WorldWideScience

Sample records for watson method

  1. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  2. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  3. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  4. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  5. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  6. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  7. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  8. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  9. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  10. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  11. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  12. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  13. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  14. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  15. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  16. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  17. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  18. Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

    Directory of Open Access Journals (Sweden)

    Brent Tisserat

    2018-04-01

    Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

  19. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  20. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  1. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  2. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  3. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  4. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  5. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  6. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  7. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  8. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  11. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  12. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  13. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  14. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  15. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  16. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  17. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  18. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  19. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  20. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  1. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  2. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  3. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  4. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  5. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  6. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  7. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  8. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  9. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  10. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  11. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  12. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  13. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  14. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  15. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  16. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  17. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  18. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  19. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  20. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  1. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  2. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  3. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  4. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  5. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  6. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  7. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  8. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  9. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  10. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  11. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  12. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  13. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  14. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  15. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  16. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  17. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  18. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  19. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  20. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  1. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  2. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  3. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  4. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  5. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  6. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  7. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  8. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  9. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  10. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  11. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  12. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  13. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  14. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  15. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  16. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  18. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  19. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  20. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  1. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  2. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  3. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  4. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  5. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  6. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  7. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  8. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  9. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  10. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  11. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  12. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  13. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  14. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  15. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  16. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  17. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  18. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  19. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  20. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  2. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  3. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  4. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  5. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  6. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  7. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  8. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  9. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  10. Comparison of approximate methods for multiple scattering in high-energy collisions. II

    International Nuclear Information System (INIS)

    Nolan, A.M.; Tobocman, W.; Werby, M.F.

    1976-01-01

    The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

  11. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  12. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  13. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  14. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  15. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  16. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  17. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  19. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  20. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  1. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  2. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  3. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  4. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  5. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  6. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  7. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  8. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  9. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  10. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  11. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  12. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  13. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  14. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  15. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  16. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  17. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  18. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  20. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  1. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  2. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  3. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  4. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  5. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  6. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  8. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  9. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  10. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  11. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  12. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  13. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  14. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  15. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  16. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  17. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  18. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  19. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  20. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  2. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  3. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  4. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  5. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  6. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  7. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  8. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  9. Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

    Directory of Open Access Journals (Sweden)

    Marjan Diayanat

    2018-02-01

    Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

  10. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  11. Using grounded theory as a method for rigorously reviewing literature

    NARCIS (Netherlands)

    Wolfswinkel, J.; Furtmueller-Ettinger, Elfriede; Wilderom, Celeste P.M.

    2013-01-01

    This paper offers guidance to conducting a rigorous literature review. We present this in the form of a five-stage process in which we use Grounded Theory as a method. We first probe the guidelines explicated by Webster and Watson, and then we show the added value of Grounded Theory for rigorously

  12. The practice of nurses caring for families of pediatric inpatients in light of Jean Watson

    Directory of Open Access Journals (Sweden)

    Maiara Rodrigues dos Santos

    2014-08-01

    Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.

  13. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  14. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  15. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  16. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  17. Computational Methods for Inviscid and Viscous Two-and-Three-Dimensional Flow Fields.

    Science.gov (United States)

    1975-01-01

    Difference Equations Over a Network, Watson Sei. Comput. Lab. Report, 19U9. 173- Isaacson, E. and Keller, H. B., Analaysis of Numerical Methods...element method has given a new impulse to the old mathematical theory of multivariate interpolation. We first study the one-dimensional case, which

  18. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  19. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  20. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  1. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  2. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  3. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  4. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    Science.gov (United States)

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  5. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  6. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  7. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  8. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  9. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  10. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  15. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  16. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  17. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  18. Effective Lagrangians, Watson's theorem and the E2/M1 mixing ratio in the excitation of the Delta resonance

    International Nuclear Information System (INIS)

    Davidson, R.M.

