide use of radiation technologies in agriculture, medicine, and industry. After several negotiations Bolivia and the Russian Federation signed the Intergovernmental Agreement on cooperation in the peaceful use of atomic energy and the construction of the Nuclear Research and Technology Center.
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
CCR Magazines | Center for Cancer Research
The Center for Cancer Research (CCR) has two magazines, MILESTONES and LANDMARKS, that highlight our annual advances and top contributions to the understanding, detection, treatment and prevention of cancer over the years.
THE CENTER FOR MILITARY BIOMECHANICS RESEARCH
Federal Laboratory Consortium — The Center for Military Biomechanics Research is a 7,500 ft2 dedicated laboratory outfitted with state-of-the-art equipment for 3-D analysis of movement, measurement...
Lewis Research Center R and D Facilities
1991-01-01
The NASA Lewis Research Center (LeRC) defines and develops advanced technology for high priority national needs. The work of the Center is directed toward new propulsion, power, and communications technologies for application to aeronautics and space, so that U.S. leadership in these areas is ensured. The end product is knowledge, usually in a report, that is made fully available to potential users--the aircraft engine industry, the energy industry, the automotive industry, the space industry, and other NASA centers. In addition to offices and laboratories for almost every kind of physical research in such fields as fluid mechanics, physics, materials, fuels, combustion, thermodynamics, lubrication, heat transfer, and electronics, LeRC has a variety of engineering test cells for experiments with components such as compressors, pumps, conductors, turbines, nozzles, and controls. A number of large facilities can simulate the operating environment for a complete system: altitude chambers for aircraft engines; large supersonic wind tunnels for advanced airframes and propulsion systems; space simulation chambers for electric rockets or spacecraft; and a 420-foot-deep zero-gravity facility for microgravity experiments. Some problems are amenable to detection and solution only in the complete system and at essentially full scale. By combining basic research in pertinent disciplines and generic technologies with applied research on components and complete systems, LeRC has become one of the most productive centers in its field in the world. This brochure describes a number of the facilities that provide LeRC with its exceptional capabilities.
76 FR 37085 - Applications for New Awards; Rehabilitation Engineering Research Centers (RERCs)
2011-06-24
... DEPARTMENT OF EDUCATION Applications for New Awards; Rehabilitation Engineering Research Centers...)--Disability and Rehabilitation Research Projects and Centers Program--Rehabilitation Engineering Research... (Rehabilitation Act). Rehabilitation Engineering Research Centers Program (RERCs) The purpose of the RERC program...
Research Associate | Center for Cancer Research
PROGRAM DESCRIPTION The Basic Science Program (BSP) pursues independent, multidisciplinary research in basic and applied molecular biology, immunology, retrovirology, cancer biology, and human genetics. Research efforts and support are an integral part of the Center for Cancer Research (CCR) at the Frederick National Laboratory for Cancer Research (FNLCR). KEY ROLES/RESPONSIBILITIES - Research Associate III Dr. Zbigniew Dauter is the head investigator of the Synchrotron Radiation Research Section (SRRS) of CCR’s Macromolecular Crystallography Laboratory. The Synchrotron Radiation Research Section is located at Argonne National Laboratory, Argonne, Illinois; this is the site of the largest U.S. synchrotron facility. The SRRS uses X-ray diffraction technique to solve crystal structures of various proteins and nucleic acids of biological and medical relevance. The section is also specializing in analyzing crystal structures at extremely high resolution and accuracy and in developing methods of effective diffraction data collection and in using weak anomalous dispersion effects to solve structures of macromolecules. The areas of expertise are: Structural and molecular biology Macromolecular crystallography Diffraction data collection Dr. Dauter requires research support in these areas, and the individual will engage in the purification and preparation of samples, crystallize proteins using various techniques, and derivatize them with heavy atoms/anomalous scatterers, and establish conditions for cryogenic freezing. Individual will also participate in diffraction data collection at the Advanced Photon Source. In addition, the candidate will perform spectroscopic and chromatographic analyses of protein and nucleic acid samples in the context of their purity, oligomeric state and photophysical properties.
Interdisciplinary research center devoted to molecular environmental science opens
Vaughan, David J.
In October, a new research center opened at the University of Manchester in the United Kingdom. The center is the product of over a decade of ground-breaking interdisciplinary research in the Earth and related biological and chemical sciences at the university The center also responds to the British governments policy of investing in research infrastructure at key universities.The Williamson Research Centre, the first of its kind in Britain and among the first worldwide, is devoted to the emerging field of molecular environmental science. This field also aims to bring about a revolution in understanding of our environment. Though it may be a less violent revolution than some, perhaps, its potential is high for developments that could affect us all.
Karlsruhe Nuclear Research Center. Progress report on research and development work in 1987
International Nuclear Information System (INIS)
1988-01-01
This summary of R and D work is the scientific annual report to be prepared by the research center in compliance with its statutes. The material is arranged by items of main activities, as given in the overall R and D programme set up for the research center. The various reports prepared by the individual institutes and principal departments are presented under their relevant subject headings. The annual report is intended to demonstrate the progress achieved in the tasks and activities assigned by the R and D programme of the research center, by referring to the purposes and goals stated in the programme, showing the joint or separate efforts and achievements of the institutes. Details and results of activities are found in the scientific-technical publications given in the bibliographical survey, and in the internal primary surveys. The main activities of the research center include the following: Fast Breeder Project (PSB), Nuclear Fusion Project (PKF), Separation Nozzle Project (TDV), and Reprocessing and Waste Treatment Project (PWA), Ultimate Disposal of Radioactive Waste (ELA), Environment and Safety (U and S), Solids and Materials (FM), Nuclear and Particle Physics (KTP), Microtechniques (MT), Materials Handling (HT), Other Research Activities (SF). Organisational aspects and institutes and the list of publications conclude the report. (orig./HK) [de
Statistical Analysis of Research Data | Center for Cancer Research
Recent advances in cancer biology have resulted in the need for increased statistical analysis of research data. The Statistical Analysis of Research Data (SARD) course will be held on April 5-6, 2018 from 9 a.m.-5 p.m. at the National Institutes of Health's Natcher Conference Center, Balcony C on the Bethesda Campus. SARD is designed to provide an overview on the general principles of statistical analysis of research data. The first day will feature univariate data analysis, including descriptive statistics, probability distributions, one- and two-sample inferential statistics.
2013-06-19
The Assistant Secretary for Special Education and Rehabilitative Services announces a priority for a Rehabilitation Engineering Research Center (RERC) on Technologies to Support Successful Aging with Disability under the Disability and Rehabilitation Research Projects and Centers Program administered by the National Institute on Disability and Rehabilitation Research (NIDRR). The Assistant Secretary may use this priority for a competition in fiscal year (FY) 2013 and later years. We take this action to focus research attention on areas of national need. We intend to use this priority to improve outcomes for individuals with disabilities.
National Center on Sleep Disorders Research
... Resources Register for Updates The National Center on Sleep Disorders Research (NCSDR) Located within the National Heart, Lung, ... 60 percent have a chronic disorder. Each year, sleep disorders, sleep deprivation, and sleepiness add an estimated $15. ...
Energy Frontier Research Centers: Impact Report, January 2017
Energy Technology Data Exchange (ETDEWEB)
None, None
2017-01-31
Since its inception in 2009, the U. S. Department of Energy’s Energy Frontier Research Center (EFRC) program has become an important research modality in the Department’s portfolio, enabling high impact research that addresses key scientific challenges for energy technologies. Funded by the Office of Science’s Basic Energy Sciences program, the EFRCs are located across the United States and are led by universities, national laboratories, and private research institutions. These multi-investigator, multidisciplinary centers bring together world-class teams of researchers, often from multiple institutions, to tackle the toughest scientific challenges preventing advances in energy technologies. The EFRCs’ fundamental scientific advances are having a significant impact that is being translated to industry. In 2009 five-year awards were made to 46 EFRCs, including 16 that were fully funded by the American Recovery and Reinvestment Act (ARRA). An open recompetition of the program in 2014 resulted in fouryear awards to 32 centers, 22 of which are renewals of existing EFRCs and 10 of which are new EFRCs. In 2016, DOE added four new centers to accelerate the scientific breakthroughs needed to support the Department’s environmental management and nuclear cleanup mission, bringing the total number of active EFRCs to 36. The impact reports in this document describe some of the many scientific accomplishments and greater impacts of the class of 2009 – 2018 EFRCs and early outcomes from a few of the class of 2014 – 2018 EFRCs.
48 CFR 235.017 - Federally Funded Research and Development Centers.
2010-10-01
... DEVELOPMENT CONTRACTING 235.017 Federally Funded Research and Development Centers. (a) Policy. (2) No DoD... Funded Research and Development Center (FFRDC) if a member of its board of directors or trustees... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Federally Funded Research...
Introduction | Center for Cancer Research
Introduction In order to meet increasing demands from both NIH intramural and extramural communities for access to a small angle X-ray scattering (SAXS) resource, the Center for Cancer Research (CCR) under the leadership of Jeffrey Strathern and Bob Wiltrout established a partnership user program (PUP) with the Argonne National Laboratory Photon Source in October 2008.
Interaction Modeling at PROS Research Center
Panach , José ,; Aquino , Nathalie; PASTOR , Oscar
2011-01-01
Part 1: Long and Short Papers; International audience; This paper describes how the PROS Research Center deals with interaction in the context of a model-driven approach for the development of information systems. Interaction is specified in a conceptual model together with the structure and behavior of the system. Major achievements and current research challenges of PROS in the field of interaction modeling are presented.
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.
2003-01-01
Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003
International Nuclear Information System (INIS)
Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.
2010-01-01
By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .
The role of architectural research centers in addressing climate change
Directory of Open Access Journals (Sweden)
John Carmody
2012-10-01
Full Text Available ABSTRACT: It is clear that an urgent, major transformation needs to happen in the design of the built environment to respond to impending climate change and other environmental degradation. This paper will explain the potential role of architectural research centers in this transformation and provide examples from the Center for Sustainable Building Research (CSBR at the University of Minnesota. A research center can become a regional hub to coordinate and disseminate critical information. CSBR is leading the establishment of Architecture 2030 standards in Minnesota, assisting local governments in writing green building policy, providing design assistance to local government, developing tools to assist design decision making, providing technical assistance to the affordable housing community inMinnesota, and establishing a regional case study database that includes actual performance information. CSBR is creating a publicly accessible, credible knowledge base on new approaches, technologies and actual performance outcomes. Research centers such as CSBR can be a critical component of the necessary feedback loop often lacking in the building industry. A research center can also fill major gaps in providing in depth professional education as well as be a catalyst for demonstration projects and public education.
Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model
Energy Technology Data Exchange (ETDEWEB)
Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)
2016-03-15
Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.
48 CFR 970.3501 - Federally funded research and development centers.
2010-10-01
... Development Contracting 970.3501 Federally funded research and development centers. ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Federally funded research and development centers. 970.3501 Section 970.3501 Federal Acquisition Regulations System DEPARTMENT...
Energy Technology Data Exchange (ETDEWEB)
Morehouse, K. [Environmental Protection Agency, Washington, DC (United States)
1995-12-01
During the 15 years that the U.S. Environmental Protection Agency (EPA) has supported university-based research centers, there have been many changes in mission, operating style, funding level, eligibility, and selection process. Even the definition of the term {open_quotes}research center{close_quotes} is open to debate. Shifting national priorities, political realities, and funding uncertainties have powered the evolution of research centers in EPA, although the agency`s basic philosophy on the purpose and value of this approach to research remains essentially unchanged. Today, EPA manages 28 centers, through the Office of Exploratory Research. These centers are administered under three distinct programs. Each program has its own mission and goals which guide the way individual centers are selected and operated. This paper will describe: (1) EPA`s philosophy of reserach centers, (2) the complicated history of EPA research centers, (3) coordination and interaction among EPA centers and others, (4) opportunities for collaboration, and (5) plans for the future.
International Nuclear Information System (INIS)
Koerting, K.
1988-01-01
At the Karlsruhe Nuclear Research Center, the Public Relations Department directly reports to the Chief Executive Officer. The head of the Public Relation Department acts as spokesman of the center in the public, which requires him to be fully informed of the work of all units and of the policy goals of the executive board. The key tools used by the Public Relations Department are KfK-Hausmitteilungen, accident information, the scientific journal KfK-Nachrichten, press releases, exhibitions, fairs, guided tours, and nuclear energy information staff. (DG)
Data Curation Education in Research Centers (DCERC)
Marlino, M. R.; Mayernik, M. S.; Kelly, K.; Allard, S.; Tenopir, C.; Palmer, C.; Varvel, V. E., Jr.
2012-12-01
Digital data both enable and constrain scientific research. Scientists are enabled by digital data to develop new research methods, utilize new data sources, and investigate new topics, but they also face new data collection, management, and preservation burdens. The current data workforce consists primarily of scientists who receive little formal training in data management and data managers who are typically educated through on-the-job training. The Data Curation Education in Research Centers (DCERC) program is investigating a new model for educating data professionals to contribute to scientific research. DCERC is a collaboration between the University of Illinois at Urbana-Champaign Graduate School of Library and Information Science, the University of Tennessee School of Information Sciences, and the National Center for Atmospheric Research. The program is organized around a foundations course in data curation and provides field experiences in research and data centers for both master's and doctoral students. This presentation will outline the aims and the structure of the DCERC program and discuss results and lessons learned from the first set of summer internships in 2012. Four masters students participated and worked with both data mentors and science mentors, gaining first hand experiences in the issues, methods, and challenges of scientific data curation. They engaged in a diverse set of topics, including climate model metadata, observational data management workflows, and data cleaning, documentation, and ingest processes within a data archive. The students learned current data management practices and challenges while developing expertise and conducting research. They also made important contributions to NCAR data and science teams by evaluating data management workflows and processes, preparing data sets to be archived, and developing recommendations for particular data management activities. The master's student interns will return in summer of 2013
Managing a Modern University Research Center.
Veres, John G., III
1988-01-01
The university research center of the future will function best to serve the rapidly changing public and private demand for services with a highly trained core staff, adequately funded and equipped, whose morale and quality of work performance is a prime consideration. (MSE)
Genomics:GTL Bioenergy Research Centers White Paper
Energy Technology Data Exchange (ETDEWEB)
Mansfield, Betty Kay [ORNL; Alton, Anita Jean [ORNL; Andrews, Shirley H [ORNL; Bownas, Jennifer Lynn [ORNL; Casey, Denise [ORNL; Martin, Sheryl A [ORNL; Mills, Marissa [ORNL; Nylander, Kim [ORNL; Wyrick, Judy M [ORNL; Drell, Dr. Daniel [Office of Science, Department of Energy; Weatherwax, Sharlene [U.S. Department of Energy; Carruthers, Julie [U.S. Department of Energy
2006-08-01
In his Advanced Energy Initiative announced in January 2006, President George W. Bush committed the nation to new efforts to develop alternative sources of energy to replace imported oil and fossil fuels. Developing cost-effective and energy-efficient methods of producing renewable alternative fuels such as cellulosic ethanol from biomass and solar-derived biofuels will require transformational breakthroughs in science and technology. Incremental improvements in current bioenergy production methods will not suffice. The Genomics:GTL Bioenergy Research Centers will be dedicated to fundamental research on microbe and plant systems with the goal of developing knowledge that will advance biotechnology-based strategies for biofuels production. The aim is to spur substantial progress toward cost-effective production of biologically based renewable energy sources. This document describes the rationale for the establishment of the centers and their objectives in light of the U.S. Department of Energy's mission and goals. Developing energy-efficient and cost-effective methods of producing alternative fuels such as cellulosic ethanol from biomass will require transformational breakthroughs in science and technology. Incremental improvements in current bioenergy-production methods will not suffice. The focus on microbes (for cellular mechanisms) and plants (for source biomass) fundamentally exploits capabilities well known to exist in the microbial world. Thus 'proof of concept' is not required, but considerable basic research into these capabilities remains an urgent priority. Several developments have converged in recent years to suggest that systems biology research into microbes and plants promises solutions that will overcome critical roadblocks on the path to cost-effective, large-scale production of cellulosic ethanol and other renewable energy from biomass. The ability to rapidly sequence the DNA of any organism is a critical part of these new
Building Technologies Research and Integration Center (BTRIC)
Federal Laboratory Consortium — The Building Technologies Research and Integration Center (BTRIC), in the Energy and Transportation Science Division (ETSD) of Oak Ridge National Laboratory (ORNL),...
International Nuclear Information System (INIS)
Lee, S. W.; Ma, K. H.; Kim, J. R.; Lee, D. C.; Lee, J. H.
1999-06-01
The research activities of Korea Cancer Center Hospital have increased for the past a few years just in proportion to the increase of research budget, but the assisting manpower of the office of research management has never been increased and the indications are that the internal and external circumstances will not allow the recruitment for a fairly long time. It has, therefore, become inevitable to enhance the work efficiency of the office by analyzing the administrative research assistance system, finding out problems and inefficiency factors, and suggesting possible answers to them. The office of research management and international cooperation has conducted this research to suggest possible ways to facilitate the administrative support for the research activities of Korea Cancer Center Hospital By analyzing the change of research budget, organization of the division of research and administrative support, manpower, and the administrative research supporting system of other institutes, we suggested possible ways to enhance the work efficiency for administrative research support and developed a relative database program. The research report will serve as a data for the organization of research support division when the Radiation Medicine Research Center is established. The database program has already been used for research budget management
Recruiting community health centers into pragmatic research: Findings from STOP CRC.
Coronado, Gloria D; Retecki, Sally; Schneider, Jennifer; Taplin, Stephen H; Burdick, Tim; Green, Beverly B
2016-04-01
Challenges of recruiting participants into pragmatic trials, particularly at the level of the health system, remain largely unexplored. As part of Strategies and Opportunities to STOP Colon Cancer in Priority Populations (STOP CRC), we recruited eight separate community health centers (consisting of 26 individual safety net clinics) into a large comparative effectiveness pragmatic study to evaluate methods of raising the rates of colorectal cancer screening. In partnership with STOP CRC's advisory board, we defined criteria to identify eligible health centers and applied these criteria to a list of health centers in Washington, Oregon, and California affiliated with Oregon Community Health Information Network, a 16-state practice-based research network of federally sponsored health centers. Project staff contacted centers that met eligibility criteria and arranged in-person meetings of key study investigators with health center leadership teams. We used the Consolidated Framework for Implementation Research to thematically analyze the content of discussions during these meetings to identify major facilitators of and barriers to health center participation. From an initial list of 41 health centers, 11 met the initial inclusion criteria. Of these, leaders at three centers declined and at eight centers (26 clinic sites) agreed to participate (73%). Participating and nonparticipating health centers were similar with respect to clinic size, percent Hispanic patients, and percent uninsured patients. Participating health centers had higher proportions of Medicaid patients and higher baseline colorectal cancer screening rates. Common facilitators of participation were perception by center leadership that the project was an opportunity to increase colorectal cancer screening rates and to use electronic health record tools for population management. Barriers to participation were concerns of center leaders about ability to provide fecal testing to and assure follow-up of
A research plan based on high intensity proton accelerator Neutron Science Research Center
International Nuclear Information System (INIS)
Mizumoto, Motoharu
1997-01-01
A plan called Neutron Science Research Center (NSRC) has been proposed in JAERI. The center is a complex composed of research facilities based on a proton linac with an energy of 1.5GeV and an average current of 10mA. The research facilities will consist of Thermal/Cold Neutron Facility, Neutron Irradiation Facility, Neutron Physics Facility, OMEGA/Nuclear Energy Facility, Spallation RI Beam Facility, Meson/Muon Facility and Medium Energy Experiment Facility, where high intensity proton beam and secondary particle beams such as neutron, pion, muon and unstable radio isotope (RI) beams generated from the proton beam will be utilized for innovative researches in the fields on nuclear engineering and basic sciences. (author)
A research plan based on high intensity proton accelerator Neutron Science Research Center
Energy Technology Data Exchange (ETDEWEB)
Mizumoto, Motoharu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment
1997-03-01
A plan called Neutron Science Research Center (NSRC) has been proposed in JAERI. The center is a complex composed of research facilities based on a proton linac with an energy of 1.5GeV and an average current of 10mA. The research facilities will consist of Thermal/Cold Neutron Facility, Neutron Irradiation Facility, Neutron Physics Facility, OMEGA/Nuclear Energy Facility, Spallation RI Beam Facility, Meson/Muon Facility and Medium Energy Experiment Facility, where high intensity proton beam and secondary particle beams such as neutron, pion, muon and unstable radio isotope (RI) beams generated from the proton beam will be utilized for innovative researches in the fields on nuclear engineering and basic sciences. (author)
Biography: MADHU SUDAN Madhu Sudan got his Bachelors ...
Indian Academy of Sciences (India)
Admin
. UC Berkeley in 1992. From 1992-1997 he was a Research Staff Member at IBM's. Thomas J. Watson Research Center. In 1997 he joined the faculty at MIT, where among other roles he served as an Associate Director of MIT's CSAIL from.
A Program of Research and Education in Astronautics at the NASA Langley Research Center
Tolson, Robert H.
2000-01-01
The objectives of the Program were to conduct research at the NASA Langley Research Center in the area of astronautics and to provide a comprehensive education program at the Center leading to advanced degrees in Astronautics. We believe that the program has successfully met the objectives and has been of significant benefit to NASA LaRC, the GWU and the nation.
International Nuclear Information System (INIS)
Waloschek, P.
1988-01-01
On November 12, 1964, the 6 GeV electrons synchrotron and the associated utility facilities were dedicated for regular operation. Since that date, the DESY Research Center, the German Electron Synchrotron in Hamburg, has offered to scientists from all over the world unique facilities in which to study the smallest constituents of matter. At present, some 580 physicists participate in DESY's research work on particle physics and high energy physics. Most of them are university teachers, a great many come from abroad. Their home institutions make considerable contributions to setting up the measuring equipment. Another 500 physicists annually make use of the extensive synchrotron radiation facilities available at DESY. DESY is one of the thirteen national research laboratories in the Federal Republic of Germany; its annual government grants for operation and personnel (1300 staff members in 1988) amount to some DM 150 million. In addition, some DM 950 million will be invested into the construction of the new HERA facility between 1984 and 1990, of which 15% will be contributed by foreign institutions. The ordinary budget of DESY is paid 90% by the German Federal Ministry for Research and Technology (BMFT) and 10% by the city of Hamburg. (orig.)
High Energy Astrophysics Science Archive Research Center
National Aeronautics and Space Administration — The High Energy Astrophysics Science Archive Research Center (HEASARC) is the primary archive for NASA missions dealing with extremely energetic phenomena, from...
Directory of Open Access Journals (Sweden)
Gabriele Guidi
2016-07-01
Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.
RCOP: Research Center for Optical Physics
Tabibi, Bagher M. (Principal Investigator)
1996-01-01
During the five years since its inception, Research Center for Optical Physics (RCOP) has excelled in the goals stated in the original proposal: 1) training of the scientists and engineers needed for the twenty-first century with special emphasis on underrepresented citizens and 2) research and technological development in areas of relevance to NASA. In the category of research training, there have been 16 Bachelors degrees and 9 Masters degrees awarded to African American students working in RCOP during the last five years. RCOP has also provided research experience to undergraduate and high school students through a number of outreach programs held during the summer and the academic year. RCOP has also been instrumental in the development of the Ph.D. program in physics which is in its fourth year at Hampton. There are currently over 40 graduate students in the program and 9 African American graduate students, working in RCOP, that have satisfied all of the requirements for Ph.D. candidancy and are working on their dissertation research. At least three of these students will be awarded their doctoral degrees during 1997. RCOP has also excelled in research and technological development. During the first five years of existence, RCOP researchers have generated well over $3 M in research funding that directly supports the Center. Close ties with NASA Langley and NASA Lewis have been established, and collaborations with NASA scientists, URC's and other universities as well as with industry have been developed. This success is evidenced by the rate of publishing research results in refereed journals, which now exceeds that of the goals in the original proposal (approx. 2 publications per faculty per year). Also, two patents have been awarded to RCOP scientists.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA LANGLEY RESEARCH CENTER AND THE TIDEWATER INTERAGENCY POLLUTION PREVENTION PROGRAM
National Aeronautics and Space Administration (NASA)'s Langley Research Center (LaRC) is an 807-acre research center devoted to aeronautics and space research. aRC has initiated a broad-based pollution prevention program guided by a Pollution Prevention Program Plan and implement...
34 CFR 350.34 - Which Rehabilitation Engineering Research Centers must have an advisory committee?
2010-07-01
... 34 Education 2 2010-07-01 2010-07-01 false Which Rehabilitation Engineering Research Centers must... Engineering Research Centers Does the Secretary Assist? § 350.34 Which Rehabilitation Engineering Research Centers must have an advisory committee? A Rehabilitation Engineering Research Center conducting research...
Human Genome Research: Decoding DNA
dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human
SWOT analysis in Sina Trauma and Surgery Research Center.
Salamati, Payman; ashraf Eghbali, Ali; Zarghampour, Manijeh
2014-01-01
The present study was conducted with the aim of identifying and evaluating the internal and external factors, affecting the Sina Trauma and Surgery Research Center, affiliated to Tehran University of Medical Sciences and propose some of related strategies to senior managers. We used a combined quantitative and qualitative methodology. Our study population consisted of personnel (18 individuals) at Sina Trauma and Surgery Research Center. Data-collection tools were the group discussions and the questionnaires. Data were analyzed with descriptive statistics and SWOT (Strength, Weakness, Opportunities and Threats) analysis. 18 individuals participated in sessions, consisting of 8 women (44.4%) and 10 men (55.6%). The final scores were 2.45 for internal factors (strength-weakness) and 2.17 for external factors (opportunities-threats). In this study, we proposed 36 strategies (10 weakness-threat strategies, 10 weakness-opportunity strategies, 7 strength-threat strategies, and 9 strength-opportunity strategies). The current status of Sina Trauma and Surgery Research Center is threatened weak. We recommend the center to implement the proposed strategies.
Likumahuwa, Sonja; Song, Hui; Singal, Robbie; Weir, Rosy Chang; Crane, Heidi; Muench, John; Sim, Shao-Chee; DeVoe, Jennifer E
2013-01-01
This article introduces the Community Health Applied Research Network (CHARN), a practice-based research network of community health centers (CHCs). Established by the Health Resources and Services Administration in 2010, CHARN is a network of 4 community research nodes, each with multiple affiliated CHCs and an academic center. The four nodes (18 individual CHCs and 4 academic partners in 9 states) are supported by a data coordinating center. Here we provide case studies detailing how CHARN is building research infrastructure and capacity in CHCs, with a particular focus on how community practice-academic partnerships were facilitated by the CHARN structure. The examples provided by the CHARN nodes include many of the building blocks of research capacity: communication capacity and "matchmaking" between providers and researchers; technology transfer; research methods tailored to community practice settings; and community institutional review board infrastructure to enable community oversight. We draw lessons learned from these case studies that we hope will serve as examples for other networks, with special relevance for community-based networks seeking to build research infrastructure in primary care settings.
Natural and Accelerated Bioremediation Research (NABIR) Field Research Center (FRC) Management Plan
Energy Technology Data Exchange (ETDEWEB)
Watson, D.B.
2002-02-28
The Environmental Sciences Division at Oak Ridge National Laboratory has established a Field Research Center (FRC) to support the Natural and Accelerated Bioremediation Research (NABIR) Program on the U.S. Department of Energy (DOE) Oak Ridge Reservation in Oak Ridge, Tennessee for the DOE Headquarters Office of Biological and Environmental Research within the Office of Science.
On-going research projects at Ankara Nuclear research center in agriculture and animal science
International Nuclear Information System (INIS)
Tukenmez, I.
