[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Replication infidelity via a mismatch with Watson-Crick geometry.

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

A Challenge to Watson

Science.gov (United States)

Detterman, Douglas K.

2011-01-01

Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

Ed Watson - 1940-2006

CERN Multimedia

2006-01-01

Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

Science.gov (United States)

Kidd, Gary R.

2004-05-01

Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

Science.gov (United States)

2013-03-20

... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

Science.gov (United States)

2013-10-25

... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

International Nuclear Information System (INIS)

Geltman, S.

1996-01-01

Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

On the scaling limits of Galton Watson processes in varying environment

NARCIS (Netherlands)

Bansaye, V.; Simatos, F.

2011-01-01

Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

Sommerfeld-Watson transformation for nuclear fission

International Nuclear Information System (INIS)

Alexandru, G.

1978-01-01

It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

Science.gov (United States)

Digdon, Nancy; Powell, Russell A; Harris, Ben

2014-11-01

In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

OpenAIRE

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2005-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

Graham Watson: Eesti vajab enam riigi sekkumist majandusse

Index Scriptorium Estoniae

Watson, Graham

2009-01-01

18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

From theory to practice: caring science according to Watson and Brewer.

Science.gov (United States)

Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

2009-10-01

Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

Oncologists partner with Watson on genomics.

Science.gov (United States)

2015-08-01

A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

Did John B. Watson Really "Found" Behaviorism?

Science.gov (United States)

Malone, John C

2014-05-01

Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

Science.gov (United States)

Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

2018-01-01

Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

Science.gov (United States)

Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

2007-01-01

In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

[From humanism to nihilism: dialectics on Jean Watson's caring theory].

Science.gov (United States)

Krol, Pawel J; Lavoie, Mireille

2015-09-01

nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2012-11-13

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2013-06-04

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

A history of the term radical behaviorism: From Watson to Skinner

Science.gov (United States)

Schneider, Susan M.; Morris, Edward K.

1987-01-01

This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

Watson's theorem and resonant pion photoproduction amplitude in the delta channel

International Nuclear Information System (INIS)

Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

1984-01-01

The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Watson's behaviorism: a comparison of the two editions (1925 and 1930).

Science.gov (United States)

Carpintero, Helio

2004-05-01

J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

Science.gov (United States)

Doyle-Lindrud, Susan

2015-02-01

IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

A conversation with Geoff Watson

OpenAIRE

Beran, R. J.; Fisher, N. I.

1998-01-01

Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

Indian Academy of Sciences (India)

IAS Admin

One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

International Nuclear Information System (INIS)

Fargher, H.E.; Roberts, M.J.

1983-01-01

Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

International Nuclear Information System (INIS)

Catalan, G.; Roberts, M.J.

1979-01-01

A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

Directory of Open Access Journals (Sweden)

Cláudio Ivan de Oliveira

Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

International Nuclear Information System (INIS)

Roberts, M.J.

1988-01-01

Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

The Game is aFoot, Watson: DeepQA systems and the future of HCI

OpenAIRE

Keates, Simeon; Varker, Philip

2012-01-01

In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

Science.gov (United States)

Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

2017-07-01

The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

Watson-Crick hydrogen bonding of unlocked nucleic acids

DEFF Research Database (Denmark)

Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

2015-01-01

We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

Watson, Skinner y Algunas Disputas dentro del Conductismo

Directory of Open Access Journals (Sweden)

RICARDO PELLÓN SUÁREZ DE PUGA

2013-01-01

Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

Science.gov (United States)

Chen, Ying; Elenee Argentinis, J D; Weber, Griff

2016-04-01

Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-01-01

Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

Directory of Open Access Journals (Sweden)

Lina Affifatusholihah

2017-04-01

In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

Science.gov (United States)

26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

Interview with Mark Watson

Directory of Open Access Journals (Sweden)

Katy Shaw

2016-04-01

Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

Watson: A new link in the IIE iron chain

Science.gov (United States)

Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

1994-01-01

Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

Science.gov (United States)

Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

2017-12-01

Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

Science.gov (United States)

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

Science.gov (United States)

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

DEFF Research Database (Denmark)

Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

2013-01-01

For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

Science.gov (United States)

Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

2016-10-11

We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

Impact parameter representation from the Watson-Sommerfeld transform

International Nuclear Information System (INIS)

Islam, M.M.

1976-01-01

Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

Some Econometric Results for the Blanchard-Watson Bubble Model

DEFF Research Database (Denmark)

Johansen, Soren; Lange, Theis

The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

de Jean Watson

Directory of Open Access Journals (Sweden)

Thaís Schossler

2008-01-01

Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

OpenAIRE

Rao, B J; Radding, C M

1994-01-01

Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

Science.gov (United States)

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

Ed Watson 1940-2006

CERN Multimedia

2006-01-01

Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

Science.gov (United States)

Malone, John C; García-Penagos, Andrés

2014-07-25

Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-12-01

Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

On the extension of the Fermi-Watson Theorem to high energy diffraction

International Nuclear Information System (INIS)

Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

1995-12-01

The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

Science.gov (United States)

Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

2010-01-01

The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

"Elementary, my dear Watson". Per una falsa citazione

Directory of Open Access Journals (Sweden)

Irene Minella

2014-12-01

Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

Science.gov (United States)

Beck, Hall P.; Levinson, Sharman; Irons, Gary

2009-01-01

In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

Science.gov (United States)

Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

2018-04-24

A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

A chat with James Watson

CERN Multimedia

2011-01-01

On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

Science.gov (United States)

Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

Building Watson: An Overview of the DeepQA Project

OpenAIRE

Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

2010-01-01

IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

DEFF Research Database (Denmark)

Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

2014-01-01

–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

Science.gov (United States)

Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

2018-02-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

Science.gov (United States)

IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

Science.gov (United States)

Caplan, R M

1982-06-01

The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

Energy Technology Data Exchange (ETDEWEB)

Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

2016-03-15

Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

Science.gov (United States)

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

Science.gov (United States)

Hicks, R. E.; Southey, G. N.

1990-01-01

The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

Science.gov (United States)

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

Science.gov (United States)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2017-06-01

The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

Directory of Open Access Journals (Sweden)

Mei-Yu LEE

2014-11-01

Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

The McLean-Watson line strength formula and its implementation

International Nuclear Information System (INIS)

Hey, J D

2009-01-01

We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

James Watson's most inconvenient truth: race realism and the moralistic fallacy.

Science.gov (United States)

Rushton, J Philippe; Jensen, Arthur R

2008-11-01

Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

Science.gov (United States)

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

Comparison of approximate methods for multiple scattering in high-energy collisions. II

International Nuclear Information System (INIS)

Nolan, A.M.; Tobocman, W.; Werby, M.F.

1976-01-01

The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

Science.gov (United States)

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

Directory of Open Access Journals (Sweden)

Luciane Favero

2009-01-01

Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

Science.gov (United States)

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

Science.gov (United States)

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

Directory of Open Access Journals (Sweden)

Roberta Maria Savieto

2016-03-01

Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

International Nuclear Information System (INIS)

Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

2010-01-01

By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

International Nuclear Information System (INIS)

Hey, J D

2014-01-01

As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

Science.gov (United States)

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

Science.gov (United States)

Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

2014-01-01

The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

Science.gov (United States)

Durgun Ozan, Yeter; Okumuş, Hülya

2017-06-01

Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

Science.gov (United States)

Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

2014-01-01

In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

Science.gov (United States)

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

Directory of Open Access Journals (Sweden)

Carme Ferré-Grau

2008-03-01

Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

The Towers Watson Approach to Improving Corporate Wellness.

Science.gov (United States)

Wootton, Adam

2012-06-01

Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

OpenAIRE

Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

2016-01-01

In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

Directory of Open Access Journals (Sweden)

Brent Tisserat

2018-04-01

Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

Directory of Open Access Journals (Sweden)

Ingrid Meireles Gomes

2013-09-01

Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

Science.gov (United States)

Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

2018-01-01

Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

Science.gov (United States)

Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

2018-04-01

Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

Applications of the Galton-Watson process to human DNA evolution and demography

CERN Document Server

Neves, A G M

2005-01-01

We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

Science.gov (United States)

Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

2013-11-01

William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

Computational Methods for Inviscid and Viscous Two-and-Three-Dimensional Flow Fields.

Science.gov (United States)

1975-01-01

Difference Equations Over a Network, Watson Sei. Comput. Lab. Report, 19U9. 173- Isaacson, E. and Keller, H. B., Analaysis of Numerical Methods...element method has given a new impulse to the old mathematical theory of multivariate interpolation. We first study the one-dimensional case, which

Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

Directory of Open Access Journals (Sweden)

Kevin Possin

2014-12-01

Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

Directory of Open Access Journals (Sweden)

Susilawati Susilawati

2016-06-01

Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

Directory of Open Access Journals (Sweden)

Gerry Joseph Nagtzaam

2014-03-01

Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

Energy Technology Data Exchange (ETDEWEB)

Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

1994-09-01

The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Using grounded theory as a method for rigorously reviewing literature

NARCIS (Netherlands)

Wolfswinkel, J.; Furtmueller-Ettinger, Elfriede; Wilderom, Celeste P.M.

2013-01-01

This paper offers guidance to conducting a rigorous literature review. We present this in the form of a five-stage process in which we use Grounded Theory as a method. We first probe the guidelines explicated by Webster and Watson, and then we show the added value of Grounded Theory for rigorously

Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

Science.gov (United States)

Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

2018-04-01

This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

Science.gov (United States)

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

International Nuclear Information System (INIS)

Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

1988-01-01

The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

The case of the missing fingerprints or Dr Watson's cosmology

International Nuclear Information System (INIS)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

Directory of Open Access Journals (Sweden)

Gonzalo Martínez Fernández

2016-01-01

Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Case of the missing fingerprints or Dr. Watson's cosmology

Energy Technology Data Exchange (ETDEWEB)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

Directory of Open Access Journals (Sweden)

Gabriele Guidi

2016-07-01

Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

CERN Multimedia

Patrice Loiez

1999-01-01

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

2003-01-01

Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

Science.gov (United States)

Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

2016-03-16

We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

International Nuclear Information System (INIS)

Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

2000-01-01

This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

CERN Multimedia

Brice, Maximilien

2014-01-01

Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

Science.gov (United States)

Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

2017-12-20

This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

International Nuclear Information System (INIS)

de Prunele, E.

1983-01-01

The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

Science.gov (United States)

Bandyopadhyay, D; Bhattacharyya, D

2006-10-15

It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

Directory of Open Access Journals (Sweden)

Siddharth Jain

Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

Behaviorism

Science.gov (United States)

Moore, J.

2011-01-01

Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

Directory of Open Access Journals (Sweden)

María L. Román-Miranda

2013-01-01

Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

Science.gov (United States)

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

Science.gov (United States)

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Use of Conditional Probability Integral Transformation Method for Testing Accelerated Failure Time Models

Directory of Open Access Journals (Sweden)

Abdalla Ahmed Abdel-Ghaly

2016-06-01

Full Text Available This paper suggests the use of the conditional probability integral transformation (CPIT method as a goodness of fit (GOF technique in the field of accelerated life testing (ALT, specifically for validating the underlying distributional assumption in accelerated failure time (AFT model. The method is based on transforming the data into independent and identically distributed (i.i.d Uniform (0, 1 random variables and then applying the modified Watson statistic to test the uniformity of the transformed random variables. This technique is used to validate each of the exponential, Weibull and lognormal distributions' assumptions in AFT model under constant stress and complete sampling. The performance of the CPIT method is investigated via a simulation study. It is concluded that this method performs well in case of exponential and lognormal distributions. Finally, a real life example is provided to illustrate the application of the proposed procedure.

Automated problem list generation and physicians perspective from a pilot study.

Science.gov (United States)

Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric

2017-09-01

An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

Different methods and metaphysics in early molecular genetics--a case of disparity of research?

Science.gov (United States)

Deichmann, Ute

2008-01-01

The encounter between two fundamentally different approaches in seminal research in molecular biology--the problems, aims, methods and metaphysics--is delineated and analyzed. They are exemplified by the microbiologist Oswald T. Avery who, in line with the reductionist mechanistic metaphysics of Jacques Loeb, attempted to explain basic life phenomena through chemistry; and the theoretical physicist Max Delbrück who, influenced by Bohr's antimechanistic views, preferred to explain these phenomena without chemistry. Avery's and Delbrück's most important studies took place concurrently. Thus analysis of their contrasting approaches lends itself to examination of the Weltanschauungen view concerning the role of fundamental (metaphysical) assumptions in scientific change, that is, the view that empirical research cannot be neutral in regard to the worldviews of the researchers. This study shows that the initial ostensible disparity (non-integratibility) of the two approaches lasted for just a short time. Ironically it was a student of Delbrück's school, James Watson, who (with Crick) proposed a chemical model, the DNA double helix, as a solution to Delbrück's problem. The structure of DNA has not been seriously challenged over the past half century Moreover, Watson's and Crick's work did not call into question the validity of Delbrück's research, but opened it up to entirely new approaches. The case of Avery and Delbrück demonstrates that after initial obstacles were overcome the different fundamental attitudes and the resulting research practices were capable of integration.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

Science.gov (United States)

Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

2018-01-01

The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

Science.gov (United States)

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

International Nuclear Information System (INIS)

Gao, X.; Patel, D.J.

1988-01-01

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

Science.gov (United States)

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

Science.gov (United States)

Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

2017-10-01

In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

Science.gov (United States)

Shanker, Sudhanshu; Bandyopadhyay, Pradipta

2017-08-01

The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

Richard Watson.

Science.gov (United States)

Wright, Ian; Bevin, William

2017-11-25

An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

Sleeping under the stars

Science.gov (United States)

Zirkel, Jack

Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

Predicting and Modeling RNA Architecture

Science.gov (United States)

Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice

2011-01-01

SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963

On Fair Lotteries

OpenAIRE

STONE, PETER

2008-01-01

PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-l-LNA

DEFF Research Database (Denmark)

Kosbar, Tamer R.; Sofan, Mamdouh A.; Abou-Zeid, Laila

2015-01-01

G-rich anti-parallel DNA triplexes were modified with LNA or α-l-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability...... of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-l-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-l-LNA and LNA in the middle of the triplex...

A new computational method for the detection of horizontal gene transfer events.

Science.gov (United States)

Tsirigos, Aristotelis; Rigoutsos, Isidore

2005-01-01

In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

Statistical Moments in Variable Density Incompressible Mixing Flows

Science.gov (United States)

2015-08-28

59]. The algorithm uses an approximate projection method [16] with the interface modeled with the Immersed Boundary Method ( IBM ), as spread via a nu...and B. C. Watson . Taylor instability of finite surface waves. J. Fluid Mech., 7:177–193, 1960. [32] E. Fermi. Taylor instability of an

Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

Science.gov (United States)

2010-03-01

that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

Science.gov (United States)

Panczyk, Tomasz; Wolski, Pawel

2018-06-01

This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

Science.gov (United States)

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

Science.gov (United States)

Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

2017-07-11

RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

Science.gov (United States)

Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

2013-12-01

Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

Directory of Open Access Journals (Sweden)

Marjan Diayanat

2018-02-01

Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

Spectral density regression for bivariate extremes

KAUST Repository

Castro Camilo, Daniela; de Carvalho, Miguel

2016-01-01

can be seen as an extension of the Nadaraya–Watson estimator where the usual scalar responses are replaced by mean constrained densities on the unit interval. Numerical experiments with the methods illustrate their resilience in a variety of contexts

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

Science.gov (United States)

2010-10-01

DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

Science.gov (United States)

2011-10-01

or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

Science.gov (United States)

2012-07-01

like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

Behaviorism and Neuroscience.

Science.gov (United States)

Thompson, Richard F.

1994-01-01

The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)

Scattering in an intense radiation field: Time-independent methods

International Nuclear Information System (INIS)

Rosenberg, L.

1977-01-01

The standard time-independent formulation of nonrelativistic scattering theory is here extended to take into account the presence of an intense external radiation field. In the case of scattering by a static potential the extension is accomplished by the introduction of asymptotic states and intermediate-state propagators which account for the absorption and induced emission of photons by the projectile as it propagates through the field. Self-energy contributions to the propagator are included by a systematic summation of forward-scattering terms. The self-energy analysis is summarized in the form of a modified perturbation expansion of the type introduced by Watson some time ago in the context of nuclear-scattering theory. This expansion, which has a simple continued-fraction structure in the case of a single-mode field, provides a generally applicable successive approximation procedure for the propagator and the asymptotic states. The problem of scattering by a composite target is formulated using the effective-potential method. The modified perturbation expansion which accounts for self-energy effects is applicable here as well. A discussion of a coupled two-state model is included to summarize and clarify the calculational procedures

VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

Directory of Open Access Journals (Sweden)

M. R. Barrón-Yánez

2009-01-01

(Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

Gompertz: A Scilab Program for Estimating Gompertz Curve Using Gauss-Newton Method of Least Squares

Directory of Open Access Journals (Sweden)

Surajit Ghosh Dastidar

2006-04-01

Full Text Available A computer program for estimating Gompertz curve using Gauss-Newton method of least squares is described in detail. It is based on the estimation technique proposed in Reddy (1985. The program is developed using Scilab (version 3.1.1, a freely available scientific software package that can be downloaded from http://www.scilab.org/. Data is to be fed into the program from an external disk file which should be in Microsoft Excel format. The output will contain sample size, tolerance limit, a list of initial as well as the final estimate of the parameters, standard errors, value of Gauss-Normal equations namely GN1 GN2 and GN3 , No. of iterations, variance(σ2 , Durbin-Watson statistic, goodness of fit measures such as R2 , D value, covariance matrix and residuals. It also displays a graphical output of the estimated curve vis a vis the observed curve. It is an improved version of the program proposed in Dastidar (2005.