    1992-01-01

    The author investigates theoretical uncertainties and model dependence in the extraction of the nucleon-delta(1232) electromagnetic transition amplitudes from the multipole data base. The starting point is an effective Lagrangian incorporating chiral symmetry, which includes at the tree level the pseudovector Born terms, leading t-channel vector meson exchanges, and s and u channel delta exchanges. The nucleon-delta magnetic dipole (M1) and electric quadrupole (E2) transition amplitudes are expressed in terms of two independent gauge couplings at the γNΔ vertex. After unitarizing the tree level amplitude, the gauge couplings are fitted to various multipole data sets, thus determining E2 and M1. Although there is much sensitivity to the method used to unitarize the amplitude, the author extracts the E2/M1 ratio to be negative, with a magnitude around 1.5%. 11 refs., 3 figs

  19. Method

    Directory of Open Access Journals (Sweden)

    Ling Fiona W.M.

    2017-01-01

    Full Text Available Rapid prototyping of microchannel gain lots of attention from researchers along with the rapid development of microfluidic technology. The conventional methods carried few disadvantages such as high cost, time consuming, required high operating pressure and temperature and involve expertise in operating the equipment. In this work, new method adapting xurography method is introduced to replace the conventional method of fabrication of microchannels. The novelty in this study is replacing the adhesion film with clear plastic film which was used to cut the design of the microchannel as the material is more suitable for fabricating more complex microchannel design. The microchannel was then mold using polymethyldisiloxane (PDMS and bonded with a clean glass to produce a close microchannel. The microchannel produced had a clean edge indicating good master mold was produced using the cutting plotter and the bonding between the PDMS and glass was good where no leakage was observed. The materials used in this method is cheap and the total time consumed is less than 5 hours where this method is suitable for rapid prototyping of microchannel.

  20. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  1. method

    Directory of Open Access Journals (Sweden)

    L. M. Kimball

    2002-01-01

    Full Text Available This paper presents an interior point algorithm to solve the multiperiod hydrothermal economic dispatch (HTED. The multiperiod HTED is a large scale nonlinear programming problem. Various optimization methods have been applied to the multiperiod HTED, but most neglect important network characteristics or require decomposition into thermal and hydro subproblems. The algorithm described here exploits the special bordered block diagonal structure and sparsity of the Newton system for the first order necessary conditions to result in a fast efficient algorithm that can account for all network aspects. Applying this new algorithm challenges a conventional method for the use of available hydro resources known as the peak shaving heuristic.

  2. Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

    Science.gov (United States)

    Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

    2018-01-01

    A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

  3. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  4. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  6. The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

  7. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  8. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  9. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  10. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez

    2009-01-01

    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  11. On the Pragmatic Functions of English Rhetoric in Public Speech: A Case Study of Emma Watson's "HeForShe"

    Science.gov (United States)

    Yuan, Bin

    2018-01-01

    The current research is mainly conducted to explore the pragmatic functions of English rhetoric in public speech. To do this, methods of close reading and case studies are adopted. The research first reveals that the boom of public speech programs helps reexamine the art of utterance, during the delivery of which English rhetoric plays an…

  12. The Importance of Short- and Long-Range Exchange on Various Excited State Properties of DNA Monomers, Stacked Complexes, and Watson-Crick Pairs.

    Science.gov (United States)

    Raeber, Alexandra E; Wong, Bryan M

    2015-05-12

    We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.

  13. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  14. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  15. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  16. "Doktor Watson minu õuel!" / Allar Viivik

    Index Scriptorium Estoniae

    Viivik, Allar

    2002-01-01

    Äsjalahkunud näitlejat Vitali Solominit (1941-2002) meenutab Juuliku villa elanik Leo Orav. Siin filmis režissöör Igor Maslennikov paar episoodi "Baskerville'de koerast" vene Sherlock Holmes'i seriaalist. Vitali Solomin mängis doktor Watsonit. Ka teistest selle seriaali võttepaikadest Eestis

  17. Alternative Watson-Crick Synthetic Genetic Systems.

    Science.gov (United States)

    Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

    2016-11-01

    In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  18. Different methods and metaphysics in early molecular genetics--a case of disparity of research?