2004-01-01
Full text:The research and development activities of Ankara Nuclear Research Center in Agriculture and Animal Science(ANRCAA) are concentrated on the contribution of atomic energy to peace by the use of nuclear and related techniques in food, agriculture and animal science. Nuclear techniques are used in the above fields in two ways: in vitro or in vivo radio tracing the substances and processes of biological importance, and irradiation of biological materials for preservation and quality modification. Research projects are carried out by interdisciplinary studies with well equipped laboratories at the Center. The projects in progress conducted by the Center comprises nuclear-aided researches in soil fertility, plant nutrition, plant protection, improvement of field crops, improvement of horticultural plants and forest trees by mutation breeding, in vitro culture technique with mutagen treatments, use of phosphogypsum in soil amelioration, sterilization of medical supplies, wastewater treatment, animal nutrition, animal health and productivity and accreditation. The on-going projects with the above subjects will be summarized for possible collaborations
On-going research projects at Ankara Nuclear Research Center in Agriculture and Animal Science
International Nuclear Information System (INIS)
Tukenmez, I.
2004-01-01
Full text: The research and development activities of Ankara Nuclear Research Center in Agriculture and Animal Science(ANRCAA) are concentrated on the contribution of atomic energy to peace by the use of nuclear and related techniques in food, agriculture and animal science. Nuclear techniques are used in the above fields in two ways: in vitro or in vivo radio tracing the substances and processes of biological importance, and irradiation of biological materials for preservation and quality modification. Research projects are carried out by interdisciplinary studies with well equipped laboratories at the Center. The projects in progress conducted by the Center comprises nuclear-aided researches in soil fertility, plant nutrition, plant protection, improvement of field crops, improvement of horticultural plants and forest trees by mutation breeding, in vitro culture technique with mutagen treatments, use of phosphogypsum in soil amelioration, sterilization of medical supplies, wastewater treatment, animal nutrition, animal health and productivity and accreditation. The on-going projects with the above subjects will be summarized for possible collaborations
CUBED: South Dakota 2010 Research Center For Dusel Experiments
International Nuclear Information System (INIS)
Keller, Christina; Alton, Drew; Bai Xinhau; Durben, Dan; Heise, Jaret; Hong Haiping; Howard, Stan; Jiang Chaoyang; Keeter, Kara; McTaggart, Robert; Medlin, Dana; Mei Dongming; Petukhov, Andre; Rauber, Joel; Roggenthen, Bill; Spaans, Jason; Sun Yongchen; Szczerbinska, Barbara; Thomas, Keenan; Zehfus, Michael
2010-01-01
With the selection of the Homestake Mine in western South Dakota by the National Science Foundation (NSF) as the site for a national Deep Underground Science and Engineering Laboratory (DUSEL), the state of South Dakota has sought ways to engage its faculty and students in activities planned for DUSEL. One such effort is the creation of a 2010 Research Center focused on ultra-low background experiments or a Center for Ultra-low Background Experiments at DUSEL (CUBED). The goals of this center include to 1) bring together the current South Dakota faculty so that one may begin to develop a critical mass of expertise necessary for South Dakota's full participation in large-scale collaborations planned for DUSEL; 2) to increase the number of research faculty and other research personnel in South Dakota to complement and supplement existing expertise in nuclear physics and materials sciences; 3) to be competitive in pursuit of external funding through the creation of a center which focuses on areas of interest to experiments planned for DUSEL such as an underground crystal growth lab, a low background counting facility, a purification/depletion facility for noble liquids, and an electroforming copper facility underground; and 4) to train and educate graduate and undergraduate students as a way to develop the scientific workforce of the state. We will provide an update on the activities of the center and describe in more detail the scientific foci of the center.
Proceedings of RIKEN BNL Research Center Workshop
Energy Technology Data Exchange (ETDEWEB)
Samios, Nicholas P. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-01-24
The twelfth evaluation of the RIKEN BNL Research Center (RBRC) took place on November 6 – 8, 2012 at Brookhaven National Laboratory. The members of the Scientific Review Committee (SRC), present at the meeting, were: Prof. Wit Busza, Prof. Miklos Gyulassy, Prof. Kenichi Imai, Prof. Richard Milner (Chair), Prof. Alfred Mueller, Prof. Charles Young Prescott, and Prof. Akira Ukawa. We are pleased that Dr. Hideto En’yo, the Director of the Nishina Institute of RIKEN, Japan, participated in this meeting both in informing the committee of the activities of the RIKEN Nishina Center for Accelerator- Based Science and the role of RBRC and as an observer of this review. In order to illustrate the breadth and scope of the RBRC program, each member of the Center made a presentation on his/her research efforts. This encompassed three major areas of investigation: theoretical, experimental and computational physics. In addition, the committee met privately with the fellows and postdocs to ascertain their opinions and concerns. Although the main purpose of this review is a report to RIKEN management on the health, scientific value, management and future prospects of the Center, the RBRC management felt that a compendium of the scientific presentations are of sufficient quality and interest that they warrant a wider distribution. Therefore we have made this compilation and present it to the community for its information and enlightenment.
Solar Energy Research Center Instrumentation Facility
Energy Technology Data Exchange (ETDEWEB)
Meyer, Thomas, J.; Papanikolas, John, P.
2011-11-11
SOLAR ENERGY RESEARCH CENTER INSTRUMENTATION FACILITY The mission of the Solar Energy Research Center (UNC SERC) at the University of North Carolina at Chapel Hill (UNC-CH) is to establish a world leading effort in solar fuels research and to develop the materials and methods needed to fabricate the next generation of solar energy devices. We are addressing the fundamental issues that will drive new strategies for solar energy conversion and the engineering challenges that must be met in order to convert discoveries made in the laboratory into commercially available devices. The development of a photoelectrosynthesis cell (PEC) for solar fuels production faces daunting requirements: (1) Absorb a large fraction of sunlight; (2) Carry out artificial photosynthesis which involves multiple complex reaction steps; (3) Avoid competitive and deleterious side and reverse reactions; (4) Perform 13 million catalytic cycles per year with minimal degradation; (5) Use non-toxic materials; (6) Cost-effectiveness. PEC efficiency is directly determined by the kinetics of each reaction step. The UNC SERC is addressing this challenge by taking a broad interdisciplinary approach in a highly collaborative setting, drawing on expertise across a broad range of disciplines in chemistry, physics and materials science. By taking a systematic approach toward a fundamental understanding of the mechanism of each step, we will be able to gain unique insight and optimize PEC design. Access to cutting-edge spectroscopic tools is critical to this research effort. We have built professionally-staffed facilities equipped with the state-of the-art instrumentation funded by this award. The combination of staff, facilities, and instrumentation specifically tailored for solar fuels research establishes the UNC Solar Energy Research Center Instrumentation Facility as a unique, world-class capability. This congressionally directed project funded the development of two user facilities: TASK 1: SOLAR
NASA Lewis Research Center's materials and structures division
International Nuclear Information System (INIS)
Weymueller, C.R.
1976-01-01
Research activities at the NASA Lewis Research Center on materials and structures are discussed. Programs are noted on powder metallurgy superalloys, eutectic alloys, dispersion strengthened alloys and composite materials. Discussions are included on materials applications, coatings, fracture mechanics, and fatigue
The Center at Florence is one of the ninety research units of the United States Department of Agriculture - Agricultural Research Service (USDA-ARS). The mission of the Center is to conduct research and transfer solutions that improve agricultural production, protect the environment, and enhance the...
Center for risk research: A review of work 1988-1991
International Nuclear Information System (INIS)
Sjoeberg, L.
1992-01-01
This report gives a summary of the research published during the first 4 years of the Center for Risk Research at the Stockholm School of Economics. Risk research carried out so far at the Center has been concerned with mapping of attitudes and risk perceptions with regard to nuclear risks, AIDS, military flight risks, and economic risks. There has also been some methodological work and some work on the relationship between risk perception and interests
Center for risk research: A review of work 1988-1991
Energy Technology Data Exchange (ETDEWEB)
Sjoeberg, L
1992-01-01
This report gives a summary of the research published during the first 4 years of the Center for Risk Research at the Stockholm School of Economics. Risk research carried out so far at the Center has been concerned with mapping of attitudes and risk perceptions with regard to nuclear risks, AIDS, military flight risks, and economic risks. There has also been some methodological work and some work on the relationship between risk perception and interests.
Role Strain in University Research Centers
Boardman, Craig; Bozeman, Barry
2007-01-01
One way in which university faculty members' professional lives have become more complex with the advent of contemporary university research centers is that many faculty have taken on additional roles. The authors' concern in this article is to determine the extent to which role strain is experienced by university faculty members who are…
Synthesis centers as critical research infrastructure
Baron, Jill S.; Specht, Alison; Garnier, Eric; Bishop, Pamela; Campbell, C. Andrew; Davis, Frank W.; Fady, Bruno; Field, Dawn; Gross, Louis J.; Guru, Siddeswara M.; Halpern, Benjamin S; Hampton, Stephanie E.; Leavitt, Peter R.; Meagher, Thomas R.; Ometto, Jean; Parker, John N.; Price, Richard; Rawson, Casey H.; Rodrigo, Allen; Sheble, Laura A.; Winter, Marten
2017-01-01
investment to maximize benefits to science and society is justified. In particular, we argue that synthesis centers represent community infrastructure more akin to research vessels than to term-funded centers of science and technology (e.g., NSF Science and Technology Centers). Through our experience running synthesis centers and, in some cases, developing postfederal funding models, we offer our perspective on the purpose and value of synthesis centers. We present case studies of different outcomes of transition plans and argue for a fundamental shift in the conception of synthesis science and the strategic funding of these centers by government funding agencies.
Translational Partnership Development Lead | Center for Cancer Research
PROGRAM DESCRIPTION The Frederick National Laboratory for Cancer Research (FNLCR) is a Federally Funded Research and Development Center operated by Leidos Biomedical Research, Inc on behalf of the National Cancer Institute (NCI). The staff of FNLCR support the NCI’s mission in the fight against cancer and HIV/AIDS. Currently we are seeking a Translational Partnership
Technologies and experimental approaches in the NIH Botanical Research Centers
Barnes, Stephen; Birt, Diane F; Cassileth, Barrie R; Cefalu, William T; Chilton, Floyd H; Farnsworth, Norman R; Raskin, Ilya; van Breemen, Richard B; Weaver, Connie M
2009-01-01
There are many similarities between research on combinatorial chemistry and natural products and research on dietary supplements and botanicals in the NIH Botanical Research Centers. The technologies in the centers are similar to those used by other NIH-sponsored investigators. All centers rigorously examine the authenticity of botanical dietary supplements and determine the composition and concentrations of the phytochemicals therein, most often by liquid chromatography–mass spectrometry. Several of the centers specialize in fractionation and high-throughput evaluation to identify the individual bioactive agent or a combination of agents. Some centers are using DNA microarray analyses to determine the effects of botanicals on gene transcription with the goal of uncovering the important biochemical pathways they regulate. Other centers focus on bioavailability and uptake, distribution, metabolism, and excretion of the phytochemicals as for all xenobiotics. Because phytochemicals are often complex molecules, synthesis of isotopically labeled forms is carried out by plant cells in culture, followed by careful fractionation. These labeled phytochemicals allow the use of accelerator mass spectrometry to trace the tissue distribution of 14C-labeled proanthocyanidins in animal models of disease. State-of-the-art proteomics and mass spectrometry are also used to identify proteins in selected tissues whose expression and posttranslational modification are influenced by botanicals and dietary supplements. In summary, the skills needed to carry out botanical centers’ research are extensive and may exceed those practiced by most NIH investigators. PMID:18258642
Allen, David; Ripley, Elizabeth; Coe, Antoinette; Clore, John
2013-12-01
In 2010, Virginia Commonwealth University (VCU) was granted a Clinical and Translational Science Award which prompted reorganization and expansion of their clinical research infrastructure. A case study approach is used to describe the implementation of a business and cost recovery model for clinical and translational research and the transformation of VCU's General Clinical Research Center and Clinical Trials Office to a combined Clinical Research Services entity. We outline the use of a Plan, Do, Study, Act cycle that facilitated a thoughtful transition process, which included the identification of required changes and cost recovery processes for implementation. Through this process, the VCU Center for Clinical and Translational Research improved efficiency, increased revenue recovered, reduced costs, and brought a high level of fiscal responsibility through financial reporting.
Energy Frontier Research Center, Center for Materials Science of Nuclear Fuels
International Nuclear Information System (INIS)
Allen, Todd R.
2011-01-01
The Office of Science, Basic Energy Sciences, has funded the INL as one of the Energy Frontier Research Centers in the area of material science of nuclear fuels. This document is the required annual report to the Office of Science that outlines the accomplishments for the period of May 2010 through April 2011. The aim of the Center for Material Science of Nuclear Fuels (CMSNF) is to establish the foundation for predictive understanding of the effects of irradiation-induced defects on thermal transport in oxide nuclear fuels. The science driver of the center's investigation is to understand how complex defect and microstructures affect phonon mediated thermal transport in UO2, and achieve this understanding for the particular case of irradiation-induced defects and microstructures. The center's research thus includes modeling and measurement of thermal transport in oxide fuels with different levels of impurities, lattice disorder and irradiation-induced microstructure, as well as theoretical and experimental investigation of the evolution of disorder, stoichiometry and microstructure in nuclear fuel under irradiation. With the premise that thermal transport in irradiated UO2 is a phonon-mediated energy transport process in a crystalline material with defects and microstructure, a step-by-step approach will be utilized to understand the effects of types of defects and microstructures on the collective phonon dynamics in irradiated UO2. Our efforts under the thermal transport thrust involved both measurement of diffusive phonon transport (an approach that integrates over the entire phonon spectrum) and spectroscopic measurements of phonon attenuation/lifetime and phonon dispersion. Our distinct experimental efforts dovetail with our modeling effort involving atomistic simulation of phonon transport and prediction of lattice thermal conductivity using the Boltzmann transport framework.
Scientific activities 1980 Nuclear Research Center ''Democritos''
International Nuclear Information System (INIS)
1982-01-01
The scientific activities and achievements of the Nuclear Research Center Democritos for the year 1980 are presented in the form of a list of 76 projects giving title, objectives, responsible of each project, developed activities and the pertaining lists of publications. The 16 chapters of this work cover the activities of the main Divisions of the Democritos NRC: Electronics, Biology, Physics, Chemistry, Health Physics, Reactor, Scientific Directorate, Radioisotopes, Environmental Radioactivity, Soil Science, Computer Center, Uranium Exploration, Medical Service, Technological Applications, Radioimmunoassay and Training. (N.C.)
Moving from Damage-Centered Research through Unsettling Reflexivity
Calderon, Dolores
2016-01-01
The author revisits autoethnographic work in order to examine how she unwittingly incorporated damage-centered (Tuck 2009) research approaches that reproduce settler colonial understandings of marginalized communities. The paper examines the reproduction of settler colonial knowledge in ethnographic research by unearthing the inherent surveillance…
Current research and development at the Nuclear Research Center Karlsruhe
International Nuclear Information System (INIS)
Kuesters, H.
1982-01-01
The Nuclear Research Center Karlsruhe (KfK) is funded to 90% by the Federal Republic of Germany and to 10% by the State of Baden-Wuerttemberg. Since its foundation in 1956 the main objective of the Center is research and development (R and D) in the aera of the nuclear technology and about 2/3 of the research capacity is now devoted to this field. Since 1960 a major activity of KfK is R and D work for the design of fast breeder reactors, including material research, physics, and safety investigations; a prototype of 300 MWe is under construction now in the lower Rhine Valley. For enrichment of 235 U fissile material KfK developed the separation nozzle process; its technical application is realized within an international contract between the Federal Republic of Germany and Brazil. Within the frame of the European Programme on fusion technology KfK develops and tests superconducting magnets for toroidal fusion systems; a smaller activity deals with research on inertial confinement fusion. A broad research programme is carried through for safety investigations of nuclear installations, especially for PWRs; this activity is supplemented by research and development in the field of nuclear materials' safeguards. Development of fast reactors has to initiate research for the reprocessing of spent fuel and waste disposal. In the pilot plant WAK spent fuel from LKWs is reprocessed; research especially tries e.g. to improve the PUREX-process by electrochemical means, vitrification of high active waste is another main activity. First studies are being performed now to clarify the necessary development for reprocessing fast reactor fuel. About 1/3 of the research capacity of KfK deals with fundamental research in nuclear physics, solid state physics, biology and studies on the impact of technology on environment. Promising new technologies as e.g. the replacement of gasoline by hydrogen cells as vehicle propulsion are investigated. (orig.)
Staff Clinician | Center for Cancer Research
The Neuro-Oncology Branch (NOB), Center for Cancer Research (CCR), National Cancer Institute (NCI), National Institutes of Health (NIH) is seeking staff clinicians to provide high-quality patient care for individuals with primary central nervous system (CNS) malignancies. The NOB is comprised of a multidisciplinary team of physicians, healthcare providers, and scientists who
Decommissioning Operations at the Cadarache Nuclear Research Center
International Nuclear Information System (INIS)
Gouhier, E.
2008-01-01
Among the different activities of the CEA research center of Cadarache, located in the south of France, one of the most important involves decommissioning. As old facilities close, decommissioning activity increases. This presentation will give an overview of the existing organization and the different ongoing decommissioning and cleanup operations on the site. We shall also present some of the new facilities under construction the purpose of which is to replace the decommissioned ones. Cadarache research center was created on October 14, 1959. Today, the activities of the research center are shared out among several technological R and D platforms, essentially devoted to nuclear energy (fission and fusion) Acting as a support to these R and D activities, the center of Cadarache has a platform of services which groups the auxiliary services required by the nuclear facilities and those necessary to the management of nuclear materials, waste, nuclear facility releases and decommissioning. Many old facilities have shut down in recent years (replaced by new facilities) and a whole decommissioning program is now underway involving the dismantling of nuclear reactors (Rapsodie, Harmonie), processing facilities (ATUE uranium treatment facility, LECA UO 2 facility) as well as waste treatment and storage facilities (INB37, INB 56. In conclusion: other dismantling and cleanup operations that are now underway in Cadarache include the following: - Waste treatment and storage facilities, - Historical VLLW and HLW storage facility, - Fissile material storage building, - Historical spent fuel storage facility. Thanks to the project organization: - Costs and risks on these projects can be reduced. - Engineers and technicians can easily move from one project to another. In some cases, when a new facility is under construction for the purpose of replacing a decommissioned one, some of the project team can integrate the new facility as members of the operation team. Today
AHPCRC - Army High Performance Computing Research Center
2010-01-01
computing. Of particular interest is the ability of a distrib- uted jamming network (DJN) to jam signals in all or part of a sensor or communications net...and reasoning, assistive technologies. FRIEDRICH (FRITZ) PRINZ Finmeccanica Professor of Engineering, Robert Bosch Chair, Department of Engineering...High Performance Computing Research Center www.ahpcrc.org BARBARA BRYAN AHPCRC Research and Outreach Manager, HPTi (650) 604-3732 bbryan@hpti.com Ms
The National Center for Atmospheric Research (NCAR) Research Data Archive: a Data Education Center
Peng, G. S.; Schuster, D.
2015-12-01
The National Center for Atmospheric Research (NCAR) Research Data Archive (RDA), rda.ucar.edu, is not just another data center or data archive. It is a data education center. We not only serve data, we TEACH data. Weather and climate data is the original "Big Data" dataset and lessons learned while playing with weather data are applicable to a wide range of data investigations. Erroneous data assumptions are the Achilles heel of Big Data. It doesn't matter how much data you crunch if the data is not what you think it is. Each dataset archived at the RDA is assigned to a data specialist (DS) who curates the data. If a user has a question not answered in the dataset information web pages, they can call or email a skilled DS for further clarification. The RDA's diverse staff—with academic training in meteorology, oceanography, engineering (electrical, civil, ocean and database), mathematics, physics, chemistry and information science—means we likely have someone who "speaks your language." Data discovery is another difficult Big Data problem; one can only solve problems with data if one can find the right data. Metadata, both machine and human-generated, underpin the RDA data search tools. Users can quickly find datasets by name or dataset ID number. They can also perform a faceted search that successively narrows the options by user requirements or simply kick off an indexed search with a few words. Weather data formats can be difficult to read for non-expert users; it's usually packed in binary formats requiring specialized software and parameter names use specialized vocabularies. DSs create detailed information pages for each dataset and maintain lists of helpful software, documentation and links of information around the web. We further grow the level of sophistication of the users with tips, tutorials and data stories on the RDA Blog, http://ncarrda.blogspot.com/. How-to video tutorials are also posted on the NCAR Computational and Information Systems
Patient-centered outcomes research in radiology: trends in funding and methodology.
Lee, Christoph I; Jarvik, Jeffrey G
2014-09-01
The creation of the Patient-Centered Outcomes Research Trust Fund and the Patient-Centered Outcomes Research Institute (PCORI) through the Patient Protection and Affordable Care Act of 2010 presents new opportunities for funding patient-centered comparative effectiveness research (CER) in radiology. We provide an overview of the evolution of federal funding and priorities for CER with a focus on radiology-related priority topics over the last two decades, and discuss the funding processes and methodological standards outlined by PCORI. We introduce key paradigm shifts in research methodology that will be required on the part of radiology health services researchers to obtain competitive federal grant funding in patient-centered outcomes research. These paradigm shifts include direct engagement of patients and other stakeholders at every stage of the research process, from initial conception to dissemination of results. We will also discuss the increasing use of mixed methods and novel trial designs. One of these trial designs, the pragmatic trial, has the potential to be readily applied to evaluating the effectiveness of diagnostic imaging procedures and imaging-based interventions among diverse patient populations in real-world settings. Copyright © 2014 AUR. Published by Elsevier Inc. All rights reserved.
NASA Space Engineering Research Center for VLSI systems design
1991-01-01
This annual review reports the center's activities and findings on very large scale integration (VLSI) systems design for 1990, including project status, financial support, publications, the NASA Space Engineering Research Center (SERC) Symposium on VLSI Design, research results, and outreach programs. Processor chips completed or under development are listed. Research results summarized include a design technique to harden complementary metal oxide semiconductors (CMOS) memory circuits against single event upset (SEU); improved circuit design procedures; and advances in computer aided design (CAD), communications, computer architectures, and reliability design. Also described is a high school teacher program that exposes teachers to the fundamentals of digital logic design.
High power electromagnetic propulsion research at the NASA Glenn Research Center
International Nuclear Information System (INIS)
LaPointe, Michael R.; Sankovic, John M.
2000-01-01
Interest in megawatt-class electromagnetic propulsion has been rekindled to support newly proposed high power orbit transfer and deep space mission applications. Electromagnetic thrusters can effectively process megawatts of power to provide a range of specific impulse values to meet diverse in-space propulsion requirements. Potential applications include orbit raising for the proposed multi-megawatt Space Solar Power Satellite and other large commercial and military space platforms, lunar and interplanetary cargo missions in support of the NASA Human Exploration and Development of Space strategic enterprise, robotic deep space exploration missions, and near-term interstellar precursor missions. As NASA's lead center for electric propulsion, the Glenn Research Center is developing a number of high power electromagnetic propulsion technologies to support these future mission applications. Program activities include research on MW-class magnetoplasmadynamic thrusters, high power pulsed inductive thrusters, and innovative electrodeless plasma thruster concepts. Program goals are highlighted, the status of each research area is discussed, and plans are outlined for the continued development of efficient, robust high power electromagnetic thrusters
Patient-centered prioritization of bladder cancer research.
Smith, Angela B; Chisolm, Stephanie; Deal, Allison; Spangler, Alejandra; Quale, Diane Z; Bangs, Rick; Jones, J Michael; Gore, John L
2018-05-04
Patient-centered research requires the meaningful involvement of patients and caregivers throughout the research process. The objective of this study was to create a process for sustainable engagement for research prioritization within oncology. From December 2014 to 2016, a network of engaged patients for research prioritization was created in partnership with the Bladder Cancer Advocacy Network (BCAN): the BCAN Patient Survey Network (PSN). The PSN leveraged an online bladder cancer community with additional recruitment through print advertisements and social media campaigns. Prioritized research questions were developed through a modified Delphi process and were iterated through multidisciplinary working groups and a repeat survey. In year 1 of the PSN, 354 patients and caregivers responded to the research prioritization survey; the number of responses increased to 1034 in year 2. The majority of respondents had non-muscle-invasive bladder cancer (NMIBC), and the mean time since diagnosis was 5 years. Stakeholder-identified questions for noninvasive, invasive, and metastatic disease were prioritized by the PSN. Free-text questions were sorted with thematic mapping. Several questions submitted by respondents were among the prioritized research questions. A final prioritized list of research questions was disseminated to various funding agencies, and a highly ranked NMIBC research question was included as a priority area in the 2017 Patient-Centered Outcomes Research Institute announcement of pragmatic trial funding. Patient engagement is needed to identify high-priority research questions in oncology. The BCAN PSN provides a successful example of an engagement infrastructure for annual research prioritization in bladder cancer. The creation of an engagement network sets the groundwork for additional phases of engagement, including design, conduct, and dissemination. Cancer 2018. © 2018 American Cancer Society. © 2018 American Cancer Society.
Research Center Renaming Will Honor Senator Domenici
2008-05-01
New Mexico Tech and the National Radio Astronomy Observatory (NRAO) will rename the observatory's research center on the New Mexico Tech campus to honor retiring U.S. Senator Pete V. Domenici in a ceremony on May 30. The building that serves as the scientific, technical, and administrative center for the Very Large Array (VLA) and Very Long Baseline Array (VLBA) radio telescopes will be named the "Pete V. Domenici Science Operations Center." The building previously was known simply as the "Array Operations Center." Sen. Pete V. Domenici Sen. Pete V. Domenici "The new name recognizes the strong and effective support for science that has been a hallmark of Senator Domenici's long career in public service," said Dr. Fred Lo, NRAO Director. New Mexico Tech President Daniel H. Lopez said Sen. Domenici has always been a supporter of science and research in Socorro and throughout the state. "He's been a statesman for New Mexico, the nation -- and without exaggeration -- for the world," Lopez said. "Anyone with that track record deserves this recognition." Van Romero, Tech vice president of research and economic development, has served as the university's main lobbyist in Washington, D.C., for more than a decade. He said Sen. Domenici has always been receptive to new ideas and willing to take risks. "Over the years, Sen. Domenici has always had time to listen to our needs and goals," Romero said. "He has served as a champion of New Mexico Tech's causes and we owe him a debt of gratitude for all his efforts over the decades." Originally dedicated in 1988, the center houses offices and laboratories that support VLA and VLBA operations. The center also supports work on the VLA modernization project and on the international Atacama Large Millimeter/submillimeter Array (ALMA) project. Work on ALMA at the Socorro center and at the ALMA Test Facility at the VLA site west of Socorro has focused on developing and testing equipment to be deployed at the ALMA site in Chile's Atacama
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Center for Fuel Cell Research and Applications development phase. Final report
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-12-01
The deployment and operation of clean power generation is becoming critical as the energy and transportation sectors seek ways to comply with clean air standards and the national deregulation of the utility industry. However, for strategic business decisions, considerable analysis is required over the next few years to evaluate the appropriate application and value added from this emerging technology. To this end the Houston Advanced Research Center (HARC) is proposing a three-year industry-driven project that centers on the creation of ``The Center for Fuel Cell Research and Applications.`` A collaborative laboratory housed at and managed by HARC, the Center will enable a core group of six diverse participating companies--industry participants--to investigate the economic and operational feasibility of proton-exchange-membrane (PEM) fuel cells in a variety of applications (the core project). This document describes the unique benefits of a collaborative approach to PEM applied research, among them a shared laboratory concept leading to cost savings and shared risks as well as access to outstanding research talent and lab facilities. It also describes the benefits provided by implementing the project at HARC, with particular emphasis on HARC`s history of managing successful long-term research projects as well as its experience in dealing with industry consortia projects. The Center is also unique in that it will not duplicate the traditional university role of basic research or that of the fuel cell industry in developing commercial products. Instead, the Center will focus on applications, testing, and demonstration of fuel cell technology.