Gompertz: A Scilab Program for Estimating Gompertz Curve Using Gauss-Newton Method of Least Squares

Directory of Open Access Journals (Sweden)

Surajit Ghosh Dastidar

2006-04-01

Full Text Available A computer program for estimating Gompertz curve using Gauss-Newton method of least squares is described in detail. It is based on the estimation technique proposed in Reddy (1985. The program is developed using Scilab (version 3.1.1, a freely available scientific software package that can be downloaded from http://www.scilab.org/. Data is to be fed into the program from an external disk file which should be in Microsoft Excel format. The output will contain sample size, tolerance limit, a list of initial as well as the final estimate of the parameters, standard errors, value of Gauss-Normal equations namely GN1 GN2 and GN3, No. of iterations, variance(σ2, Durbin-Watson statistic, goodness of fit measures such as R2, D value, covariance matrix and residuals. It also displays a graphical output of the estimated curve vis a vis the observed curve. It is an improved version of the program proposed in Dastidar (2005.

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

Fidelity Mechanisms of DNA Polymerase Alpha

Science.gov (United States)

2008-07-23

between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

X-Ray Diffraction and the Discovery of the Structure of DNA

Science.gov (United States)

Crouse, David T.

2007-01-01

A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

Science.gov (United States)

Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

2016-06-01

Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

Contemporary Danish book art

DEFF Research Database (Denmark)

Larsen, Poul Steen

the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

A Vision System Model

Science.gov (United States)

1991-06-01

Away" in Mind and Cognition: A Reader. Ed. William G. Lycan. Cambridge MA: Basil Blackwell. Pp. 63-77. (1990c). Descartes , Rene . Rules for the Direction...other case, we accept that we cannot or need not understand the methods of the brain [behaviorism - Watson; Dualism - Descartes ; Intentionalism

78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

Science.gov (United States)

2013-01-31

.... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Total Body Water Determination: Have We To Adapt Its Determination To The Patient Clinical Status?

Directory of Open Access Journals (Sweden)

Almudena Pérez Torres

2012-06-01

Conclusion: There is a good concordance between both methods in the determination of the TBW. The Watson formula overestimates the TBW in patients with high %FM and underestimates in those with high FFM. In the clinical practice, it is necessary to adapt the determination of TBW to the patient situation.

Discrete state perturbation theory via Green's functions

International Nuclear Information System (INIS)

Rubinson, W.

1975-01-01

The exposition of stationary-state perturbation theory via the Green's function method in Goldberger and Watson's Collision Theory is reworked in a way that makes explicit its mathematical basis. It is stressed that the theory consists of the construction of, and manipulations on, a mathematical identity. The perturbation series fall out of the identity almost immediately. The logical status of the method is commented on

The ϱ-ππ coupling constant in lattice gauge theory

Science.gov (United States)

Gottlieb, Steven; MacKenzie, Paul B.; Thacker, H. B.; Weingarten, Don

1984-01-01

We present a method for studying hadronic transitions in lattice gauge theory which requires computer time comparable to that required by recent hadron spectrum calculations. This method is applied to a calculation of the decay ϱ-->ππ. On leave from the Department of Physics, Indiana University, Bloomington, IN 47405, USA. Address after September 1, 1983: IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598, USA.

75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

Science.gov (United States)

2010-09-07

... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

Commentary on Malone: Who Founded Behaviorism?

Science.gov (United States)

Reese, Hayne W

2015-05-01

Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

NARCIS (Netherlands)

Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

1995-01-01

In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

Science.gov (United States)

Fukawa-Connelly, Timothy Patrick; Newton, Charlene

2014-01-01

Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

the use of research in protected area management in Madagascar

African Journals Online (AJOL)

they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

The web server of IBM's Bioinformatics and Pattern Discovery group.

Science.gov (United States)

Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo

2003-07-01

We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.

Genetics by the Numbers

Science.gov (United States)

... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

A Middle-School Classroom Inquiry: Estimating the Height of a Tree

Science.gov (United States)

Watson, Jane; Brown, Natalie; Wright, Suzie; Skalicky, Jane

2011-01-01

There is an old saying that "there is more than one way to skin a cat." Such is the case with finding the height of tall objects, a task that people have been approximating for centuries. Following an article in the "Australian Primary Mathematics Classroom" (APMC) with methods appropriate for primary students (Brown, Watson,…

Does Size Matter?

Science.gov (United States)

Watson, David

2014-01-01

In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

Educational Technologists: Leading Change for a New Paradigm of Education

Science.gov (United States)

Aslan, Sinem; Reigeluth, Charles M.

2013-01-01

The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

Music Technology and Musical Creativity: Making Connections

Science.gov (United States)

Thompson, Douglas Earl

2012-01-01

This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

Bringing Precision Medicine to Community Oncologists.

Science.gov (United States)

2017-01-01

Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

Anti-parallel triplexes

DEFF Research Database (Denmark)

Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.

2015-01-01

about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...

and electro-production of mesons with arbitrary spins

Indian Academy of Sciences (India)

carried out by straightforward methods'. These formulae apply directly for photo- production of other pseudoscalar mesons like η. In the case of the isovector pion, an earlier isospin analysis by Watson [13] was made use of to express each one of these amplitudes Fi(i = 1–4) in terms of three independent nucleon isospin ...

Possible role of double scattering in electron-atom scattering in a laser field

International Nuclear Information System (INIS)

Rabadan, I.; Mendez, L.; Dickinson, A.S.

1996-01-01

By considering observations of double-scattering effects in the excitation of the 2 1 P level of He, gas density values estimated for the laser-assisted elastic scattering experiments of Wallbank and Holmes (1993, 1994a,b) for which the Kroll-Watson approximation appears to fail. Using comparable densities for He and lower densities for Ar, and assuming the Kroll-Watson approximation for single-scattering events, differential cross sections are calculated including double scattering for laser-assisted scattering for a range of energies and scattering angles. Comparison with the observed values shows that double-scattering effects can give a semi-quantitative explanation of the apparent breakdown of the Kroll-Watson approximation in both He and Ar. (author)

Extended low-frequency approximation for laser-modified electron scattering: Coulomb effects

International Nuclear Information System (INIS)

Mittleman, M.H.

1988-01-01

The Kroll-Watson [N.M. Kroll and K. M. Watson, Phys. Rev. A 8, 804 (1973)] theory for electron scattering in the field of a low-frequency laser has been extended by L. Rosenberg [Phys. Rev. A 23, 2283 (1981); 28, 2727 (1983)] to apply to higher intensities. That result is rederived in another way so as to make the correction second order. The correction terms are obtained and shown to be small in the high-intensity low-energy regime in which the original theory is weakest. The special case of a Coulomb potential is analyzed and shown to present special peculiarities in the extended theory just as in the original Kroll-Watson theory

A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

Science.gov (United States)

Willis, Derek W.

2010-01-01

This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

Eckert, Wallace John (1902-71)

Science.gov (United States)

Murdin, P.

2000-11-01

Computer scientist and astronomer. Born in Pittsburgh, PA, Eckert was a pioneer of the use of IBM punched card equipment for astronomical calculations. As director of the US Nautical Almanac Office he introduced computer methods to calculate and print tables instead of relying on human `computers'. When, later, he became director of the Watson Scientific Computing Laboratory at Columbia Universit...

Examining Current Conceptualizations of Psychopathology With the MMPI-2/MMPI-2-RF Restructured Clinical Scales: Preliminary Findings From a Cross-Cultural Study.

Science.gov (United States)

Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S

2017-01-01

Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.

Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

Science.gov (United States)

2011-07-01

AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

Nonequilibrium Phase Transitions Associated with DNA Replication

Science.gov (United States)

2011-02-11

polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

The web server of IBM's Bioinformatics and Pattern Discovery group: 2004 update.

Science.gov (United States)

Huynh, Tien; Rigoutsos, Isidore

2004-07-01

In this report, we provide an update on the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server, which is operational around the clock, provides access to a large number of methods that have been developed and published by the group's members. There is an increasing number of problems that these tools can help tackle; these problems range from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences, the identification--directly from sequence--of structural deviations from alpha-helicity and the annotation of amino acid sequences for antimicrobial activity. Additionally, annotations for more than 130 archaeal, bacterial, eukaryotic and viral genomes are now available on-line and can be searched interactively. The tools and code bundles continue to be accessible from http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.

Improving the Army’s Next Effort in Technology Forecasting

Science.gov (United States)

2010-09-01

DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

OSA Proceedings on Ultrafast Electronics and Optoelectronics Held in San Francisco, California on January 25 -27, 1993. Volume 14,

Science.gov (United States)

1993-01-27

Fetterman , University of California, Los Angeles M. Fischetti, IBM T. J. Watson Research Center D. Grischkowski, IBM T. J. Watson Research Center E. P. Ippen...Spectroscopy System ............................. 112 Jeffrey S. Bostak, Daniel W. Van Der Weide, Ikuro Aoki, Bertram A. Aul" and David M. Bloom Sub-Picosecond...Martin, F. K. Oshita, and H. R. Fetterman ix On-Wafer Optoelectronic Techniques for Millimeter-Wave Generation, Control, and Circuit Characterization

Determination of the Effects of Medium Composition on the Monochloramine Disinfection Kinetics of Nitrosomonas europaea by the Propidium Monoazide Quantitative PCR and Live/Dead BacLight Methods ▿

Science.gov (United States)

Wahman, David G.; Schrantz, Karen A.; Pressman, Jonathan G.

2010-01-01

Various medium compositions (phosphate, 1 to 50 mM; ionic strength, 2.8 to 150 meq/liter) significantly affected Nitrosomonas europaea monochloramine disinfection kinetics, as determined by the Live/Dead BacLight (LD) and propidium monoazide quantitative PCR (PMA-qPCR) methods (lag coefficient, 37 to 490 [LD] and 91 to 490 [PMA-qPCR] mg·min/liter; Chick-Watson rate constant, 4.0 × 10−3 to 9.3 × 10−3 [LD] and 1.6 × 10−3 to 9.6 × 10−3 [PMA-qPCR] liter/mg·min). Two competing effects may account for the variation in disinfection kinetic parameters: (i) increasing kinetics (disinfection rate constant [k] increased, lag coefficient [b] decreased) with increasing phosphate concentration and (ii) decreasing kinetics (k decreased, b increased) with increasing ionic strength. The results support development of a standard medium for evaluating disinfection kinetics in drinking water. PMID:20952645

How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-08-14

The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

Glutamate Receptor Aptamers and ALS

Science.gov (United States)

2009-01-01

considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

A method to evaluate genome-wide methylation in archival formalin-fixed, paraffin-embedded ovarian epithelial cells.

Directory of Open Access Journals (Sweden)

Qiling Li

Full Text Available The use of DNA from archival formalin and paraffin embedded (FFPE tissue for genetic and epigenetic analyses may be problematic, since the DNA is often degraded and only limited amounts may be available. Thus, it is currently not known whether genome-wide methylation can be reliably assessed in DNA from archival FFPE tissue.Ovarian tissues, which were obtained and formalin-fixed and paraffin-embedded in either 1999 or 2011, were sectioned and stained with hematoxylin-eosin (H&E.Epithelial cells were captured by laser micro dissection, and their DNA subjected to whole genomic bisulfite conversion, whole genomic polymerase chain reaction (PCR amplification, and purification. Sequencing and software analyses were performed to identify the extent of genomic methylation. We observed that 31.7% of sequence reads from the DNA in the 1999 archival FFPE tissue, and 70.6% of the reads from the 2011 sample, could be matched with the genome. Methylation rates of CpG on the Watson and Crick strands were 32.2% and 45.5%, respectively, in the 1999 sample, and 65.1% and 42.7% in the 2011 sample.We have developed an efficient method that allows DNA methylation to be assessed in archival FFPE tissue samples.

Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

Science.gov (United States)

Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

2018-01-01

A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

Automated Information Enrichment for a Better Search

OpenAIRE

José Luis Preza

2016-01-01

The process of adding the Metadata when uploading a digital object onto a repository is usually manual. This means that the user has to have already at hand the keywords and all the other information about the asset. This paper addresses the possibility of enriching the “manual metadata” by generating automated metadata using the cognitive services provided by technologies like IBM Watson platform. The cognitive computing services offered by IBM Watson automatically generate Semantic Data (in...

Healthcare Information Technology (HIT) in an Anti-Access (A2) and Area Denial (AD) Environment

Science.gov (United States)

2014-03-01

point for multiple sites to connect to each other so radiologists can read diagnostic images by managing firewall connections. The idea of multiple...learn from them.41 Although IBM’s Watson isn’t living up to the hype just yet, the artificial intelligent ( AI ) computer system is a precursor for a...on the ground can control a UAV with two passengers in it; one technician and one AI healthcare machine (Medical IBM Watson). Once the UAV lands

Coulomb interaction in multiple scattering theory

International Nuclear Information System (INIS)

Ray, L.; Hoffmann, G.W.; Thaler, R.M.

1980-01-01

The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reaction cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+ 208 Pb elastic scattering and compared with experimental data

Detection of mutations in genes by specific LNA primers

DEFF Research Database (Denmark)

2001-01-01

acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

The discovery of the structure of DNA

Science.gov (United States)

Squires, G. L.

2003-04-01

On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

Visual marking and change blindness : moving occluders and transient masks neutralize shape changes to ignored objects

OpenAIRE

Watson, Derrick G.; Kunar, Melina A.

2010-01-01

Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys, 2002). Here we present 5 experiments that examined whether such object changes are still effective in recapturing attention if the changes occur while the pr...

Foreign Broadcast Information Service. History. Part 1: 1941-1947

Science.gov (United States)

1969-04-01

station outside the Punchbowl. Then the·tlold bugaboo ". arose, as Paige put it in a letter on 24 July 1944. Paige said he had asked for clarification...transfer ofFBIS personnel to PWB jurisdiction proved to be a rather poor invest - ment from an FBIS standpoint. PWB, a joint U.S.-British organization...communist front groups, and said Watson belonged to all of them. Fly’~ reply assured Dies that he had been misinformed. Watson had been thoroughly invest

Distance breached or distance transformed? Dilemmas of simulated and banal closeness in humanitarian communication

DEFF Research Database (Denmark)

Bajde, Domen; Knudsen, Gry Høngsmark

Social media have been argued to have transformed humanitarian communication and those involved in it. Networked humanitarian organizations are supposedly more open and transparent (Kanter and Fine 2010) and their “audiences” too are networked and "cause-wired" (Watson 2009), implying an unpreced......Social media have been argued to have transformed humanitarian communication and those involved in it. Networked humanitarian organizations are supposedly more open and transparent (Kanter and Fine 2010) and their “audiences” too are networked and "cause-wired" (Watson 2009), implying...

Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing

Science.gov (United States)

2010-01-01

DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research addresses how the...Acid dsDNA double stranded DNA MOSAIC Mobile Stream Processing Cluster PCR Polymerase Chain Reaction RAM Random Access Memory ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ...are 5′→3′ and strands with strikethrough are 3′→5′. A dsDNA duplex formed between a strand and its reverse complement is called a

Animal welfare in brown trout farming: hematological results

Directory of Open Access Journals (Sweden)

G. Forneris

2010-01-01

Full Text Available The effect of stress resulting from fish farming has received considerable attention in this last period and fish welfare in aquaculture is a relevant topic, very important for the future of aquaculture (Watson et al., 2004; Klinger et al., 1996; Peres et al., 2004; Ron et al., 1995;Wagner et al., 1995;Watson et al., 1998. Brown trout farming is less developed then rainbow trout farming, but this kind of fish farming is increasing, mainly for fish conservation and restocking aquaculture.

"Doktor Watson minu õuel!" / Allar Viivik

Index Scriptorium Estoniae

Viivik, Allar

2002-01-01

Äsjalahkunud näitlejat Vitali Solominit (1941-2002) meenutab Juuliku villa elanik Leo Orav. Siin filmis režissöör Igor Maslennikov paar episoodi "Baskerville'de koerast" vene Sherlock Holmes'i seriaalist. Vitali Solomin mängis doktor Watsonit. Ka teistest selle seriaali võttepaikadest Eestis

Alternative Watson-Crick Synthetic Genetic Systems.