    Science.gov (United States)

    Deichmann, Ute

    2008-01-01

    The encounter between two fundamentally different approaches in seminal research in molecular biology--the problems, aims, methods and metaphysics--is delineated and analyzed. They are exemplified by the microbiologist Oswald T. Avery who, in line with the reductionist mechanistic metaphysics of Jacques Loeb, attempted to explain basic life phenomena through chemistry; and the theoretical physicist Max Delbrück who, influenced by Bohr's antimechanistic views, preferred to explain these phenomena without chemistry. Avery's and Delbrück's most important studies took place concurrently. Thus analysis of their contrasting approaches lends itself to examination of the Weltanschauungen view concerning the role of fundamental (metaphysical) assumptions in scientific change, that is, the view that empirical research cannot be neutral in regard to the worldviews of the researchers. This study shows that the initial ostensible disparity (non-integratibility) of the two approaches lasted for just a short time. Ironically it was a student of Delbrück's school, James Watson, who (with Crick) proposed a chemical model, the DNA double helix, as a solution to Delbrück's problem. The structure of DNA has not been seriously challenged over the past half century Moreover, Watson's and Crick's work did not call into question the validity of Delbrück's research, but opened it up to entirely new approaches. The case of Avery and Delbrück demonstrates that after initial obstacles were overcome the different fundamental attitudes and the resulting research practices were capable of integration.

  19. The Use of Conditional Probability Integral Transformation Method for Testing Accelerated Failure Time Models

    Directory of Open Access Journals (Sweden)

    Abdalla Ahmed Abdel-Ghaly

    2016-06-01

    Full Text Available This paper suggests the use of the conditional probability integral transformation (CPIT method as a goodness of fit (GOF technique in the field of accelerated life testing (ALT, specifically for validating the underlying distributional assumption in accelerated failure time (AFT model. The method is based on transforming the data into independent and identically distributed (i.i.d Uniform (0, 1 random variables and then applying the modified Watson statistic to test the uniformity of the transformed random variables. This technique is used to validate each of the exponential, Weibull and lognormal distributions' assumptions in AFT model under constant stress and complete sampling. The performance of the CPIT method is investigated via a simulation study. It is concluded that this method performs well in case of exponential and lognormal distributions. Finally, a real life example is provided to illustrate the application of the proposed procedure.

  20. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  1. A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

    NARCIS (Netherlands)

    Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

    1995-01-01

    In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

  2. Computer‐Assisted Library Instruction and Face‐to‐Face Library Instruction Prove Equally Effective for Teaching Basic Library Skills in Academic Libraries. A review of: Zhang, Li, Watson, Erin M. and Banfield, Laura. ʺThe Efficacy of Computer‐Assisted Instruction Versus Face‐to‐Face Instruction in Academic Libraries: A Systematic Review.ʺ The Journal of Academic Librarianship 33.4 (July 2007: 478‐484.

    Directory of Open Access Journals (Sweden)

    Stephanie Walker

    2008-03-01

    , and case studies, with a sample size greater than one and with pre‐ and post‐test measurements;study participants had to be academic library patrons; the study needed to compare CAI and face‐to‐face instruction; and both the students’ information skills and reactions to the instruction had to be measured. This left 40 unique studies, which were then retrieved in full text. Next, studies were selected to meet the inclusion criteria further using the QUOROM format, a reporting structure used for improving the quality of reports of meta‐analyses of randomised trials (Moher et al 1896‐1900. Evaluation of methodological quality was then done using a dual method: authors Watson and Zhang assessed the studies independently, each using the “Checklist for Study Quality” developed by Downs and Black (Downs and Black 377‐384, adapted slightly to remove non‐relevant questions. After analysis, when additional information was needed, original study authors werecontacted. Finally, ten studies were included in the analysis.The instruction sessions covered many topics, such as catalog use, reading citations, awareness of library services and collections, basic searching of bibliographic databases, and more. But all could qualify as basic, rather than advanced, library instruction. All studies did pre‐ and posttests of students’ skills – some immediatelyafter instruction, and others with a time lapse of up to six weeks. Most authors created their own tests, though one adapted an existing scale. Individual performance improvement was not studied in many cases due to privacy concerns.Main Results ‐ Nine of the ten studies found CAI and face‐to‐face instruction equally effective; the tenth study found face to‐face instruction more effective. The students’ reaction to instruction methods varied – some students felt more satisfied with face‐to‐face instruction and felt that they learned better, while other studies found that students receiving CAI

  3. Scattering in an intense radiation field: Time-independent methods

    International Nuclear Information System (INIS)

    Rosenberg, L.