Nuclear Research Center IRT reactor dynamics calculation
International Nuclear Information System (INIS)
Aleman Fernandez, J.R.
1990-01-01
The main features of the code DIRT, for dynamical calculations are described in the paper. With the results obtained by the program, an analysis of the dynamic behaviour of the Research Reactor IRT of the Nuclear Research Center (CIN) is performed. Different transitories were considered such as variation of the system reactivity, coolant inlet temperature variation and also variations of the coolant velocity through the reactor core. 3 refs
Zeeman and orbital limiting magnetic fields in cuprates: The ...
Indian Academy of Sciences (India)
1IBM T. J. Watson Research Center, Yorktown Heights, New York 10598, ... In cuprates, in a view where pairing correlations set in at the pseudogap ... the field Hc2 bounding the superconducting response and the pseudogap closing field.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Electron Microscopy-Data Analysis Specialist | Center for Cancer Research
PROGRAM DESCRIPTION The Cancer Research Technology Program (CRTP) develops and implements emerging technology, cancer biology expertise and research capabilities to accomplish NCI research objectives. The CRTP is an outward-facing, multi-disciplinary hub purposed to enable the external cancer research community and provides dedicated support to NCI’s intramural Center for
2008-01-01
This audit was initiated in response to a hotline complaint regarding the review, approval, and release of scientific and technical information (STI) at Johnson Space Center. The complainant alleged that Johnson personnel conducting export control reviews of STI were not fully qualified to conduct those reviews and that the reviews often did not occur until after the STI had been publicly released. NASA guidance requires that STI, defined as the results of basic and applied scientific, technical, and related engineering research and development, undergo certain reviews prior to being released outside of NASA or to audiences that include foreign nationals. The process includes technical, national security, export control, copyright, and trade secret (e.g., proprietary data) reviews. The review process was designed to preclude the inappropriate dissemination of sensitive information while ensuring that NASA complies with a requirement of the National Aeronautics and Space Act of 1958 (the Space Act)1 to provide for the widest practicable and appropriate dissemination of information resulting from NASA research activities. We focused our audit on evaluating the STI review process: specifically, determining whether the roles and responsibilities for the review, approval, and release of STI were adequately defined and documented in NASA and Center-level guidance and whether that guidance was effectively implemented at Goddard Space Flight Center, Johnson Space Center, Langley Research Center, and Marshall Space Flight Center. Johnson was included in the review because it was the source of the initial complaint, and Goddard, Langley, and Marshall were included because those Centers consistently produce significant amounts of STI.
Song, Hui; Li, Vivian; Gillespie, Suzanne; Laws, Reesa; Massimino, Stefan; Nelson, Christine; Singal, Robbie; Wagaw, Fikirte; Jester, Michelle; Weir, Rosy Chang
2015-01-01
The mission of the Community Health Applied Research Network (CHARN) is to build capacity to carry out Patient-Centered Outcomes Research at community health centers (CHCs), with the ultimate goal to improve health care for vulnerable populations. The CHARN Needs Assessment Staff Survey investigates CHCs' involvement in research, as well as their need for research training and resources. Results will be used to guide future training. The survey was developed and implemented in partnership with CHARN CHCs. Data were collected across CHARN CHCs. Data analysis and reports were conducted by the CHARN data coordinating center (DCC). Survey results highlighted gaps in staff research training, and these gaps varied by staff role. There is considerable variation in research involvement, partnerships, and focus both within and across CHCs. Development of training programs to increase research capacity should be tailored to address the specific needs and roles of staff involved in research.
Project 'European Research Center for Air Pollution Abatement Measures'
International Nuclear Information System (INIS)
1985-04-01
During the 5-7th of March 1985 the first status report of the project 'European Research Center for Air Pollution Control Measures' took place in the Nuclear Research Center, Karlsruhe. Progress reports on the following topics assessment and analysis of the impacts of airborne pollutants on forest trees; distinction from other potential causes of recent forest dieback, research into atmospheric dispersion, conversion and deposition of airborne pollutants, development and optimization of industrial-technical processes to reduce or avoid emissions and providing instruments and making recommendations to the industrial and political sectors were presented. This volume is a collection of the work reported there. 42 papers were entered separately. (orig./MG) [de
Establishing a national research center on day care
DEFF Research Database (Denmark)
Ellegaard, Tomas
The paper presents and discusses the current formation of a national research center on ECEC. The center is currently being established. It is partly funded by the Danish union of early childhood and youth educators. It is based on cooperation between a number of Danish universities and this nati...... current new public management policies. However there is also more conflicting issues that emerge in this enterprise – especially on interests, practice relevance and knowledge paradigms....
International Nuclear Information System (INIS)
Pope, Gary A.
2011-01-01
'The Center for Frontiers of Subsurface Energy Security (CFSES)' was submitted to the 'Life at the Frontiers of Energy Research' video contest at the 2011 Science for Our Nation's Energy Future: Energy Frontier Research Centers (EFRCs) Summit and Forum. Twenty-six EFRCs created short videos to highlight their mission and their work. CFSES is directed by Gary A. Pope at the University of Texas at Austin and partners with Sandia National Laboratories. The Office of Basic Energy Sciences in the U.S. Department of Energy's Office of Science established the 46 Energy Frontier Research Centers (EFRCs) in 2009. These collaboratively-organized centers conduct fundamental research focused on 'grand challenges' and use-inspired 'basic research needs' recently identified in major strategic planning efforts by the scientific community. The overall purpose is to accelerate scientific progress toward meeting the nation's critical energy challenges.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
Applied Physics Research at the Idaho Accelerator Center
International Nuclear Information System (INIS)
Date, D. S.; Hunt, A. W.; Chouffani, K.; Wells, D. P.
2011-01-01
The Idaho Accelerator Center, founded in 1996 and based at Idaho State University, supports research, education, and high technology economic development in the United States. The research center currently has eight electron linear accelerators ranging in energy from 6 to 44 MeV with the latter linear accelerator capable of picosecond pulses, a 2 MeV positive-ion Van de Graaff, a 4 MV Nec tandem Pelletron, and a pulsed-power 8 k A, 10 MeV electron induction accelerator. Current research emphases include, accelerator physics research, accelerator based medical isotope production, active interrogation techniques for homeland security and nuclear nonproliferation applications, non destructive testing and materials science studies in support of industry as well as the development of advanced nuclear fuels, pure and applied radio-biology, and medical physics. This talk will highlight three of these areas including the production of the isotopes 99 Tc and 67 Cu for medical diagnostics and therapy, as well as two new technologies currently under development for nuclear safeguards and homeland security - namely laser Compton scattering and the polarized photofission of actinides
Center for Urban Environmental Research and Education (CUERE)
Federal Laboratory Consortium — The Center for Urban Environmental Research and Education (CUERE) at UMBC was created in 2001 with initial support from the U.S. Environmental Protection Agency and...
Research priorities for a multi-center child abuse pediatrics network - CAPNET.
Lindberg, Daniel M; Wood, Joanne N; Campbell, Kristine A; Scribano, Philip V; Laskey, Antoinette; Leventhal, John M; Pierce, Mary Clyde; Runyan, Desmond K
2017-03-01
Although child maltreatment medical research has benefited from several multi-center studies, the new specialty of child abuse pediatrics has not had a sustainable network capable of pursuing multiple, prospective, clinically-oriented studies. The Child Abuse Pediatrics Network (CAPNET) is a new multi-center research network dedicated to child maltreatment medical research. In order to establish a relevant, practical research agenda, we conducted a modified Delphi process to determine the topic areas with highest priority for such a network. Research questions were solicited from members of the Ray E. Helfer Society and study authors and were sorted into topic areas. These topic areas were rated for priority using iterative rounds of ratings and in-person meetings. The topics rated with the highest priority were missed diagnosis and selected/indicated prevention. This agenda can be used to target future multi-center child maltreatment medical research. Copyright © 2017 Elsevier Ltd. All rights reserved.
48 CFR 1335.017 - Federal funded research and development centers.
2010-10-01
... OF COMMERCE SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 1335.017 Federal funded research and development centers. ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Federal funded research...
Staff Scientist - RNA Bioinformatics | Center for Cancer Research
The newly established RNA Biology Laboratory (RBL) at the Center for Cancer Research (CCR), National Cancer Institute (NCI), National Institutes of Health (NIH) in Frederick, Maryland is recruiting a Staff Scientist with strong expertise in RNA bioinformatics to join the Intramural Research Program’s mission of high impact, high reward science. The RBL is the equivalent of an
A RESEARCH REPORT ON OPERATIONAL PLANS FOR DEVELOPING REGIONAL EDUCATIONAL MEDIA RESEARCH CENTERS.
CARPENTER, C.R.; AND OTHERS
THE NEED AND FEASIBILITY OF ESTABLISHING A NUMBER OF "REGIONAL EDUCATIONAL MEDIA RESEARCH CENTERS WITH A PROGRAMMATIC ORIENTATION" WERE INVESTIGATED. A PLANNING GROUP WAS ESTABLISHED TO SERVE AS A STEERING COMMITTEE. CONFERENCES IN WHICH GROUPS IN RESEARCH AND EDUCATION IN WIDELY DISTRIBUTED REGIONS OF THE COUNTRY PARTICIPATED WERE HELD…
Northwest Hazardous Waste Research, Development, and Demonstration Center: Program Plan
International Nuclear Information System (INIS)
1988-02-01
The Northwest Hazardous Waste Research, Development, and Demonstration Center was created as part of an ongoing federal effort to provide technologies and methods that protect human health and welfare and environment from hazardous wastes. The Center was established by the Superfund Amendments and Reauthorization Act (SARA) to develop and adapt innovative technologies and methods for assessing the impacts of and remediating inactive hazardous and radioactive mixed-waste sites. The Superfund legislation authorized $10 million for Pacific Northwest Laboratory to establish and operate the Center over a 5-year period. Under this legislation, Congress authorized $10 million each to support research, development, and demonstration (RD and D) on hazardous and radioactive mixed-waste problems in Idaho, Montana, Oregon, and Washington, including the Hanford Site. In 1987, the Center initiated its RD and D activities and prepared this Program Plan that presents the framework within which the Center will carry out its mission. Section 1.0 describes the Center, its mission, objectives, organization, and relationship to other programs. Section 2.0 describes the Center's RD and D strategy and contains the RD and D objectives, priorities, and process to be used to select specific projects. Section 3.0 contains the Center's FY 1988 operating plan and describes the specific RD and D projects to be carried out and their budgets and schedules. 9 refs., 18 figs., 5 tabs
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition
2014-07-09
The Assistant Secretary for Special Education and Rehabilitative Services announces a priority under the Disability and Rehabilitation Research Projects and Centers Program administered by the National Institute on Disability and Rehabilitation Research (NIDRR). Specifically, we announce a priority for a Rehabilitation Engineering Research Center (RERC) on Improving the Accessibility, Usability, and Performance of Technology for Individuals who are Deaf or Hard of Hearing. The Assistant Secretary may use this priority for competitions in fiscal year (FY) 2014 and later years. We take this action to focus research attention on an area of national need. We intend the priority to contribute to improving the accessibility, usability, and performance of technology for individuals who are deaf or hard of hearing.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
Qualitative Methods in Patient-Centered Outcomes Research.
Vandermause, Roxanne; Barg, Frances K; Esmail, Laura; Edmundson, Lauren; Girard, Samantha; Perfetti, A Ross
2017-02-01
The Patient-Centered Outcomes Research Institute (PCORI), created to fund research guided by patients, caregivers, and the broader health care community, offers a new research venue. Many (41 of 50) first funded projects involved qualitative research methods. This study was completed to examine the current state of the science of qualitative methodologies used in PCORI-funded research. Principal investigators participated in phenomenological interviews to learn (a) how do researchers using qualitative methods experience seeking funding for, implementing and disseminating their work; and (b) how may qualitative methods advance the quality and relevance of evidence for patients? Results showed the experience of doing qualitative research in the current research climate as "Being a bona fide qualitative researcher: Staying true to research aims while negotiating challenges," with overlapping patterns: (a) researching the elemental, (b) expecting surprise, and (c) pushing boundaries. The nature of qualitative work today was explicitly described and is rendered in this article.
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
An Overview of the Antenna Measurement Facilities at the NASA Glenn Research Center
Lambert, Kevin M.; Anzic, Godfrey; Zakrajsek, Robert J.; Zaman, Afroz J.
2002-10-01
For the past twenty years, the NASA Glenn Research Center (formerly Lewis Research Center) in Cleveland, Ohio, has developed and maintained facilities for the evaluation of antennas. This effort has been in support of the work being done at the center in the research and development of space communication systems. The wide variety of antennas that have been considered for these systems resulted in a need for several types of antenna ranges at the Glenn Research Center. Four ranges, which are part of the Microwave Systems Laboratory, are the responsibility of the staff of the Applied RF Technology Branch. A general description of these ranges is provided in this paper.
Electron Microscopist | Center for Cancer Research
PROGRAM DESCRIPTION The Cancer Research Technology Program (CRTP) develops and implements emerging technology, cancer biology expertise and research capabilities to accomplish NCI research objectives. The CRTP is an outward-facing, multi-disciplinary hub purposed to enable the external cancer research community and provides dedicated support to NCI’s intramural Center for Cancer Research (CCR). The dedicated units provide electron microscopy, protein characterization, protein expression, optical microscopy and genetics. These research efforts are an integral part of CCR at the Frederick National Laboratory for Cancer Research (FNLCR). CRTP scientists also work collaboratively with intramural NCI investigators to provide research technologies and expertise. KEY ROLES/RESPONSIBILITIES - THIS POSITION IS CONTINGENT UPON FUNDING APPROVAL The Electron Microscopist will: Operate ultramicrotomes (Leica) and other instrumentation related to the preparation of embedded samples for EM (TEM and SEM) Operate TEM microscopes, (specifically Hitachi, FEI T20 and FEI T12) as well as SEM microscopes (Hitachi); task will include loading samples, screening, and performing data collection for a variety of samples: from cells to proteins Manage maintenance for the TEM and SEM microscopes Provide technical advice to investigators on sample preparation and data collection
National Research Council Canada - National Science Library
Woods, William; Mittal, Anu; Neumann, John; Williams, Cheryl; Candon, Sharron; Sterling, Suzanne; Wade, Jacqueline; Zwanzig, Peter
2008-01-01
.... FFRDCs -- including laboratories, studies and analyses centers, and systems engineering centers -- conduct research in military space programs, nanotechnology, microelectronics, nuclear warfare...
Present status and future plans of the National Atomic Research Center of Malaysia
International Nuclear Information System (INIS)
Rashid, N.K.
1980-01-01
The Malaysian Atomic Research Center (PUSPATI) was established in 1972 and operates under the Ministry of Science, Technology and the Environment. It is the first research center of this kind in Malaysia. Some of the objectives of this center are: operation and maintenance of the research reactor; research and development in reactor science and technology; production of short-lived radioisotopes for use in medicine, agriculture and industry; coordination of the utilization of the reactor and its experimental facilities among the various research institutes and universities; training in nuclear radiation field; personnel monitoring and environmental surveillance
Applied high-speed imaging for the icing research program at NASA Lewis Research Center
Slater, Howard; Owens, Jay; Shin, Jaiwon
1992-01-01
The Icing Research Tunnel at NASA Lewis Research Center provides scientists a scaled, controlled environment to simulate natural icing events. The closed-loop, low speed, refrigerated wind tunnel offers the experimental capability to test for icing certification requirements, analytical model validation and calibration techniques, cloud physics instrumentation refinement, advanced ice protection systems, and rotorcraft icing methodology development. The test procedures for these objectives all require a high degree of visual documentation, both in real-time data acquisition and post-test image processing. Information is provided to scientific, technical, and industrial imaging specialists as well as to research personnel about the high-speed and conventional imaging systems will be on the recent ice protection technology program. Various imaging examples for some of the tests are presented. Additional imaging examples are available from the NASA Lewis Research Center's Photographic and Printing Branch.
Using curriculum vitae to compare some impacts of NSF research grants with research center funding
Monica Gaughan; Barry Bozeman
2002-01-01
While traditional grants remain central in US federal support of academic scientists and engineers, the role of multidisciplinary NSF Centers is growing. Little is known about how funding through these Centers affects scientific output or (as is an NSF aim) increases academic collaboration with industry. This paper tests the use of CVs to examine how Center funding affects researchers' publication rates and their obtaining industry grants. Copyright , Beech Tree Publishing.
Scientist, Single Cell Analysis Facility | Center for Cancer Research
The Cancer Research Technology Program (CRTP) develops and implements emerging technology, cancer biology expertise and research capabilities to accomplish NCI research objectives. The CRTP is an outward-facing, multi-disciplinary hub purposed to enable the external cancer research community and provides dedicated support to NCI’s intramural Center for Cancer Research (CCR). The dedicated units provide electron microscopy, protein characterization, protein expression, optical microscopy and nextGen sequencing. These research efforts are an integral part of CCR at the Frederick National Laboratory for Cancer Research (FNLCR). CRTP scientists also work collaboratively with intramural NCI investigators to provide research technologies and expertise. KEY ROLES AND RESPONSIBILITIES We are seeking a highly motivated Scientist II to join the newly established Single Cell Analysis Facility (SCAF) of the Center for Cancer Research (CCR) at NCI. The SCAF will house state of the art single cell sequencing technologies including 10xGenomics Chromium, BD Genomics Rhapsody, DEPPArray, and other emerging single cell technologies. The Scientist: Will interact with close to 200 laboratories within the CCR to design and carry out single cell experiments for cancer research Will work on single cell isolation/preparation from various tissues and cells and related NexGen sequencing library preparation Is expected to author publications in peer reviewed scientific journals
AHPCRC (Army High Performance Computing Research Center) Bulletin. Volume 1, Issue 2
2011-01-01
area and the researchers working on these projects. Also inside: news from the AHPCRC consortium partners at Morgan State University and the NASA ...Computing Research Center is provided by the supercomputing and research facilities at Stanford University and at the NASA Ames Research Center at...atomic and molecular level, he said. He noted that “every general would like to have” a Star Trek -like holodeck, where holographic avatars could
Palmer, C. L.; Mayernik, M. S.; Weber, N.; Baker, K. S.; Kelly, K.; Marlino, M. R.; Thompson, C. A.
2013-12-01
The need for data curation is being recognized in numerous institutional settings as national research funding agencies extend data archiving mandates to cover more types of research grants. Data curation, however, is not only a practical challenge. It presents many conceptual and theoretical challenges that must be investigated to design appropriate technical systems, social practices and institutions, policies, and services. This presentation reports on outcomes from an investigation of research problems in data curation conducted as part of the Data Curation Education in Research Centers (DCERC) program. DCERC is developing a new model for educating data professionals to contribute to scientific research. The program is organized around foundational courses and field experiences in research and data centers for both master's and doctoral students. The initiative is led by the Graduate School of Library and Information Science at the University of Illinois at Urbana-Champaign, in collaboration with the School of Information Sciences at the University of Tennessee, and library and data professionals at the National Center for Atmospheric Research (NCAR). At the doctoral level DCERC is educating future faculty and researchers in data curation and establishing a research agenda to advance the field. The doctoral seminar, Research Problems in Data Curation, was developed and taught in 2012 by the DCERC principal investigator and two doctoral fellows at the University of Illinois. It was designed to define the problem space of data curation, examine relevant concepts and theories related to both technical and social perspectives, and articulate research questions that are either unexplored or under theorized in the current literature. There was a particular emphasis on the Earth and environmental sciences, with guest speakers brought in from NCAR, National Snow and Ice Data Center (NSIDC), and Rensselaer Polytechnic Institute. Through the assignments, students
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Research Summaries: The 11th Biennial Rivkin Center Ovarian Cancer Research Symposium.
Armstrong, Deborah K
2017-11-01
In September 2016, the 11th biennial ovarian cancer research symposium was presented by the Rivkin Center for Ovarian Cancer and the American Association for Cancer Research. The 2016 symposium focused on 4 broad areas of research: Mechanisms of Initiation and Progression of Ovarian Cancer, Tumor Microenvironment and Models of Ovarian Cancer, Detection and Prevention of Ovarian Cancer, and Novel Therapeutics for Ovarian Cancer. The presentations and abstracts from each of these areas are reviewed in this supplement to the International Journal of Gynecologic Oncology.
48 CFR 3035.017 - Federally Funded Research and Development Centers.
2010-10-01
... CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING Scope of Part 3035.017 Federally Funded Research and... use of Federally Funded Research and Development Centers (FFRDCs) in (FAR) 48 CFR 35.017. [71 FR 25771... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Federally Funded Research...
After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.
Creager, Angela N H; Morgan, Gregory J
2008-06-01
Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.
75 FR 59720 - Methodology Committee of the Patient-Centered Outcomes Research Institute (PCORI)
2010-09-28
... GOVERNMENT ACCOUNTABILITY OFFICE Methodology Committee of the Patient-Centered Outcomes Research... responsibility for appointing not more than 15 members to a Methodology Committee of the Patient- Centered Outcomes Research Institute. In addition, the Directors of the Agency for Healthcare Research and Quality...
34 CFR 350.30 - What requirements must a Rehabilitation Engineering Research Center meet?
2010-07-01
... 34 Education 2 2010-07-01 2010-07-01 false What requirements must a Rehabilitation Engineering... DISABILITY AND REHABILITATION RESEARCH PROJECTS AND CENTERS PROGRAM What Rehabilitation Engineering Research Centers Does the Secretary Assist? § 350.30 What requirements must a Rehabilitation Engineering Research...
List of scientific publications, Nuclear Research Center Karlsruhe 1984
International Nuclear Information System (INIS)
1985-04-01
The report abstracted contains a list of works published in 1984. Papers not in print yet are listed separately. Patent entries take account of all patent rights granted or published in 1984, i.e. patents or patent specifications. The list of publications is classified by institutes. The project category lists but the respective reports and studies carried out and published by members of the project staff concerned. Also listed are publications related to research and development projects of the 'product engineering project' (PFT/Projekt 'Fertigungstechnik'). With different companies and institutes cooperating, PFT is sponsored by Nuclear Research Center Karlsruhe GmbH. The latter is also responsible for printing above publications. Moreover the list contains the publications of a branch of the Bundesforschungsanstalt fuer Ernaehrung which is located on the KfK-premises. The final chapter of the list summarizes publications dealing with guest-experiments and research at Nuclear Research Center Karlsruhe. (orig./PW) [de
Directory of Open Access Journals (Sweden)
Carme Ferré-Grau
2008-03-01
Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with
The Strategic Electrochemical Research Center in Denmark
DEFF Research Database (Denmark)
Mogensen, Mogens Bjerg; Hansen, Karin Vels
2011-01-01
A 6-year strategic electrochemistry research center (SERC) in fundamental and applied aspects of electrochemical cells with a main emphasis on solid oxide cells was started in Denmark on January 1st, 2007 in cooperation with other Danish and Swedish Universities. Furthermore, 8 Danish companies...... are presented. ©2011 COPYRIGHT ECS - The Electrochemical Society...
Developmental Scientist | Center for Cancer Research
PROGRAM DESCRIPTION Within the Leidos Biomedical Research Inc.’s Clinical Research Directorate, the Clinical Monitoring Research Program (CMRP) provides high-quality comprehensive and strategic operational support to the high-profile domestic and international clinical research initiatives of the National Cancer Institute (NCI), National Institute of Allergy and Infectious Diseases (NIAID), Clinical Center (CC), National Institute of Heart, Lung and Blood Institute (NHLBI), National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS), National Center for Advancing Translational Sciences (NCATS), National Institute of Neurological Disorders and Stroke (NINDS), and the National Institute of Mental Health (NIMH). Since its inception in 2001, CMRP’s ability to provide rapid responses, high-quality solutions, and to recruit and retain experts with a variety of backgrounds to meet the growing research portfolios of NCI, NIAID, CC, NHLBI, NIAMS, NCATS, NINDS, and NIMH has led to the considerable expansion of the program and its repertoire of support services. CMRP’s support services are strategically aligned with the program’s mission to provide comprehensive, dedicated support to assist National Institutes of Health researchers in providing the highest quality of clinical research in compliance with applicable regulations and guidelines, maintaining data integrity, and protecting human subjects. For the scientific advancement of clinical research, CMRP services include comprehensive clinical trials, regulatory, pharmacovigilance, protocol navigation and development, and programmatic and project management support for facilitating the conduct of 400+ Phase I, II, and III domestic and international trials on a yearly basis. These trials investigate the prevention, diagnosis, treatment of, and therapies for cancer, influenza, HIV, and other infectious diseases and viruses such as hepatitis C, tuberculosis, malaria, and Ebola virus; heart, lung, and
The Towers Watson Approach to Improving Corporate Wellness.
Wootton, Adam
2012-06-01
Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.
Nuclear Criticality Experimental Research Center (NCERC) Overview
Energy Technology Data Exchange (ETDEWEB)
Goda, Joetta Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Grove, Travis Justin [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hayes, David Kirk [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Myers, William L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sanchez, Rene Gerardo [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-03-03
The mission of the National Criticality Experiments Research Center (NCERC) at the Device Assembly Facility (DAF) is to conduct experiments and training with critical assemblies and fissionable material at or near criticality in order to explore reactivity phenomena, and to operate the assemblies in the regions from subcritical through delayed critical. One critical assembly, Godiva-IV, is designed to operate above prompt critical. The Nuclear Criticality Experimental Research Center (NCERC) is our nation’s only general-purpose critical experiments facility and is only one of a few that remain operational throughout the world. This presentation discusses the history of NCERC, the general activities that makeup work at NCERC, and the various government programs and missions that NCERC supports. Recent activities at NCERC will be reviewed, with a focus on demonstrating how NCERC meets national security mission goals using engineering fundamentals. In particular, there will be a focus on engineering theory and design and applications of engineering fundamentals at NCERC. NCERC activities that relate to engineering education will also be examined.
Waste management at the Karlsruhe Nuclear Research Center
International Nuclear Information System (INIS)
Hoehlein, G.; Lins, W.
1982-01-01
In the Karlsruhe Nuclear Research Center the responsibility for waste management is concentrated in the Decontamination Department which serves to collect and transport all liquid waste and solid material from central areas in the center for further waste treatment, clean radioactive equipment for repair and re-use or for recycling of material, remove from the liquid effluents any radioactive and chemical pollutants as specified in legislation on the protection of waters, convert radioactive wastes into mechanically and chemically stable forms allowing them to be transported into a repository. (orig./RW)
Progress report of Cekmece Nuclear Research and Training Center for 1981
International Nuclear Information System (INIS)
1982-01-01
Presented are the research works carried out in 1981 in Energy, Radiological Safety, Radioisotope, Application of Nuclear Techniques and Basic Research of Cekmece Nuclear Research and Training Center. (author)
Research Centers & Consortia | College of Engineering & Applied Science
Academics Admission Student Life Research Schools & Colleges Libraries Athletics Centers & ; Applied Science Powerful Ideas. Proven Results. Search for: Go This site All UWM Search Site Menu Skip to content Academics Undergraduate Programs Majors Minors Integrated Bachelor/Master Degree Applied Computing
Cancer Center Clinic and Research Team Perceptions of Identity and Interactions.
Reimer, Torsten; Lee, Simon J Craddock; Garcia, Sandra; Gill, Mary; Duncan, Tobi; Williams, Erin L; Gerber, David E
2017-12-01
Conduct of cancer clinical trials requires coordination and cooperation among research and clinic teams. Diffusion of and confusion about responsibility may occur if team members' perceptions of roles and objectives do not align. These factors are critical to the success of cancer centers but are poorly studied. We developed a survey adapting components of the Adapted Team Climate Inventory, Measure of Team Identification, and Measure of In-Group Bias. Surveys were administered to research and clinic staff at a National Cancer Institute-designated comprehensive cancer center. Data were analyzed using descriptive statistics, t tests, and analyses of variance. Responses were received from 105 staff (clinic, n = 55; research, n = 50; 61% response rate). Compared with clinic staff, research staff identified more strongly with their own group ( P teams, we also identified key differences, including perceptions of goal clarity and sharing, understanding and alignment with cancer center goals, and importance of outcomes. Future studies should examine how variation in perceptions and group dynamics between clinic and research teams may impact function and processes of cancer care.