Science.gov (United States)

Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

2016-11-01

In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

HuMiTar: A sequence-based method for prediction of human microRNA targets

Directory of Open Access Journals (Sweden)

Chen Ke

2008-12-01

Full Text Available Abstract Background MicroRNAs (miRs are small noncoding RNAs that bind to complementary/partially complementary sites in the 3' untranslated regions of target genes to regulate protein production of the target transcript and to induce mRNA degradation or mRNA cleavage. The ability to perform accurate, high-throughput identification of physiologically active miR targets would enable functional characterization of individual miRs. Current target prediction methods include traditional approaches that are based on specific base-pairing rules in the miR's seed region and implementation of cross-species conservation of the target site, and machine learning (ML methods that explore patterns that contrast true and false miR-mRNA duplexes. However, in the case of the traditional methods research shows that some seed region matches that are conserved are false positives and that some of the experimentally validated target sites are not conserved. Results We present HuMiTar, a computational method for identifying common targets of miRs, which is based on a scoring function that considers base-pairing for both seed and non-seed positions for human miR-mRNA duplexes. Our design shows that certain non-seed miR nucleotides, such as 14, 18, 13, 11, and 17, are characterized by a strong bias towards formation of Watson-Crick pairing. We contrasted HuMiTar with several representative competing methods on two sets of human miR targets and a set of ten glioblastoma oncogenes. Comparison with the two best performing traditional methods, PicTar and TargetScanS, and a representative ML method that considers the non-seed positions, NBmiRTar, shows that HuMiTar predictions include majority of the predictions of the other three methods. At the same time, the proposed method is also capable of finding more true positive targets as a trade-off for an increased number of predictions. Genome-wide predictions show that the proposed method is characterized by 1.99 signal

Numerical and experimental investigations into life assessment of blade-disc connections of gas turbines

International Nuclear Information System (INIS)

Issler, Stephan; Roos, Eberhard

2003-01-01

The positively engaged connection between blade and disc of a gas turbine s highly stressed by fatigue and creep fatigue loadings. For this purpose, a ew calculating method based on inelastic finite element analyses considering he main influences on damage was developed at MPA Stuttgart. Low cycle fatigue (LCF) tests with component-like specimens have been conducted for verification. Experimental data and life assessment results based on the Smith, Watson and Topper parameters were compared well

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

1-, 2-, and 4-Ethynylpyrenes in the Structure of Twisted Intercalating Nucleic Acids: Structure, Thermal Stability, and Fluorescence Relationship

DEFF Research Database (Denmark)

Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

2008-01-01

to ortho in homopyrimidine TINAs. Thus, for para-TINAs the bulge insertion of an intercalator led to high thermal stability of Hoogsteen-type parallel triplexes and duplexes, whereas Watson-Cricktype duplexes were destabilized. In the case of ortho-TINA, both Hoogsteen and Watson-Crick-type complexes were......A postsynthetic, on-column Sonogashira reaction was applied on DNA molecules modified by 2- or 4-iodophenylmethylglycerol in the middle of the sequence, to give the corresponding ortho- and para-twisted intercalating nucleic acids (TINA) with 1-, 2-, and 4-ethynylpyrene residues. The convenient...

Pathogenesis of Septic Acute Lung Injury and Strategies for Immuno-Pharmacological Therapy.

Science.gov (United States)

1996-10-01

J Cell Biol 120:1227-1235. 90. Lasky, L. A., M. S. Singer, D. Dowbenko, Y. Imai, W. J. Henzel, C. Grimley, C. Fennie , N. Gillett, S. R. Watson, and...Rats. J. Immunol 152:832-840. 102. Lasky, L. A., M. S. Singer, T. A. Yednock, D. Dowbenko, C. Fennie , H. Rodriguez, T. Nguyen, S. Stachel, and S. D...1132-1135. 105. Foxall, C. R., S. R. Watson, C. Fennie , L. A. Lasky, M. Kiso, A. Hasegawa, D. Asa, and B. Brandley. 1992. The three members of the

Millimetre-wave spectrum of anti-13C1 and 13C2 isotopologues of ethanol

International Nuclear Information System (INIS)

Bouchez, Aurelia; Walters, Adam; Müller, Holger S.P.; Ordu, Matthias; Lewen, Frank; Koerber, Monika; Bottinelli, Sandrine; Endres, Christian P.; Schlemmer, Stephan

2012-01-01

The rotational spectra of the two monosubstituted 13 C isotopologues of the anti conformer of ethanol have been measured between 80-800 GHz using three different spectrometers at the Cologne Laboratory Astrophysics group. The dataset was constrained for fitting with a standard Watson-S reduction Hamiltonian by rejecting transitions from high-lying states showing significant perturbation with the gauche states and by averaging some small methyl torsional splits. This treatment is compatible with the needs for a first astrophysical research for which an appropriate set of predictions is given.

Particle Deposition onto Enclosure Surfaces

Science.gov (United States)

2009-08-20

quantitative descriptions were published by Watson in 193633 and Zernik in 1957.34 Thermophoretic force arises from asymmetrical interactions of an aerosol...N t vq CN II s .— o B *-* 2 ^ 3d - CO > X3 CO o feel s.i = ••§ 5 o 5 Ci- vs CJ O T3 0< _ JH C TJ CO — C ca -a 5...Edinburgh 32,239(1884). 52 33. H. H. Watson, "The Dust-Free Space Surrounding Hot Bodies," Trans. Faraday Soc. 32, 1073 (1936). 34. W. Zernik , "The

Complex integration and Cauchy's theorem

CERN Document Server

Watson, GN

2012-01-01

This brief monograph by one of the great mathematicians of the early twentieth century offers a single-volume compilation of propositions employed in proofs of Cauchy's theorem. Developing an arithmetical basis that avoids geometrical intuitions, Watson also provides a brief account of the various applications of the theorem to the evaluation of definite integrals.Author G. N. Watson begins by reviewing various propositions of Poincaré's Analysis Situs, upon which proof of the theorem's most general form depends. Subsequent chapters examine the calculus of residues, calculus optimization, the

A sensitive, support-vector-machine method for the detection of horizontal gene transfers in viral, archaeal and bacterial genomes.

Science.gov (United States)

Tsirigos, Aristotelis; Rigoutsos, Isidore

2005-01-01

In earlier work, we introduced and discussed a generalized computational framework for identifying horizontal transfers. This framework relied on a gene's nucleotide composition, obviated the need for knowledge of codon boundaries and database searches, and was shown to perform very well across a wide range of archaeal and bacterial genomes when compared with previously published approaches, such as Codon Adaptation Index and C + G content. Nonetheless, two considerations remained outstanding: we wanted to further increase the sensitivity of detecting horizontal transfers and also to be able to apply the method to increasingly smaller genomes. In the discussion that follows, we present such a method, Wn-SVM, and show that it exhibits a very significant improvement in sensitivity compared with earlier approaches. Wn-SVM uses a one-class support-vector machine and can learn using rather small training sets. This property makes Wn-SVM particularly suitable for studying small-size genomes, similar to those of viruses, as well as the typically larger archaeal and bacterial genomes. We show experimentally that the new method results in a superior performance across a wide range of organisms and that it improves even upon our own earlier method by an average of 10% across all examined genomes. As a small-genome case study, we analyze the genome of the human cytomegalovirus and demonstrate that Wn-SVM correctly identifies regions that are known to be conserved and prototypical of all beta-herpesvirinae, regions that are known to have been acquired horizontally from the human host and, finally, regions that had not up to now been suspected to be horizontally transferred. Atypical region predictions for many eukaryotic viruses, including the alpha-, beta- and gamma-herpesvirinae, and 123 archaeal and bacterial genomes, have been made available online at http://cbcsrv.watson.ibm.com/HGT_SVM/.

Spectral density regression for bivariate extremes

KAUST Repository

Castro Camilo, Daniela

2016-05-11

We introduce a density regression model for the spectral density of a bivariate extreme value distribution, that allows us to assess how extremal dependence can change over a covariate. Inference is performed through a double kernel estimator, which can be seen as an extension of the Nadaraya–Watson estimator where the usual scalar responses are replaced by mean constrained densities on the unit interval. Numerical experiments with the methods illustrate their resilience in a variety of contexts of practical interest. An extreme temperature dataset is used to illustrate our methods. © 2016 Springer-Verlag Berlin Heidelberg

(Mis)understanding Science: The Problem with Scientific Breakthroughs.

Science.gov (United States)

Evans, James P

2016-09-01

On Saturday morning, February 28, 1953, the mystery of heredity appeared secure. Humans hadn't the faintest idea of how genetic information was transmitted-how the uncanny resemblance between mother and daughter, grandfather and grandson was conveyed across generations. Yet, by that Saturday afternoon, two individuals, James Watson and Francis Crick, had glimpsed the solution to these mysteries. The story of Watson and Crick's great triumph has been told and retold and has rightly entered the pantheon of scientific legend. But Watson and Crick's breakthrough was just that: a rupture and dramatic discontinuity in human knowledge that solved a deep mystery, the likes of which occurs, perhaps, a couple of times each century. And that's the problem. The story is just so good and so irresistible that it has misled generations of scientists about what to expect regarding a life in science. And more damaging, the resulting breakthrough mentality misleads the public, the media, and society's decision-makers about how science really works, all to the detriment of scientific progress and our society's well-being. © 2016 The Hastings Center.

After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.

Science.gov (United States)

Creager, Angela N H; Morgan, Gregory J

2008-06-01

Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.

Branching processes and neutral evolution

CERN Document Server

Taïb, Ziad

1992-01-01

The Galton-Watson branching process has its roots in the problem of extinction of family names which was given a precise formulation by F. Galton as problem 4001 in the Educational Times (17, 1873). In 1875, an attempt to solve this problem was made by H. W. Watson but as it turned out, his conclusion was incorrect. Half a century later, R. A. Fisher made use of the Galton-Watson process to determine the extinction probability of the progeny of a mutant gene. However, it was J. B. S. Haldane who finally gave the first sketch of the correct conclusion. J. B. S. Haldane also predicted that mathematical genetics might some day develop into a "respectable branch of applied mathematics" (quoted in M. Kimura & T. Ohta, Theoretical Aspects of Population Genetics. Princeton, 1971). Since the time of Fisher and Haldane, the two fields of branching processes and mathematical genetics have attained a high degree of sophistication but in different directions. This monograph is a first attempt to apply the current sta...

Role modeling excellence in clinical nursing practice.

Science.gov (United States)

Perry, R N Beth

2009-01-01

Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.

Simple apparatus for polarization sensing of analytes

Science.gov (United States)

Gryczynski, Zygmunt; Gryczynski, Ignacy; Lakowicz, Joseph R.

2000-09-01

We describe a simple device for fluorescence sensing based on an unexpansive light source, a dual photocell and a Watson bridge. The emission is detected from two fluorescent samples, one of which changes intensity in response to the analyte. The emission from these two samples is observed through two orthogonally oriented polarizers and an analyzer polarizer. The latter polarizer is rotated to yield equal intensities from both sides of the dual photocell, as determined by a zero voltage from the Watson bridge. Using this device, we are able to measure fluorescein concentration to an accuracy near 2% at 1 (mu) M fluorescein, and pH values accurate to +/- 0.02 pH units. We also use this approach with a UV hand lamp and a glucose-sensitive protein to measure glucose concentrations near 2 (mu) M to an accuracy of +/- 0.1 (mu) M. This approach requires only simple electronics, which can be battery powered. Additionally, the method is generic, and can be applied with any fluorescent sample that displays a change in intensity. One can imagine this approach being used to develop portable point-of-care clinical devices.

Two speeches that changed the world: from Fulton to Zurich

Directory of Open Access Journals (Sweden)

Alan John Watson

2016-12-01

Full Text Available In this extract from his new book Churchill’s Legacy: Two Speeches to Save the World (Watson, 2016, Lord Watson of Richmond draws on his own experience of post war British politics, as a television presenter and media commentator and then as a Liberal Peer and Chairman of the English-Speaking Union, to analyse the significance of Churchill’s Zurich speech of 19 September 1946. He argues that, building on Churchill’s earlier speech at Fulton, Missouri, it helped change the perceptions of the West and alter their response to the emerging Cold War and the future of Europe.

Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

DEFF Research Database (Denmark)

Aagaard, C; Douthwaite, S

1994-01-01

RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

The psyche as behavior

OpenAIRE

Clavijo A., Arturo

2012-01-01

Según el conductismo, el comportamiento constituye la Psique y el tema de estudio de la psicología. Aunque algunos científicos habían realizado trabajos empíricos con métodos objetivos antes de 1913, año en el que John B. Watson publicó su manifiesto, este último fue el primero en intentar la sistematización de la conducta como equivalente a la Psique, esto es, como el objeto de estudio de la psicología. El artículo discute la noción de comportamiento de Watson y la compara con otras dos form...

Visualization of 2-D and 3-D fields from its value in a finite number of points

International Nuclear Information System (INIS)

Dari, E.A.; Venere, M.J.

1990-01-01

This work describes a method for the visualization of two- and three-dimensional fields, given its value in a finite number of points. These data can be originated in experimental measurements, numerical results, or any other source. For the field interpolation, the space is divided into simplices (triangles or tetrahedrons), using the Watson algorithm to obtain the Delaunay triangulation. Inside each simplex, linear interpolation is assumed. The visualization is accomplished by means of Finite Elements post-processors, capable of handling unstructured meshes, which were also developed by the authors. (Author) [es

Investigation of Nanophase Materials for Thermoelectric Applications

National Research Council Canada - National Science Library

Stokes, Kevin

2004-01-01

.... Watson Research Center. Our major accomplishments include the chemical synthesis of nanoparticles, nanorods and nanowires of lead chalcogenide, bismuth calcogenide and bismuth antimony materials...

A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

International Nuclear Information System (INIS)

Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

2011-01-01

Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

Evaluation of a scatter correlation technique for single photon transmission measurements in PET by means of Monte Carlo simulations

International Nuclear Information System (INIS)

Wegmann, K.; Brix, G.

2000-01-01

Purpose: Single photon transmission (SPT) measurements offer a new approach for the determination of attenuation correction factors (ACF) in PET. It was the aim of the present work, to evaluate a scatter correction alogrithm proposed by C. Watson by means of Monte Carlo simulations. Methods: SPT measurements with a Cs-137 point source were simulated for a whole-body PET scanner (ECAT EXACT HR + ) in both the 2D and 3D mode. To examine the scatter fraction (SF) in the transmission data, the detected photons were classified as unscattered or scattered. The simulated data were used to determine (i) the spatial distribution of the SFs, (ii) an ACF sinogram from all detected events (ACF tot ) and (iii) from the unscattered events only (ACF unscattered ), and (iv) an ACF cor =(ACF tot ) 1+Κ sinogram corrected according to the Watson algorithm. In addition, density images were reconstructed in order to quantitatively evaluate linear attenuation coefficients. Results: A high correlation was found between the SF and the ACF tot sinograms. For the cylinder and the EEC phantom, similar correction factors Κ were estimated. The determined values resulted in an accurate scatter correction in both the 2D and 3D mode. (orig.) [de

Концепция когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson

OpenAIRE

Мазуров Никита Юрьевич; Струков Иван Александрович; Лебедева Марина Юрьевна

2016-01-01

в данной статье рассматривается роль концепции когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson. Авторы отмечают, что сфера когнитивных технологий крайне перспективна.

The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.

Science.gov (United States)

Waddell, Thomas G.; Rybolt, Thomas R.

2003-01-01

Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)

The SHARPn project on secondary use of Electronic Medical Record data: progress, plans, and possibilities.

Science.gov (United States)

Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M

2011-01-01

SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010.

Structure of the DNA duplex d(ATTAAT2 with Hoogsteen hydrogen bonds.

Directory of Open Access Journals (Sweden)

Francisco J Acosta-Reyes

Full Text Available The traditional Watson-Crick base pairs in DNA may occasionally adopt a Hoogsteen conformation, with a different organization of hydrogen bonds. Previous crystal structures have shown that the Hoogsteen conformation is favored in alternating AT sequences of DNA. Here we present new data for a different sequence, d(ATTAAT2, which is also found in the Hoogsteen conformation. Thus we demonstrate that other all-AT sequences of DNA with a different sequence may be found in the Hoogsteen conformation. We conclude that any all-AT sequence might acquire this conformation under appropriate conditions. We also compare the detailed features of DNA in either the Hoogsteen or Watson-Crick conformations.

The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

DEFF Research Database (Denmark)

Vester, B; Hansen, L H; Douthwaite, S

1995-01-01

the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...

Calculation of the positronium formation differential cross section for collision of electron with anti-hydrogen atoms

International Nuclear Information System (INIS)

Ghanbari Adivi, E.; Kanjuri, F.; Bolorizadeh, M.

2006-01-01

The positronium formation differential cross sections in collision of the high-energy but non-relativistic electrons with anti-hydrogen atoms are calculated by using the three-body Faddeev-Watson-Lovelace formalism. In a second-order approximation, the inter-nuclear and nuclear-electronic partial amplitudes therein the Faddeev-Watson series are calculated, analytically, in the range of 0-180 degrees of the scattering angles. The presence of the T homas peak a t 45 d egree i s investigated. The results are discussed for 1 and 10 keV impact energies and for electron transition from anti-hydrogen ground state into the different states therein the K-, L- and M- shells of the positronium atoms.

Applied Meteorology Unit (AMU) Quarterly Report Fourth Quarter FY-14

Science.gov (United States)

Bauman, William H.; Crawford, Winifred C.; Watson, Leela R.; Shafer, Jaclyn

2014-01-01

Ms. Crawford completed the final report for the dual-Doppler wind field task. Dr. Bauman completed transitioning the 915-MHz and 50-MHz Doppler Radar Wind Profiler (DRWP) splicing algorithm developed at Marshall Space Flight Center (MSFC) into the AMU Upper Winds Tool. Dr. Watson completed work to assimilate data into model configurations for Wallops Flight Facility (WFF) and Kennedy Space Center/Cape Canaveral Air Force Station (KSC/CCAFS). Ms. Shafer began evaluating the a local high-resolution model she had set up previously for its ability to forecast weather elements that affect launches at KSC/CCAFS. Dr. Watson began a task to optimize the data-assimilated model she just developed to run in real time.