    1977-01-01

    The standard time-independent formulation of nonrelativistic scattering theory is here extended to take into account the presence of an intense external radiation field. In the case of scattering by a static potential the extension is accomplished by the introduction of asymptotic states and intermediate-state propagators which account for the absorption and induced emission of photons by the projectile as it propagates through the field. Self-energy contributions to the propagator are included by a systematic summation of forward-scattering terms. The self-energy analysis is summarized in the form of a modified perturbation expansion of the type introduced by Watson some time ago in the context of nuclear-scattering theory. This expansion, which has a simple continued-fraction structure in the case of a single-mode field, provides a generally applicable successive approximation procedure for the propagator and the asymptotic states. The problem of scattering by a composite target is formulated using the effective-potential method. The modified perturbation expansion which accounts for self-energy effects is applicable here as well. A discussion of a coupled two-state model is included to summarize and clarify the calculational procedures

  4. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  5. Durbin-Watson statistic for the least trimmed squares

    Czech Academy of Sciences Publication Activity Database

    Víšek, Jan Ámos

    2001-01-01

    Roč. 8, č. 14 (2001), s. 1-40 ISSN 1212-074X Grant - others:GA UK(CZ) 255/2000/A EK/FSV Institutional research plan: CEZ:AV0Z1075907 Keywords : diagnostics * robustness * regression Subject RIV: BB - Applied Statistics, Operational Research

  6. Garri Potter povzroslel! / Daniel Radcliffe, Emma Watson ; interv. Stass Tõrkin

    Index Scriptorium Estoniae

    Radcliffe, Daniel, 1989-

    2005-01-01

    Peaosatäitja järjekorras neljandas Potteri ekraniseeringus "Harry Potter ja tulepeeker" endast, oma tegelaskuju arengust. Samas ka lühiintervjuu näitlejanna Emma Watsoniga. Režissöör Mike Newell : Suurbritannia-USA 2005

  7. Kate Watson on Reynold Humphries’ Hollywood’s Blacklists

    Directory of Open Access Journals (Sweden)

    2008-12-01

    Full Text Available Reynold Humphries. Hollywood’s Blacklists: A Political and Cultural History. Edinburgh: Edinburgh University Press, 2008. Reynold Humphries’ Hollywood’s Blacklists provides a comprehensive examination of the historical and political ramifications of the blacklisting process and of Communism in the motion picture industry. His section on ‘The Background’ initially sets up just this, making the debate and dispute accessible even to those not au fait with such knowledge. This section is informat...

  8. "Elementar, Meu Caro Watson": Jô Soares Reinvents the Classics

    Science.gov (United States)

    Martin, Sarah

    2016-01-01

    Detective fiction--with its roots primarily in Europe and the United States--was slow to catch on in Brazil, where national authors did not attempt more than small forays into the genre for most of the twentieth century. This was due in large part to the particularities of Brazilian society, in which law enforcement agencies, rife with corruption,…

  9. Discourses of Indiscipline: An Informal Hobbesian Riposte to Cate Watson

    Science.gov (United States)

    McManus, Michael

    2006-01-01

    Classroom battles are real and not a metaphor. Warfare is a historical and present fact of human life. Life really is a battle and conflict inevitable; injuries to the psyche are just as real as those to the body. Schools cannot step outside society. It is not Foucault but Thomas Hobbes who offers the most perceptive insight into human behaviour…

  10. What Would It Be Like to Be IBM's Computer, Watson?

    Science.gov (United States)

    Schlinger, Henry D., Jr.

    2012-01-01

    Rachlin (2012) makes two general assertions: (a) "To be human is to behave as humans behave, and to function in society as humans function," and (b) "essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer'. Although Rachlin's article is an…

  11. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-12-01

    Full Text Available In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913 conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  12. Watson, skinner y algunas disputas dentro del conductismo

    OpenAIRE

    Pellón Suárez de Puga, Ricardo

    2013-01-01

    In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913) conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  13. Agentes virtuales con capacidades cognitivas utilizando IBM Watson

    OpenAIRE

    Carrillo Calderón, Manuel Esteban

    2017-01-01

    Resumen (castellano) En la actualidad, los avances en la tecnología informática y la creciente globalización por medio de Internet y las redes sociales han obligado a que los comercios tradicionales luchen por digitalizarse, a la par que los comercios online traten de ser cada vez más personales y cercanos a los clientes. En esto consiste el comercio electrónico conversacional, una evolución del ecosistema del comercio electrónico. Hoy en día, los chats automáticos con mensajes estándar...