Tennessee Valley Authority National Fertilizer and Environmental Research Center
International Nuclear Information System (INIS)
Gautney, J.
1991-01-01
The National Fertilizer and Environmental Research Center (NFERC) is a unique part of the Tennessee Valley Authority (TVA), a government agency created by an Act of Congress in 1933. The Center, located in Muscle Shoals, Alabama, is a national laboratory for research, development, education and commercialization for fertilizers and related agricultural chemicals including their economic and environmentally safe use, renewable fuel and chemical technologies, alternatives for solving environmental/waste problems, and technologies which support national defense- NFERC projects in the pesticide waste minimization/treatment/disposal areas include ''Model Site Demonstrations and Site Assessments,'' ''Development of Waste Treatment and Site Remediation Technologies for Fertilizer/Agrichemical Dealers,'' ''Development of a Dealer Information/Education Program,'' and ''Constructed Wetlands.''
Overview of Dynamics Integration Research (DIR) program at Langley Research Center
Sliwa, Steven M.; Abel, Irving
1989-01-01
Research goals and objectives for an ongoing activity at Langley Research Center (LaRC) are described. The activity is aimed principally at dynamics optimization for aircraft. The effort involves active participation by the Flight Systems, Structures, and Electronics directorates at LaRC. The Functional Integration Technology (FIT) team has been pursuing related goals since 1985. A prime goal has been the integration and optimization of vehicle dynamics through collaboration at the basic principles or equation level. Some significant technical progress has been accomplished since then and is reflected here. An augmentation for this activity, Dynamics Integration Research (DIR), has been proposed to NASA Headquarters and is being considered for funding in FY 1990 or FY 1991.
DeCarlo, S.; Potemra, J. T.; Wang, K.
2012-12-01
The International Pacific Research Center (IPRC) at the University of Hawaii maintains a data center for climate studies called the Asia-Pacific Data-Research Center (APDRC). This data center was designed within a center of excellence in climate research with the intention of serving the needs of the research scientist. The APDRC provides easy access to a wide collection of climate data and data products for a wide variety of users. The data center maintains an archive of approximately 100 data sets including in-situ and remote data, as well as a range of model-based output. All data are available via on-line browsing tools such as a Live Access Server (LAS) and DChart, and direct binary access is available through OPeNDAP services. On-line tutorials on how to use these services are now available. Users can keep up-to-date with new data and product announcements via the APDRC facebook page. The main focus of the APDRC has been climate scientists, and the services are therefore streamlined to such users, both in the number and types of data served, but also in the way data are served. In addition, due to the integration of the APDRC within the IPRC, several value-added data products (see figure for an example using Argo floats) have been developed via a variety of research activities. The APDRC, therefore, has three main foci: 1. acquisition of climate-related data, 2. maintenance of integrated data servers, and 3. development and distribution of data products The APDRC can be found at http://apdrc.soest.hawaii.edu. The presentation will provide an overview along with specific examples of the data, data products and data services available at the APDRC.; APDRC product example: gridded field from Argo profiling floats
Assessment team report on flight-critical systems research at NASA Langley Research Center
Siewiorek, Daniel P. (Compiler); Dunham, Janet R. (Compiler)
1989-01-01
The quality, coverage, and distribution of effort of the flight-critical systems research program at NASA Langley Research Center was assessed. Within the scope of the Assessment Team's review, the research program was found to be very sound. All tasks under the current research program were at least partially addressing the industry needs. General recommendations made were to expand the program resources to provide additional coverage of high priority industry needs, including operations and maintenance, and to focus the program on an actual hardware and software system that is under development.
Cambell, T. G.; Bailey, M. C.; Cockrell, C. R.; Beck, F. B.
1983-01-01
The electromagnetic analysis activities at the Langley Research Center are resulting in efficient and accurate analytical methods for predicting both far- and near-field radiation characteristics of large offset multiple-beam multiple-aperture mesh reflector antennas. The utilization of aperture integration augmented with Geometrical Theory of Diffraction in analyzing the large reflector antenna system is emphasized.
Cooperative research with CHECIR (CHErnobyl Center for International Research)
International Nuclear Information System (INIS)
Nagaoka, T.; Saito, K.; Sakamoto, R.; Tsutsumi, M.; Moriuchi, S.
1994-01-01
The Chernobyl Center for International Research (CHECIR) has been established under an agreement among IAEA. Russia, Byelorussia and Ukraine in order to implement various studies on the reactor facilities and on the environment near and around the reactor. JAERI started discussions with a view to join the idea on the research project of study on assessment and analysis of environmental consequences in contaminated area. On June, 1992, JAERI and CHECIR concluded an agreement on the Implementation of Research at the CHECIR. Under the agreement, JAERI has started 'Study on Assessment and Analysis of Environmental Radiological Consequences and Verification of an Assessment System'. This project is scheduled to last until 1996. This study consists of following two subjects. Subject-1: Study on Measurements and Evaluation of Environmental External Exposure after Nuclear Accident. Subject-2: Study on the Validation of Assessment Models in an Environmental Consequence Assessment Methodology for Nuclear Accidents. Subject-3: Study on Migration of Radionuclides Released into Rivers adjacent to the Chernobyl Nuclear Power Plant (planned to start from FY1994). In this workshop, research activity will be introduced with actually measured data. (J.P.N.)
Ku, Joy P; Hicks, Jennifer L; Hastie, Trevor; Leskovec, Jure; Ré, Christopher; Delp, Scott L
2015-11-01
Regular physical activity helps prevent heart disease, stroke, diabetes, and other chronic diseases, yet a broad range of conditions impair mobility at great personal and societal cost. Vast amounts of data characterizing human movement are available from research labs, clinics, and millions of smartphones and wearable sensors, but integration and analysis of this large quantity of mobility data are extremely challenging. The authors have established the Mobilize Center (http://mobilize.stanford.edu) to harness these data to improve human mobility and help lay the foundation for using data science methods in biomedicine. The Center is organized around 4 data science research cores: biomechanical modeling, statistical learning, behavioral and social modeling, and integrative modeling. Important biomedical applications, such as osteoarthritis and weight management, will focus the development of new data science methods. By developing these new approaches, sharing data and validated software tools, and training thousands of researchers, the Mobilize Center will transform human movement research. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association.
Directory of Open Access Journals (Sweden)
Ingrid Meireles Gomes
2013-09-01
Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.
San Joaquin Valley Aerosol Health Effects Research Center (SAHERC)
Federal Laboratory Consortium — At the San Joaquin Valley Aerosol Health Effects Center, located at the University of California-Davis, researchers will investigate the properties of particles that...
Meharry-Johns Hopkins Center for Prostate Cancer Research
2015-11-01
formerly at the Institute for Health, Social, and Community Research (IHSCR) Center for Survey Research ( CSR ) at Shaw University in Raleigh, NC...survey will be conducted at CSR which is now located at Johns Hopkins Bloomberg School of Public Health (JHBSPH) located in Raleigh, NC. The Sons...the strategy to contact sons for whom she had no address or phone number. It was hoped that the father will notify the son to contact the study
Double Star Research: A Student-Centered Community of Practice
Johnson, Jolyon
2016-06-01
Project and team-based pedagogies are increasingly augmenting lecture-style science classrooms. Occasionally, university professors will invite students to tangentially partcipate in their research. Since 2006, Dr. Russ Genet has led an astronomy research seminar for community college and high school students that allows participants to work closely with a melange of professional and advanced amatuer researchers. The vast majority of topics have centered on measuring the position angles and searations of double stars which can be readily published in the Journal of Double Star Observations. In the intervening years, a collaborative community of practice (Wenger, 1998) formed with the students as lead researchers on their projects with the guidance of experienced astronomers and educators. The students who join the research seminar are often well prepared for further STEM education in college and career. Today, the research seminar involves multile schools in multiple states with a volunteer educator acting as an assistant instructor at each location. These assistant instructors interface with remote observatories, ensure progress is made, and recruit students. The key deliverables from each student team include a published research paper and a public presentation online or in-person. Citing a published paper on scholarship and college applications gives students' educational carreers a boost. Recently the Journal of Double Star Observations published its first special issue of exlusively student-centered research.
SNU-KAERI Degree and Research Center for Radiation Convergence Sciences
International Nuclear Information System (INIS)
Jo, Sungkee; Kim, S. U.; Roh, C. H
2011-12-01
In this study, we tried to establish and perform the demonstrative operation of the 'Degree and Research Center for Radiation Convergence Sciences' to raise the Korea's technology competitiveness. As results of this project we got the successful accomplishment as below: 1. Operation of Degree and Research Center for Radiation Convergence Sciences and establishment of expert researcher training system Ο Presentation of an efficient model for expert researcher training program through the operation of university-institute collaboration courses by combining of Graduate course and DRC system. Ο Radiation Convergence Sciences major is scheduled to be established in 2013 at SNU Graduate School of Convergence Science and Technology Ο A big project for research, education, and training of radiation convergence science is under planning 2. Establishment and conduction of joint research by organization of radiation convergence research consortium · Joint research was conducted in close connection with the research projects of researchers participating in this DRC project (44 articles published in journals, 6 patents applied, 88 papers presented in conferences) · The resources of the two organization (SNU and KAERI), such as research infrastructure (hightech equipment and etc), manpower (professor/researcher), and original technology and know how were utilized to conduct the joint research and to establish the collaboration system of the two organizations
Patient Care Coordinator | Center for Cancer Research
PROGRAM DESCRIPTION Within the Leidos Biomedical Research Inc.’s Clinical Research Directorate, the Clinical Monitoring Research Program (CMRP) provides high-quality comprehensive and strategic operational support to the high-profile domestic and international clinical research initiatives of the National Cancer Institute (NCI), National Institute of Allergy and Infectious Diseases (NIAID), Clinical Center (CC), National Institute of Heart, Lung and Blood Institute (NHLBI), National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS), National Center for Advancing Translational Sciences (NCATS), National Institute of Neurological Disorders and Stroke (NINDS), and the National Institute of Mental Health (NIMH). Since its inception in 2001, CMRP’s ability to provide rapid responses, high-quality solutions, and to recruit and retain experts with a variety of backgrounds to meet the growing research portfolios of NCI, NIAID, CC, NHLBI, NIAMS, NCATS, NINDS, and NIMH has led to the considerable expansion of the program and its repertoire of support services. CMRP’s support services are strategically aligned with the program’s mission to provide comprehensive, dedicated support to assist National Institutes of Health researchers in providing the highest quality of clinical research in compliance with applicable regulations and guidelines, maintaining data integrity, and protecting human subjects. For the scientific advancement of clinical research, CMRP services include comprehensive clinical trials, regulatory, pharmacovigilance, protocol navigation and development, and programmatic and project management support for facilitating the conduct of 400+ Phase I, II, and III domestic and international trials on a yearly basis. These trials investigate the prevention, diagnosis, treatment of, and therapies for cancer, influenza, HIV, and other infectious diseases and viruses such as hepatitis C, tuberculosis, malaria, and Ebola virus; heart, lung, and
Center for modeling of turbulence and transition: Research briefs, 1995
1995-10-01
This research brief contains the progress reports of the research staff of the Center for Modeling of Turbulence and Transition (CMOTT) from July 1993 to July 1995. It also constitutes a progress report to the Institute of Computational Mechanics in Propulsion located at the Ohio Aerospace Institute and the Lewis Research Center. CMOTT has been in existence for about four years. In the first three years, its main activities were to develop and validate turbulence and combustion models for propulsion systems, in an effort to remove the deficiencies of existing models. Three workshops on computational turbulence modeling were held at LeRC (1991, 1993, 1994). At present, CMOTT is integrating the CMOTT developed/improved models into CFD tools which can be used by the propulsion systems community. This activity has resulted in an increased collaboration with the Lewis CFD researchers.
Alpha waste management at the Valduc Research Center
International Nuclear Information System (INIS)
Jouan, A.; Cartier, R.; Durec, J.P.; Flament, T.
1995-01-01
Operation of the reprocessing facilities at the Valduc Research Center of the French Atomic Energy Commission (CEA) generates waste with a variety of characteristics. The waste compatible with surface storage requirements is transferred to the French Radioactive Waste Management Agency (ANDRA); rest is reprocessed under a program which enables storage in compliance with the requirements of permits issued by safety Authorities. The waste reprocessing program provides for the construction of an incinerator capable of handling nearly all of the combustible waste generated by the Center and vitrification facility for treating liquid waste generated by the plutonium handling plant. (authors)
New York can be our nation's center for Alzheimer's research.
Vann, Allan S
2014-09-01
More than 5 million people in this country have Alzheimer's disease, and more than 300,000 of those with Alzheimer's live in New York. By 2025, it is estimated that there will be 350,000 residents living with Alzheimer's in New York. Congressman Steve Israel and New York Assemblyman Charles Lavine issued a joint proposal in June, 2013 suggesting that New York become this country's center for Alzheimer's research. Obviously, they would both like to see increased federal funding, but they also know that we cannot count on that happening. So Israel and Lavine have proposed a $3 billion state bonding initiative to secure sufficient funding to tackle this disease. It would be similar to the bonding initiatives that have made California and Texas this nation's centers for stem cell and cancer research. The bond would provide a dedicated funding stream to support research to find effective means to treat, cure, and eventually prevent Alzheimer's, and fund programs to help people currently dealing with Alzheimer's and their caregivers. New York already has some of the major "ingredients" to make an Alzheimer's bond initiative a success, including 3 of our nation's 29 Alzheimer's Disease Research Centers and some of the finest research facilities in the nation for genetic and neuroscience research. One can only imagine the synergy of having these world class institutions working on cooperative grants and projects with sufficient funding to attract even more world class researchers and scientists to New York to find ways to prevent, treat, and cure Alzheimer's. © The Author(s) 2014.
Aircraft Engine Noise Research and Testing at the NASA Glenn Research Center
Elliott, Dave
2015-01-01
The presentation will begin with a brief introduction to the NASA Glenn Research Center as well as an overview of how aircraft engine noise research fits within the organization. Some of the NASA programs and projects with noise content will be covered along with the associated goals of aircraft noise reduction. Topics covered within the noise research being presented will include noise prediction versus experimental results, along with engine fan, jet, and core noise. Details of the acoustic research conducted at NASA Glenn will include the test facilities available, recent test hardware, and data acquisition and analysis methods. Lastly some of the actual noise reduction methods investigated along with their results will be shown.
Karlsruhe Nuclear Research Center, Central Safety Department. Annual report 1993
International Nuclear Information System (INIS)
Koelzer, W.
1994-04-01
The Central Safety Department is responsible for handling all tasks of radiation protection, safety and security of the institutes and departments of the Karlsruhe Nuclear Research Center, for waste water activity measurements and environmental monitoring of the whole area of the Center, and for research and development work mainly focusing on nuclear safety and radiation protection measures. The research and development work concentrates on the following aspects: behavior of trace elements in the environment and decontamination of soil, behavior of tritium in the air/soil-plant system, improvement in radiation protection measurements and personnel dosimetry. This report gives details of the different duties, indicates the results of 1993 routine tasks and reports about results of investigations and developments of the working groups of the Department. (orig.) [de
Multi-Vehicle Cooperative Control Research at the NASA Armstrong Flight Research Center, 2000-2014
Hanson, Curt
2014-01-01
A brief introductory overview of multi-vehicle cooperative control research conducted at the NASA Armstrong Flight Research Center from 2000 - 2014. Both flight research projects and paper studies are included. Since 2000, AFRC has been almost continuously pursuing research in the areas of formation flight for drag reduction and automated cooperative trajectories. An overview of results is given, including flight experiments done on the FA-18 and with the C-17. Other multi-vehicle cooperative research is discussed, including small UAV swarming projects and automated aerial refueling.
The Creation and Role of the USDA Biomass Research Centers
William F. Anderson; Jeffery Steiner; Randy Raper; Ken Vogel; Terry Coffelt; Brenton Sharratt; Bob Rummer; Robert L. Deal; Alan Rudie
2011-01-01
The Five USDA Biomass Research Centers were created to facilitate coordinated research to enhance the establishment of a sustainable feedstock production for bio-based renewable energy in the United States. Scientists and staff of the Agricultural Research Service (ARS) and Forest Service (FS) within USDA collaborate with other federal agencies, universities and...
International Nuclear Information System (INIS)
Hill, D.J; Braun, J.C; Klickman, A.E.; Bugaenko, S.E; Kabanov, L.P; Kraev, A.G.
2000-01-01
The Russian Federation Ministry for Atomic Energy (MINATOM) and the U.S. Department of Energy (USDOE) have formed International Nuclear Safety Centers to collaborate on nuclear safety research. USDOE established the U. S. Center at Argonne National Laboratory in October 1995. MINATOM established the Russian Center at the Research and Development Institute of Power Engineering in Moscow in July 1996. In April 1998 the Russian center became an independent, autonomous organization under MINATOM. The goals of the centers are to: cooperate in the development of technologies associated with nuclear safety in nuclear power engineering. be international centers for the collection of information important for safety and technical improvements in nuclear power engineering. maintain a base for fundamental knowledge needed to design nuclear reactors.The strategic approach that is being used to accomplish these goals is for the two centers to work together to use the resources and the talents of the scientists associated with the US Center and the Russian Center to do collaborative research to improve the safety of Russian-designed nuclear reactors
The Austrian Research Centers activities in energy risks
International Nuclear Information System (INIS)
Sdouz, Gert
1998-01-01
Among the institutions involved in energy analyses in Austria the risk context is being treated by three different entities: the Energy Consumption Agency, internationally known as EVA, the Federal Environmental Protection Agency, or Urnweltbundesarnt assessing mainly the environmental risks involved and the Austrian Research Centers, working on safety and risk evaluation. The Austrian Research Center Seibersdorf draws form its proficiency in Reactor Safety and Fusion Research, two fields of experience it has been involved in since its foundation, for some 40 years now. Nuclear energy is not well accepted by the Austrian population. Therefore in our country only energy systems with advanced safety level might be accepted in the far future. This means that the development of methods to compare risks is an important task. The characteristics of energy systems featuring advanced safety levels are: A very low hazard potential and a focus on deterministic safety instead of probabilistic safety, meaning to rely on inherently safe physics concepts, confirmed by probabilistic safety evaluation results. This can be achieved by adequate design of fusion reactors, advanced fission reactors and all different renewable sources of energy
Program budget 1992 of the Karlsruhe Nuclear Research Center. As of November 19, 1991
International Nuclear Information System (INIS)
1992-01-01
In the future, the research program of the Nuclear Research Center in Karlsruhe will concentrate on three areas, which are of the same status over the medium term: Environmental research, energy research and micro system technology and fundamental research. The central infrastructure, the financial planning and the assignment of research and development projects of the Nuclear Research Center are presented in tables. (orig./HP) [de
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho
2018-04-01
Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was
The NIH-NIAID Filariasis Research Reagent Resource Center.
Directory of Open Access Journals (Sweden)
Michelle L Michalski
2011-11-01
Full Text Available Filarial worms cause a variety of tropical diseases in humans; however, they are difficult to study because they have complex life cycles that require arthropod intermediate hosts and mammalian definitive hosts. Research efforts in industrialized countries are further complicated by the fact that some filarial nematodes that cause disease in humans are restricted in host specificity to humans alone. This potentially makes the commitment to research difficult, expensive, and restrictive. Over 40 years ago, the United States National Institutes of Health-National Institute of Allergy and Infectious Diseases (NIH-NIAID established a resource from which investigators could obtain various filarial parasite species and life cycle stages without having to expend the effort and funds necessary to maintain the entire life cycles in their own laboratories. This centralized resource (The Filariasis Research Reagent Resource Center, or FR3 translated into cost savings to both NIH-NIAID and to principal investigators by freeing up personnel costs on grants and allowing investigators to divert more funds to targeted research goals. Many investigators, especially those new to the field of tropical medicine, are unaware of the scope of materials and support provided by the FR3. This review is intended to provide a short history of the contract, brief descriptions of the fiilarial species and molecular resources provided, and an estimate of the impact the resource has had on the research community, and describes some new additions and potential benefits the resource center might have for the ever-changing research interests of investigators.
Applied analytical combustion/emissions research at the NASA Lewis Research Center
Deur, J. M.; Kundu, K. P.; Nguyen, H. L.
1992-01-01
Emissions of pollutants from future commercial transports are a significant concern. As a result, the Lewis Research Center (LeRC) is investigating various low emission combustor technologies. As part of this effort, a combustor analysis code development program was pursued to guide the combustor design process, to identify concepts having the greatest promise, and to optimize them at the lowest cost in the minimum time.
Reducing Losses from Wind-Related Natural Perils: Research at the IBHS Research Center
Standohar-Alfano, Christine D.; Estes, Heather; Johnston, Tim; Morrison, Murray J.; Brown-Giammanco, Tanya M.
2017-01-01
The capabilities of the Insurance Institute for Business & Home Safety (IBHS) Research Center full-scale test chamber are described in detail. This research facility allows complete full-scale structures to be tested. Testing at full-scale allows vulnerabilities of structures to be evaluated with fewer assumptions than was previously possible. Testing buildings under realistic elevated wind speeds has the potential to isolate important factors that influence the performance of components, pot...
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
34 CFR 350.31 - What collaboration must a Rehabilitation Engineering Research Center engage in?
2010-07-01
... 34 Education 2 2010-07-01 2010-07-01 false What collaboration must a Rehabilitation Engineering... DISABILITY AND REHABILITATION RESEARCH PROJECTS AND CENTERS PROGRAM What Rehabilitation Engineering Research Centers Does the Secretary Assist? § 350.31 What collaboration must a Rehabilitation Engineering Research...
The Begun Center for Violence Prevention Research and Education at Case Western Reserve University
Flannery, Daniel J.; Singer, Mark I.
2015-01-01
Established in the year 2000, the Begun Center for Violence Prevention Research and Education is a multidisciplinary center located at a school of social work that engages in collaborative, community-based research and evaluation that spans multiple systems and disciplines. The Center currently occupies 4,200 sq. ft. with multiple offices and…
Spadaro, Antonia J; Grunbaum, Jo Anne; Dawkins, Nicola U; Wright, Demia S; Rubel, Stephanie K; Green, Diane C; Simoes, Eduardo J
2011-05-01
The Centers for Disease Control and Prevention has administered the Prevention Research Centers Program since 1986. We quantified the number and reach of training programs across all centers, determined whether the centers' outcomes varied by characteristics of the academic institution, and explored potential benefits of training and technical assistance for academic researchers and community partners. We characterized how these activities enhanced capacity building within Prevention Research Centers and the community. The program office collected quantitative information on training across all 33 centers via its Internet-based system from April through December 2007. Qualitative data were collected from April through May 2007. We selected 9 centers each for 2 separate, semistructured, telephone interviews, 1 on training and 1 on technical assistance. Across 24 centers, 4,777 people were trained in 99 training programs in fiscal year 2007 (October 1, 2006-September 30, 2007). Nearly 30% of people trained were community members or agency representatives. Training and technical assistance activities provided opportunities to enhance community partners' capacity in areas such as conducting needs assessments and writing grants and to improve the centers' capacity for cultural competency. Both qualitative and quantitative data demonstrated that training and technical assistance activities can foster capacity building and provide a reciprocal venue to support researchers' and the community's research interests. Future evaluation could assess community and public health partners' perception of centers' training programs and technical assistance.
Energy Technology Data Exchange (ETDEWEB)
Hules, J. [ed.
1996-11-01
National Energy Research Scientific Computing Center (NERSC) provides researchers with high-performance computing tools to tackle science`s biggest and most challenging problems. Founded in 1974 by DOE/ER, the Controlled Thermonuclear Research Computer Center was the first unclassified supercomputer center and was the model for those that followed. Over the years the center`s name was changed to the National Magnetic Fusion Energy Computer Center and then to NERSC; it was relocated to LBNL. NERSC, one of the largest unclassified scientific computing resources in the world, is the principal provider of general-purpose computing services to DOE/ER programs: Magnetic Fusion Energy, High Energy and Nuclear Physics, Basic Energy Sciences, Health and Environmental Research, and the Office of Computational and Technology Research. NERSC users are a diverse community located throughout US and in several foreign countries. This brochure describes: the NERSC advantage, its computational resources and services, future technologies, scientific resources, and computational science of scale (interdisciplinary research over a decade or longer; examples: combustion in engines, waste management chemistry, global climate change modeling).
2010-07-01
... Rehabilitation Engineering Research Center meet? A Rehabilitation Engineering Research Center— (a) Shall... 34 Education 2 2010-07-01 2010-07-01 false What cooperation requirements must a Rehabilitation Engineering Research Center meet? 350.33 Section 350.33 Education Regulations of the Offices of the Department...
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
1989-10-01
Aires, and Philips Laboratory at Briarcliff, NY. B. Cernuschi-Frias is with Facultad de Ingenieria , Universidad de Buenos Aires, Buenos Aires... Ingenieria , Universidad de Buenos Aires, and from IBM (Thomas J. Watson Research Center). David B. Cooper (S’53-M’64) received the B.Sc. and Sc.M
Günlük, O.; Woeginger, G.J.
2011-01-01
This volume contains the 33 papers presented at IPCO 2011, the 15th Conference on Integer Programming and Combinatorial Optimization, held during June 15–17, 2011 at the IBM T.J. Watson Research Center in New York, USA. IPCO conferences are sponsored by the Mathematical Optimization Society. The
Successes of Small Business Innovation Research at NASA Glenn Research Center
Kim, Walter S.; Bitler, Dean W.; Prok, George M.; Metzger, Marie E.; Dreibelbis, Cindy L.; Ganss, Meghan
2002-01-01
This booklet of success stories highlights the NASA Glenn Research Center's accomplishments and successes by the Small Business Innovation Research (SBIR) and Small Business Technology Transfer (STTR) Programs. These success stories are the results of selecting projects that support NASA missions and also have high commercialization potential. Each success story describes the innovation accomplished, commercialization of the technology, and further applications and usages. This booklet emphasizes the integration and incorporation of technologies into NASA missions and other government projects. The company name and the NASA contact person are identified to encourage further usage and application of the SBIR developed technologies and also to promote further commercialization of these products.
Overview of Stirling Technology Research at NASA Glenn Research Center
Wilson, Scott D.; Schifer, Nicholas A.; Williams, Zachary D.; Metscher, Jonathan F.
2016-01-01
Stirling Radioisotope Power Systems (RPSs) are under development to provide power on future space science missions where robotic spacecraft will orbit, fly by, land, or rove using less than a quarter of the plutonium the currently available RPS uses to produce about the same power. NASA Glenn Research Center's newly formulated Stirling Cycle Technology Development Project (SCTDP) continues development of Stirling-based systems and subsystems, which include a flight-like generator and related housing assembly, controller, and convertors. The project also develops less mature technologies under Stirling Technology Research, with a focus on demonstration in representative environments to increase the technology readiness level (TRL). Matured technologies are evaluated for selection in future generator designs. Stirling Technology Research tasks focus on a wide variety of objectives, including increasing temperature capability to enable new environments, reducing generator mass and/or size, improving reliability and system fault tolerance, and developing alternative designs. The task objectives and status are summarized.
Nuclear research center looks for 4000 pressure-cookers
International Nuclear Information System (INIS)
Anon.
2013-01-01
The CEA/Valduc research center has recently made a strange bid for the purchase of 4000 stainless steel pressure-cookers. In fact pressure-cookers are economical containers perfectly fitted for keeping radioactive materials. About 10.000 pressure-cookers have been bought in the last 50 years by CEA/Valduc. (A.C.)