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

Science.gov (United States)

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

Trauma-related guilt: conceptual development and relationship with posttraumatic stress and depressive symptoms.

Science.gov (United States)

Browne, Kendall C; Trim, Ryan S; Myers, Ursula S; Norman, Sonya B

2015-04-01

Despite high prevalence and concerning associated problems, little effort has been made to conceptualize the construct of posttraumatic guilt. This investigation examined the theoretical model of trauma-related guilt proposed by Kubany and Watson (2003). This model hypothesizes that emotional and physical distress related to trauma memories partially mediates the relationship between guilt cognitions and posttraumatic guilt. Using path analysis, this investigation (a) empirically evaluated relationships hypothesized in Kubany and Watson's model, and (b) extended this conceptualization by evaluating models whereby guilt cognitions, distress, and posttraumatic guilt were related to posttraumatic stress disorder (PTSD) symptoms depression symptom severity. Participants were male U.S. Iraq and Afghanistan veterans (N = 149). Results yielded a significant indirect effect from guilt cognitions to posttraumatic guilt via distress, providing support for Kubany and Watson's model (β = .14). Findings suggested distress may be the strongest correlate of PTSD symptoms (β = .47) and depression symptoms (β = .40), and that guilt cognitions may serve to intensify the relationship between distress and posttraumatic psychopathology. Research is needed to evaluate whether distress specific to guilt cognitions operates differentially on posttraumatic guilt when compared to distress more broadly related to trauma memories. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

A report on the occurrence of Thraustochytrid species in Indian waters

Digital Repository Service at National Institute of Oceanography (India)

Raghukumar, S.; Raghukumar, C.

Raghukumar Labyrinthuloidus minuta (Watson and Raper) Perkins, L. yorkensis, Perkins, Thraustochytrium aggregatum Ulken, T. motivum Goldstein, T. multirudimentale, Goldstein, T. striatum, Schneider, Schizochytrium mangrovei, Raghukumar and Ulkenia visurgensis...

An econometrics method to estimate demand of sugar

Directory of Open Access Journals (Sweden)

Negar Seyed Soleimany

2012-01-01

Full Text Available Sugar is one of the strategic goods in the basket of households in each country and it plays an important role in supplying the required energy. On the other hand, it is one of the goods, which Iranian government is about to change its subsidy strategies. To design useful sugar subsidy strategies, it is necessary to know sugar position in the basket of households and be familiar with households' sugar demand or consumption behavior. This research estimates sugar demand for Iranian households by using time series of 1984-2008, which is taken from central bank of Iran. In this paper, first independent and dependent variables of household sugar demand model are chosen based on the literature review and theory of demand. Then, sugar demand is estimated by OLS technique and linear regression. The preliminary statistical observations such as Durbin-Watson, F statistic and R2 indicate that the regression is admissible. The results seem plausible and consistent with theory and show that sugar demand in Iranian households is associated with household expenditure, relative sugar price, family size and indicate that demand of sugar is affected during the war time. The results also show the income elasticity is 0.8 and price elasticity is -0.2 which means sugar is essential good for Iranian households and is inelastic to price.

76 FR 59141 - Determination That LOXITANE (Loxapine Succinate) Capsules and Three Other Drug Products Were Not...

Science.gov (United States)

2011-09-23

... Applicant NDA 017525 LOXITANE (loxapine Watson Laboratories succinate) Inc., 417 Wakara Capsules, Way, Suite.../milliliter. NDA 020828 FORTOVASE Hoffmann La Roche (saquinavir) Inc., 340 Kingsland Capsule, 200 mg. St...

An atlas of the (near) future: cognitive computing applications for medical imaging (Conference Presentation)

Science.gov (United States)

LeGrand, Anne

2017-02-01

The role of medical imaging in global health systems is literally fundamental. Like labs, medical images are used at one point or another in almost every high cost, high value episode of care. CT scans, mammograms, and x-rays, for example, "atlas" the body and help chart a course forward for a patient's care team. Imaging precision has improved as a result of technological advancements and breakthroughs in related medical research. Those advancements also bring with them exponential growth in medical imaging data. As IBM trains Watson to "see" medical images, Ms. Le Grand will discuss recent advances made by Watson Health and explore the potential value of "augmented intelligence" to assist healthcare providers like radiologists and cardiologists, as well as the patients they serve.

Hydrogen bond indices and tertiary structure of yeast tRNA sup(Phe)

International Nuclear Information System (INIS)

Giambiagi, M.S. de; Giambiagi, M.; Esquivel, D.M.S.

1982-01-01

The rigidity and stability of the tertiary structure of yeast tRNA sup(Phe) is related to a bond index employed in an IEHT calculation. The index permits a quantitative estimate of the electronic cloud along the hydrogen bond, having thus an appealing physical meaning. The results indicate that Hoogsteen-type bonds have, as expected, greater electronic population than Watson-Crick type ones. Other non-Watson-Crick pairings, the wobble pair and G 15 -C 48 , exhibit high values of the index for the NH...O bond. In the triples, the electronic density of the hydrogen bridges does not weaken, comparing it with the one of the pairs involved. Contour density maps are shown and dipolar moments of pairs and triples are qualitatively discussed. (Author) [pt

Teatripeegel : Milliseid elamusi on hooaeg pakkunud Mihkel Mutile / Mihkel Mutt

Index Scriptorium Estoniae

Mutt, Mihkel, 1953-

1998-01-01

Arthur Conan Doyle'i "Sherlock Holmes ja doktor Watson", lav. Ago-Endrik Kerge ja Bertold Brechti "Kolmekrossiooper", lav. Adolf Shapiro Tallinna Linnateatris. Humanitaarinstituudi teatrifakulteedi õpilaste esituses Jean Anouilh' "Antigone", lav. Lembit Peterson

Field determined variation of the unsaturated hydraulic conductivity functions using simplified analysis of internal drainage experiments Variação da condutividade hidráulica do solo não saturado determinada em condições de campo utilizando análises simplificadas de experimentos de drenagem interna

Directory of Open Access Journals (Sweden)

M. M. Villagra

1994-04-01

Full Text Available Experimentally determined values of unsaturated soil hydraulic conductivity are presented for an Alfisol of the county of Piracicaba, S.P., Brazil. Simultaneous measurements of soil water content and pressure head are made along a 125 m transect within an irrigated field during the internal drainage process. Calculations of the soil hydraulic conductivity were made using the instantaneous profile method (Watson, 1966 and the unit gradient method (LIBARDI et al., 1980. The spatial variability of the soil hydraulic conductivity manifested along the transect indicates the need to develop a field method to measure K(theta within prescribed fiducial limits, taking into account quantitative evaluation of spatial and temporal variances associated with the mathematical model, instrument calibration and soil properties.São apresentados dados experimentais de condutividade hidráulica do solo, para uní Alfisol (terra roxa estruturada do Município de Piracicaba,SP - Brasil. Medidas simultâneas de umidade do solo e de potencial total da água no solo foram realizadas ao longo de uma transeção de 125 m, dentro de um campo irrigado, durante o processo de drenagem interna. Os cálculos de condutividade hidráulica foram feitos utilizando o método do perfil instantâneo (WATSON, 1966 e o método do gradiente unitário (LIBARDI et al., 1980. A variabilidade espacial da condutividade hidráulica do solo observada ao longo da transeção aponta a necessidade do desenvolvimento de método de campo para a medida de K (teta dentro de limites preestabelecidos de precisão, levando em conta a medida quantitativa das variâncias temporal e espacial associadas ao modelo matemático, a calibração dos instrumentos e as propriedades do solo.

The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

[The brain in stereotaxic coordinates (a textbook for colleges)].

Science.gov (United States)

Budantsev, A Iu; Kisliuk, O S; Shul'govskiĭ, V V; Rykunov, D S; Iarkov, A V

1993-01-01

The present textbook is directed forward students of universities and medical colleges, young scientists and practicing doctors dealing with stereotaxic method. The Paxinos and Watson stereotaxic rat brain atlas (1982) is the basis of the textbook. The atlas has been transformed into computer educational program and seven laboratory works: insertion of the electrode into brain, microelectrophoresis, microinjection of drugs into brain, electrolytic destruction in the brain structures, local brain superfusion. The laboratory works are compiled so that they allow not only to study practical use of the stereotaxic method but to model simple problems involving stereotaxic surgery in the deep structures of brain. The textbook is intended for carrying by IBM PC/AT computers. The volume of the textbook is 1.7 Mbytes.

R2 Cognitive Computing

Data.gov (United States)

National Aeronautics and Space Administration — Robonaut 2, a crew assistant robotic prototype, will be integrated with IBM’s Watson. R2 will embody the artificial intelligence to enable new levels of robotic...

Human genes and genomes: science, health, society

National Research Council Canada - National Science Library

Rosenberg, Leon E; Rosenberg, Diane Drobnis

2012-01-01

"In the nearly 60 years since Watson and Crick proposed the double helical structure of DNA, the molecule of heredity, waves of discoveries have made genetics the most thrilling field in the sciences...

Processo clinical caritas: novos rumos para o cuidado de enfermagem transpessoal Proceso clinical caritas: nuevos rumbos para el cuidado de enfermería transpersonal Human caring processes: direction for nursing care

Directory of Open Access Journals (Sweden)

Jania Jacson dos Santos Mathias

2006-09-01

Full Text Available O objetivo deste artigo é fazer uma reflexão sobre o cuidado humano à luz da evolução teórica das concepções de Jean Watson, tendo em vista as suas novas proposições do que venha ser o homem e sua conexão com o cosmos e as possibilidades de cuidado ante o potencial existente dentro de cada um. Esta forma de cuidar propõe a reestruturação do homem para melhor vivenciar os diferentes momentos da vida, rompendo com os antigos paradigmas em relação ao cuidado de enfermagem. Demonstra as diferentes possibilidades para a prática da enfermagem, bem como os desdobramentos concernentes ao ensino e à pesquisa.El objetivo de este artículo es hacer una reflexión sobre el cuidado humano a la luz de la evolución teórica de las concepciones de Jean Watson, teniendo en vista sus nuevas propuestas respecto a lo que es el hombre y su conexión con el cosmos y las posibilidades de cuidado ante el potencial existente dentro de cada uno. Esta forma de cuidar propone la reestructuración del hombre para vivenciar mejor los diferentes momentos de la vida, rompiendo con los antiguos paradigmas en relación al cuidado de enfermería. Demuestra las diferentes posibilidades para la práctica de la enfermería, así como también los desdoblamientos concernientes a la enseñanza y a la investigación.This article discusses Jean Watson theoretical work on human caring processes, which acknowledges unity of life and men-universe connection. Caring encompasses the reorganization of the human being in order to live deeply the different moments of life, and the breaching of old paradigms in relation to nursing care. Watson's theoretical work suggests different possibilities for nursing practice, teaching, and research.

Durbin-Watson statistic for the least trimmed squares

Czech Academy of Sciences Publication Activity Database

Víšek, Jan Ámos

2001-01-01

Roč. 8, č. 14 (2001), s. 1-40 ISSN 1212-074X Grant - others:GA UK(CZ) 255/2000/A EK/FSV Institutional research plan: CEZ:AV0Z1075907 Keywords : diagnostics * robustness * regression Subject RIV: BB - Applied Statistics, Operational Research

Kate Watson on Reynold Humphries’ Hollywood’s Blacklists

Directory of Open Access Journals (Sweden)

2008-12-01

Full Text Available Reynold Humphries. Hollywood’s Blacklists: A Political and Cultural History. Edinburgh: Edinburgh University Press, 2008. Reynold Humphries’ Hollywood’s Blacklists provides a comprehensive examination of the historical and political ramifications of the blacklisting process and of Communism in the motion picture industry. His section on ‘The Background’ initially sets up just this, making the debate and dispute accessible even to those not au fait with such knowledge. This section is informat...

Watson, skinner y algunas disputas dentro del conductismo

OpenAIRE

Pellón Suárez de Puga, Ricardo

2013-01-01

In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913) conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

Watson, Skinner y Algunas Disputas dentro del Conductismo

Directory of Open Access Journals (Sweden)

RICARDO PELLÓN SUÁREZ DE PUGA

2013-12-01

Full Text Available In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913 conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

Agentes virtuales con capacidades cognitivas utilizando IBM Watson

OpenAIRE

Carrillo Calderón, Manuel Esteban

2017-01-01

Resumen (castellano) En la actualidad, los avances en la tecnología informática y la creciente globalización por medio de Internet y las redes sociales han obligado a que los comercios tradicionales luchen por digitalizarse, a la par que los comercios online traten de ser cada vez más personales y cercanos a los clientes. En esto consiste el comercio electrónico conversacional, una evolución del ecosistema del comercio electrónico. Hoy en día, los chats automáticos con mensajes estándar...

75 FR 9478 - Qualification of Drivers; Exemption Applications; Vision

Science.gov (United States)

2010-03-02

... and devices showing standard red, green, and amber (49 CFR 391.41(b)(10)). FMCSA recognizes that some..., Donald D. Overton, Willie L. Parks, Derrick A. Robinson, Clarence Robinshaw, Jr., Norman J. Watson and...

76 FR 7625 - Qualification of Drivers; Exemption Applications; Diabetes Mellitus

Science.gov (United States)

2011-02-10

... exempts, Thomas H. Adams, Jr., Charlie A. Barner, Charles G. Beasley, Philp M. Carr, Timothy D. Cochran..., Darwin D. Roberts, Robert A. Roskamp, David N. Studebaker, Danny J. Watson, Robert L. Wenzel, David A...

Coal fire mapping of East Basuria Colliery, Jharia coalfield using ...

Indian Academy of Sciences (India)

detect coal fire regions based on surface tem- perature ..... and non-coal fire regions have been delineated well in the ..... System Development Notes; Paterson Grant and Watson .... Schloemer S 2006 Innovative technologies for exploration,.

Can you really larn yersel Geordie?

DEFF Research Database (Denmark)

Jensen, Marie Møller

’ perceptions of frequency and abilities to identify local forms, and a mini corpus of popular dialect literature. Results support Honeybone & Watson’s claim that popular dialect literature can give us an indication of which linguistic forms are salient and index local affiliation.......Popular dialect literature (what Honeybone and Watson 2013 call Contemporary, Humorous, Localised Dialect Literature or CHLDL) is meant to entertain and amuse. It represents a recognisable form of a local variety which speaks to readers with knowledge of that particular variety. While often relying...... on fairly rude language and jokes, literature of this kind also often take the form of ‘handbooks’ promising to help you learn a particular variety (Lern Yerself Scouse, Larn Yersel Geordie, etc). Honeybone and Watson, who investigated the representation of selected phonological variables in a variety...

Insights into the Structures of DNA Damaged by Hydroxyl Radical: Crystal Structures of DNA Duplexes Containing 5-Formyluracil

Directory of Open Access Journals (Sweden)

Masaru Tsunoda

2010-01-01

Full Text Available Hydroxyl radicals are potent mutagens that attack DNA to form various base and ribose derivatives. One of the major damaged thymine derivatives is 5-formyluracil (fU, which induces pyrimidine transition during replication. In order to establish the structural basis for such mutagenesis, the crystal structures of two kinds of DNA d(CGCGRATfUCGCG with R = A/G have been determined by X-ray crystallography. The fU residues form a Watson-Crick-type pair with A and two types of pairs (wobble and reversed wobble with G, the latter being a new type of base pair between ionized thymine base and guanine base. In silico structural modeling suggests that the DNA polymerase can accept the reversed wobble pair with G, as well as the Watson-Crick pair with A.

Deixando o preconceito de lado e entendendo o Behaviorismo Radical

Directory of Open Access Journals (Sweden)

Rodrigo Pinto Guimarães

Full Text Available O Behaviorismo Radical de Skinner é muitas vezes criticado de forma indevida e até preconceituosa. Muitas destas críticas, na verdade, são críticas da psicologia de Watson e não do Behaviorismo Radical. O entendimento das diferenças entre os modos idealista e materialista de pensar ajuda a esclarecer a maneira de estudar e compreender o comportamento para o Behaviorismo Radical, bem como a sua posição anti-mentalista. O estudo da história da evolução do Behaviorismo é necessário para possibilitar o entendimento das diferenças entre o Behaviorismo Metodológico de Watson e o Behaviorismo Radical de Skinner, bem como das suas respectivas contribuições para a psicologia.

anti K-nucleon interactions

Energy Technology Data Exchange (ETDEWEB)

Chand, Ramesh

1963-10-15

Total scattering and absorption cross sections for anti K-nucleon collisions in I = 1, p_3/2 - channel are given as functions of the two sets of energy dependent anti KN scattering parameters solutions, called solution A' and solution B'. These scattering parameters are obtained by linear interpolations between Watson's amplitudes around 400 MeV/c and the amplitude at the position of the pole in the anti KN scattering amplitude corresponding to the p_3/2-wave 1385 MeV Y₁-resonance with 50 MeV width. The zero-range expansion for p-wave anti K-nucleon phase shift and the scattering parameters of Watson's solution B are found to be in violation of the requirements of causality and of positive definiteness of transition probabilities. (auth)

Cognitive and emotional predictors of episodic and dispositional forgiveness

Directory of Open Access Journals (Sweden)

Mróz Justyna

2017-06-01

Full Text Available The study examined the importance of cognitive (positive orientation, basic hope and emotional (positive and negative affectivity, emotional control variables for state and trait forgiveness. One hundred and thirty nine participants completed six inventories in Polish version: HFS (Thompson et al., 2005, TRIM (McCullough et al., 1998, P-Scale (Caprara et al., 2012, BHI-12 (Trzebiński & Zięba, 2003a, SUPIN (Polish version of PANAS; Watson, Clark, & Tellegen, 1988, CECS (Watson & Greer, 1983. Results showed that dispositional forgiveness (general and positive was associated with cognitive and emotional predictors, whereas episodic forgiveness primarily with certain emotional variables. In addition, the results indicated that emotional predictors merely participate in the process of reducing unforgiveness, whereas cognitive and emotional variables were shown to be necessary for full forgiveness.