Demonstration-informative center based on research reactor IR-50 in heat regime
International Nuclear Information System (INIS)
Krupenina, Ph.
2000-01-01
Many problems exist in the nuclear field, but the most significant one is the public's mistrust of Nuclear Energy. Strong downfalls of the radiological culture affect public perception, the main paradox being the situation after Chernobyl. The task of creating a Demonstration-Informative Center (Minatom RF) on reactor IR-50 research is conducted by Research and Development Institute of Power Engineering (ENTEK). The IR-50 is situated on the grounds of the institute. It will be a unique event when the functional reactor is situated in the center of the city. The purposes of the Demonstration-Informative Center are discussed. (authors)
Applications of the Galton-Watson process to human DNA evolution and demography
Neves, A G M
2005-01-01
We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...
Bibliometric analysis of poison center-related research published in peer-review journals.
Forrester, M B
2016-07-01
Poison centers advance knowledge in the field of toxicology through publication in peer-review journals. This investigation describes the pattern of poison center-related publications. Cases were poison center-related research published in peer-review journals during 1995-2014. These were identified through searching the PubMed database, reviewing the tables of contents of selected toxicology journals, and reviewing abstracts of various national and international meetings. The following variables for each publication were identified: year of publication, journal, type of publication (meeting abstract vs. other, i.e. full article or letter to the editor), and the country(ies) of the poison center(s) included in the research. Of the 3147 total publications, 62.1% were meeting abstracts. There were 263 publications in 1995-1999, 536 in 2000-2004, 999 in 2005-2009, and 1349 in 2010-2014. The publications were in 234 different journals. The journals in which the highest number of research was published were Clinical Toxicology (69.7%), Journal of Medical Toxicology (2.2%), and Veterinary and Human Toxicology (2.1%). The research was reported from 62 different countries. The countries with the highest number of publications were the United States (67.9%), United Kingdom (6.5%), Germany (3.9%), France (2.5%), and Italy (2.4%). The number of publications increased greatly over the 20 years. Although the publications were in a large number of journals, a high proportion of the publications were in one journal. While the research came from a large number of countries, the preponderance came from the United States. © The Author(s) 2015.
A Survey of Knowledge Management Research & Development at NASA Ames Research Center
Keller, Richard M.; Clancy, Daniel (Technical Monitor)
2002-01-01
This chapter catalogs knowledge management research and development activities at NASA Ames Research Center as of April 2002. A general categorization scheme for knowledge management systems is first introduced. This categorization scheme divides knowledge management capabilities into five broad categories: knowledge capture, knowledge preservation, knowledge augmentation, knowledge dissemination, and knowledge infrastructure. Each of nearly 30 knowledge management systems developed at Ames is then classified according to this system. Finally, a capsule description of each system is presented along with information on deployment status, funding sources, contact information, and both published and internet-based references.
Continuing training program in radiation protection in biological research centers
International Nuclear Information System (INIS)
Escudero, R.; Hidalgo, R.M.; Usera, F.; Macias, M.T.; Mirpuri, E.; Perez, J.; Sanchez, A.
2008-01-01
The use of ionizing radiation in biological research has many specific characteristics. A great variety of radioisotopic techniques involve unsealed radioactive sources, and their use not only carries a risk of irradiation, but also a significant risk of contamination. Moreover, a high proportion of researchers are in training and the labor mobility rate is therefore high. Furthermore, most newly incorporated personnel have little or no previous training in radiological protection, since most academic qualifications do not include training in this discipline. In a biological research center, in addition to personnel whose work is directly associated with the radioactive facility (scientific-technical personnel, operators, supervisors), there are also groups of support personnel The use of ionizing radiation in biological research has many specific characteristics. A great variety of radioisotopic techniques involve unsealed radioactive sources, and their use not only carries a risk of irradiation, but also a significant risk of contamination. Moreover, a high proportion of researchers are in training and the labor mobility rate is therefore high. Furthermore, most newly incorporated personnel have little or no previous training in radiological protection, since most academic qualifications do not include training in this discipline. In a biological research center, in addition to personnel whose work is directly associated with the radioactive facility (scientific-technical personnel, operators, supervisors), there are also groups of support personnel maintenance and instrumentation workers, cleaners, administrative personnel, etc. who are associated with the radioactive facility indirectly. These workers are affected by the work in the radioactive facility to varying degrees, and they therefore also require information and training in radiological protection tailored to their level of interaction with the installation. The aim of this study was to design a
Center of Excellence for Geospatial Information Science research plan 2013-18
Usery, E. Lynn
2013-01-01
The U.S. Geological Survey Center of Excellence for Geospatial Information Science (CEGIS) was created in 2006 and since that time has provided research primarily in support of The National Map. The presentations and publications of the CEGIS researchers document the research accomplishments that include advances in electronic topographic map design, generalization, data integration, map projections, sea level rise modeling, geospatial semantics, ontology, user-centered design, volunteer geographic information, and parallel and grid computing for geospatial data from The National Map. A research plan spanning 2013–18 has been developed extending the accomplishments of the CEGIS researchers and documenting new research areas that are anticipated to support The National Map of the future. In addition to extending the 2006–12 research areas, the CEGIS research plan for 2013–18 includes new research areas in data models, geospatial semantics, high-performance computing, volunteered geographic information, crowdsourcing, social media, data integration, and multiscale representations to support the Three-Dimensional Elevation Program (3DEP) and The National Map of the future of the U.S. Geological Survey.
Implementing multidisciplinary research center infrastructure - A trendsetting example: SUNUM
Birkan, Burak; Özgüz, Volkan Hüsnü; Ozguz, Volkan Husnu
2014-01-01
Sabanci University Nanotechnology Research and Application Center (SUNUM) became operational in January 2012. SUNUM is a trendsetting example of a green and flexible research facility that is a test bed for the cost-effective operation of a Centralized Demand-Controlled Ventilation (CDCV) system, a state-of-the-art cleanroom, and world-class high technology equipment. The total investment in the facility was US$35 million.
Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane
2013-11-01
William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.
International Nuclear Information System (INIS)
Hill, D. J.; Braun, J. C.; Klickman, A. E.; Bougaenko, S. E.; Kabonov, L. P.; Kraev, A. G.
2000-01-01
The Russian Federation Ministry for Atomic Energy (MINATOM) and the US Department of Energy (USDOE) have formed International Nuclear Safety Centers to collaborate on nuclear safety research. USDOE established the US Center (ISINSC) at Argonne National Laboratory (ANL) in October 1995. MINATOM established the Russian Center (RINSC) at the Research and Development Institute of Power Engineering (RDIPE) in Moscow in July 1996. In April 1998 the Russian center became a semi-independent, autonomous organization under MINATOM. The goals of the center are to: Cooperate in the development of technologies associated with nuclear safety in nuclear power engineering; Be international centers for the collection of information important for safety and technical improvements in nuclear power engineering; and Maintain a base for fundamental knowledge needed to design nuclear reactors. The strategic approach is being used to accomplish these goals is for the two centers to work together to use the resources and the talents of the scientists associated with the US Center and the Russian Center to do collaborative research to improve the safety of Russian-designed nuclear reactors. The two centers started conducting joint research and development projects in January 1997. Since that time the following ten joint projects have been initiated: INSC databases--web server and computing center; Coupled codes--Neutronic and thermal-hydraulic; Severe accident management for Soviet-designed reactors; Transient management and advanced control; Survey of relevant nuclear safety research facilities in the Russian Federation; Computer code validation for transient analysis of VVER and RBMK reactors; Advanced structural analysis; Development of a nuclear safety research and development plan for MINATOM; Properties and applications of heavy liquid metal coolants; and Material properties measurement and assessment. Currently, there is activity in eight of these projects. Details on each of these
NDE research at NASA Langley Research Center
International Nuclear Information System (INIS)
Heyman, J.S.
1989-01-01
The Nondestructive Measurement Science Branch at NASA Langley is the Agency's lead Center for NDE research. The focus of the laboratory is to improve the science base for NDE, evolve a more quantitative, interpretable technology to insure safety and reliability, and transfer that technology to the commercial sector. To address the broad needs of the Agency, the program has developed expertise in many areas, some of which are in ultrasonics, nonlinear acoustics, nano and microstructure characterization, thermal NDE, x-ray tomography, optical fiber sensors, magnetic probing, process monitoring sensors, and image/signal processing. The authors laboratory has recently dedicated its new 20,000 square foot research facility bringing the lab space to 30,000 square feet. The new facility includes a high bay for the x-ray CAT scanner, a revolutionary new concept in materials measurement. The CAT scanner is called QUEST, for quantitative experimental stress tomography lab. This system combines for the first time a microfocus x-ray source and detector with a fatigue load frame. Three dimensional imaging of density/geometry of the tested sample is thus possible during tension/compression loading. This system provides the first 3-D view of crack initiation, crack growth, phase transformation, bonded surface failure, creep-all with a density sensitivity of 0.1% and a resolution of about 25 microns (detectability of about 1 micron)
Armstrong Flight Research Center Research Technology and Engineering 2017
Voracek, David F. (Editor)
2018-01-01
I am delighted to present this report of accomplishments at NASA's Armstrong Flight Research Center. Our dedicated innovators possess a wealth of performance, safety, and technical capabilities spanning a wide variety of research areas involving aircraft, electronic sensors, instrumentation, environmental and earth science, celestial observations, and much more. They not only perform tasks necessary to safely and successfully accomplish Armstrong's flight research and test missions but also support NASA missions across the entire Agency. Armstrong's project teams have successfully accomplished many of the nation's most complex flight research projects by crafting creative solutions that advance emerging technologies from concept development and experimental formulation to final testing. We are developing and refining technologies for ultra-efficient aircraft, electric propulsion vehicles, a low boom flight demonstrator, air launch systems, and experimental x-planes, to name a few. Additionally, with our unique location and airborne research laboratories, we are testing and validating new research concepts. Summaries of each project highlighting key results and benefits of the effort are provided in the following pages. Technology areas for the projects include electric propulsion, vehicle efficiency, supersonics, space and hypersonics, autonomous systems, flight and ground experimental test technologies, and much more. Additional technical information is available in the appendix, as well as contact information for the Principal Investigator of each project. I am proud of the work we do here at Armstrong and am pleased to share these details with you. We welcome opportunities for partnership and collaboration, so please contact us to learn more about these cutting-edge innovations and how they might align with your needs.
Refractory Research Group - U.S. DOE, Albany Research Center [Institution Profile
Energy Technology Data Exchange (ETDEWEB)
Bennett, James P.
2004-09-01
The refractory research group at the Albany Research Center (ARC) has a long history of conducting materials research within the U.S. Bureau of Mines, and more recently, within the U.S. Dept. of Energy. When under the U.S. Bureau of Mines, research was driven by national needs to develop substitute materials and to conserve raw materials. This mission was accomplished by improving refractory material properties and/or by recycling refractories using critical and strategic materials. Currently, as a U.S. Dept of Energy Fossil Energy field site, research is driven primarily by the need to assist DOE in meeting its vision to develop economically and environmentally viable technologies for the production of electricity from fossil fuels. Research at ARC impacts this vision by: • Providing information on the performance characteristics of materials being specified for the current generation of power systems; • Developing cost-effective, high performance materials for inclusion in the next generation of fossil power systems; and • Solving environmental emission and waste problems related to fossil energy systems. A brief history of past refractory research within the U.S. Bureau of Mines, the current refractory research at ARC, and the equipment and capabilities used to conduct refractory research at ARC will be discussed.
The Design of HVAC System in the Conventional Facility of Proton Accelerator Research Center
International Nuclear Information System (INIS)
Jeon, G. P.; Kim, J. Y.; Choi, B. H.
2007-01-01
The HVAC systems for conventional facility of Proton Accelerator Research Center consist of 3 systems : accelerator building HVAC system, beam application building HVAC system and miscellaneous HVAC system. We designed accelerator building HVAC system and beam application research area HVAC system in the conventional facilities of Proton Accelerator research center. Accelerator building HVAC system is divided into accelerator tunnel area, klystron area, klystron gallery area, accelerator assembly area. Also, Beam application research area HVAC system is divided into those of beam experimental hall, accelerator control area, beam application research area and Ion beam application building. In this paper, We described system design requirements and explained system configuration for each systems. We presented operation scenario of HVAC system in the Conventional Facility of Proton Accelerator Research Center
Center for Space Transportation and Applied Research Fifth Annual Technical Symposium Proceedings
1993-01-01
This Fifth Annual Technical Symposium, sponsored by the UT-Calspan Center for Space Transportation and Applied Research (CSTAR), is organized to provide an overview of the technical accomplishments of the Center's five Research and Technology focus areas during the past year. These areas include chemical propulsion, electric propulsion, commerical space transportation, computational methods, and laser materials processing. Papers in the area of artificial intelligence/expert systems are also presented.
The Center for Cancer Research’s ability to rapidly deploy integrated basic and clinical research teams at a single site facilitated the rapid FDA approval of the immunotherapy drug avelumab for metastatic Merkel cell carcinoma, a rare, aggressive form of skin cancer. Learn more...
Research and Technology at the John F. Kennedy Space Center 1993
1993-01-01
As the NASA Center responsible for assembly, checkout, servicing, launch, recovery, and operational support of Space Transportation System elements and payloads, the John F. Kennedy Space Center is placing increasing emphasis on its advanced technology development program. This program encompasses the efforts of the Engineering Development Directorate laboratories, most of the KSC operations contractors, academia, and selected commercial industries - all working in a team effort within their own areas of expertise. This edition of the Kennedy Space Center Research and Technology 1993 Annual Report covers efforts of all these contributors to the KSC advanced technology development program, as well as our technology transfer activities. Major areas of research include material science, advanced software, industrial engineering, nondestructive evaluation, life sciences, atmospheric sciences, environmental technology, robotics, and electronics and instrumentation.
Environmental monitoring and research at the John F. Kennedy Space Center
Hall, C. R.; Hinkle, C. R.; Knott, W. M.; Summerfield, B. R.
1992-01-01
The Biomedical Operations and Research Office at the NASA John F. Kennedy Space Center has been supporting environmental monitoring and research since the mid-1970s. Program elements include monitoring of baseline conditions to document natural variability in the ecosystem, assessments of operations and construction of new facilities, and ecological research focusing on wildlife habitat associations. Information management is centered around development of a computerized geographic information system that incorporates remote sensing and digital image processing technologies along with traditional relational data base management capabilities. The proactive program is one in which the initiative is to anticipate potential environmental concerns before they occur and, by utilizing in-house expertise, develop impact minimization or mitigation strategies to reduce environmental risk.
Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...
Physical Measurement Profile at Gilgel Gibe Field Research Center ...
African Journals Online (AJOL)
Physical Measurement Profile at Gilgel Gibe Field Research Center, ... hip circumference in under 35 years and body mass index in under 45 year age groups were ... Comparison with findings in other parts of the world showed that Ethiopians ...
Annual report of Tokyo Metropolitan Isotope Research Center, fiscal year 1994
International Nuclear Information System (INIS)
1995-01-01
This Research Center was founded in 1959, and has carried out the research, test and guidance regarding industry, agriculture and fishry, medical treatment, environment preservation and radiation protection by utilizing the merits of radiation and based on the needs of the age, thus obtained good results. Recently, by the adoption of an ion accelerator, the application to advanced technology such as ion implantation has been tried, and the development of advanced measurement technology using PIXE and RBS has been carried out. In fiscal year 1994, the results have been obtained in the research 'Development of the method of evaluating the nobility of noble metal products by nondestructive inspection'. Also the research on the development of the technology for utilizing the ion accelerator was started. The researches on making radiation breeding of Chinese cabbage efficient and the business of technically supporting the activation of medium and small enterprises were advanced. The history, organization and budget of this Research Center, the reports of research and investigation, safety control, the publication of research, events and others are reported. (K.I.)
Proposed Development of NASA Glenn Research Center's Aeronautical Network Research Simulator
Nguyen, Thanh C.; Kerczewski, Robert J.; Wargo, Chris A.; Kocin, Michael J.; Garcia, Manuel L.
2004-01-01
Accurate knowledge and understanding of data link traffic loads that will have an impact on the underlying communications infrastructure within the National Airspace System (NAS) is of paramount importance for planning, development and fielding of future airborne and ground-based communications systems. Attempting to better understand this impact, NASA Glenn Research Center (GRC), through its contractor Computer Networks & Software, Inc. (CNS, Inc.), has developed an emulation and test facility known as the Virtual Aircraft and Controller (VAC) to study data link interactions and the capacity of the NAS to support Controller Pilot Data Link Communications (CPDLC) traffic. The drawback of the current VAC test bed is that it does not allow the test personnel and researchers to present a real world RF environment to a complex airborne or ground system. Fortunately, the United States Air Force and Navy Avionics Test Commands, through its contractor ViaSat, Inc., have developed the Joint Communications Simulator (JCS) to provide communications band test and simulation capability for the RF spectrum through 18 GHz including Communications, Navigation, and Identification and Surveillance functions. In this paper, we are proposing the development of a new and robust test bed that will leverage on the existing NASA GRC's VAC and the Air Force and Navy Commands JCS systems capabilities and functionalities. The proposed NASA Glenn Research Center's Aeronautical Networks Research Simulator (ANRS) will combine current Air Traffic Control applications and physical RF stimulation into an integrated system capable of emulating data transmission behaviors including propagation delay, physical protocol delay, transmission failure and channel interference. The ANRS will provide a simulation/stimulation tool and test bed environment that allow the researcher to predict the performance of various aeronautical network protocol standards and their associated waveforms under varying
University of Washington Center for Child Environmental Health Risks Research
Federal Laboratory Consortium — The theme of the University of Washington based Center for Child Environmental Health Risks Research (CHC) is understanding the biochemical, molecular and exposure...
Energy Technology Data Exchange (ETDEWEB)
Brown, G.Z.
1990-01-01
This research program addresses the need to increase the energy efficiency of industrialized housing. Two research centers have responsibility for the program: the Center for Housing Innovation at the University of Oregon and the Florida Solar Energy Center, a research institute of the University of Central Florida. The two organizations provide complementary architectural, systems engineering, and industrial engineering capabilities. In 1989 we worked on these tasks: (1) the formation of a steering committee, (2) the development of a multiyear research plan, (3) analysis of the US industrialized housing industry, (4) assessment of foreign technology, (5) assessment of industrial applications, (6) analysis of computerized design and evaluation tools, and (7) assessment of energy performance of baseline and advanced industrialized housing concepts. The current research program, under the guidance of a steering committee composed of industry and government representatives, focuses on three interdependent concerns -- (1) energy, (2) industrial process, and (3) housing design. Building homes in a factory offers the opportunity to increase energy efficiency through the use of new materials and processes, and to increase the value of these homes by improving the quality of their construction. Housing design strives to ensure that these technically advanced homes are marketable and will meet the needs of the people who will live in them.
Rajan, Abinaya; Sullivan, Richard; Bakker, Suzanne; van Harten, Willem H.
2012-01-01
Background. Translational research is a complex cumulative process that takes time. However, the operating environment for cancer centers engaged in translational research is now financially insecure. Centers are challenged to improve results and reduce time from discovery to practice innovations.
Andres Cibils; Mark Petersen; Shad Cox; Michael Rubio
2008-01-01
Description: New Mexico State University's Corona Range and Livestock Research Center (CRLRC) is located in a pinon-juniper (PJ)/grassland ecotone in the southern Basin and Range Province in south central New Mexico. A number of research projects conducted at this facility revolve around soil, plant, livestock, and wildlife responses to PJ woodland management. The...
Nuclear Research Center Karlsruhe, Central Safety Department. Annual report 1992
International Nuclear Information System (INIS)
Koelzer, W.
1993-05-01
The Central Safety Department is responsible for handling all problems of radiation protection, safety and security of the institutes and departments of the Karlsruhe Nuclear Research Center, for waste water activity measurements and environmental monitoring of the whole area of the Center, and for research and development work mainly focusing on nuclear safety and radiation protection measures. The research and development work concentrates on the following aspects: Physical and chemical behavior of trace elements in the environment, biophysics of multicellular systems, behavior of tritium in the air/soil-plant system, improvement in radiation protection measurement and personnel dosimetry. This report gives details of the different duties, indicates the results of 1992 routine tasks and reports about results of investigations and developments of the working groups of the Department. The reader is referred to the English translation of Chapter 1 describing the duties and organization of the Central Safety Department. (orig.) [de
Collaborative Aerospace Research and Fellowship Program at NASA Glenn Research Center
Heyward, Ann O.; Kankam, Mark D.
2004-01-01
During the summer of 2004, a 10-week activity for university faculty entitled the NASA-OAI Collaborative Aerospace Research and Fellowship Program (CFP) was conducted at the NASA Glenn Research Center in collaboration with the Ohio Aerospace Institute (OAI). This is a companion program to the highly successful NASA Faculty Fellowship Program and its predecessor, the NASA-ASEE Summer Faculty Fellowship Program that operated for 38 years at Glenn. The objectives of CFP parallel those of its companion, viz., (1) to further the professional knowledge of qualified engineering and science faculty,(2) to stimulate an exchange of ideas between teaching participants and employees of NASA, (3) to enrich and refresh the research and teaching activities of participants institutions, and (4) to contribute to the research objectives of Glenn. However, CFP, unlike the NASA program, permits faculty to be in residence for more than two summers and does not limit participation to United States citizens. Selected fellows spend 10 weeks at Glenn working on research problems in collaboration with NASA colleagues and participating in related activities of the NASA-ASEE program. This year's program began officially on June 1, 2004 and continued through August 7, 2004. Several fellows had program dates that differed from the official dates because university schedules vary and because some of the summer research projects warranted a time extension beyond the 10 weeks for satisfactory completion of the work. The stipend paid to the fellows was $1200 per week and a relocation allowance of $1000 was paid to those living outside a 50-mile radius of the Center. In post-program surveys from this and previous years, the faculty cited numerous instances where participation in the program has led to new courses, new research projects, new laboratory experiments, and grants from NASA to continue the work initiated during the summer. Many of the fellows mentioned amplifying material, both in
Renata Adler Memorial Research Center for Child Welfare and Protection, Tel-Aviv University
Ronen, Tammie
2011-01-01
The Renata Adler Memorial Research Center for Child Welfare and Protection operates within the Bob Shapell School of Social Work at Tel-Aviv University in Israel. The main aims of this research center are to facilitate study and knowledge about the welfare of children experiencing abuse or neglect or children at risk and to link such knowledge to…
Thom, Jinhee P; Crockett, Carolyn M
2008-05-01
We describe a method for managing environmental enhancement plans for individual research projects at a national primate research center where most monkeys are assigned to active research projects. The Psychological Well-being Program (PWB) at the University of Washington National Primate Research Center developed an Environmental Enhancement Plan form (EEPL) that allows PWB to quantify and track changes in enrichment allowances over time while ensuring that each animal is provided with as much enrichment as possible without compromising research. Very few projects involve restrictions on toys or perches. Some projects have restrictions on food treats and foraging, primarily involving the provision of these enrichments by research staff instead of husbandry staff. Restrictions are not considered exemptions unless they entirely prohibit an element of the University of Washington Environmental Enhancement Plan (UW EE Plan). All exemptions must be formally reviewed and approved by the institutional animal care and use committee. Most exemptions from elements of the UW EE Plan involve social housing. Between 2004 and 2006, the percentage of projects with no social contact restrictions increased by 1%, but those prohibiting any tactile social contact declined by 7%, and projects permitting tactile social contact during part of the study increased by 9%. The EEPL form has facilitated informing investigators about the enrichment their monkeys will receive if no restrictions or exemptions are requested and approved. The EEPL form also greatly enhances PWB's ability to coordinate the specific enrichment requirements of a project.
Directory of Open Access Journals (Sweden)
Mohammad-Reza Sohrabi
2015-02-01
Full Text Available Background and objective: It is obvious that, because of the lack of resources, we should devote our limited resources to priorities in order to reach an acceptable level of health. The objective of this study was to research priority setting for Pediatric Surgery Research Center; with the participation of all stakeholders.Material and Methods: This is a Health System Research (HSR project in order to apply governance and leadership issues with the participation of 41 people including faculty members in Pediatric Surgery Research Center, Shahid Beheshti Medical University and the other pediatric specialists and health system stakeholders as well as the people associated with health system inside & outside the university. This was performed in 2010 using the Council on Health Research for Development COHRED( model with little change. Based on the model, at first the stakeholders were identified and the field situation of Pediatric Surgery was analyzed. Then, research areas and titles were specified and research priorities were set out by giving scores according to the criteria.Results: The seven obtained research areas in priority order are included pediatric trauma, pediatric cancers, pediatric urology diseases, undescended testicles in children, developmental genetics & congenital defects, emergency in children and application of laparoscopic surgery in children. Because each of the research areas is composed of multiple subareas, we managed to finally specify 43 research subareas as research priorities. These subareas included epidemiology, risk factors, prevention, screening, diagnosis and treatment. They also included follow-up, complications, knowledge & attitudes of parents, quality of life, economy aspects and data bank for further research.Conclusion: In this project, research priorities were set out for Pediatric Surgery Research Center of Shahid Beheshti University of Medical Sciences, with the participation of all the stakeholders
34 CFR 350.1 - What is the Disability and Rehabilitation Research Projects and Centers Program?
2010-07-01
...) Rehabilitation Engineering Research Centers. (Authority: Sec. 204; 29 U.S.C. 762) ... 34 Education 2 2010-07-01 2010-07-01 false What is the Disability and Rehabilitation Research... DISABILITY AND REHABILITATION RESEARCH PROJECTS AND CENTERS PROGRAM General § 350.1 What is the Disability...
Space Weather Forecasting and Research at the Community Coordinated Modeling Center
Aronne, M.
2015-12-01
The Space Weather Research Center (SWRC), within the Community Coordinated Modeling Center (CCMC), provides experimental research forecasts and analysis for NASA's robotic mission operators. Space weather conditions are monitored to provide advance warning and forecasts based on observations and modeling using the integrated Space Weather Analysis Network (iSWA). Space weather forecasters come from a variety of backgrounds, ranging from modelers to astrophysicists to undergraduate students. This presentation will discuss space weather operations and research from an undergraduate perspective. The Space Weather Research, Education, and Development Initiative (SW REDI) is the starting point for many undergraduate opportunities in space weather forecasting and research. Space weather analyst interns play an active role year-round as entry-level space weather analysts. Students develop the technical and professional skills to forecast space weather through a summer internship that includes a two week long space weather boot camp, mentorship, poster session, and research opportunities. My unique development of research projects includes studying high speed stream events as well as a study of 20 historic, high-impact solar energetic particle events. This unique opportunity to combine daily real-time analysis with related research prepares students for future careers in Heliophysics.
Molecular Science Research Center 1992 annual report
Energy Technology Data Exchange (ETDEWEB)
Knotek, M.L.
1994-01-01
The Molecular Science Research Center is a designated national user facility, available to scientists from universities, industry, and other national laboratories. After an opening section, which includes conferences hosted, appointments, and projects, this document presents progress in the following fields: chemical structure and dynamics; environmental dynamics and simulation; macromolecular structure and dynamics; materials and interfaces; theory, modeling, and simulation; and computing and information sciences. Appendices are included: MSRC staff and associates, 1992 publications and presentations, activities, and acronyms and abbreviations.
Hart, Maureen McArthur
2013-01-01
Within the past few decades, university-industry research centers have been developed in large numbers and emphasized as a valuable policy tool for innovation. Yet little is known about the heterogeneity of organizational structure within these centers, which has implications regarding policy for and management of these centers. This dissertation…
NASA Glenn Research Center Experience with "LENR Phenomenon"
Wrbanek, Susan Y.; Fralick, Gustave C.; Wrbanek, John D.; Niedra, Janis M.
2012-01-01
Since 1989 NASA Glenn Research Center (GRC) has performed some small-scale limited experiments that show evidence of effects claimed by some to be evidence of Low Energy Nuclear Reactions (LENR). The research at GRC has involved observations and work on measurement techniques for observing the temperature effects in reactions of isotopes of hydrogen with palladium hydrides. The various experiments performed involved loading Pd with gaseous H2 and D2, and exposing Pd thin films to multi-bubble sonoluminescence in regular and deuterated water. An overview of these experiments and their results will be presented.
NASA Glenn Research Center Experience with LENR Phenomenon
Wrbanek, Susan Y.; Fralick, Gustave C.; Wrbanek, John D.; Niedra, Janis M.
2012-01-01
Since 1989 NASA Glenn Research Center (GRC) has performed some small-scale limited experiments that show evidence of effects claimed by some to be evidence of Low Energy Nuclear Reactions (LENR). The research at GRC has involved observations and work on measurement techniques for observing the temperature effects in reactions of isotopes of hydrogen with palladium hydrides. The various experiments performed involved loading Pd with gaseous H2 and D2, and exposing Pd thin films to multi-bubble sonoluminescence in regular and deuterated water. An overview of these experiments and their results will be presented.
Directory of Open Access Journals (Sweden)
Kevin Possin
2014-12-01
Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.
A new phase I clinical trial conducted by researchers at the Center for Cancer Research (CCR) is evaluating the safety and tolerability, or the degree to which any side effects can be tolerated by patients, of a two-drug combination as a potential alternative to bladder removal for bladder cancer patients. The trial targets patients with non-muscle invasive bladder cancer (NMIBC) whose cancers have stopped responding to traditional therapies. Read more...
Twenty-fifth anniversary of the Juelich Nuclear Research Center
International Nuclear Information System (INIS)
Haefele, W.
1982-01-01
On December 10, 1981, KFA Juelich celebrated its 25th year of existence; on December 11, 1956, the land parliament of North Rhine Westphalia had decided in favour of the erection of a joint nuclear research facility of the land of North Rhine Westphalia. In contrast to other nuclear research centers, the Juelich centre was to develop and operate large-scale research equipment and infrastructure for joint use by the universities of the land. This cooperation has remained an important characteristic in spite of the independent scientific work of KFA institutes, Federal government majorities, and changes in research fields and tasks. KFA does fundamental research in nuclear and plasma physics, solid state research, medicine, life sciences, and environmental research; other activities are R + D tasks for the HTR reactor and its specific applications as well as energy research in general. (orig.) [de
Re:Centering Adult Education Research: Whose World Is First?
Hall, Budd L.
1993-01-01
The discourse of adult education research needs to be reframed to place at the center the issues and concerns of the majority of the world's people who live in poverty, ill health, and insecurity and at the margins the concerns of the rich and powerful. (SK)
Effluent Monitoring System Design for the Proton Accelerator Research Center of PEFP
International Nuclear Information System (INIS)
Kim, Jun Yeon; Mun, Kyeong Jun; Cho, Jang Hyung; Jo, Jeong Hee
2010-01-01
Since host site host site was selected Gyeong-ju city in January, 2006. we need design revision of Proton Accelerator research center to reflect on host site characteristics and several conditions. Also the IAC recommended maximization of space utilization and construction cost saving. After GA(General Arrangement) is made a decision, it is necessary to evaluate the radiation analysis of every controlled area in the proton accelerator research center such as accelerator tunnel, Klystron gallery, beam experimental hall, target rooms and ion beam application building to keep dose rate below the ALARA(As Low As Reasonably achievable) objective. Our staff has reviewed and made a shielding design of them. In this paper, According to accelerator operation mode and access conditions based on radiation analysis and shielding design, we made the exhaust system configuration of controlled area in the proton accelerator research center. Also, we installed radiation monitor and set its alarm value for each radiation area
Yazdani, Kamran; Rahimi-Movaghar, Afarin; Nedjat, Saharnaz; Ghalichi, Leila; Khalili, Malahat
2015-01-01
Background: Since Tehran University of Medical Sciences (TUMS) has the oldest and highest number of research centers among all Iranian medical universities, this study was conducted to evaluate scientific output of research centers affiliated to Tehran University of Medical Sciences (TUMS) using scientometric indices and the affecting factors. Moreover, a number of scientometric indicators were introduced. Methods: This cross-sectional study was performed to evaluate a 5-year scientific performance of research centers of TUMS. Data were collected through questionnaires, annual evaluation reports of the Ministry of Health, and also from Scopus database. We used appropriate measures of central tendency and variation for descriptive analyses. Moreover, uni-and multi-variable linear regression were used to evaluate the effect of independent factors on the scientific output of the centers. Results: The medians of the numbers of papers and books during a 5-year period were 150.5 and 2.5 respectively. The median of the "articles per researcher" was 19.1. Based on multiple linear regression, younger age centers (p=0.001), having a separate budget line (p=0.016), and number of research personnel (p<0.001) had a direct significant correlation with the number of articles while real properties had a reverse significant correlation with it (p=0.004). Conclusion: The results can help policy makers and research managers to allocate sufficient resources to improve current situation of the centers. Newly adopted and effective scientometric indices are is suggested to be used to evaluate scientific outputs and functions of these centers. PMID:26157724
The development of a clinical outcomes survey research application: Assessment Center.
Gershon, Richard; Rothrock, Nan E; Hanrahan, Rachel T; Jansky, Liz J; Harniss, Mark; Riley, William
2010-06-01
The National Institutes of Health sponsored Patient-Reported Outcome Measurement Information System (PROMIS) aimed to create item banks and computerized adaptive tests (CATs) across multiple domains for individuals with a range of chronic diseases. Web-based software was created to enable a researcher to create study-specific Websites that could administer PROMIS CATs and other instruments to research participants or clinical samples. This paper outlines the process used to develop a user-friendly, free, Web-based resource (Assessment Center) for storage, retrieval, organization, sharing, and administration of patient-reported outcomes (PRO) instruments. Joint Application Design (JAD) sessions were conducted with representatives from numerous institutions in order to supply a general wish list of features. Use Cases were then written to ensure that end user expectations matched programmer specifications. Program development included daily programmer "scrum" sessions, weekly Usability Acceptability Testing (UAT) and continuous Quality Assurance (QA) activities pre- and post-release. Assessment Center includes features that promote instrument development including item histories, data management, and storage of statistical analysis results. This case study of software development highlights the collection and incorporation of user input throughout the development process. Potential future applications of Assessment Center in clinical research are discussed.
Bibliography of Lewis Research Center Technical Publications announced in 1991
1992-01-01
This compilation of abstracts describes and indexes the technical reporting that resulted from the scientific engineering work performed and managed by the Lewis Research Center in 1991. All the publications were announced in the 1991 issues of STAR (Scientific and Technical Aerospace Reports) and/or IAA (International Aerospace Abstracts). Included are research reports, journal articles, conference presentations, patents and patent applications, and theses.
The Amistad Research Center: Documenting the African American Experience.
Chepesiuk, Ron
1993-01-01
Describes the Amistad Research Center housed at Tulane University which is a repository of primary documents on African-American history. Topics addressed include the development and growth of the collection; inclusion of the American Missionary Association archives; sources of support; civil rights; and collecting for the future. (LRW)
Does Every Research Library Need a Digital Humanities Center?
Schaffner, Jennifer; Erway, Ricky
2014-01-01
The digital humanities (DH) are attracting considerable attention and funding at the same time that this nascent field is striving for an identity. Some research libraries are making significant investments by creating digital humanities centers. However, questions about whether such investments are warranted persist across the cultural heritage…
Radiation protection at the Cadarache research center
International Nuclear Information System (INIS)
Anon.
2015-01-01
This article recalls the French law about radiation protection and its evolution due to the implementation of the 2013/59-EURATOM directive that separates the missions of counsel from the more operative missions of the person appointed as 'competent in radiation protection'. The organisation of the radiation protection of the Cadarache research center is presented. The issue of sub-contracting and the respect of an adequate standard of radioprotection is detailed since 2 facilities operated by AREVA are being dismantled on the site. (A.C.)
Atomic, Nuclear and Molecular Research Center CICANUM
International Nuclear Information System (INIS)
Loria Meneses, Luis Guillermo
2011-01-01
CICANUM has a Gamma Spectroscopy Laboratory, has been the laboratory official, appointed by the Ministerio de Agricultura in Costa Rica to analyze export products (for human consumption and animal), also, to determine radioactive contamination. The Laboratory has four systems using germanium detectors and canberra technology, including software Genie 2000 to establish the activity of cesium, iodine and natural gamma emitters in solid or liquid samples for food products, sediments and rocks. This Laboratory belongs to the Universidad de Costa Rica which has different institutes and research centers
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
Small UAS Test Area at NASA's Dryden Flight Research Center
Bauer, Jeffrey T.
2008-01-01
This viewgraph presentation reviews the areas that Dryden Flight Research Center has set up for testing small Unmanned Aerial Systems (UAS). It also reviews the requirements and process to use an area for UAS test.
The status of shielding research at Tajoura research center
International Nuclear Information System (INIS)
El-Bakkoush, F.A.
2005-01-01
This paper gives a description to the shielding research activities which have been carried-out at the radiation shielding group ,Tajoura Research Center. This includes the design of different types of concrete shields made from local aggregates which have suitable radiation attenuation properties. These include, Ordinary Concrete(with density p = 2.3 ton/m3) heavy weight concrete (with density p =3.6 ton/m3) and heat resistant concrete with aggregates having bound- in water. Investigation have been carried -out by measuring the neutron and gamma-rays spectra which have been transmitted through barriers having different thickness. These were performed using a collimated beam of reactor neutrons and gamma-ray transmitted from the horizontal channel no 1 of Tajoura-Research reactor with 10 MW Max ape rating power. The transmitted fast neutron and gamma spectra were measured by neutron-gamma spectrometer employing NE-213 liquid organic scintillater. Discrimination of against undesired pulses of neutrons or gamma-ray was achieved by a pulse shape discrimination method based on differences in the shape of the decay part of the emitted pulses. The obtained results are presented in the form of displayed neutron and gamma spectra measured behind different thickness of the investigated concrete shield. These spectra were used to derive the macroscopic cross section for at different energy for material under investigation
High Power MPD Thruster Development at the NASA Glenn Research Center
LaPointe, Michael R.; Mikellides, Pavlos G.; Reddy, Dhanireddy (Technical Monitor)
2001-01-01
Propulsion requirements for large platform orbit raising, cargo and piloted planetary missions, and robotic deep space exploration have rekindled interest in the development and deployment of high power electromagnetic thrusters. Magnetoplasmadynamic (MPD) thrusters can effectively process megawatts of power over a broad range of specific impulse values to meet these diverse in-space propulsion requirements. As NASA's lead center for electric propulsion, the Glenn Research Center has established an MW-class pulsed thruster test facility and is refurbishing a high-power steady-state facility to design, build, and test efficient gas-fed MPD thrusters. A complimentary numerical modeling effort based on the robust MACH2 code provides a well-balanced program of numerical analysis and experimental validation leading to improved high power MPD thruster performance. This paper reviews the current and planned experimental facilities and numerical modeling capabilities at the Glenn Research Center and outlines program plans for the development of new, efficient high power MPD thrusters.
Energy Frontier Research Center, Center for Materials Science of Nuclear Fuels
Energy Technology Data Exchange (ETDEWEB)
Todd R. Allen, Director
2011-04-01
The Office of Science, Basic Energy Sciences, has funded the INL as one of the Energy Frontier Research Centers in the area of material science of nuclear fuels. This document is the required annual report to the Office of Science that outlines the accomplishments for the period of May 2010 through April 2011. The aim of the Center for Material Science of Nuclear Fuels (CMSNF) is to establish the foundation for predictive understanding of the effects of irradiation-induced defects on thermal transport in oxide nuclear fuels. The science driver of the center’s investigation is to understand how complex defect and microstructures affect phonon mediated thermal transport in UO2, and achieve this understanding for the particular case of irradiation-induced defects and microstructures. The center’s research thus includes modeling and measurement of thermal transport in oxide fuels with different levels of impurities, lattice disorder and irradiation-induced microstructure, as well as theoretical and experimental investigation of the evolution of disorder, stoichiometry and microstructure in nuclear fuel under irradiation. With the premise that thermal transport in irradiated UO2 is a phonon-mediated energy transport process in a crystalline material with defects and microstructure, a step-by-step approach will be utilized to understand the effects of types of defects and microstructures on the collective phonon dynamics in irradiated UO2. Our efforts under the thermal transport thrust involved both measurement of diffusive phonon transport (an approach that integrates over the entire phonon spectrum) and spectroscopic measurements of phonon attenuation/lifetime and phonon dispersion. Our distinct experimental efforts dovetail with our modeling effort involving atomistic simulation of phonon transport and prediction of lattice thermal conductivity using the Boltzmann transport framework.
Progress report of Cekmece Nuclear Research and Training Center for 1980
International Nuclear Information System (INIS)
1982-01-01
Presented are the research works carried out in 1980 in Physics, Chemistry, Nuclear engineering, Radiobiology, Reactor operation and reactor enlargement, Health physics, Radioisotope production, Electronic, Industrial application of radioisotopes, Nuclear fuel technology, Technical services, Construction control, Publication and documentation, Training division of Cekmece Nuclear Research and Training Center
Bibliography of Lewis Research Center technical publications announced in 1990
1991-01-01
This compilation of abstracts describes and indexes the technical reporting that resulted from the scientific and engineering work performed and managed by the Lewis Research Center in 1990. All the publications were announced in the 1990 issues of STAR (Scientific and Technical Aerospace Reports) and/or IAA (International Aerospace Abstracts). Included are research reports, journal articles, conference presentations, patents and patent applications, and theses.
Bibliography of Lewis Research Center technical publications announced in 1992
1993-01-01
This compilation of abstracts describes and indexes the technical reporting that resulted from the scientific and engineering work performed and managed by the Lewis Research Center in 1992. All the publications were announced in the 1992 issues of STAR (Scientific and Technical Aerospace Reports) and/or IAA (International Aerospace Abstracts). Included are research reports, journal articles, conference presentations, patents and patent applications, and theses.
Bibliography of Lewis Research Center technical publications announced in 1993
1994-01-01
This compilation of abstracts describes and indexes the technical reporting that resulted from the scientific and engineering work performed and managed by the Lewis Research Center in 1993. All the publications were announced in the 1993 issues of STAR (Scientific and Technical Aerospace Reports) and/or IAA (International Aerospace Abstracts). Included are research reports, journal articles, conference presentations, patents and patent applications, and theses.
Bibliography of Lewis Research Center technical publications announced in 1989
1990-01-01
This compilation of abstracts describes and indexes the technical reporting that resulted from the scientific and engineering work performed and managed by the Lewis Research Center in 1989. All the publications were announced in the 1989 issues of STAR (Scientific and Technical Aerospace Reports) and/or IAA (International Aerospace Abstracts). Included are research reports, journal articles, conference presentations, patents and patent applications, and theses.
NASA Langley Research Center tethered balloon systems
Owens, Thomas L.; Storey, Richard W.; Youngbluth, Otto
1987-01-01
The NASA Langley Research Center tethered balloon system operations are covered in this report for the period of 1979 through 1983. Meteorological data, ozone concentrations, and other data were obtained from in situ measurements. The large tethered balloon had a lifting capability of 30 kilograms to 2500 meters. The report includes descriptions of the various components of the balloon systems such as the balloons, the sensors, the electronics, and the hardware. Several photographs of the system are included as well as a list of projects including the types of data gathered.
Sugarman, Jeremy
2016-04-01
The Affordable Care Act includes provisions for the conduct of large-scale, patient-centered comparative effectiveness research. Such efforts aim toward the laudable moral goal of having evidence to improve health care decision making. Nevertheless, these pragmatic clinical research efforts that typically pose minimal incremental risk and are enmeshed in routine care settings perhaps surprisingly encounter an array of ethics and regulatory challenges and opportunities for academic health centers. An emphasis on patient-centeredness forces an examination of the appropriateness of traditional methods used to protect the rights, interests, and welfare of participants. At the same time, meaningful collaboration with patients throughout the research process also necessitates ensuring that novel approaches to research (including recruitment and consent) entail necessary protections regarding such issues as privacy. As the scientific and logistical aspects of this research are being developed, substantial attention is being focused on the accompanying ethics and regulatory issues that have emerged, which should help to facilitate ethically appropriate research in a variety of contexts.
[The Engineering and Technical Services Directorate at the Glenn Research Center
Moon, James
2004-01-01
My name is James Moon and I am a senior at Tennessee State University where my major is Aeronautical and Industrial Technology with a concentration in industrial electronics. I am currently serving my internship in the Engineering and Technical Services Directorate at the Glenn Research Center (GRC). The Engineering and Technical Service Directorate provides the services and infrastructure for the Glenn Research Center to take research concepts to reality. They provide a full range of integrated services including engineering, advanced prototyping and testing, facility management, and information technology for NASA, industry, and academia. Engineering and Technical Services contains the core knowledge in Information Technology (IT). This includes data systems and analysis, inter and intranet based systems design and data security. Including the design and development of embedded real-time s o h a r e applications for flight and supporting ground systems, Engineering and Technical Services provide a wide range of IT services and products specific to the Glenn Research Center research and engineering community. In the 7000 Directorate I work directly in the 7611 organization. This organization is known as the Aviation Environments Technical Branch. My mentor is Vincent Satterwhite who is also the Branch Chief of the Aviation Environments Technical Branch. In this branch, I serve as the Assistant program manager of the Engineering Technology Program. The Engineering Technology Program (ETP) is one of three components of the High School L.E.R.C.I.P. This is an Agency-sponsored, eight-week research-based apprenticeship program designed to attract traditionally underrepresented high school students that demonstrate an aptitude for and interest in mathematics, science, engineering, and technology.
Hochman, Bernardo; Locali, Rafael Fagionato; Oliveira Filho, Renato Santos de; Oliveira, Ricardo Leão de; Goldenberg, Saul; Ferreira, Lydia Masako
2006-01-01
To suggest a standardization, in the English language, the formatting of the citation of the research centers. From three more recent publications of the first 20 journals available in Brazilian Portal of Scientific Information - Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), with bigger factor of impact during the year of 2004, according of information in ISI Web of Knowledge Journal Citation Reports database in biennium 2004-2005, had extracted the formats of citations of the research centers. An analogy to the institutional hierarchie step of the Federal University of Sao Paulo (UNIFESP) was carried out, and the formats most frequent, in the English language, had been adopted as standard to be suggested to cite the research centers for sending articles. In relation to the citation "Departamento", was standardized "Department of ..." (being "..." the name in English of the Department), to the citation "Programa de Pós-Graduação" "... Program", "Disciplina" "Division of ...", "Orgãos, Grupos e Associações" "... Group ", "Setor" "Section of...", "Centro" "Center for ...", "Unidade" "... Unit ", "Instituto" "Institute of ...", "Laboratório" "Laboratory of ..." and "Grupo" "Group of ...".
The Wetland and Aquatic Research Center strategic science plan
,
2017-02-02
IntroductionThe U.S. Geological Survey (USGS) Wetland and Aquatic Research Center (WARC) has two primary locations (Gainesville, Florida, and Lafayette, Louisiana) and field stations throughout the southeastern United States and Caribbean. WARC’s roots are in U.S. Fish and Wildlife Service (USFWS) and National Park Service research units that were brought into the USGS as the Biological Research Division in 1996. Founded in 2015, WARC was created from the merger of two long-standing USGS biology science Centers—the Southeast Ecological Science Center and the National Wetlands Research Center—to bring together expertise in biology, ecology, landscape science, geospatial applications, and decision support in order to address issues nationally and internationally. WARC scientists apply their expertise to a variety of wetland and aquatic research and monitoring issues that require coordinated, integrated efforts to better understand natural environments. By increasing basic understanding of the biology of important species and broader ecological and physiological processes, this research provides information to policymakers and aids managers in their stewardship of natural resources and in regulatory functions.This strategic science plan (SSP) was developed to guide WARC research during the next 5–10 years in support of Department of the Interior (DOI) partnering bureaus such as the USFWS, the National Park Service, and the Bureau of Ocean Energy Management, as well as other Federal, State, and local natural resource management agencies. The SSP demonstrates the alignment of the WARC goals with the USGS mission areas, associated programs, and other DOI initiatives. The SSP is necessary for workforce planning and, as such, will be used as a guide for future needs for personnel. The SSP also will be instrumental in developing internal funding priorities and in promoting WARC’s capabilities to both external cooperators and other groups within the USGS.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
Directory of Open Access Journals (Sweden)
Susilawati Susilawati
2016-06-01
Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52
The Brain Takes Center Stage at 2014 NIH Research Festival | Poster
By Andrea Frydl, Contributing Writer The 2014 NIH Research Festival, Sept. 22–24, focused on the human brain for two, very specific, reasons: to coincide with the White House BRAIN Initiative and to highlight the John Edward Porter Neuroscience Research Center, which opened earlier this year on the NIH campus.
Applied wind energy research at the National Wind Technology Center
International Nuclear Information System (INIS)
Robinson, M.C.; Tu, P.
1997-01-01
Applied research activities currently being undertaken at the National Wind Technology Center, part of the National Renewable Energy Laboratory, in the United States, are divided into several technical disciplines. An integrated multi-disciplinary approach is urged for the future in order to evaluate advanced turbine designs. The risk associated with any new turbine development program can thus be mitigated through the provision of the advanced technology, analysis tools and innovative designs available at the Center, and wind power can be promoted as a viable renewable energy alternative. (UK)
Center for Ecotoxicological Research of Montenegro
International Nuclear Information System (INIS)
Vucinic, Z.
2006-01-01
PI Center for Ecotoxicological Research of Montenegro (CETI) is founded 1996's in accordance with Government policy, for the purpose to: Unite the problems of protecting the environment in one institution, Organize the monitoring of the all segments of environment (air, waters soils, waste, ionizing and non-ionizing radiation, noise measurements etc.), Organize control of human and animal food and toxicological analysis of all kind of samples, forensic analyses etc. To concentrate the expensive instrumental equipment and human resources in one institution. December 1996 - CETI founded by decision of Montenegrin government 1997-CETI starting with acquisition of equipment and education of the staff March of 1998 - Officially starting with the job and realization with Program's September 2004 - Took the ISO 9001:2000 Certificate and Accreditation under ISO/IEC 17025 in November 2004 Organisation Scheme of CETI: Laboratory For Ecotoxicological Research And Radiation Protection I. Department For Laboratory Diagnostic And Monitoring II. Department For Radiation Protection And Monitoring Sector For Administration Department For Economy Department For Administration Total number of Employs is 63 of permanent staff
Translational Partnership Development Lead | Center for Cancer Research
PROGRAM DESCRIPTION The Frederick National Laboratory for Cancer Research (FNLCR) is a Federally Funded Research and Development Center operated by Leidos Biomedical Research, Inc on behalf of the National Cancer Institute (NCI). The staff of FNLCR support the NCI’s mission in the fight against cancer and HIV/AIDS. Currently we are seeking a Translational Partnership Development Lead (TPDL) who will work closely with the Office of Translational Resources (OTR) within the Office of the Director (OD) of NCI’s Center for Cancer Research (CCR) to facilitate the successful translation of CCR’s basic and preclinical research advances into new therapeutics and diagnostics. The TPDL with be strategically aligned within FNLCR’s Partnership Development Office (PDO), to maximally leverage the critical mass of expertise available within the PDO. CCR comprises the basic and clinical components of the NCI’s Intramural Research Program (IRP) and consists of ~230 basic and clinical Investigators located at either the NIH main campus in Bethesda or the NCI-Frederick campus. CCR Investigators are focused primarily on cancer and HIV/AIDS, with special emphasis on the most challenging and important high-risk/high-reward problems driving the fields. (See https://ccr.cancer.gov for a full delineation of CCR Investigators and their research activities.) The process of developing research findings into new clinical applications is high risk, complex, variable, and requires multiple areas of expertise seldom available within the confines of a single Investigator’s laboratory. To accelerate this process, OTR serves as a unifying force within CCR for all aspects of translational activities required to achieve success and maintain timely progress. A key aspect of OTR’s function is to develop and strengthen essential communications and collaborations within NIH, with extramural partners and with industry to bring together experts in chemistry, human subjects research
Climate Change and Vector Borne Diseases on NASA Langley Research Center
Cole, Stuart K.; DeYoung, Russell J.; Shepanek, Marc A.; Kamel, Ahmed
2014-01-01
Increasing global temperature, weather patterns with above average storm intensities, and higher sea levels have been identified as phenomena associated with global climate change. As a causal system, climate change could contribute to vector borne diseases in humans. Vectors of concern originate from the vicinity of Langley Research Center include mosquitos and ticks that transmit disease that originate regionally, nationwide, or from outside the US. Recognizing changing conditions, vector borne diseases propagate under climate change conditions, and understanding the conditions in which they may exist or propagate, presents opportunities for monitoring their progress and mitigating their potential impacts through communication, continued monitoring, and adaptation. Personnel comprise a direct and fundamental support to NASA mission success, continuous and improved understanding of climatic conditions, and the resulting consequence of disease from these conditions, helps to reduce risk in terrestrial space technologies, ground operations, and space research. This research addresses conditions which are attributed to climatic conditions which promote environmental conditions conducive to the increase of disease vectors. This investigation includes evaluation of local mosquito population count and rainfall data for statistical correlation and identification of planning recommendations unique to LaRC, other NASA Centers to assess adaptation approaches, Center-level planning strategies.
Flow Cytometry Technician | Center for Cancer Research
PROGRAM DESCRIPTION The Basic Science Program (BSP) pursues independent, multidisciplinary research in basic and applied molecular biology, immunology, retrovirology, cancer biology, and human genetics. Research efforts and support are an integral part of the Center for Cancer Research (CCR) at the Frederick National Laboratory for Cancer Research (FNLCR). KEY ROLES/RESPONSIBILITIES The Flow Cytometry Core (Flow Core) of the Cancer and Inflammation Program (CIP) is a service core which supports the research efforts of the CCR by providing expertise in the field of flow cytometry (using analyzers and sorters) with the goal of gaining a more thorough understanding of the biology of cancer and cancer cells. The Flow Core provides service to 12-15 CIP laboratories and more than 22 non-CIP laboratories. Flow core staff provide technical advice on the experimental design of applications, which include immunological phenotyping, cell function assays, and cell cycle analysis. Work is performed per customer requirements, and no independent research is involved. The Flow Cytometry Technician will be responsible for: Monitor performance of and maintain high dimensional flow cytometer analyzers and cell sorters Operate high dimensional flow cytometer analyzers and cell sorters Monitoring lab supply levels and order lab supplies, perform various record keeping responsibilities Assist in the training of scientific end users on the use of flow cytometry in their research, as well as how to operate and troubleshoot the bench-top analyzer instruments Experience with sterile technique and tissue culture
Scholarly Citadel in Chicago: The Center for Research Libraries.
Boylan, Ray
1979-01-01
The Center provides access to infrequently used research materials in three interrelated ways: (1) it provides a deposit library for such materials from the collections of member libraries; (2) it acquires such materials at members' shared expense and for their common use; and (3) it provides rapid access to its collection materials. (Author/JD)
Primary Care Research in the Patient-Centered Outcomes Research Institute's Portfolio.