Solution of the neutron transport equation by the Method of Characteristics using a linear representation of the source within a mesh

International Nuclear Information System (INIS)

Mazumdar, Tanay; Degweker, S.B.

2017-01-01

Highlights: • In Method of Characteristics, the neutron source within a mesh is expanded up to linear term. • This expansion reduces the number of meshes as compared to flat source assumption. • Poor representation of circular geometry with coarser meshes is corrected. • Few benchmark problems are solved to show the advantages of linear expansion of source. • The advantage of the present formalism is quite visible in problems with large flux gradient. - Abstract: A common assumption in the solution of the neutron transport equation by the Method of Characteristics (MOC) is that the source (or flux) is constant within a mesh. This assumption is adequate provided the meshes are small enough so that the spatial variation of flux within a mesh may be ignored. Whether a mesh is small enough or not depends upon the flux gradient across a mesh, which in turn depends on factors like the presence of strong absorbers, localized sources or vacuum boundaries. The flat flux assumption often requires a very large number of meshes for solving the neutron transport equation with acceptable accuracy as was observed in our earlier work on the subject. A significant reduction in the required number of meshes is attainable by using a higher order representation of the flux within a mesh. In this paper, we expand the source within a mesh up to first order (linear) terms, which permits the use of larger sized (and therefore fewer) meshes and thereby reduces the computation time without compromising the accuracy of calculation. Since the division of the geometry into meshes is through an automatic triangulation procedure using the Bowyer-Watson algorithm, representation of circular objects (cylindrical fuel rods) with coarse meshes is poorer and causes geometry related errors. A numerical recipe is presented to make a correction to the automatic triangulation process and thereby eliminate this source of error. A number of benchmark problems are analyzed to emphasize the

Nucleic acid nanomaterials: Silver-wired DNA

Science.gov (United States)

Auffinger, Pascal; Ennifar, Eric

2017-10-01

DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

Uus raamatusari õpetajatele / Inga Kukk

Index Scriptorium Estoniae

Kukk, Inga

2003-01-01

Haridus- ja teadusministeerium hakkas välja andma tänapäeva pedagoogika raamatusarja "XXI sajandi kool". Ilmumas on esimene raamat: George Watson. Koolikäitumise käsiraamat. Kommenteerivad Jaan Kõrgesaar, Krista Sillar

Publications | Page 272 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Fighting the violet vampire. In the fields of sub-Saharan Africa, Alan Watson and McGill University's Weed Research Group are battling devastating parasites — naturally. Something big was happening in these agricultural fields of.

Genetics Home Reference: hereditary paraganglioma-pheochromocytoma

Science.gov (United States)

... 295(6):628. Citation on PubMed Selak MA, Armour SM, MacKenzie ED, Boulahbel H, Watson DG, Mansfield ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

trawl bycatch in the fishing grounds of Bus

African Journals Online (AJOL)

ajl yemi

2011-11-30

. Biol. 86: 1455-1462. Watson RA, Dredge MLC, Mayer DG (1990). Spatial and seasonal variation in demersal trawl fauna associated with a prawn fishery on the CentralGreat Barrier Reef, Australia. Aust. J. Mar. Freshw. Res.

NCBI nr-aa BLAST: CBRC-SARA-01-1089 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-SARA-01-1089 ref|ZP_00518636.1| Major facilitator superfamily [Crocosphaera watson...ii WH 8501] gb|EAM48279.1| Major facilitator superfamily [Crocosphaera watsonii WH 8501] ZP_00518636.1 1.3 32% ...

Plant gene technology: social considerations

African Journals Online (AJOL)

Administrator

The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

Use of the FAO AquaCrop model in developing sowing guidelines ...

African Journals Online (AJOL)

2014-03-03

Mar 3, 2014 ... Thomas (1961) with indication of the meteorological stations (stars) used ...... FYLSTRA D, LASDON L, WATSON J and WARREN A (1998) Design ... JONES CA, KINIRY JR and DYKE PT (1987) CERES-Maize: A Simu-.

The Psyche as Behavior

Directory of Open Access Journals (Sweden)

ARTURO CLAVIJO A.

2013-12-01

Full Text Available Behaviorism has argued that behavior is the Psyche and the subject matter of psychology. Although, some scientists had done empirical work with objective methods before 1913, the year in which John B. Watson published his manifesto, he was the first one to attempt a systematization of behavior as the Psyche, that is, as psychology’s subject matter. In this text, I outline Watson’s notion of behavior to compare it with two other forms of behaviorism: Skinner’s radical behaviorism and molar behaviorism. The purpose of the paper is to illustrate how the concept of behavior has been and is changing.

[Sherlock Holmes as amateur physician].

Science.gov (United States)

Madsen, S

1998-03-30

The medical literature contains numerous articles dealing with Sherlock Holmes and his companion Dr. Watson. Some of the articles are concerned with the medical and scientific aspects of his cases. Other articles adopt a more philosophical view: They compare the methods of the master detective with those of the physician--the ideal clinician should be as astute in his profession as the detective must be in his. It this article the author briefly reviews the abilities of Sherlock Holmes as an amateur physician. Often Holmes was brilliant, but sometimes he made serious mistakes. In one of his cases (The Adventure of the Lion's Mane) he misinterpreted common medical signs.

Journal of Humanities - Vol 13, No 1 (1999)

African Journals Online (AJOL)

From cultural aesthetic to performance technique: Continuities and contrasts in improvisational milieux of Vimbuza and Jazz* · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Watson Msosa, 47-58 ...

75 FR 57984 - Investigations Regarding Certifications of Eligibility To Apply for Worker Adjustment Assistance

Science.gov (United States)

2010-09-23

... Cambridge, OH......... 09/08/10 09/07/10 (Workers). 74606 Watson Laboratories, Inc. Carmel, NY 09/10/10 09... Galt Temp Agency Burlington, MA........ 09/10/10 09/03/10 (State/One-Stop). 74614 IBM Global Services...

RESEARCH REPORTS

African Journals Online (AJOL)

This study is concerned with the productivity of nurses working within the. Primary ..... rience more work-related stress and report this as overall poor health, than ... performance, and reduces the possibility of staff loss through burnout (Watson,.

The role of the yeast as probiotic in the protection against liver fibrosis

African Journals Online (AJOL)

khairy

treatment groups have been fed by yeast from the first 35 to 60 days, respectively. The results show ... medicinal and pharmaceutical applications (Kumura et al., 2004 ..... sclerosis and rheumatoid arthritis (Nicklin et al., 1994;. Watson and ...

NCBI nr-aa BLAST: CBRC-OSAT-06-0035 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-OSAT-06-0035 ref|ZP_00516533.1| Abortive infection protein [Crocosphaera watson...ii WH 8501] gb|EAM50385.1| Abortive infection protein [Crocosphaera watsonii WH 8501] ZP_00516533.1 8e-37 41% ...

NCBI nr-aa BLAST: CBRC-DDIS-02-0008 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DDIS-02-0008 ref|ZP_00515102.1| conserved hypothetical protein [Crocosphaera watson...ii WH 8501] gb|EAM51937.1| conserved hypothetical protein [Crocosphaera watsonii WH 8501] ZP_00515102.1 5e-10 32% ...

A preliminary geochemical study of zircons and monazites from ...

Indian Academy of Sciences (India)

R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

equation of Watson and Harrison (1983) predicts that zircon with Zr-contents ... tion equation of Montel (1993) predicts that the .... and geochemistry of the basalts of Gujarat state (western ... solution kinetics: implications for the thorium and light.

Resilience Metrics for the Electric Power System: A Performance-Based Approach.

Energy Technology Data Exchange (ETDEWEB)

Vugrin, Eric D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Castillo, Andrea R [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Silva-Monroy, Cesar Augusto [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2017-02-01

Grid resilience is a concept related to a power system's ability to continue operating and delivering power even in the event that low probability, high-consequence disruptions such as hurricanes, earthquakes, and cyber-attacks occur. Grid resilience objectives focus on managing and, ideally, minimizing potential consequences that occur as a result of these disruptions. Currently, no formal grid resilience definitions, metrics, or analysis methods have been universally accepted. This document describes an effort to develop and describe grid resilience metrics and analysis methods. The metrics and methods described herein extend upon the Resilience Analysis Process (RAP) developed by Watson et al. for the 2015 Quadrennial Energy Review. The extension allows for both outputs from system models and for historical data to serve as the basis for creating grid resilience metrics and informing grid resilience planning and response decision-making. This document describes the grid resilience metrics and analysis methods. Demonstration of the metrics and methods is shown through a set of illustrative use cases.

Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

Science.gov (United States)

Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

2016-09-07

One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

Science.gov (United States)

Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

2018-02-01

Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

Effects of National Fadama III Programme on the Scope and Scale of ...

African Journals Online (AJOL)

User

Agriculture is the backbone of Nigeria's economy, despite being a leading producer of oil in the ... financing for the diverse livelihood activities which the beneficiaries themselves ..... McIntyre B. D., Herren H. R., Wakhungu J., Watson R. T.),.

NCBI nr-aa BLAST: CBRC-TTRU-01-0347 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TTRU-01-0347 ref|ZP_00517921.1| similar to membrane protein [Crocosphaera watson...ii WH 8501] gb|EAM48985.1| similar to membrane protein [Crocosphaera watsonii WH 8501] ZP_00517921.1 0.23 27% ...

Vabastav raamat kosmilisest totaalsusest / Kaido Floren

Index Scriptorium Estoniae

Floren, Kaido

2000-01-01

Arvustus: Strugatski, Arkadi, Strugatski, Boriss. Asustatud saar / tlk. Kalle Käsper ja Gohar Käsper-Markosjan. Tln: : Varrak, 1999. Vastukaja : Käsper, Kalle, Käsper-Markosjan, Gohar. Elementaarne, Watson! // Eesti Päevaleht : Arkaadia (2000) 15. jaan., lk. 10

Zeeman and orbital limiting magnetic fields in cuprates: The ...

Indian Academy of Sciences (India)

1IBM T. J. Watson Research Center, Yorktown Heights, New York 10598, ... In cuprates, in a view where pairing correlations set in at the pseudogap ... the field Hc2 bounding the superconducting response and the pseudogap closing field.

Fulltext PDF

Indian Academy of Sciences (India)

Unknown

and Watson clearly showed how, in fact, a gene could work. ... fifties Crick suggested that RNA acts as an adaptor that enables amino acids to associate ... tions, segmentation and complementation in development and origin of life on earth.

Finite-size scaling of survival probability in branching processes.

Science.gov (United States)

Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Álvaro

2015-04-01

Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We derive analytically the existence of finite-size scaling for the survival probability as a function of the control parameter and the maximum number of generations, obtaining the critical exponents as well as the exact scaling function, which is G(y)=2ye(y)/(e(y)-1), with y the rescaled distance to the critical point. Our findings are valid for any branching process of the Galton-Watson type, independently of the distribution of the number of offspring, provided its variance is finite. This proves the universal behavior of the finite-size effects in branching processes, including the universality of the metric factors. The direct relation to mean-field percolation is also discussed.

The Psyche as Behavior

Directory of Open Access Journals (Sweden)

ARTURO CLAVIJO A.

2013-01-01

Full Text Available Según el conductismo, el comportamiento constituye la Psique y el tema de estudio de la psicología. Aunque algunos científicos habían realizado trabajos empíricos con métodos objetivos antes de 1913, año en el que John B. Watson publicó su manifiesto, este último fue el primero en intentar la sistematización de la conducta como equivalente a la Psique, esto es, como el objeto de estudio de la psicología. El artículo discute la noción de comportamiento de Watson y la compara con otras dos formas de conductismo: el conductismo radical de Skinner y el conductismo molar, con el fin de ilustrar la forma en que el concepto de comportamiento ha cambiado y sigue cambiando.

Sherlock Holmes: scientific detective.

Science.gov (United States)

Snyder, Laura J

2004-09-01

Sherlock Holmes was intended by his creator, Arthur Conan Doyle, to be a 'scientific detective'. Conan Doyle criticized his predecessor Edgar Allan Poe for giving his creation - Inspector Dupin - only the 'illusion' of scientific method. Conan Doyle believed that he had succeeded where Poe had failed; thus, he has Watson remark that Holmes has 'brought detection as near an exact science as it will ever be brought into the world.' By examining Holmes' methods, it becomes clear that Conan Doyle modelled them on certain images of science that were popular in mid- to late-19th century Britain. Contrary to a common view, it is also evident that rather than being responsible for the invention of forensic science, the creation of Holmes was influenced by the early development of it.

The Egg with Two Yellows

Indian Academy of Sciences (India)

Srimath

James Watson, Seymour Benzer's work and his place in the .... A graduate student, Ronald J Konopka from. Dayton, joined him, hoping .... genetics of Thomas Hunt Morgan and his student Alfred ... the findings of Franz Boas, Frank A Brown Jr,.

Ainooson et al., Afr J Tradit Complement Altern Med. (2012) 9(1):8 ...

African Journals Online (AJOL)

AJTCAM

Ainooson et al., Afr J Tradit Complement Altern Med. (2012) ..... The authors are grateful for the technical assistance offered by Messrs Thomas Ansah, Gordon Darku and George Ofei of ... Miller, J. R. (2003). ... R. Watson and V. R. Preedy.

Human papillomavirus E6 and E7 oncoproteins as risk factors

Indian Academy of Sciences (India)

Prakash

J. Biosci. 34(1), March 2009. 1. Introduction. Human papillomavirus (HPV) is a double-stranded DNA virus that ..... contact and loss of cell polarity (Watson et al 2003; Thomas ..... Arrand JR 1995 Translation of the human papillomavirus type 16.

Mahlburg's Work on Crank Functions

Indian Academy of Sciences (India)

IAS Admin

640–651, 2006. [8]. G N Watson, Ramanujan's Vermutung uber zerfallungsanzahlen, J. Reine Angew Math., Vol.179, pp.97–128, 1938. [9]. J Lehner, Ramanujan identities involving the partition function for the moduli 11α, Amer. J. Math.

NCBI nr-aa BLAST: CBRC-TSYR-01-0417 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TSYR-01-0417 ref|ZP_00516838.1| hypothetical protein CwatDRAFT_3220 [Crocosphaera watson...ii WH 8501] gb|EAM50060.1| hypothetical protein CwatDRAFT_3220 [Crocosphaera watsonii WH 8501] ZP_00516838.1 0.17 23% ...

NCBI nr-aa BLAST: CBRC-FCAT-01-0153 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-FCAT-01-0153 ref|ZP_00516194.1| hypothetical protein CwatDRAFT_3642 [Crocosphaera watson...ii WH 8501] gb|EAM50727.1| hypothetical protein CwatDRAFT_3642 [Crocosphaera watsonii WH 8501] ZP_00516194.1 0.59 26% ...

Impact parameter representation without high-energy, small-angle limitation

International Nuclear Information System (INIS)

Islam, M.M.

Using Watson-Sommerfeld transform the impact parameter representation of the scattering amplitude is shown to be valid for all physical energies and scattering angles. It is also shown how the direct channel Regge poles enter in the impact parameter amplitude [fr

Condensing the information in DNA with double-headed nucleotides

DEFF Research Database (Denmark)

Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

2017-01-01

A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

London home for Crick archive.

Science.gov (United States)

Williams, Nigel

2002-01-08

Unprecedented access to the archives of Francis Crick, just before the 50th anniversary next year of his famous paper co-authored with James Watson on the proposed double helix structure of DNA, looks set to go ahead. Nigel Williams reports.

Little Albert from the Viewpoint of Abnormal Psychology Textbook Authors.

Science.gov (United States)

LeUnes, Arnold

1983-01-01

Watson and Rayner's study of Little Albert and conditioned emotional reactions is unquestionably a classic in psychology. Observations are made on what authors of 27 college textbooks in abnormal psychology have to say or not to say about Little Albert. (RM)

Browse Title Index

African Journals Online (AJOL)

Items 101 - 150 of 292 ... SAHARA J Journal of Social Aspects of HIV/AIDS Research Alliance. ... Thomas M Rehle, Olive Shisana ... H French, M Greeff, MJ Watson .... G Mchunu, B Ncama, JR Naidoo, S Majeke, T Myeza, T Ndebele, P Pillay.