Selby, Joe V; Slutsky, Jean R
2016-04-01
In their article in this issue, Mazur and colleagues analyze the characteristics of early recipients of funding from the Patient-Centered Outcomes Research Institute (PCORI). Mazur and colleagues note correctly that PCORI has a unique purpose and mission and suggest that it should therefore have a distinct portfolio of researchers and departments when compared with other funders such as the National Institutes of Health (NIH). Responding on behalf of PCORI, the authors of this Commentary agree with the characterization of PCORI's mission as distinct from that of NIH and others. They agree too that data found on PCORI's Web site demonstrate that PCORI's portfolio of researchers and departments is more diverse and more heavily populated with clinician researchers, as would be expected. The authors take issue with Mazur and colleagues' suggestion that because half of clinical visits occur within primary care settings, half of PCORI's funded research should be based in primary care departments. PCORI's portfolio reflects what patients and others tell PCORI are the critical questions. Many of these do, in fact, occur with more complex conditions in specialty care. The authors question whether the research of primary care departments is too narrowly focused and whether it sufficiently considers study of these complex conditions. Research on more complex conditions including heart failure, coronary artery disease, and multiple comorbid conditions could be highly valuable when approached from the primary care perspective, where many of the comparative effectiveness questions first arise.
Recipients of Regional Centers of Research Excellence (RCREs) P20 Grant Awards Announced
NCI, Center for Global Health (CGH) release of the applications represents novel global collaborations charged with planning and designing sustainable, Regional Centers of Research Excellence (RCREs) for non-communicable diseases, including cancer, in low- and middle-income countries (LMICs) or regions.
ADVANCED COMPOSITES TECHNOLOGY CASE STUDY AT NASA LANGLEY RESEARCH CENTER
This report summarizes work conducted at the National Aeronautics and Space Administration's Langley Research Center (NASA-LaRC) in Hampton, VA, under the U.S. Environmental Protection Agency’s (EPA) Waste Reduction Evaluations at Federal Sites (WREAFS) Program. Support for...
The Rise of Federally Funded Research and Development Centers
Energy Technology Data Exchange (ETDEWEB)
DALE,BRUCE C.; MOY,TIMOTHY D.
2000-09-01
Federally funded research and development centers (FFRDCS) area unique class of research and development (R and D) facilities that share aspects of private and public ownership. Some FFRDCS have been praised as national treasures, but FFRDCS have also been the focus of much criticism through the years. This paper traces the history of FFRDCS through four periods: (1) the World War II era, which saw the birth of federal R and D centers that would eventually become FFRDCS; (2) the early Cold War period, which exhibited a proliferation of FFRDCS despite their unclear legislative status and growing tension with an increasingly capable and assertive defense industry, (3) there-evaluation and retrenchment of FFRDCS in the 1960s and early 1970s, which resulted in a dramatic decline in the number of FFRDCS; and (4) the definition and codification of the FFRDC entity in the late 1970s and 1980s, when Congress and the executive branch worked together to formalize regulations to control FFRDCS. The paper concludes with observations on the status of FFRDCS at the end of the twentieth century.
Sixth NASA Glenn Research Center Propulsion Control and Diagnostics (PCD) Workshop
Litt, Jonathan S. (Compiler)
2018-01-01
The Intelligent Control and Autonomy Branch at NASA Glenn Research Center hosted the Sixth Propulsion Control and Diagnostics Workshop on August 22-24, 2017. The objectives of this workshop were to disseminate information about research being performed in support of NASA Aeronautics programs; get feedback from peers on the research; and identify opportunities for collaboration. There were presentations and posters by NASA researchers, Department of Defense representatives, and engine manufacturers on aspects of turbine engine modeling, control, and diagnostics.
the use of research in protected area management in Madagascar
African Journals Online (AJOL)
they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...
Academic Centers and/as Industrial Consortia: US Microelectronics Research 1976-2016
Mody, Cyrus C.M.
2017-01-01
In the U.S., in the late 1970s and early 1980s, academic research centers that were tightly linked to the semiconductor industry began to proliferate – at exactly the same time as the first academic start-up companies in biotech, and slightly before the first U.S. industrial semiconductor research
International Nuclear Information System (INIS)
Drell, Persis; Armstrong, Neal; Carter, Emily; DePaolo, Don; Gunnoe, Brent
2011-01-01
A distinguished panel of scientists from the EFRC community provide their perspective on the importance of EFRCs for addressing critical energy needs at the 2011 EFRC Summit. Persis Drell, Director at SLAC, served as moderator. Panel members are Neal Armstrong (Director of the Center for Interface Science: Solar Electric Materials, led by the University of Arizona), Emily Carter (Co-Director of the Combustion EFRC, led by Princeton University. She is also Team Leader of the Heterogeneous Functional Materials Center, led by the University of South Carolina), Don DePaolo (Director of the Center for Nanoscale Control of Geologic CO2, led by LBNL), and Brent Gunnoe (Director of the Center for Catalytic Hydrocarbon Functionalization, led by the University of Virginia). The 2011 EFRC Summit and Forum brought together the EFRC community and science and policy leaders from universities, national laboratories, industry and government to discuss 'Science for our Nation's Energy Future.' In August 2009, the Office of Science established 46 Energy Frontier Research Centers. The EFRCs are collaborative research efforts intended to accelerate high-risk, high-reward fundamental research, the scientific basis for transformative energy technologies of the future. These Centers involve universities, national laboratories, nonprofit organizations, and for-profit firms, singly or in partnerships, selected by scientific peer review. They are funded at $2 to $5 million per year for a total planned DOE commitment of $777 million over the initial five-year award period, pending Congressional appropriations. These integrated, multi-investigator Centers are conducting fundamental research focusing on one or more of several 'grand challenges' and use-inspired 'basic research needs' recently identified in major strategic planning efforts by the scientific community. The purpose of the EFRCs is to integrate the talents and expertise of leading scientists in a setting designed to accelerate
Chambers, Joseph R.
2005-01-01
The goal of this publication is to provide an overview of the topic of revolutionary research in aeronautics at Langley, including many examples of research efforts that offer significant potential benefits, but have not yet been applied. The discussion also includes an overview of how innovation and creativity is stimulated within the Center, and a perspective on the future of innovation. The documentation of this topic, especially the scope and experiences of the example research activities covered, is intended to provide background information for future researchers.
Doreswamy, Rajiv
1990-01-01
The Marshall Space Flight Center (MSFC) owns and operates a space station module power management and distribution (SSM-PMAD) testbed. This system, managed by expert systems, is used to analyze and develop power system automation techniques for Space Station Freedom. The Lewis Research Center (LeRC), Cleveland, Ohio, has developed and implemented a space station electrical power system (EPS) testbed. This system and its power management controller are representative of the overall Space Station Freedom power system. A virtual link is being implemented between the testbeds at MSFC and LeRC. This link would enable configuration of SSM-PMAD as a load center for the EPS testbed at LeRC. This connection will add to the versatility of both systems, and provide an environment of enhanced realism for operation of both testbeds.
Jamshidi, M. (Editor); Lumia, R. (Editor); Tunstel, E., Jr. (Editor); White, B. (Editor); Malone, J. (Editor); Sakimoto, P. (Editor)
1997-01-01
This first volume of the Autonomous Control Engineering (ACE) Center Press Series on NASA University Research Center's (URC's) Advanced Technologies on Space Exploration and National Service constitute a report on the research papers and presentations delivered by NASA Installations and industry and Report of the NASA's fourteen URC's held at the First National Conference in Albuquerque, New Mexico from February 16-19, 1997.
PROCEEDINGS OF RIKEN BNL RESEARCH CENTER WORKSHOP, VOLUME 66
International Nuclear Information System (INIS)
OGAWA, A.
2005-01-01
The RIKEN BNL Research Center (RSRC) was established in April 1997 at Brookhaven National Laboratory. It is funded by the 'Rikagaku Kenkyusho (RIKEN, The Institute of Physical and Chemical Research) of Japan. The Center is dedicated to the study of strong interactions, including spin physics, lattice QCD, and RHIC physics through the nurturing of a new generation of young physicists. The RBRC has both a theory and experimental component. At present the theoretical group has 4 Fellows and 3 Research Associates as well as 11 RHIC Physics/University Fellows (academic year 2003-2004). To date there are approximately 30 graduates from the program of which 13 have attained tenure positions at major institutions worldwide. The experimental group is smaller and has 2 Fellows and 3 RHIC Physics/University Fellows and 3 Research Associates, and historically 6 individuals have attained permanent positions. Beginning in 2001 a new RIKEN Spin Program (RSP) category was implemented at RBRC. These appointments are joint positions of RBRC and RIKEN and include the following positions in theory and experiment: RSP Researchers, RSP Research Associates, and Young Researchers, who are mentored by senior RBRC Scientists, A number of RIKEN Jr. Research Associates and Visiting Scientists also contribute to the physics program at the Center. RBRC has an active workshop program on strong interaction physics with each workshop focused on a specific physics problem. Each workshop speaker is encouraged to select a few of the most important transparencies from his or her presentation, accompanied by a page of explanation. This material is collected at the end of the workshop by the organizer to form proceedings, which can therefore be available within a short time. To date there are sixty nine proceedings volumes available. The construction of a 0.6 teraflops parallel processor, dedicated to lattice QCD, begun at the Center on February 19, 1998, was completed on August 28, 1998 and is still
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society
Directory of Open Access Journals (Sweden)
Gerry Joseph Nagtzaam
2014-03-01
Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action. In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence. Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.
Massachusetts Institute of Technology, Plasma Fusion Center, Technical Research Programs
International Nuclear Information System (INIS)
1980-08-01
A review is given of the technical programs carried out by the Plasma Fusion Center. The major divisions of work areas are applied plasma research, confinement experiments, fusion technology and engineering, and fusion systems. Some objectives and results of each program are described
Armstrong Flight Research Center Research Technology and Engineering Report 2015
Voracek, David F.
2016-01-01
I am honored to endorse the 2015 Neil A. Armstrong Flight Research Center’s Research, Technology, and Engineering Report. The talented researchers, engineers, and scientists at Armstrong are continuing a long, rich legacy of creating innovative approaches to solving some of the difficult problems and challenges facing NASA and the aerospace community.Projects at NASA Armstrong advance technologies that will improve aerodynamic efficiency, increase fuel economy, reduce emissions and aircraft noise, and enable the integration of unmanned aircraft into the national airspace. The work represented in this report highlights the Center’s agility to develop technologies supporting each of NASA’s core missions and, more importantly, technologies that are preparing us for the future of aviation and space exploration.We are excited about our role in NASA’s mission to develop transformative aviation capabilities and open new markets for industry. One of our key strengths is the ability to rapidly move emerging techniques and technologies into flight evaluation so that we can quickly identify their strengths, shortcomings, and potential applications.This report presents a brief summary of the technology work of the Center. It also contains contact information for the associated technologists responsible for the work. Don’t hesitate to contact them for more information or for collaboration ideas.
The materials processing research base of the Materials Processing Center
Latanision, R. M.
1986-01-01
An annual report of the research activities of the Materials Processing Center of the Massachusetts Institute of Technology is given. Research on dielectrophoresis in the microgravity environment, phase separation kinetics in immiscible liquids, transport properties of droplet clusters in gravity-free fields, probes and monitors for the study of solidification of molten semiconductors, fluid mechanics and mass transfer in melt crystal growth, and heat flow control and segregation in directional solidification are discussed.
Earth Radiation Budget Research at the NASA Langley Research Center
Smith, G. Louis; Harrison, Edwin F.; Gibson, Gary G.
2014-01-01
In the 1970s research studies concentrating on satellite measurements of Earth's radiation budget started at the NASA Langley Research Center. Since that beginning, considerable effort has been devoted to developing measurement techniques, data analysis methods, and time-space sampling strategies to meet the radiation budget science requirements for climate studies. Implementation and success of the Earth Radiation Budget Experiment (ERBE) and the Clouds and the Earth's Radiant Energy System (CERES) was due to the remarkable teamwork of many engineers, scientists, and data analysts. Data from ERBE have provided a new understanding of the effects of clouds, aerosols, and El Nino/La Nina oscillation on the Earth's radiation. CERES spacecraft instruments have extended the time coverage with high quality climate data records for over a decade. Using ERBE and CERES measurements these teams have created information about radiation at the top of the atmosphere, at the surface, and throughout the atmosphere for a better understanding of our climate. They have also generated surface radiation products for designers of solar power plants and buildings and numerous other applications
Selected Research and Development Topics on Aerospace Communications at NASA Glenn Research Center
Miranda, Felix A.; Romanofsky, Robert R.; Nessel, James A.
2014-01-01
This presentation discusses some of the efforts on communications RD that have been performed or are currently underway at NASA Glenn Research Center. The primary purpose of this presentation is to outline some RD topics to serve as talking points for a Technical Interchange Meeting with the Ohio State University. The meeting is scheduled to take place at The ElectroScience Laboratory of the Ohio State University on February 24, 2014.
Massachusetts Institute of Technology, Plasma Fusion Center, Technical Research Programs
Energy Technology Data Exchange (ETDEWEB)
Davidson, Ronald C.
1980-08-01
A review is given of the technical programs carried out by the Plasma Fusion Center. The major divisions of work areas are applied plasma research, confinement experiments, fusion technology and engineering, and fusion systems. Some objectives and results of each program are described. (MOW)
Scientific and technical information output of the Langley Research Center
1984-01-01
Scientific and technical information that the Langley Research Center produced during the calendar year 1983 is compiled. Included are citations for Formal Reports, Quick-Release Technical Memorandums, Contractor Reports, Journal Articles and other Publications, Meeting Presentations, Technical Talks, Computer Programs, Tech Briefs, and Patents.
Annual report 1995 of the Central Safety Department, Research Center Karlsruhe
International Nuclear Information System (INIS)
Koelzer, W.
1996-04-01
The Central Safety Department is responsible for supervising, monitoring and, to some extent, also executing measures of radiation protection, industrial health and safety as well as physical protection and security at and for the institutes and departments of the Karlsruhe Research Center (Forschungszentrum Karlsruhe GmbH), and for monitoring liquid effluents and the environment of all facilities and nuclear installations on the premises of the Research Center. In addition, research and development work is carried out in the fields of behavior of tritium in the air/soil/plant system, tritium balances for nuclear fusion fuel cycles, and assessments of mining and ore dressing spoils. This report gives details of the different duties and reports the results of 1995 routine tasks, investigations and developments of the working groups of the Department. The reader is referred to the English translation of Chapter 1 describing the duties and organization of the Central Safety Department. (orig.) [de
International Nuclear Information System (INIS)
Fingleton, Donald J.; Bhada, Ron K.; Derald Morgan, J.; Julien, Howard
1992-01-01
The Waste Isolation Pilot Plant (WIPP) was designed and built as a research and development facility to obtain data to demonstrate the safe management, storage, and disposal of defense-related transuranic (TRU) waste. The WIPP facility, near Carlsbad, New Mexico, is scheduled to receive its first shipment of TRU waste in 1992. The citizens of Carlsbad requested the U.S. Department of Energy (DOE) to provide them with an independent organization that would monitor the entire area with state-of-the-art monitoring techniques and publish the data. As a follow-up, the DOE approved a proposal from the Waste-management Education and Research Consortium of New Mexico to develop and implement this program. The purpose of this paper is to (1) describe this innovative program to establish the Carlsbad Environmental Monitoring and Research Center, an independent university based center to study health and environmental impacts associated with technological development; (2) present the Center's mission and objectives; and (3) give an overview of the progress. (author)
DEFF Research Database (Denmark)
Katan, Lina Hauge; Baarts, Charlotte
Research-based teaching has long been a distinguishing trait of higher education. Engaging students in research-like processes has been employed to great effect in learning and continues to be encouraged by educational studies. The literature on this subject reflects how ‘technical’ or ‘field......’ exercises tend to dominate the common understandings of research-based learning. Here we address a specific area of inquiry overlooked by previous studies: whether and how reading, thinking and writing indeed share the same learning potentials as the practical foundation for research-based teaching....... In the humanities and social sciences, integrated acts of reading, writing and thinking account for an obvious and substantial overlap in student and researcher practices, creating a clear opportunity for research-based teaching. Moreover, our empirical data point to reading, thinking and writing as quintessential...
LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci
Energy Technology Data Exchange (ETDEWEB)
Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)
1994-09-01
The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
International Nuclear Information System (INIS)
Meyer, W.; Wood, R.M.; Scherer, J.
1990-01-01
The Electric Power Research Institute (EPRI) has announced the establishment of the Knowledge-Based Technology Application Center (KBTAC), whose goal is to assist member utilities with expert system technology and applications. The center, established November 7, 1989, is located on the campus of Syracuse University, Syracuse, New York, and will be operated jointly by Kaman Sciences Corporation and the university. The mission of the KBTAC is to assist EPRI member utilities to develop, test, and transfer expert systems into nuclear power plant operations, maintenance, and administration
Landgrebe, Anton J.
1987-01-01
An overview of research activities at the United Technologies Research Center (UTRC) in the area of Computational Fluid Dynamics (CFD) is presented. The requirement and use of various levels of computers, including supercomputers, for the CFD activities is described. Examples of CFD directed toward applications to helicopters, turbomachinery, heat exchangers, and the National Aerospace Plane are included. Helicopter rotor codes for the prediction of rotor and fuselage flow fields and airloads were developed with emphasis on rotor wake modeling. Airflow and airload predictions and comparisons with experimental data are presented. Examples are presented of recent parabolized Navier-Stokes and full Navier-Stokes solutions for hypersonic shock-wave/boundary layer interaction, and hydrogen/air supersonic combustion. In addition, other examples of CFD efforts in turbomachinery Navier-Stokes methodology and separated flow modeling are presented. A brief discussion of the 3-tier scientific computing environment is also presented, in which the researcher has access to workstations, mid-size computers, and supercomputers.
Mantay, Wayne R.; Adelman, Howard M.
1990-01-01
This paper describes a joint NASA/Army research activity at the Langley Research Center to develop optimization procedures aimed at improving the rotor blade design process by integrating appropriate disciplines and accounting for important interactions among the disciplines. The activity is being guided by a Steering Committee made up of key NASA and Army researchers and managers. The paper describes the optimization formulation in terms of the objective function, design variables, and constraints. The analysis aspects are discussed, and the interdisciplinary interactions are defined in terms of the information that must be transferred among disciplinary analyses as well as the trade-offs between disciplines in determining the details of the design. At this writing, some significant progress has been made. Results given in the paper represent accomplishments in rotor aerodynamic performance optimization for minimum horsepower, rotor dynamic optimization for vibration reduction, approximate analysis of frequencies and mode shapes, rotor structural optimization for minimum weight, and integrated aerodynamic load/dynamics optimization for minimum vibration and weight.
Variable-Speed Power-Turbine Research at Glenn Research Center
Welch, Gerard E.; McVetta, Ashlie B.; Stevens, Mark A.; Howard, Samuel A.; Giel, Paul W.; Ameri, Ali, A.; To, Waiming; Skoch, Gary J.; Thurman, Douglas R.
2012-01-01
The main rotors of the NASA Large Civil Tilt-Rotor (LCTR) notional vehicle operate over a wide speed-range, from 100 percent at takeoff to 54 percent at cruise. The variable-speed power turbine (VSPT) offers one approach by which to effect this speed variation. VSPT aerodynamics challenges include high work factors at cruise, wide (40 to 60 ) incidence-angle variations in blade and vane rows over the speed range, and operation at low Reynolds numbers. Rotordynamics challenges include potential responsiveness to shaft modes within the 50 percent VSPT speed-range. A research effort underway at NASA Glenn Research Center, intended to address these key aerodynamic and rotordynamic challenges, is described. Conceptual design and 3-D multistage RANS and URANS analyses, conducted internally and under contract, provide expected VSPT sizing, stage-count, performance and operability information, and maps for system studies. Initial steps toward experimental testing of incidence-tolerant blading in a transonic linear cascade are described, and progress toward development/improvement of a simulation capability for multistage turbines with low Reynolds number transitional flow is summarized. Preliminary rotordynamics analyses indicate that viable concept engines with 50 percent VSPT shaft-speed range. Assessments of potential paths toward VSPT component-level testing are summarized.
Energy Technology Data Exchange (ETDEWEB)
Brunel, Guy; Denis, Dominique; Boulet, Alain [Commissariat a l' energie Atomique et aux Energies Alternatives - CEA-Cadarache, DEN/CEACAD/UCAP, 13108 Saint Paul lez Durance Cedex (France)
2013-07-01
The CEA Cadarache research center is one of the 10 research centers of the French Alternative Energies and Atomic Energy Commission (CEA). Distributed throughout various research platforms, it focuses on nuclear fission, nuclear fusion, new energy technologies (hydrogen, solar, biomass) and fundamental research in the field of vegetal biology. It is the most important technological research and development centers for energy in Europe. Considering the sensitive nature of nuclear activities, the questions surrounding the issue of radioactive waste, the nuclear energy and the social, economic and environmental concerns for present and future generations, the French Government asked nuclear actors to open communication and to give all the information asked by the Local Information Commission (CLI) and the public [1]. In this context, the CEA Cadarache has decided to better show and explain its expertise and experience in the area of nuclear energy and nuclear power plant design, and to make it available to stakeholders and to the public. CEA Cadarache receives each year more than 9000 visitors. To complete technical visits of the research facilities and laboratories, a scientific cultural center has been built in 2011 to inform the public on CEA Cadarache research activities and to facilitate the acceptance of nuclear energy in a way suited to the level of knowledge of the visitors. A modern interactive exhibition of 150 m{sup 2} allows visitors to find out more about energy, CEA Cadarache research programs, radioactive waste management and radiological impact on the research center activities. It also offers an auditorium for group discussions and for school groups to discover science through enjoyment. This communication center has received several thousand visitors since its opening on October 2011; the initial results of this experience are now available. It's possible to explain the design of this exhibition, to give some statistics on the number of the
International Nuclear Information System (INIS)
Brunel, Guy; Denis, Dominique; Boulet, Alain
2013-01-01
The CEA Cadarache research center is one of the 10 research centers of the French Alternative Energies and Atomic Energy Commission (CEA). Distributed throughout various research platforms, it focuses on nuclear fission, nuclear fusion, new energy technologies (hydrogen, solar, biomass) and fundamental research in the field of vegetal biology. It is the most important technological research and development centers for energy in Europe. Considering the sensitive nature of nuclear activities, the questions surrounding the issue of radioactive waste, the nuclear energy and the social, economic and environmental concerns for present and future generations, the French Government asked nuclear actors to open communication and to give all the information asked by the Local Information Commission (CLI) and the public [1]. In this context, the CEA Cadarache has decided to better show and explain its expertise and experience in the area of nuclear energy and nuclear power plant design, and to make it available to stakeholders and to the public. CEA Cadarache receives each year more than 9000 visitors. To complete technical visits of the research facilities and laboratories, a scientific cultural center has been built in 2011 to inform the public on CEA Cadarache research activities and to facilitate the acceptance of nuclear energy in a way suited to the level of knowledge of the visitors. A modern interactive exhibition of 150 m 2 allows visitors to find out more about energy, CEA Cadarache research programs, radioactive waste management and radiological impact on the research center activities. It also offers an auditorium for group discussions and for school groups to discover science through enjoyment. This communication center has received several thousand visitors since its opening on October 2011; the initial results of this experience are now available. It's possible to explain the design of this exhibition, to give some statistics on the number of the visitors
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
The meeting will feature the researchers and senior scientists from the Children's Centers, the PEHSUs, scientists from federal agencies and others through interdisciplinary presentations and discussions that explore connections between research findings,
Proposing a Center on Aging and Well-Being: Research, Education, and Practice Considerations
Lindenbach, Jeannette M.; Jessup-Falcioni, Heather
2016-01-01
This environmental scan aimed to discover research interests and educational needs of faculty, graduate, and undergraduate students to inspire research, education, and practice in the development of a center on aging and well-being for older adults. The scan consisted of a search of university faculty and researchers regarding research on aging; a…
International Nuclear Information System (INIS)
Watson, David; Jardine, Philip; Gu, Baohua; Parker, Jack; Brandt, Craig; Holladay, Susan; Wolfe, Amy; Bogle, Mary Anna; Lowe, Kenneth; Hyder, Kirk
2006-01-01
The Field Research Center (FRC) in Oak Ridge (Fig. 1), Tennessee supports the U.S. Department of Energy's (DOE's) Environmental Remediation Sciences Program (ERSP) goal of understanding the complex physical, chemical, and biological properties of contaminated sites for new solutions to environmental remediation and long-term stewardship. In particular, the FRC provides the opportunity for researchers to conduct studies that promote the understanding of the processes that influence the transport and fate of subsurface contaminants, the effectiveness and long-term consequences of existing remediation options, and the development of improved remediation strategies. It offers a series of contaminated sites around the former S-3 Waste Disposal Ponds and uncontaminated sites in which investigators and students conduct field research or collect samples for laboratory analysis. FRC research also spurs the development of new and improved characterization and monitoring tools. Site specific knowledge gained from research conducted at the FRC also provides the DOE-Oak Ridge Office of Environmental Management (EM) the critical scientific knowledge needed to make cleanup decisions for the S-3 Ponds and other sites on the Oak Ridge Reservation (ORR)
Fondermann, Philipp; Togt, van der P.L.
2016-01-01
Wageningen University and Research Center (WUR) is one of the most prestigious research institutions in the world in life sciences and improved significantly in several rankings over the last years. One of the `drivers` of this success story is a comprehensive quality management exercise based on
Therapist effects on dropout from a college counseling center practice research network.
Xiao, Henry; Castonguay, Louis G; Janis, Rebecca A; Youn, Soo Jeong; Hayes, Jeffrey A; Locke, Benjamin D
2017-07-01
Dropout has been a pervasive and costly problem in psychotherapy, particularly for college counseling centers. The present study examined potential predictors of dropout using a large data set (N = 10,147 clients, 481 therapists) that was gathered through a college counseling center practice research network as a replication and extension of recent findings regarding therapist effects on dropout. The final model resulted in a dropout rate of 15.9% and a therapist effect of 9.51% on dropout variance. Therapist demographic variables were investigated, though none were found to be significant. Variables found to be predictive of increased likelihood of dropping out included higher levels of general presenting concerns, alcohol-related distress, and current financial stress. Ultimately, this study showed that therapists may play an important role in the likelihood of client dropout, and that additional research should be conducted to identify additional predictors, particularly at the therapist and center level. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Friedman, Robert M.; Evans, Mary; Morrison-Rodriguez, Barbara; Kutash, Krista; Duchnowski, Al; Hernandez, Mario; Hodges, Sharon; Armstrong, Mary; Pires, Sheila; Stroul, Beth; Greenbaum, Paul; Brown, Eric; Lazear, Katherine
This paper describes each of eight current interrelated federally funded research projects conducted by the Research and Training Center for Children's Mental Health at the University of South Florida. For each project, information is provided on the project's background, purpose, methodology, and anticipated results. Project titles and principal…
1997-12-01
Fracture Analysis of the F-5, 15%-Spar Bolt DR Devendra Kumar SAALC/LD 6- 16 CUNY-City College, New York, NY A Simple, Multiversion Concurrency Control...Program, University of Dayton, Dayton, OH. [3]AFGROW, Air Force Crack Propagation Analysis Program, Version 3.82 (1997) 15-8 A SIMPLE, MULTIVERSION ...Office of Scientific Research Boiling Air Force Base, DC and San Antonio Air Logistic Center August 1997 16-1 A SIMPLE, MULTIVERSION CONCURRENCY
2011-11-16
...] Center for Biologics Evaluation and Research Report of Scientific and Medical Literature and Information... period for the notice on its report of scientific and medical literature and information concerning the... ``Center for Biologics Evaluation and Research Report of Scientific and Medical Literature and Information...
International Nuclear Information System (INIS)
Shibata, Hiromi; Iwai, Takeo; Narui, Makoto; Omata, Takao
1996-01-01
In the hyper irradiation research facility at the Atomic Research Center, the University of Tokyo, following apparatuses were newly installed for accelerator relating apparatus on 1995 fiscal year; 1) Hyper ion microbeam analysis apparatus, 2) Fourier conversion infrared microscopy, 3) Pico second two-dimensional fluorescence measuring apparatus, 4) Femto second wave-length reversible pulse laser radiation apparatus, and others. In addition to double irradiation, pulse beam irradiation experiment and so forth characteristic in conventional hyper irradiation research apparatus, upgrading of material irradiation experiments using these new apparatuses are intended. (G.K.)