A novel CYP1A1 gene polymorphism and the risk of head and neck ...

African Journals Online (AJOL)

Administrator

2011-06-15

Jun 15, 2011 ... 5274 Afr. J. Biotechnol. The principal enzymes ..... Amalio T, Paul I, Francine M, Tobias S, Thomas B (1993). Direct, automated .... Olshan A, Weissler M, Watson MA, Bell D (2000). GSTM1, GSTT1, ... Jr. JF, editors. Cancer ...

Fulltext PDF

Indian Academy of Sciences (India)

Unknown

2004-11-29

Nov 29, 2004 ... Watson was the leader in the construction of the model, .... consciousness at the end of his scientific career was obviously not an accident. ... consciousness: in his case, to find the physical laws specific to organisms, that he ...

Climate change in Africa and the Middle East in light of health ...

African Journals Online (AJOL)

thought about how climate change, by which I primarily mean global warming, is expected to ... investment in these areas is likely to decrease,[9] which would presumably leave people in a ..... Pilifosova 0. Middle East and Arid Asia. In: Watson ...

Get Active for Good Health (A Cup of Health with CDC)

Centers for Disease Control (CDC) Podcasts

2013-05-02

Only one in five Americans is getting enough exercise. In this podcast, Dr. Kathleen Watson discusses the importance of being active and supporting the design of walkable communities.  Created: 5/2/2013 by MMWR.   Date Released: 5/2/2013.

Echo Hunting

DEFF Research Database (Denmark)

King, Anthea L.

Broad line active galactic nuclei (AGN) have been proposed as potential standardisablecandles by Watson et al. (2011), using a technique called reverberation mapping. This thesisinvestigates whether AGN are useful high redshift standard candles and how to optimise thescientific output of the ongo...

Unusual hydrogen bonding patterns in AF [aminofluorene] and AAF [acetylaminofluorene] modified DNA

International Nuclear Information System (INIS)

Broyde, S.; Hingerty, B.E.; Shapiro, R.; Norman, D.; Oak Ridge National Lab., TN; New York Univ., NY; Columbia Univ., New York, NY

1989-01-01

New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs

Fulltext PDF

Indian Academy of Sciences (India)

IAS Admin

Resonance journal of science education. March 2014 Volume 19 Number 3. GENERALARTICLES. 198 John McCarthy – Father of Artificial Intelligence. V Rajaraman. 208 LISP. Harish Karnick. 222 Elementary? Question Answering, IBM's Watson, and the Jeopardy! Challenge. Raman Chandrasekar. 242 Cloud Computing.

Theoretical Characterization of Sulfur-to-Selenium Substitution in an Emissive RNA Alphabet: Impact on H-bonding Potential and Photophysical Properties

KAUST Repository

Chawla, Mohit; Poater, Albert; Besalu-Sala, Pau; Kalra, Kanav; Oliva, Romina; Cavallo, Luigi

2018-01-01

of the classical Watson-Crick base pairs, thus potentially mimicking the natural bases in a RNA duplex in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge of purines are destabilized as compared

Young and Active (A Cup of Health with CDC)

Centers for Disease Control (CDC) Podcasts

Regular physical activity is essential at all stages of life, but it’s especially important that young people develop good exercise habits early. In this podcast, Dr. Kathy Watson discusses the importance of ensuring that young people get enough exercise.

Next-generation bis-locked nucleic acids with stacking linker and 2'-glycylamino-LNA show enhanced DNA invasion into supercoiled duplexes

DEFF Research Database (Denmark)

Geny, Sylvain; Moreno, Pedro M D; Krzywkowski, Tomasz

2016-01-01

Targeting and invading double-stranded DNA with synthetic oligonucleotides under physiological conditions remain a challenge. Bis-locked nucleic acids (bisLNAs) are clamp-forming oligonucleotides able to invade into supercoiled DNA via combined Hoogsteen and Watson-Crick binding. To improve the b...

Circular dichroism as a means to follow DNA gymnastics: on the shoulders of giants

Directory of Open Access Journals (Sweden)

H.H. Klump

2010-01-01

Full Text Available This is the first report of DNA stem-loops self-assembled by ‘foot-loop’ interactions into either two-dimensional strings or three-dimensional spirals, distinguished by circular dichroism spectroscopy. All subunits are linked by cooperative Watson-Crick hydrogen bonds.

B-DNA model systems in non-terran bio-solvents : Implications for structure, stability and replication

NARCIS (Netherlands)

Hamlin, Trevor A.; Poater, Jordi; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias

2017-01-01

We have computationally analyzed a comprehensive series of Watson-Crick and mismatched B-DNA base pairs, in the gas phase and in several solvents, including toluene, chloroform, ammonia, methanol and water, using dispersion-corrected density functional theory and implicit solvation. Our analyses

NCBI nr-aa BLAST: CBRC-MDOM-02-0389 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-02-0389 ref|ZP_00516333.1| Protein of unknown function DUF6 [Crocosphaera watson...ii WH 8501] gb|EAM50587.1| Protein of unknown function DUF6 [Crocosphaera watsonii WH 8501] ZP_00516333.1 0.17 28% ...

NCBI nr-aa BLAST: CBRC-MDOM-05-0122 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-05-0122 ref|ZP_00516333.1| Protein of unknown function DUF6 [Crocosphaera watson...ii WH 8501] gb|EAM50587.1| Protein of unknown function DUF6 [Crocosphaera watsonii WH 8501] ZP_00516333.1 0.34 32% ...

Auger Physicists visit CMS

CERN Multimedia

Hoch, Michael

2012-01-01

Visit at CERN P5 CMS in the experimental cavern Alan Watson, Auger Spokesperson Emeritus, University of Leeds; Jim Cronin, Nobel Laureate, Auger Spokesperson Emeritus, University of Chicago; Jim Virdee, CMS Former Spokesperson, Imperial College; Jim Matthews, Auger Co-Spokesperson, Louisiana State University

Macromolecules Vis-a-Vis the Traditions of Chemistry

Science.gov (United States)

Flory, Paul J.

1973-01-01

Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…

Biography: MADHU SUDAN Madhu Sudan got his Bachelors ...

Indian Academy of Sciences (India)

Admin

. UC Berkeley in 1992. From 1992-1997 he was a Research Staff Member at IBM's. Thomas J. Watson Research Center. In 1997 he joined the faculty at MIT, where among other roles he served as an Associate Director of MIT's CSAIL from.

The History of Molecular Structure Determination Viewed through the Nobel Prizes.

Science.gov (United States)

Jensen, William P.; Palenik, Gus J.; Suh, Il-Hwan

2003-01-01

Discusses the importance of complex molecular structures. Emphasizes their individual significance through examination of the Nobel Prizes of the 20th century. Highlights prizes awarded to Conrad Rontgen, Francis H.C. Crick, James D. Watson, Maurice H.F. Wilkins, and others. (SOE)

Perceived and physiological arousal during a stress task: Can they differentiate between anxiety and depression?

NARCIS (Netherlands)

Dieleman, G.C.; Ende, J. van der; Verhulst, F.C.; Huizink, A.C.

2010-01-01

Background - Anxiety and depression might be two different valid constructs that often co-occur, or they could be different manifestations of the same underlying vulnerability. A theoretical framework to address this question is the tripartite model, by Clark and Watson, which hypothesizes that

Perceived and physiological arousal during a stress task: can they differentiate between anxiety and depression?

NARCIS (Netherlands)

Dieleman, G.C.; van der Ende, J.; Verhulst, F.C.; Huizink, A.C.

2010-01-01

Background: Anxiety and depression might be two different valid constructs that often co-occur, or they could be different manifestations of the same underlying vulnerability. A theoretical framework to address this question is the tripartite model, by Clark and Watson, which hypothesizes that

Spying on volcanoes

Science.gov (United States)

Watson, Matthew

2017-07-01

Active volcanoes can be incredibly dangerous, especially to those who live nearby, but how do you get close enough to observe one in action? Matthew Watson explains how artificial drones are providing volcanologists with insights that could one day save human lives

Potential Activity of Subglacial Microbiota Transported to Anoxic River Delta Sediments

DEFF Research Database (Denmark)

Cameron, Karen A.; Stibal, Marek; Olsen, Nikoline S.

2017-01-01

-related organisms. Later, a reduction in methane was observed to be paired with the depletion of sulphate, and we hypothesise that sulphate reduction out competed hydrogenotrophic methanogenesis. The structure and diversity of the original CO2/H2-amended incubation communities changed dramatically with a major......The Watson River drains a portion of the SW Greenland ice sheet, transporting microbial communities from subglacial environments to a delta at the head of Søndre Strømfjord. This study investigates the potential activity and community shifts of glacial microbiota deposited and buried under layers...... of sediments within the river delta. A long-term (12-month) incubation experiment was established using Watson River delta sediment under anaerobic conditions, with and without CO2/H2 enrichment. Within CO2/H2-amended incubations, sulphate depletion and a shift in the microbial community to a 52% predominance...

Synthesis and Structural Characterization of 2'-Fluoro-α-L-RNA-Modified Oligonucleotides

DEFF Research Database (Denmark)

Bundgaard Jensen, Troels; Pasternak, Anna; Stahl Madsen, Andreas

2011-01-01

with the smallest destabilization towards RNA. Thermodynamic data show that the duplex formation with 2'-fluoro-α-L-RNA nucleotides is enthalpically disfavored but entropically favored. 2'-Fluoro-α-L-RNA nucleotides exhibit very good base pairing specificity following Watson-Crick rules. The 2'-fluoro......-α-L-RNA monomer was designed as a monocyclic mimic of the bicyclic α-L-LNA, and molecular modeling showed that this indeed is the case as the 2'-fluoro monomer adopts a C3'-endo/C2'-exo sugar pucker. Molecular modeling of modified duplexes show that the 2'-fluoro-α-L-RNA nucleotides partake in Watson-Crick base......We describe the synthesis and binding properties of oligonucleotides that contain one or more 2'-fluoro-α-L-RNA thymine monomer(s). Incorporation of 2'-fluoro-α-L-RNA thymine into oligodeoxynucleotides decreased thermal binding stability slightly upon hybridization with complementary DNA and RNA...

A forecasting performance comparison of dynamic factor models based on static and dynamic methods

Directory of Open Access Journals (Sweden)

Marra Fabio Della

2017-03-01

Full Text Available We present a comparison of the forecasting performances of three Dynamic Factor Models on a large monthly data panel of macroeconomic and financial time series for the UE economy. The first model relies on static principal-component and was introduced by Stock and Watson (2002a, b. The second is based on generalized principal components and it was introduced by Forni, Hallin, Lippi and Reichlin (2000, 2005. The last model has been recently proposed by Forni, Hallin, Lippi and Zaffaroni (2015, 2016. The data panel is split into two parts: the calibration sample, from February 1986 to December 2000, is used to select the most performing specification for each class of models in a in- sample environment, and the proper sample, from January 2001 to November 2015, is used to compare the performances of the selected models in an out-of-sample environment. The metholodogical approach is analogous to Forni, Giovannelli, Lippi and Soccorsi (2016, but also the size of the rolling window is empirically estimated in the calibration process to achieve more robustness. We find that, on the proper sample, the last model is the most performing for the Inflation. However, mixed evidencies appear over the proper sample for the Industrial Production.

The practice of nurses caring for families of pediatric inpatients in light of Jean Watson

Directory of Open Access Journals (Sweden)

Maiara Rodrigues dos Santos

2014-08-01

Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.

High-energy expansion for nuclear multiple scattering

International Nuclear Information System (INIS)

Wallace, S.J.

1975-01-01

The Watson multiple scattering series is expanded to develop the Glauber approximation plus systematic corrections arising from three (1) deviations from eikonal propagation between scatterings, (2) Fermi motion of struck nucleons, and (3) the kinematic transformation which relates the many-body scattering operators of the Watson series to the physical two-body scattering amplitude. Operators which express effects ignored at the outset to obtain the Glauber approximation are subsequently reintroduced via perturbation expansions. Hence a particular set of approximations is developed which renders the sum of the Watson series to the Glauber form in the center of mass system, and an expansion is carried out to find leading order corrections to that summation. Although their physical origins are quite distinct, the eikonal, Fermi motion, and kinematic corrections produce strikingly similar contributions to the scattering amplitude. It is shown that there is substantial cancellation between their effects and hence the Glauber approximation is more accurate than the individual approximations used in its derivation. It is shown that the leading corrections produce effects of order (2kR/subc/) -1 relative to the double scattering term in the uncorrected Glauber amplitude, hk being momentum and R/subc/ the nuclear char []e radius. The leading order corrections are found to be small enough to validate quatitative analyses of experimental data for many intermediate to high energy cases and for scattering angles not limited to the very forward region. In a Gaussian model, the leading corrections to the Glauber amplitude are given as convenient analytic expressions

Rotational Spectrum, Conformational Composition, Intramolecular Hydrogen Bonding, and Quantum Chemical Calculations of Mercaptoacetonitrile (HSCH2C≡N), a Compound of Potential Astrochemical Interest.

Science.gov (United States)

Møllendal, Harald; Samdal, Svein; Guillemin, Jean-Claude

2016-03-31

The microwave spectra of mercaptoacetonitrile (HSCH2C≡N) and one deuterated species (DSCH2C≡N) were investigated in the 7.5-124 GHz spectral interval. The spectra of two conformers denoted SC and AP were assigned. The H-S-C-C chain of atoms is synclinal in SC and anti-periplanar in AP. The ground state of SC is split into two substates separated by a comparatively small energy difference resulting in closely spaced transitions with equal intensities. Several transitions of the parent species of SC deviate from Watson's Hamiltonian. Only slight improvements were obtained using a Hamiltonian that takes coupling between the two substates into account. Deviations from Watson's Hamiltonian were also observed for the parent species of AP. However, the spectrum of the deuterated species, which was investigated only for the SC conformer, fits satisfactorily to Watson's Hamiltonian. Relative intensity measurements found SC to be lower in energy than AP by 3.8(3) kJ/mol. The strength of the intramolecular hydrogen bond between the thiol and cyano groups was estimated to be ∼2.1 kJ/mol. The microwave work was augmented by quantum chemical calculations at CCSD and MP2 levels using basis sets of minimum triple-ζ quality. Mercaptoacetonitrile has astrochemical interest, and the spectra presented herein should be useful for a potential identification of this compound in the interstellar medium. Three different ways of generating mercaptoacetonitrile from compounds already found in the interstellar medium were explored by quantum chemical calculations.

Sleep in intensive care unit

DEFF Research Database (Denmark)

Boyko, Yuliya; Jennum, Poul; Nikolic, Miki

2017-01-01

PURPOSE: To determine if improving intensive care unit (ICU) environment would enhance sleep quality, assessed by polysomnography (PSG), in critically ill mechanically ventilated patients. MATERIALS AND METHODS: Randomized controlled trial, crossover design. The night intervention "quiet routine...... Medicine) sleep scoring criteria were insufficient for the assessment of polysomnograms. Modified classification for sleep scoring in critically ill patients, suggested by Watson et al. (Crit Care Med 2013;41:1958-1967), was used. RESULTS: Sound level analysis showed insignificant effect...... patients. We were not able to further reduce the already existing low noise levels in the ICU and did not find any association between the environmental intervention and the presence of normal sleep characteristics in the PSG....

Lumping procedure for a kinetic model of catalytic naphtha reforming

Directory of Open Access Journals (Sweden)

H. M. Arani

2009-12-01

Full Text Available A lumping procedure is developed for obtaining kinetic and thermodynamic parameters of catalytic naphtha reforming. All kinetic and deactivation parameters are estimated from industrial data and thermodynamic parameters are calculated from derived mathematical expressions. The proposed model contains 17 lumps that include the C6 to C8+ hydrocarbon range and 15 reaction pathways. Hougen-Watson Langmuir-Hinshelwood type reaction rate expressions are used for kinetic simulation of catalytic reactions. The kinetic parameters are benchmarked with several sets of plant data and estimated by the SQP optimization method. After calculation of deactivation and kinetic parameters, plant data are compared with model predictions and only minor deviations between experimental and calculated data are generally observed.

Modeling Breakthrough Curves of Citric Acid Adsorption onto Anionic Resins in an Aqueous Solution

Directory of Open Access Journals (Sweden)

Sohrabali Ghorbanian

2015-01-01

Full Text Available Breakthrough curves for citric acid adsorption from aqueous solution onto ion-exchange resin at 20, 35, and 55°C have been investigated. To predict breakthrough curves, three mathematical models have been analyzed based on the values of the least square method parameters, Durbin-Watson test, and mean relative percent error and, finally, appropriate models have been achieved. Models are in good agreement with experimental data based on the results. To examine models reliabilities and accuracy, models have been compared by various breakthrough curve data obtained by other investigators. The results show appropriate agreement and in some cases regression errors have been reduced to less than 1.0 percent.

"Elementar, Meu Caro Watson": Jô Soares Reinvents the Classics

Science.gov (United States)

Martin, Sarah

2016-01-01

Detective fiction--with its roots primarily in Europe and the United States--was slow to catch on in Brazil, where national authors did not attempt more than small forays into the genre for most of the twentieth century. This was due in large part to the particularities of Brazilian society, in which law enforcement agencies, rife with corruption,…

Some remarks on electron scattering in a laser field

International Nuclear Information System (INIS)

Ehlotzky, F.

1988-01-01

Potential scattering of electrons in a quantized radiation field is reconsidered. Some remarks are made on the validity of the Kroll-Watson scattering formula and on the close connection of this formula with the classical transition rate of scattering in a radiation field. (17 refs.)

Nonparametric conditional predictive regions for time series

NARCIS (Netherlands)

de Gooijer, J.G.; Zerom Godefay, D.

2000-01-01

Several nonparametric predictors based on the Nadaraya-Watson kernel regression estimator have been proposed in the literature. They include the conditional mean, the conditional median, and the conditional mode. In this paper, we consider three types of predictive regions for these predictors — the

Rupture of the tuberosity of the tibia

International Nuclear Information System (INIS)

Schild, H.; Schwarzkopf, W.

1981-01-01

Ruptures of the tuberosity of the tibia occur particularly in male adolescents, although on the whole they represent a rare type of injury. The article discusses classification into different types according to Watson-Jones as well as exemplary models, traumatology, clinic and therapy. (orig.) [de

The Discovery of the Double Helix

CERN Multimedia

CERN. Geneva

2011-01-01

Professor James D. Watson has kindly agreed to make a presentation on the 1953 finding of the Double Helix at the Cavendish Laboratory by Francis Crick and himself. Being one of the greatest scientific discoveries in human history, little else needs to be added.

IRP Stage 2 Remedial Investigation/Feasibility Study, Appendices A through K and M through R, for BOMARC Missile Site, McGuire AFB, New Jersey.

Science.gov (United States)

1992-05-26

Mellinger, P. J., R. D. Stenner , D. K. Landstrom, D. G. Watson, C. E. Cushing and R. A. Ewing. 1987. Evaluation of the Potential Environmental...Northwest Weatherized Residences. PNL-6058, Pacific Northwest Laboratory, Richland, Washington. Mellinger, P. J., and R. D. Stenner . 1986. Environmental

Runoff and mass-balance simulations from the Greenland Ice Sheet at Kangerlussuaq (Søndre Strømfjord) in a 30-year perspective, 1979-2008

NARCIS (Netherlands)

Mernild, S. H.; Liston, G. E.; Steffen, K.; van den Broeke, M.R.; Hasholt, B.

2010-01-01

This study provides insights into surface mass-balance (SMB) and runoff exiting the Watson River drainage basin, Kangerlussuaq, West Greenland during a 30 year period (1978/1979–2007/2008) when the climate experienced increasing temperatures and precipitation. The 30-year simulations quantify the

QCD on the BlueGene/L Supercomputer

International Nuclear Information System (INIS)

Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

2005-01-01

In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented

QCD on the BlueGene/L Supercomputer

Science.gov (United States)

Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

2005-03-01

In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.

Essays on habit formation and inflation hedging

NARCIS (Netherlands)

Zhou, Y.

2014-01-01

The thesis consists of four chapters. Chapter 1 reviews recent contributions on habit formation in the literature and investigates its implications for investors. Chapter 2 revisits the “Floor-Leverage” rule for investors with ratchet consumption preference proposed by Scott and Watson (2011). It

Mõõtmine ja intelligentsus / Rein Raud

Index Scriptorium Estoniae

Raud, Rein, 1961-

2007-01-01

Geeniteadlane James Watson leidis, et Aafrikas elavate inimeste intelligentsustase ei ole võrdne valge nahavärviga inimeste omaga. TLÜ professor Rein Raud leiab, et selle väite peamine nõrkus on eeldus, et on vaid üks ja universaalne mõõtmisparameeter

Acetylcholinesterase in central vocal control nuclei of the zebra finch ...

Indian Academy of Sciences (India)

Unknown

paring the data to other singing birds and vocalizing birds. As acquisition ..... In Nissl-stained sec- tions, a small RA and area X can be distinguished from ..... Neurol. 356 345–354. Watson J T, Adkins-Regan E, Whiting P, Lindstrom J M and.

Spatial Strategy Use during Logo Mastery: The Impact of Cognitive Style and Development Level.

Science.gov (United States)

Easton, Charles E.; Watson, J. Allen

1993-01-01

Tested the Watson and Busch model of how children learn LOGO programing. Investigated second- and fifth-grade students' stage of cognitive development, stylistic preferences, and strategy usage. Field-independent children showed a marginal advantage over field-dependent children in learning to program in LOGO. (MM)

Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

NARCIS (Netherlands)

Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

2000-01-01

Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

Exploring and Exploiting the Protein S100A7 as a New Target for Breast Cancer Therapy

Science.gov (United States)

2010-01-01

Microbiology , University of Victoria, Victoria, British Columbia, Canada and 3Department of Pathology and Laboratory Medicine, University of British...Watson 9 Oncogene Modur V, Feldhaus MJ, Weyrich AS, Jicha DL, Prescott SM, Zimmerman GA et al. (1997). Oncostatin M is a proinflammatory mediator. in

BioRadBase: A database for bioremediation of radioactive waste

African Journals Online (AJOL)

Windows User

2012-05-01

May 1, 2012 ... 16(3): 254-260. Llyod JR, Chesnes J, Glasauer S, Bunker DJ, Livens FR, Lovely DR ... Macaskie LE, Lloyd JR, Thomas RAP, Tolley MR (1996). The use of ... Carroll S, He Z, Gu B, Luo J, Criddle CS, Watson DB, Jardine PM,.

Coaxing an intimate public : Life narrative in digital storytelling

NARCIS (Netherlands)

Poletti, Anna

2011-01-01

This article considers the practice of digital storytelling in light of contemporary theories of autobiography and affect. Using the concept of coaxed life narrative developed by Sidonie Smith and Julia Watson, I analyse the role of digital storytelling in diversifying the voices in the public

Group Member or Outsider: Perceptions of Undergraduates with Disabilities on Leisure Time Physical Activity

Science.gov (United States)

Devine, Mary Ann

2013-01-01

College provides students with many opportunities to achieve academic success and enrich other aspects of their lives. Participating in campus activities can reduce stress, create social connections, promote healthy active living, and broaden civic engagement (Lindsey & Sessoms, 2006; Watson, Ayers, Zizzi, & Naoi, 2006). Studies noting…

DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

Science.gov (United States)

Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

2015-10-29

Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

South African Journal of Sports Medicine - Vol 26, No 1 (2014)

African Journals Online (AJOL)

The prevalence of self-reported neck pain in rugby union players in Gauteng Province · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. ED Watson, R-L Hodge, M Gekis, 26-30. http://dx.doi.org/10.7196/sajsm.512 ...

How Often to Get a Pap Test (A Cup of Health with CDC)

Centers for Disease Control (CDC) Podcasts

2013-01-10

Cervical cancer has declined in the U.S., and the decline is largely due to Pap testing and follow-up. Screening recommendations have changed. In this podcast, Meg Watson discusses Pap testing.  Created: 1/10/2013 by MMWR.   Date Released: 1/10/2013.

Project cost estimation techniques used by most emerging building ...

African Journals Online (AJOL)

consisted of five distinct types of contractors, general builders, civil engineers, electricians ... Mmboswobeni Watson Ladzani, Department of Business Management, University of South .... final cost of a proposed project for a given work scope. Thus, by .... Since the test statistic does not exceed the critical region, the null.

Parieto-occipital areas involved in efficient filtering in search: a time course analysis of visual marking using behavioural and functional imaging procedures

DEFF Research Database (Denmark)

Humphreys, Glyn W; Kyllingsbæk, Søren; Watson, Derrick G.

2004-01-01

Search for a colour-form conjunction target can be facilitated by presenting one set of distractors prior to the second set of distractors and the target: the preview benefit (Watson & Humphreys, 1997). The early presentation of one set of distractors enables them to be efficiently filtered from...

George Gamow and the Genetic Code

Indian Academy of Sciences (India)

cause they were held together by hydrogen bonds formed be- tween adenine and ... To return to our story, on the 8th of July Gamow addressed a letter to Watson and ... "For example, the animal will be a cat if Adenine is always followed by ...

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

Untitled

African Journals Online (AJOL)

to-type character, expression of particular genetic components, and biosafety parameters. NARS wishing to introduce any of the genetically modified organisms available at CIP should make a request through its Regional Representative. An, G., Watson, B.D. and Chiang, C.C. 1986. Transformation of tobacco, tomato, ...

36 http://spilplus.journals.ac.za/

African Journals Online (AJOL)

behaviorisme, veral van Watson (Behaviorism, 1924) en ;.leiss (A Theoretical basis of human behaviour, 1924, hersiene uitgawe 1929). Soos bekend, is die behaviorisme die opvatting dat psigologiese verskynsels voldoende behandel en verklaar kan word deur 'n studie van die reaksies van 'n organisme op stimuli sonder ...

Student-Athletes' Perceptions of Mental Illness and Attitudes toward Help-Seeking

Science.gov (United States)

Barnard, Jordan D.

2016-01-01

Given that there is evidence that college student-athletes may be at risk for psychological disturbances (Pinkerton, Hintz, & Barrow, 1989), and possibly underutilizing college mental health services (Watson & Kissinger, 2007), the purpose of this study was to examine attitudes toward mental illness and help seeking among college…

The genus Alvania on the Canary Islands and Madeira (Mollusca: Gastropoda) Part 1

NARCIS (Netherlands)

Moolenbeek, R.G.; Hoenselaar, H.J.

1989-01-01

Micromolluscs of the family Rissoidae and belonging to the genus Alvania s.l. from the Canary Islands and the Madeira archipelago are revised. For several species the type locality is restricted and lectotypes are designated for Rissoa canadensis d’Orbigny, 1839, R. euchila Watson, 1886, R.

Squamous Cell Carcinoma of the Palm in Nigeria

African Journals Online (AJOL)

Fleming ID, Barnawell JR, Burlison PE, Rankin JS. Skin cancer in ... Thomas M. Malignant tumours of the hand and wrist. Indian J. Plast Surg 2011;44:337‑47. 8. ... Chakrabarti I, Watson JD, Dorrance H. Skin tumours of the hand. A 10‑year ...

A Case for Criminal Enforcement of Federal Environmental Laws

Science.gov (United States)

1989-02-19

enforcement scheme can actually contribute to improper disposal. Szasz , Corporations. Organized Crime. and the Disposal of Hazardous Waste: An...the Syndicate Control Mystiaue, 1 Nat’l Envtl. Enforcement J. 3 (Dec. 1986). 150. See Szasz , supra note 79. 151. United States v. MacDonald & Watson

Peripheral nervous system topics

NARCIS (Netherlands)

Marani, Enrico; Lakke, E.A.J.F.; Mai, J.K.; Paxinos, G.

2011-01-01

*Adopts standard nomenclature following the new scheme by Paxinos, Watson, and Puelles and aligned with the Mai et al. Atlas of the Human Brain (new edition in 2007) * Provides essential reference information for users in conjunction with brain atlases for the identification of brain structures, the

Lodgepole pine provenances differ in chemical defense capacities against foliage and stem diseases

Science.gov (United States)

Maximization of lodgepole pine (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) growth in the face of climate change and new pest outbreaks requires an understanding of the natural variability of quantitative resistance to disease. We assessed trees for the severity of foliar d...

76 FR 45801 - Perrigo Company and Paddock Laboratories, Inc.; Analysis of Agreement Containing Consent Orders...

Science.gov (United States)

2011-08-01

.... Testosterone gel, marketed by Abbott under the brand name Androgel, is a prescription gel used to treat adult... proposed transaction. With its resources, capabilities, strong reputation, and experience manufacturing and marketing generic products, Watson is well-positioned to replicate the competition that would be lost with...

Modelling the PCR amplification process by a size-dependent branching process and estimation of the efficiency

NARCIS (Netherlands)

Lalam, N.; Jacob, C.; Jagers, P.

2004-01-01

We propose a stochastic modelling of the PCR amplification process by a size-dependent branching process starting as a supercritical Bienaymé-Galton-Watson transient phase and then having a saturation near-critical size-dependent phase. This model allows us to estimate the probability of replication

Binding of tryptophan and iron by reptilion plasnna proteins

African Journals Online (AJOL)

transport functions. Albumin of the alligator (Alligator mississippiensis) and other reptiles binds, amongst other ions, tryptophan (McMenamy & Watson 1968) and transferrin binds iron (Barber & Sheeler 1963). Multiple transferrins are present in the plasma of many reptiles. (Dessauer et af 1962) and the albumin region of the.

Mentoring: Positively Influencing Job Satisfaction and Retention of New Hire Nurse Practitioners.

Science.gov (United States)

Horner, Diane Kostrey

The purpose of study was to determine whether mentoring based on Watson's Caring Model positively influences nurse practitioner (NP) job satisfaction. This nonexperimental mixed-methods study utilized an online survey, administered through Qualtrics containing demographic and mentoring variables. Job satisfaction results were obtained from the Misener Nurse Practitioner Job Satisfaction Scale (MNPJSS). Also, open-ended questions regarding mentoring were reported. There was a 54% response rate in which 37 of the 69 participants responded (n = 37), with statistical significance set at p job satisfaction. Scores from the MNPJSS ranged from 141 to 246, with a mean of 195.26 (SD = 28.29) corresponding to "minimally satisfied" or a mean of 4.44 on the 6-point scale. These results are similar to the MNPJSS score with a mean of 4.39. A mentoring experience can provide a positive environment, which can lead to increased job satisfaction. In turn, a higher level of satisfaction in the work environment can be associated with reduced turnover and improved retention and patient outcomes. Ultimately, a safer health care system will evolve and improve patient care and outcomes. Through Watson's Caring Model, a reciprocal relationship between the mentor and the mentee can provide a new NP hire a sense of community and direct availability. By experiencing a mentor relationship, job satisfaction can improve, which is a key factor in retaining NPs. As E-mentoring is a newer topic in nursing literature, further research is needed. Further studies could also review and develop one-on-one mentoring programs.

Study on developing a business index using electric power demand for industry

Energy Technology Data Exchange (ETDEWEB)

Nah, In Kang [Korea Energy Economics Institute, Euiwang (Korea)

1999-10-01

In this study, it examined a business index using the amount of electric power used for industry and studied a method to distinguish business fluctuations. Using a measuring model, it applied a method to distinguish economy to the amount of electric power used. First of all it used a dynamic factor analysis of Stock-Watson(SW) for a multivariable analysis, and for a single variable analysis, it used Markov Switching method by Hamilton to verify the capability of distinguishing business situation by the amount of electric power used. As a result of using monthly amount of electric power used, it showed a big difference between the peak and low point of data from the National Statistical Office. Looking at the depression rate at the end of 1997, most of measuring models realized that depression started in December 1997 and expected to end in August 1998. This study aims to improve existing foreign measuring models to be adjusted in Korean situation. (author). 23 refs., 38 figs., 20 tabs.

A new cryptogonimid (Digenea) from the Mayan cichlid, Cichlasoma urophthalmus (Osteichthyes: Cichlidae), in several localities of the Yucatán Peninsula, Mexico.

Science.gov (United States)

Razo-Mendivil, Ulises; Rosas-Valdez, Rogelio; Pérez-Ponce de León, Gerardo

2008-12-01

Oligogonotylus mayae n.sp. is described from the intestine of the Mayan cichlid Cichlasoma urophthalmus (Günther) in Ría Lagartos, Ría Celestún, and Estero Progreso, Yucatán State. This is the second species described for Oligogonotylus Watson, 1976, the other being O.manteri Watson, 1976. The new species is readily distinguished from O. manteri by the anterior extension of the vitelline follicles. In O. Manteri, Vitelline follicles are found entirely in the hindbody, extending posteriorly to mid-testicular level. Vitelline follicles in the new species extend from teh anterior margin of posterior testis to the region between the bentral sucker and the pharynx. comparison of approximately 1,850 bases of ribosomal DNA (ITS1, ITS2, 5.8S, and 28S), and 400 bases of cytochrome c oxidase subunit I (cox1) strongly supports the status of O. mayae as a new species, as compared to O. manteri collected from cichlids in other localities of Mexico, Belize, and Guatemala.

Rates for the competitive market

International Nuclear Information System (INIS)

Ander, B.; Watson, I.; Snelson, K.

1997-01-01

The discussion panel consisted of Bruce Ander of Pamco Atlas, Ian Watson, Chair of the Ontario Chamber of Commerce Energy Committee, and Ken Snelson, Principal of Snelson International Energy. Ian Watson shared his membership's views on the future supply of electric power under a competitive energy system in Ontario, stressing the need for the government to instruct Ontario Hydro to bring forward a transmission rate to the Ontario Energy Board in 1997, and for legislation to allow independent buyers and sellers to contract with one another to use that transmission rate outside the control of Ontario Hydro. He also expressed concern about Ontario Hydro's anti-competitive load retention rate which was an obvious bid to retain its major customers. Ken Snelson reported on a review of the effects of competition on Canada's long-term energy outlook. He predicted that in a competitive market with full retail access, customers can expect a lot more choice; independent producers also will have many more options for selling power

Who Invented the Word Asteroid: William Herschel or Stephen Weston?