Energy Technology Data Exchange (ETDEWEB)
Shibata, Hiromi; Iwai, Takeo; Narui, Makoto; Omata, Takao [Tokyo Univ. (Japan). Research Center for Nuclear Science and Technology
1996-12-01
In the hyper irradiation research facility at the Atomic Research Center, the University of Tokyo, following apparatuses were newly installed for accelerator relating apparatus on 1995 fiscal year; (1) Hyper ion microbeam analysis apparatus, (2) Fourier conversion infrared microscopy, (3) Pico second two-dimensional fluorescence measuring apparatus, (4) Femto second wave-length reversible pulse laser radiation apparatus, and others. In addition to double irradiation, pulse beam irradiation experiment and so forth characteristic in conventional hyper irradiation research apparatus, upgrading of material irradiation experiments using these new apparatuses are intended. (G.K.)
Research Center for Optical Physics: Education and Technology for the 21st Century
2003-01-01
During the past eleven years since its inception, RCOP has excelled in its two primary goals: 1) training of the scientists and engineers needed for the twenty-first century with special emphasis on underrepresented citizens and 2) research and technological development in areas of relevance to NASA. In the category of research training, as of May 2003, RCOP produced 36 Bachelors degrees, 25 Masters degrees, and 13 Doctoral degrees. Of these, all 36 Bachelors degrees, 16 of the Masters degrees and 9 of the Doctoral degrees were awarded to African Americans. Four of the Doctoral graduates and one of the Masters graduates are working at NASA Field Centers. RCOP has also provided research experiences to 130 undergraduate students and 22 high school students through a number of outreach programs held during the summer and the academic year. RCOP has also been crucial to the development of the Ph.D. program in physics at Hampton University by providing high quality research training and technical electives required for a Doctoral degree in physics. RCOP has also excelled in research and technological development. Since 1992, RCOP researchers have leveraged over 8 million dollars in additional research funding, published 152 papers in refereed journals and proceedings, and given 125 presentations at refereed international conferences in the United States and eight other countries. RCOP also developed numerous collaborations with other research centers, universities and industries. In recognition of this outstanding work, RCOP is the first research center in the United States invited to join the Joint Open Laboratory for Laser Crystals and Precise Laser Systems headed by Dr. Alexander Kaminiskii of the Russian Academy of Sciences.
Amiri, Mohammad Meskarpour; Nasiri, Taha; Saadat, Seyed Hassan; Anabad, Hosein Amini; Ardakan, Payman Mahboobi
2016-11-01
Efficiency analysis is necessary in order to avoid waste of materials, energy, effort, money, and time during scientific research. Therefore, analyzing efficiency of knowledge production in health areas is necessary, especially for developing and in-transition countries. As the first step in this field, the aim of this study was the analysis of selected health research center efficiency using data envelopment analysis (DEA). This retrospective and applied study was conducted in 2015 using input and output data of 16 health research centers affiliated with a health sciences university in Iran during 2010-2014. The technical efficiency of health research centers was evaluated based on three basic data envelopment analysis (DEA) models: input-oriented, output-oriented, and hyperbolic-oriented. The input and output data of each health research center for years 2010-2014 were collected from the Iran Ministry of Health and Medical Education (MOHE) profile and analyzed by R software. The mean efficiency score in input-oriented, output-oriented, and hyperbolic-oriented models was 0.781, 0.671, and 0.798, respectively. Based on results of the study, half of the health research centers are operating below full efficiency, and about one-third of them are operating under the average efficiency level. There is also a large gap between health research center efficiency relative to each other. It is necessary for health research centers to improve their efficiency in knowledge production through better management of available resources. The higher level of efficiency in a significant number of health research centers is achievable through more efficient management of human resources and capital. Further research is needed to measure and follow the efficiency of knowledge production by health research centers around the world and over a period of time.
The joint center for energy storage research: A new paradigm for battery research and development
International Nuclear Information System (INIS)
Crabtree, George
2015-01-01
The Joint Center for Energy Storage Research (JCESR) seeks transformational change in transportation and the electricity grid driven by next generation high performance, low cost electricity storage. To pursue this transformative vision JCESR introduces a new paradigm for battery research: integrating discovery science, battery design, research prototyping and manufacturing collaboration in a single highly interactive organization. This new paradigm will accelerate the pace of discovery and innovation and reduce the time from conceptualization to commercialization. JCESR applies its new paradigm exclusively to beyond-lithium-ion batteries, a vast, rich and largely unexplored frontier. This review presents JCESR's motivation, vision, mission, intended outcomes or legacies and first year accomplishments
The joint center for energy storage research: A new paradigm for battery research and development
Energy Technology Data Exchange (ETDEWEB)
Crabtree, George [Joint Center for Energy Storage Research, Argonne National Laboratory, 9700 S. Cass Avenue, Argonne, IL 60439, USA and University of Illinois at Chicago, 845 W. Taylor Street, Chicago, IL 60607 (United States)
2015-03-30
The Joint Center for Energy Storage Research (JCESR) seeks transformational change in transportation and the electricity grid driven by next generation high performance, low cost electricity storage. To pursue this transformative vision JCESR introduces a new paradigm for battery research: integrating discovery science, battery design, research prototyping and manufacturing collaboration in a single highly interactive organization. This new paradigm will accelerate the pace of discovery and innovation and reduce the time from conceptualization to commercialization. JCESR applies its new paradigm exclusively to beyond-lithium-ion batteries, a vast, rich and largely unexplored frontier. This review presents JCESR's motivation, vision, mission, intended outcomes or legacies and first year accomplishments.
Innovative Educational Aerospace Research at the Northeast High School Space Research Center
Luyet, Audra; Matarazzo, Anthony; Folta, David
1997-01-01
Northeast High Magnet School of Philadelphia, Pennsylvania is a proud sponsor of the Space Research Center (SPARC). SPARC, a model program of the Medical, Engineering, and Aerospace Magnet school, provides talented students the capability to successfully exercise full simulations of NASA manned missions. These simulations included low-Earth Shuttle missions and Apollo lunar missions in the past, and will focus on a planetary mission to Mars this year. At the end of each scholastic year, a simulated mission, lasting between one and eight days, is performed involving 75 students as specialists in seven teams The groups are comprised of Flight Management, Spacecraft Communications (SatCom), Computer Networking, Spacecraft Design and Engineering, Electronics, Rocketry, Robotics, and Medical teams in either the mission operations center or onboard the spacecraft. Software development activities are also required in support of these simulations The objective of this paper is to present the accomplishments, technology innovations, interactions, and an overview of SPARC with an emphasis on how the program's educational activities parallel NASA mission support and how this education is preparing student for the space frontier.
Environmental assessment of the Carlsbad Environmental Monitoring and Research Center Facility
International Nuclear Information System (INIS)
1995-10-01
This Environmental Assessment has been prepared to determine if the Carlsbad Environmental Monitoring and Research Center (the Center), or its alternatives would have significant environmental impacts that must be analyzed in an Environmental Impact Statement. DOE's proposed action is to continue funding the Center. While DOE is not funding construction of the planned Center facility, operation of that facility is dependent upon continued funding. To implement the proposed action, the Center would initially construct a facility of approximately 2,300 square meters (25,000 square feet). The Phase 1 laboratory facilities and parking lot will occupy approximately 1.2 hectares (3 acres) of approximately 8.9 hectares (22 acres) of land which were donated to New Mexico State University (NMSU) for this purpose. The facility would contain laboratories to analyze chemical and radioactive materials typical of potential contaminants that could occur in the environment in the vicinity of the DOE Waste Isolation Pilot Plant (WIPP) site or other locations. The facility also would have bioassay facilities to measure radionuclide levels in the general population and in employees of the WIPP. Operation of the Center would meet the DOE requirement for independent monitoring and assessment of environmental impacts associated with the planned disposal of transuranic waste at the WIPP
Environmental assessment of the Carlsbad Environmental Monitoring and Research Center Facility
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-10-01
This Environmental Assessment has been prepared to determine if the Carlsbad Environmental Monitoring and Research Center (the Center), or its alternatives would have significant environmental impacts that must be analyzed in an Environmental Impact Statement. DOE`s proposed action is to continue funding the Center. While DOE is not funding construction of the planned Center facility, operation of that facility is dependent upon continued funding. To implement the proposed action, the Center would initially construct a facility of approximately 2,300 square meters (25,000 square feet). The Phase 1 laboratory facilities and parking lot will occupy approximately 1.2 hectares (3 acres) of approximately 8.9 hectares (22 acres) of land which were donated to New Mexico State University (NMSU) for this purpose. The facility would contain laboratories to analyze chemical and radioactive materials typical of potential contaminants that could occur in the environment in the vicinity of the DOE Waste Isolation Pilot Plant (WIPP) site or other locations. The facility also would have bioassay facilities to measure radionuclide levels in the general population and in employees of the WIPP. Operation of the Center would meet the DOE requirement for independent monitoring and assessment of environmental impacts associated with the planned disposal of transuranic waste at the WIPP.
Deur, J. M.; Kundu, K. P.; Nguyen, H. L.
1992-01-01
Emissions of pollutants from future commercial transports are a significant concern. As a result, the Lewis Research Center (LeRC) is investigating various low emission combustor technologies. As part of this effort, a combustor analysis code development program was pursued to guide the combustor design process, to identify concepts having the greatest promise, and to optimize them at the lowest cost in the minimum time.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
2010-09-23
...] Science Advisory Board to the National Center for Toxicological Research Notice of Meeting AGENCY: Food... closed to the public. Name of Committee: Science Advisory Board (SAB) to the National Center for Toxicological Research (NCTR). General Function of the Committee: To provide advice and recommendations to the...
2012-09-18
...] Science Advisory Board to the National Center for Toxicological Research; Notice of Meeting AGENCY: Food... closed to the public. Name of Committee: Science Advisory Board (SAB) to the National Center for Toxicological Research (NCTR). General Function of the Committee: To provide advice and recommendations to the...
Krummheuer, Götz
2013-01-01
In 2008, the research center "Individual Development and Adaptive Education" was constituted by the Goethe University, the German Institute for International Educational Research, and the Sigmund Freud Institute, all located in Frankfurt am Main, Germany (http://www.idea-frankfurt.eu). The research of the center focuses on the…
Proceeding of the Seminar of Research Result of Multipurpose Reactor Center Year of 1997/1998
International Nuclear Information System (INIS)
Jujuratisbela, U.
1998-08-01
The proceeding contained papers presented in seminar on research results of Multipurpose Reactor Center year 1997/1998 held on June 9-10, 1998 in Serpong, Indonesia. These papers are the significant result of research activities conducted in the Multipurpose Reactor Center, National Atomic Energy Agency during fiscal year of 1997/1998. There are 37 article which have separated index. (ID)
A future perspective on technological obsolescenceat NASA, Langley Research Center
Mcintyre, Robert M.
1990-01-01
The present research effort was the first phase of a study to forecast whether technological obsolescence will be a problem for the engineers, scientists, and technicians at NASA Langley Research Center (LaRC). There were four goals of the research: to review the literature on technological obsolescence; to determine through interviews of division chiefs and branch heads Langley's perspective on future technological obsolescence; to begin making contacts with outside industries to find out how they view the possibility of technological obsolescence; and to make preliminary recommendations for dealing with the problem. A complete description of the findings of this research can be reviewed in a technical report in preparation. The following are a small subset of the key findings of the study: NASA's centers and divisions vary in their missions and because of this, in their capability to control obsolescence; research-oriented organizations within NASA are believed by respondents to keep up to date more than the project-oriented organizations; asked what are the signs of a professional's technological obsolescence, respondents had a variety of responses; top performing scientists were viewed as continuous learners, keeping up to date by a variety of means; when asked what incentives were available to aerospace technologists for keeping up to data, respondents specified a number of ideas; respondents identified many obstacles to professionals' keeping up to date in the future; and most respondents expressed some concern for the future of the professionals at NASA vis a vis the issue of professional obsolescence.
U.S. Department of Energy's Genomics: GTL Bioenergy Research Centers White Paper
Energy Technology Data Exchange (ETDEWEB)
none,
2006-08-01
The Genomics:GTL Bioenergy Research Centers will be dedicated to fundamental research on microbe and plant systems with the goal of developing knowledge that will advance biotechnology-based strategies for biofuels production. The aim is to spur substantial progress toward cost-effective production of biologically based renewable energy sources. This document describes the rationale for the establishment of the centers and their objectives in light of the U.S. Department of Energy’s mission and goals.
Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq
2018-04-01
This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.
Development of a pharmacy student research program at a large academic medical center.
McLaughlin, Milena M; Skoglund, Erik; Bergman, Scott; Scheetz, Marc H
2015-11-01
A program to promote research by pharmacy students created through the collaboration of an academic medical center and a college of pharmacy is described. In 2009, Midwestern University Chicago College of Pharmacy and Northwestern Memorial Hospital (NMH) expanded their existing partnership by establishing a program to increase opportunities for pharmacy students to conduct clinical-translational research. All professional year 1, 2, or 3 students at the college, as well as professional year 4 students on rotation at NMH, can participate in the program. Central to the program's infrastructure is the mentorship of student leads by faculty- and hospital-based pharmacists. The mentors oversee the student research projects and guide development of poster presentations; student leads mentor junior students and assist with orientation and training activities. Publication of research findings in the peer-reviewed literature is a key program goal. In the first four years after program implementation, participation in a summer research program grew nearly 10-fold (mainly among incoming professional year 2 or 3 students, and student poster presentations at national pharmacy meetings increased nearly 20-fold; the number of published research articles involving student authors increased from zero in 2009 to three in 2012 and two in 2013. A collaborative program between an academic medical center and a college of pharmacy has enabled pharmacy students to conduct research at the medical center and has been associated with increases in the numbers of poster presentations and publications involving students. Copyright © 2015 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
Architecture and Civil Design Status of the Proton Accelerator Research Center in PEFP
International Nuclear Information System (INIS)
Nam, J. M.; Kim, J. Y.; Mun, K. J.; Jeon, G. P.; Cho, J. S.; Lee, S. K.; Min, Y. S.; Joo, H. G.
2009-01-01
PEFP (Proton Engineering Frontier Project) is scheduled to administrate the conventional facilities design with Gyeongju and complement its unfit points. When construction work starts according to the construction schedule, a field work office will be installed to supervise the Proton Accelerator Conventional Facilities Construction. In this paper, we describe the geological investigation procedure for the construction of the proton accelerator conventional facilities of PEFP. By the geological investigation, data for the reasonable and economic construction work, such as stratum structure and geotechnical characteristics. In Site Plot Plan for PEFP, we classified center as 2 groups such as main facilities and support facilities. We also designed access road of the Proton Accelerator Research Center of PEFP. In architectural design for PEFP, we described the design procedure of the buildings and landscape architectures of the Proton Accelerator Research Center
Fisher, David F.
1999-01-01
Titles, authors, report numbers, and abstracts are given for more than 2200 unclassified and unrestricted technical reports and papers published from September 1946 to December 1996 by NASA Dryden Flight Research Center and its predecessor organizations. These technical reports and papers describe and give the results of 50 years of flight research performed by the NACA and NASA, from the X-1 and other early X-airplanes, to the X-15, Space Shuttle, X-29 Forward Swept Wing, and X-31 aircraft. Some of the other research airplanes tested were the D-558, phase 1 and 2; M-2, HL-10 and X-24 lifting bodies; Digital Fly-By-Wire and Supercritical Wing F-8; XB-70; YF-12; AFTI F-111 TACT and MAW; F-15 HiDEC; F-18 High Alpha Research Vehicle, and F-18 Systems Research Aircraft. The citations of reports and papers are listed in chronological order, with author and aircraft indices. In addition, in the appendices, citations of 233 contractor reports, more than 200 UCLA Flight System Research Center reports and 25 video tapes are included.
Based on Intelligent Robot of E-business Distribution Center Operation Mode Research
Directory of Open Access Journals (Sweden)
Li Juntao
2016-01-01
Full Text Available According to E-business distribution center operation mode in domestic and advanced experience drawing lessons at home and abroad, this paper based on intelligent robot researches E-business distribution center operation mode. And it proposes the innovation logistics storage in E-business and sorting integration system, and elaborates its principle, characteristics, as well as studies its business mode and logistics process, and its parameters and working mode of AGV equipment.
Demonstration and information center on the basis of the research reactor IR-50
International Nuclear Information System (INIS)
Krupenina, F.
2001-01-01
Many problems exist in the nuclear field, but the most significant one is the public's mistrust of Nuclear Energy. Strong downfalls of the radiological culture affect public perception, the main paradox being the situation after Chernobyl. The task of creating a Demonstration and-Information Center (Minatom RF) on the basis of the research reactor IR-50 is conducted by Research and Development Institute of Power Engineering (ENTEK). The IR-50 is situated on the grounds of the institute. It will be a unique event when the functional reactor is situated in the center of the city (about 5 km from Kremlin). (author)
African Journals Online (AJOL)
This study is concerned with the productivity of nurses working within the. Primary ..... rience more work-related stress and report this as overall poor health, than ... performance, and reduces the possibility of staff loss through burnout (Watson,.
Directory of Open Access Journals (Sweden)
Amy J. Elliott
2015-12-01
Full Text Available The Collaborative Research Center for American Indian Health (CRCAIH was established in September 2012 as a unifying structure to bring together tribal communities and health researchers across South Dakota, North Dakota and Minnesota to address American Indian/Alaska Native (AI/AN health disparities. CRCAIH is based on the core values of transdisciplinary research, sustainability and tribal sovereignty. All CRCAIH resources and activities revolve around the central aim of assisting tribes with establishing and advancing their own research infrastructures and agendas, as well as increasing AI/AN health research. CRCAIH is comprised of three divisions (administrative; community engagement and innovation; research projects, three technical cores (culture, science and bioethics; regulatory knowledge; and methodology, six tribal partners and supports numerous multi-year and one-year pilot research projects. Under the ultimate goal of improving health for AI/AN, this paper describes the overarching vision and structure of CRCAIH, highlighting lessons learned in the first three years.
Superconducting microwave electronics at Lewis Research Center
Warner, Joseph D.; Bhasin, Kul B.; Leonard, Regis F.
Over the last three years, NASA Lewis Research Center has investigated the application of newly discovered high temperature superconductors to microwave electronics. Using thin films of YBa2Cu3O7-delta and Tl2Ca2Ba2Cu3Ox deposited on a variety of substrates, including strontium titanate, lanthanum gallate, lanthanum aluminate and magnesium oxide, a number of microwave circuits have been fabricated and evaluated. These include a cavity resonator at 60 GHz, microstrip resonators at 35 GHz, a superconducting antenna array at 35 GHz, a dielectric resonator at 9 GHz, and a microstrip filter at 5 GHz. Performance of some of these circuits as well as suggestions for other applications are reported.
Superconducting Microwave Electronics at Lewis Research Center
Warner, Joseph D.; Bhasin, Kul B.; Leonard, Regis F.
1991-01-01
Over the last three years, NASA Lewis Research Center has investigated the application of newly discovered high temperature superconductors to microwave electronics. Using thin films of YBa2Cu3O7-delta and Tl2Ca2Ba2Cu3Ox deposited on a variety of substrates, including strontium titanate, lanthanum gallate, lanthanum aluminate and magnesium oxide, a number of microwave circuits have been fabricated and evaluated. These include a cavity resonator at 60 GHz, microstrip resonators at 35 GHz, a superconducting antenna array at 35 GHz, a dielectric resonator at 9 GHz, and a microstrip filter at 5 GHz. Performance of some of these circuits as well as suggestions for other applications are reported.
The Research Results of Radioactive Waste Management Technology Center Year 1997/1998
International Nuclear Information System (INIS)
1998-12-01
The research results of Radioactive Waste Management Technology Center, National Atomic Energy Agency of Indonesia year 1997/1998 contain paper as form of research results on radioactive waste management related fields. There were included many aspects such as radioactive waste processing, storage, decontamination, decommissioning, safety and environmental aspects. There are 26 papers indexed individually (ID)
General aviation internal combustion engine research programs at NASA-Lewis Research Center
Willis, E. A.
1978-01-01
An update is presented of non-turbine general aviation engine programs underway at the NASA-Lewis Research Center in Cleveland, Ohio. The program encompasses conventional, lightweight diesel and rotary engines. Its three major thrusts are: (a) reduced SFC's; (b) improved fuels tolerance; and (c) reducing emissions. Current and planned future programs in such areas as lean operation, improved fuel management, advanced cooling techniques and advanced engine concepts, are described. These are expected to lay the technology base, by the mid to late 1980's, for engines whose life cycle fuel costs are 30 to 50% lower than today's conventional engines.
Fisher, David F.
2007-01-01
Titles, authors, report numbers, and abstracts are given for nearly 2900 unclassified and unrestricted technical reports and papers published from September 1946 to December 2006 by the NASA Dryden Flight Research Center and its predecessor organizations. These technical reports and papers describe and give the results of 60 years of flight research performed by the NACA and NASA, from the X-1 and other early X-airplanes, to the X-15, Space Shuttle, X-29 Forward Swept Wing, X-31, and X-43 aircraft. Some of the other research airplanes tested were the D-558, phase 1 and 2; M-2, HL-10 and X-24 lifting bodies; Digital Fly-By-Wire and Supercritical Wing F-8; XB-70; YF-12; AFTI F-111 TACT and MAW; F-15 HiDEC; F-18 High Alpha Research Vehicle, F-18 Systems Research Aircraft and the NASA Landing Systems Research aircraft. The citations of reports and papers are listed in chronological order, with author and aircraft indices. In addition, in the appendices, citations of 270 contractor reports, more than 200 UCLA Flight System Research Center reports, nearly 200 Tech Briefs, 30 Dryden Historical Publications, and over 30 videotapes are included.
The San Diego Center for Patient Safety: Creating a Research, Education, and Community Consortium
National Research Council Canada - National Science Library
Pratt, Nancy; Vo, Kelly; Ganiats, Theodore G; Weinger, Matthew B
2005-01-01
In response to the Agency for Healthcare Research and Quality's Developmental Centers of Education and Research in Patient Safety grant program, a group of clinicians and academicians proposed the San...
Anatomy of an organizational change effort at the Lewis Research Center
Hawker, James R.; Dali, Richard S.
1988-01-01
By 1979, after a long decline following the end of the Apollo program, the Lewis Research Center found its very existence endangered because it was not doing the kind of research that could attract funding at the time. New management under Andrew J. Stofan applied a program of strategic planning, participative management, and consensus decision making. A corporate-cultural change was effected which enabled Lewis to commit itself to four fundable research and development projects. Morale-building and training programs which were essential to this change are described.
University of Tennessee Center for Space Transportation and Applied Research (CSTAR)
1995-10-01
The Center for Space Transportation and Applied Research had projects with space applications in six major areas: laser materials processing, artificial intelligence/expert systems, space transportation, computational methods, chemical propulsion, and electric propulsion. The closeout status of all these projects is addressed.
University of Tennessee Center for Space Transportation and Applied Research (CSTAR)
1995-01-01
The Center for Space Transportation and Applied Research had projects with space applications in six major areas: laser materials processing, artificial intelligence/expert systems, space transportation, computational methods, chemical propulsion, and electric propulsion. The closeout status of all these projects is addressed.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-05-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Energy Technology Data Exchange (ETDEWEB)
1994-02-01
The Department of Energy (DOE) has prepared an Environmental Assessment (EA) evaluating the proposed construction and operation of the Strom Thurmond Biomedical Research Center (Center) at the Medical University of South Carolina (MUSC), Charleston, SC. The DOE is evaluating a grant proposal to authorize the MUSC to construct, equip and operate the lower two floors of the proposed nine-story Center as an expansion of on-going clinical research and out-patient diagnostic activities of the Cardiology Division of the existing Gazes Cardiac Research Institute. Based on the analysis in the EA, the DOE has determined that the proposed action does not constitute a major federal action significantly affecting the quality of the human environment within the meaning of the NEPA. Therefore, the preparation of an Environmental Impact Statement is not required.
Bituminization of radioactive wastes at the Nuclear Research Center Karlsruhe
International Nuclear Information System (INIS)
Hild, W.; Kluger, W.; Krause, H.
1976-05-01
A summary is given of the main operational experience gained at the Nuclear Research Center Karlsruhe in 4 years operation of the bituminization plant for evaporator concentrates from low- and medium level wastes. At the same time some of the essential results are compiled that have been obtained in the R + D activities on bituminization. (orig.) [de
MedAustron - Ion-Beam Therapy and Research Center
International Nuclear Information System (INIS)
Schreiner, Thomas; Seemann, Rolf
2015-01-01
MedAustron is a synchrotron-based light-ion beam therapy center for cancer treatment as well as for clinical and non-clinical research, currently in the commissioning phase in Wiener Neustadt, Austria. Recently, the first proton beam was transported successfully to one of the four irradiation rooms. Whilst the choice of basic machine parameters was driven by medical requirements, i.e. 60 MeV protons and 120 MeV/A to 400 MeV/A carbon ions, the accelerator complex design was also optimized to offer flexibility for research operation. The potential of the synchrotron is being exploited to increase the maximum proton energy far beyond the medical needs to up to 800 MeV, for experimental physics applications, mainly in the areas of proton scattering and detector research. The accelerator layout allows for the installation of up to four ion source-spectrometer units, to provide various ion types besides the clinical used protons and carbon ions. Besides experimental physics, the two main non-clinical research disciplines are medical radiation physics and radiation biology. To decouple research and medical operation, a dedicated irradiation room for non-clinical research was included providing the installation of different experiments. In addition, several labs have been equipped with appropriate devices for preparing and analyzing radio-biological samples. This presentation gives a status overview over the whole project and highlights the non-clinical research opportunities at MedAustron. (Author)
International Nuclear Information System (INIS)
Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.
1988-01-01
The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs
Collaborative Mission Design at NASA Langley Research Center
Gough, Kerry M.; Allen, B. Danette; Amundsen, Ruth M.
2005-01-01
NASA Langley Research Center (LaRC) has developed and tested two facilities dedicated to increasing efficiency in key mission design processes, including payload design, mission planning, and implementation plan development, among others. The Integrated Design Center (IDC) is a state-of-the-art concurrent design facility which allows scientists and spaceflight engineers to produce project designs and mission plans in a real-time collaborative environment, using industry-standard physics-based development tools and the latest communication technology. The Mission Simulation Lab (MiSL), a virtual reality (VR) facility focused on payload and project design, permits engineers to quickly translate their design and modeling output into enhanced three-dimensional models and then examine them in a realistic full-scale virtual environment. The authors were responsible for envisioning both facilities and turning those visions into fully operational mission design resources at LaRC with multiple advanced capabilities and applications. In addition, the authors have created a synergistic interface between these two facilities. This combined functionality is the Interactive Design and Simulation Center (IDSC), a meta-facility which offers project teams a powerful array of highly advanced tools, permitting them to rapidly produce project designs while maintaining the integrity of the input from every discipline expert on the project. The concept-to-flight mission support provided by IDSC has shown improved inter- and intra-team communication and a reduction in the resources required for proposal development, requirements definition, and design effort.
International Nuclear Information System (INIS)
Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz
2007-01-01
The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.
The Research Results of Radioactive Waste Management Technology Center Year 1996/1997
International Nuclear Information System (INIS)
Budiman, P.; Martono, H.; Las, T.; Lubis, E.; Mulyanto; Wisnubroto, D. S.; Sucipta
1997-12-01
The research results of Radioactive Waste Management Technology Center, National Atomic Energy Agency of Indonesia year 1996/1997 contain paper as form of research results on radioactive waste management related fields. There were included many aspects such as radioactive waste processing, storage, decontamination, decommissioning, safety and environmental aspects. There are 24 papers and 12 short communications indexed individually(ID)