Science.gov (United States)

Cunningham, Clifford J.; Orchiston, Wayne

2011-11-01

William Herschel made the first serious study of 1 Ceres and 2 Pallas in the year 1802. He was moved by their dissimilarities to the other planets to coin a new term to distinguish them. For this purpose he enlisted the aid of his good friends William Watson and Sir Joseph Banks. Watson gave him a long list of possible names, which Herschel rejected. With a lifetime of experience classifying and naming newly found objects in nature, Banks became the man both Erasmus Darwin (in 1781) and William Herschel (in 1802) turned to for sage advice in developing a new descriptive language. In the case of Ceres and Pallas, Banks turned the task over to his friend, the noted philologist Stephen Weston, FRS. It has recently been stated by a noted British historian that it was Weston - not Herschel - who coined the term 'asteroid' to collectively describe Ceres and Pallas. This claim is investigated, and parallels are drawn in the use of neologism in astronomy and botany.

[Considering body ethics in the healthcare profession].

Science.gov (United States)

Wang, Shin-Yun

2014-10-01

This article uses the theory of body phenomenology and Watson's caring theory to develop and apply body ethics to the clinical healthcare profession. This attempt is meant to facilitate deep, humanistic experiences for healthcare personnel. The analysis of body phenomenology reveals that the soul is banished from her familiar and comfortable "at-home" status when illness and pain invade the body. In such situations, the body becomes an external object that is self-alienated. This experience induces experiences such as solitude and violence. However, it also holds the potential to expose the original morality of the body. Additionally, this article discusses popular tools used in clinical ethics such as principalism and virtual-based ethics, which are based on moral reasoning and moral feeling. In contrast to these, body ethics seek a more profound and humble level of sensibility that is able to implant authenticity into the ethics. Finally, we offer some suggestions related to Watson's caring theory.

Resonance – Journal of Science Education | Indian Academy of ...

Indian Academy of Sciences (India)

https://www.ias.ac.in/article/fulltext/reso/019/03/0222-0241. Keywords. John McCarthy; artificial intelligence; natural language processing; question answering system; IBM; DeepQA; Watson; Jeopardy!; quiz show. Author Affiliations. Raman Chandrasekar1. ProQuest 501 North 34th Street Suite 300, Seattle, WA 98103, USA ...

Pneumococcal Vaccine to Counter Emerging Infectious Disease Threat in the Military

Science.gov (United States)

2001-12-01

Medical Center. San pathogen is an even greater threat to some subpopulations in Diego, CA; Wyeth Lederle Vaccines: LT David Cute, MC USN, Erica...Butler JC. Tenover FC, Elliott JA, Facklam RR. Emergence of 43. Musher DM, Luchi MJ, Watson DA, Hamilton R, Baughn RE: Pneumococcal drug-resistant

The role of biotechnology in the socio-economic advancement and ...

African Journals Online (AJOL)

Biotechnology is any technique which involves the application of biological organisms or their components, systems or processes to manufacturing and service industries to make or modify products, to improve plants or animals or to develop micro-organisms for special uses. Since 1953, when James Watson and Francis ...

Confronting Science: The Dilemma of Genetic Testing.

Science.gov (United States)

Zallen, Doris T.

1997-01-01

Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)

The main cause of problematic ERP implementations : Bad management or functional mismatches?

NARCIS (Netherlands)

Koning, de W. Fred

2005-01-01

This paper describes the results of a multiple case study in which five ERP implementations were investigated. This case study led to some remarkable conclusions. Using the project implementation success of Wixom and Watson (2001) as a yardstick, only two out of the five cases could be considered as

Toward a Model Based-Bayesian Theory for Estimating and Recognizing Parameterized 3-D Objects Using Two or More Images Taken from Different Positions

Science.gov (United States)

1989-10-01

Aires, and Philips Laboratory at Briarcliff, NY. B. Cernuschi-Frias is with Facultad de Ingenieria , Universidad de Buenos Aires, Buenos Aires... Ingenieria , Universidad de Buenos Aires, and from IBM (Thomas J. Watson Research Center). David B. Cooper (S’53-M’64) received the B.Sc. and Sc.M

Activate Your Body (A Cup of Health with CDC)

Centers for Disease Control (CDC) Podcasts

As people age, it gets tougher to be physically active. While cutting back on certain activities is inevitable, finding ways to exercise on a regular basis is important for maintaining good health. In this podcast, Dr. Kathy Watson discusses the importance of older adults maintaining an active lifestyle.

Integer programming and combinatorial optimization : 15th international conference, IPCO 2011, New York NY, USA, June 15-17, 2011 : proceedings

NARCIS (Netherlands)

Günlük, O.; Woeginger, G.J.

2011-01-01

This volume contains the 33 papers presented at IPCO 2011, the 15th Conference on Integer Programming and Combinatorial Optimization, held during June 15–17, 2011 at the IBM T.J. Watson Research Center in New York, USA. IPCO conferences are sponsored by the Mathematical Optimization Society. The

The Structure of Anxiety and Depression in a Normative Sample of Younger and Older Australian Adolescents

Science.gov (United States)

Tully, Phillip J.; Zajac, Ian T.; Venning, Anthony J.

2009-01-01

It has been reported that depression and anxiety have overlapping symptoms and are conceptually interrelated. One of the most prominent theoretical developments that explain this association is Clark and Watson's tripartite model ("Journal of Abnormal Psychology," 100:316-336, 1991) that posits these two disorders and negative emotions…

CHAPTER 1

African Journals Online (AJOL)

Dr Olaleye

1Department of Physiotherapy, Faculty of College Allied Health Sciences, Bayero University, Kano, Nigeria ... motor recovery on QoL of Nigerian stroke survivors in the acute and sub-acute stages of recovery is .... instruments include the World Health Organization .... Preedly VR and Ronald R Watson (eds) Handbook of.

Induction and flow cytometry identification of mixoploidy through ...

African Journals Online (AJOL)

faten omezzine

16436 Afr. J. Biotechnol. 1.8 and 2. ..... 29:35-40. Alberts B, Bray D, Lewis J, Raff M, Roberts K,Watson D (1994). ... Gu XF, Yang AF, Meng H, Zhang JR (2005). In vitro ... Punt W, Blackmore S, Nilsson S and Le Thomas A (1994). Glossary of.

C9H14N

Indian Academy of Sciences (India)

J. Chem. Sci. Vol. 128, No. 7, July 2016, pp. 1037–1045. c Indian Academy of ..... Teraski O, Barry J C and Thomas J M 1987 Nature ... Betteridge P W, Carruthers J R, Cooper R I, Prout K and ... Clegg W and Watson D G 2007 Acta Cryst.

(De Winton, 1897) and A. namaquensis (A. Smith, 1834) (Rodentia

African Journals Online (AJOL)

1993-03-24

Mar 24, 1993 ... genus Aethornys Thomas, the present study examines non- geographic variation in ... Watson 1986; Visser & Robinson 1986; 1987; Brecd, Cox,. Leigh & Hawkins 1988) ... Verheyen & Bracke (J 966), Morris (J 972), Perrin (J 982) and Dippenaar ...... GENOWA YS, H.H. & JONES, Jr., J.K. t972. Variation and.

Beech Bark Disease

Science.gov (United States)

David R. Houston; James T. O' Brien

1983-01-01

Beech bark disease causes significant mortality and defect in American beech, Fagus grandifolia (Ehrh.). The disease results when bark, attacked and altered by the beech scale, Cryptococcus fagisuga Lind., is invaded and killed by fungi, primarily Nectria coccinea var. faginata Lohman, Watson, and Ayers, and sometimes N. galligena Bres.

Human Genome Research: Decoding DNA

Science.gov (United States)

dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

The Role of Entrepreneurial Financing on National Output: An ...

African Journals Online (AJOL)

Nneka Umera-Okeke

integration, Error Correction Estimates and Pairwise Granger Causality tests. It was discovered that in ..... (3) nearby government territories; using questionnaires and broke down utilizing chi- ..... Adjusted R-squared 0.810671 S.D. dependent var ... confirms its goodness of fit and its Durbin-Watson value of 1.873394 is within.

Estimation of the PCR efficiency based on a size-dependent modelling of the amplification process

NARCIS (Netherlands)

Lalam, N.; Jacob, C.; Jagers, P.

2005-01-01

We propose a stochastic modelling of the PCR amplification process by a size-dependent branching process starting as a supercritical Bienaymé–Galton–Watson transient phase and then having a saturation near-critical size-dependent phase. This model based on the concept of saturation allows one to

Nieuwe gegevens over de sectie Rubus uit het genus Rubus L. in Nederland

NARCIS (Netherlands)

Beek, van de A.

2005-01-01

In dit artikel worden een nieuwe serie en enkele nieuwe soorten van het genus Rubus (Braam) beschreven. Nieuwe series: Gypsocaulon (P.J. Mueller ex Sudre) Watson ex A.Beek. Nieuwe soorten: Rubus kolmariensis (Spribille) A.Beek; R. desarmatus A.Beek; R. nelliae A.Beek; R. calothyrsus A.Beek; R.

A new taxonomy of sublinear keyword pattern matching algorithms

NARCIS (Netherlands)

Cleophas, L.G.W.A.; Watson, B.W.; Zwaan, G.

2004-01-01

Abstract This paper presents a new taxonomy of sublinear (multiple) keyword pattern matching algorithms. Based on an earlier taxonomy by Watson and Zwaan [WZ96, WZ95], this new taxonomy includes not only suffix-based algorithms related to the Boyer-Moore, Commentz-Walter and Fan-Su algorithms, but

Research in Electronics - JSEP (Joint Services Electronics Program)

Science.gov (United States)

1982-04-01

Laboratory Lexington, MA, May 1, 1981, P.L. Kelley, H. Fetterman * P. Tannenbaum, R. Osgood EGG Inc. Salem. MA, May 1, 1981, S. Goldberg. S. Friedman Los...Helvajian Thomas Fischer Michael Stuke Joseph Catanzarite Delroy Baugh Frough Shokoohi Thomas Watson Fanao Kong David Sumida Jim-Son Chou Julio

Conflicting Ideologies and Language Policy in Adult ESL: Complexities of Language Socialization in a Majority-L1 Classroom

Science.gov (United States)

Mori, Miki

2014-01-01

This study looks at how language ideologies affect and are revealed in language socialization practices in a majority-L1 adult ESL classroom, particularly looking at language use and policy. It draws on recent theories and critiques of language socialization (Bayley & Langman, 2011; Bronson & Watson-Gegeo, 2008; Garrett &…

Ideas. A History: From Fire to Freud. 2. ed.; Ideen. Eine Kulturgeschichte von der Entdeckung des Feuers bis zur Moderne

Energy Technology Data Exchange (ETDEWEB)

Watson, P.

2005-07-01

In this hugely ambitious and exciting book Peter Watson tells the history of ideas from prehistory to the present day, seeking a new way to tell the history of the world. The book begins over a million years ago with a discussion of how the earliest ideas might have originated. Looking at animal behaviour that appears to require some thought tool-making, territoriality, counting, language (or at least sounds), pairbonding Peter Watson moves on to the apeman and the development of simple ideas such as cooking, the earliest language, the emergence of family life. All the obvious areas will be tackled the Ancient Greeks, Christian theology, the ideas of Jesus, astrological thought, the soul, the self, beliefs about the heavens, the ideas of Islam, the Crusades, humanism, the Renaissance, Gutenberg and the book, the scientific revolution, the age of discovery, Shakespeare, the idea of Revolution, the Romantic imagination, Darwin, imperialism, modernism, Freud right up to the present day and the internet. (orig./GL) [German] Beginnt die Ideengeschichte der Menschheit, als die Fruehmenschen erstmals Feuer machen, vor ca. 1,8 Millionen Jahren? Oder schon mit dem ersten Faustkeil vor etwa 2,5 Millionen Jahren? Warum entwickelte sich vor 40 000 Jahren eine komplexe Sprache? Wie kamen das Minus- und das Plus-Zeichen in die Vorstellungswelt, und wie entstand das Bild vom Paradies? Peter Watson laedt ein zu einer Expedition durch die abenteuerliche Welt menschlicher Ideen. Vom ersten Feuer, dem ersten Werkzeug und den ersten Worten ueber die Geburt der Goetter, die ersten Gesetze und die Entwicklung grosser Zentren von Wissen und Weisheit bis hin zu den umwaelzenden Ideen der Moderne: das Groesste und das Kleinste, das Selbst-Bewusstsein des Individuums und die Entdeckung des Unbewussten. Dabei ordnet Watson die riesige Materialfuelle nach drei zentralen Ideen, die fuer ihn die Geschichte der Menschheit praegen: die Seele, mehr als die Idee von einem Gott, Europa, mehr als das

Reform, Racism and the Centrality of Whiteness: Assessment, Ability and the "New Eugenics"

Science.gov (United States)

Gillborn, David

2010-01-01

The Nobel Prize winning scientist James Watson was vilified when his views on the supposedly inherent deficiencies of black people became public. The scientific establishment, mainstream media and politicians joined a chorus of disapproval that would seem to evidence a widespread rejection of the old myths of racially ordered intelligence.…

78 FR 75899 - Safety Zone; 2013 Holiday Boat Parades, Captain of the Port Miami Zone; FL

Science.gov (United States)

2013-12-13

... on Watson Island, head west around Palm Island and Hibiscus Island, head east between Di Lido Island... Environmental Health Risks and Safety Risks. This rule is not an economically significant rule and does not create an environmental risk to health or risk to safety that may disproportionately affect children. 11...

77 FR 70681 - Special Local Regulations; 2012 Holiday Boat Parades, Captain of the Port Miami Zone; FL

Science.gov (United States)

2012-11-27

... on Watson Island, head west around Palm Island and Hibiscus Island, head east between Di Lido Island..., Protection of Children from Environmental Health Risks and Safety Risks. This rule is not an economically significant rule and does not create an environmental risk to health or risk to safety that may...

On the irrationality of Ramanujan's mock theta functions and other q-series at an infinite number of points

OpenAIRE

Mingarelli, Angelo B.

2007-01-01

We show that all of Ramanujan's mock theta functions of order 3, Watson's three additional mock theta functions of order 3, the Rogers-Ramanujan q-series, and 6 mock theta functions of order 5 take on irrational values at the points q=\\pm 1/2,\\pm 1/3,\\pm 1/4,...

Fulltext PDF

Indian Academy of Sciences (India)

Admin

skills, must be compatible and be capable of resolving debates which ... The Turing Award which is the highest recognition given to computer scientists was given ... A much more remarkable feat was IBM Watson beating in 2011 the human champion in a ... The game Jeopardy! televised in USA involves framing a question.

SHORT COMMUNICATION Serological profiles of Herpes simplex ...

African Journals Online (AJOL)

Dr.Mirambo

Journal of Infectious Diseases, 185, 45-52. Watson-Jones, D., Weiss, H.A., Rusizoka, M., Changalucha, J., Baisley, K., Mugeye, K., Tanton, C.,. Ross, D., Everett, D. & Clayton, T. (2008) Effect of herpes simplex suppression on incidence of HIV among women in Tanzania. New England Journal of Medicine 358: 1560-1571.

40 CFR 52.233 - Review of new sources and modifications.

Science.gov (United States)

2010-07-01

... construction, work is suspended for 1 year. (7) Any owner or operator subject to the provisions of this..., or if during the construction, work is suspended for 1 year. (6) Approval to construct or modify... Implementation Plan, the Watson petroleum refinery owned by Atlantic Richfield Company, located at 1801 East...

Disease: H01235 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available ion characterized by mild to moderate mucocutaneous bleeding. Patients are with platelet dysfunction but nor...et P2Y12 receptor of a patient with congenital bleeding. ... JOURNAL ... Proc Natl Ac...i J, Collins PW, Watson SP, Morgan NV ... TITLE ... SLFN14 mutations underlie thrombocytopenia with excessive bleeding

Investigating electronic portfolio in pre-service teacher education in the Gulf Region

NARCIS (Netherlands)

Alhammar, A.

2006-01-01

Keeping its higher education systems competitive in the 21st century, the technology era, is the vital task of higher education in the Gulf Region as well as throughout the world (Abdullah, 2001; Alaasemi, 2003; Al-Nagim, 2002; Watson, 2001). The use of the Internet and Web-based tools and support

Allies and Competitors as Enscripted Audiences in Scientific Writing.

Science.gov (United States)

Perry, Susan

A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…

Substituent Effects on Hydrogen Bonds in DNA : A Kohn-Sham DFT Approach

NARCIS (Netherlands)

Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

2006-01-01

In this Chapter, we discuss how the hydrogen bonds in Watson-Crick base pairs can be tuned both structurally and in terms of bond strength by exposing the DNA bases to different kinds of substitutions: (1) substitution in the X-H Y hydrogen bonding moiety, (2) remote substitution, i.e., introducing

Spatial Long-Range Modulation of Contrast Discrimination

Science.gov (United States)

2000-07-01

details. power p and then divided by the divisive 91 inhibitory input (I) plus an additive constant. That is, R EPR = -- (1) I+a where c is an...contrast and contrast discrimination. Vision Research, 38, 1935 -1945. 18. Solomon, J. A., Watson, A. B. & Morgan, M. J. (1999). Transducer model produces