  14. Концепция когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson

    OpenAIRE

    Мазуров Никита Юрьевич; Струков Иван Александрович; Лебедева Марина Юрьевна

    2016-01-01

    в данной статье рассматривается роль концепции когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson. Авторы отмечают, что сфера когнитивных технологий крайне перспективна.

  15. Perturbation methods

    CERN Document Server

    Nayfeh, Ali H

    2008-01-01

    1. Introduction 1 2. Straightforward Expansions and Sources of Nonuniformity 23 3. The Method of Strained Coordinates 56 4. The Methods of Matched and Composite Asymptotic Expansions 110 5. Variation of Parameters and Methods of Averaging 159 6. The Method of Multiple Scales 228 7. Asymptotic Solutions of Linear Equations 308 References and Author Index 387 Subject Index 417

  16. Distillation methods

    International Nuclear Information System (INIS)

    Konecny, C.

    1975-01-01

    Two main methods of separation using the distillation method are given and evaluated, namely evaporation and distillation in carrier gas flow. Two basic apparatus are described for illustrating the methods used. The use of the distillation method in radiochemistry is documented by a number of examples of the separation of elements in elemental state, volatile halogenides and oxides. Tables give a survey of distillation methods used for the separation of the individual elements and give conditions under which this separation takes place. The suitability of the use of distillation methods in radiochemistry is discussed with regard to other separation methods. (L.K.)

  17. Gompertz: A Scilab Program for Estimating Gompertz Curve Using Gauss-Newton Method of Least Squares

    Directory of Open Access Journals (Sweden)

    Surajit Ghosh Dastidar

    2006-04-01

    Full Text Available A computer program for estimating Gompertz curve using Gauss-Newton method of least squares is described in detail. It is based on the estimation technique proposed in Reddy (1985. The program is developed using Scilab (version 3.1.1, a freely available scientific software package that can be downloaded from http://www.scilab.org/. Data is to be fed into the program from an external disk file which should be in Microsoft Excel format. The output will contain sample size, tolerance limit, a list of initial as well as the final estimate of the parameters, standard errors, value of Gauss-Normal equations namely GN1 GN2 and GN3 , No. of iterations, variance(σ2 , Durbin-Watson statistic, goodness of fit measures such as R2 , D value, covariance matrix and residuals. It also displays a graphical output of the estimated curve vis a vis the observed curve. It is an improved version of the program proposed in Dastidar (2005.

  18. Gompertz: A Scilab Program for Estimating Gompertz Curve Using Gauss-Newton Method of Least Squares

    Directory of Open Access Journals (Sweden)

    Surajit Ghosh Dastidar

    2006-04-01

    Full Text Available A computer program for estimating Gompertz curve using Gauss-Newton method of least squares is described in detail. It is based on the estimation technique proposed in Reddy (1985. The program is developed using Scilab (version 3.1.1, a freely available scientific software package that can be downloaded from http://www.scilab.org/. Data is to be fed into the program from an external disk file which should be in Microsoft Excel format. The output will contain sample size, tolerance limit, a list of initial as well as the final estimate of the parameters, standard errors, value of Gauss-Normal equations namely GN1 GN2 and GN3, No. of iterations, variance(σ2, Durbin-Watson statistic, goodness of fit measures such as R2, D value, covariance matrix and residuals. It also displays a graphical output of the estimated curve vis a vis the observed curve. It is an improved version of the program proposed in Dastidar (2005.

  19. galerkin's methods

    African Journals Online (AJOL)

    user

    The assumed deflection shapes used in the approximate methods such as in the Galerkin's method were normally ... to direct compressive forces Nx, was derived by Navier. [3]. ..... tend to give higher frequency and stiffness, as well as.

  20. Mining Method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Shik; Lee, Kyung Woon; Kim, Oak Hwan; Kim, Dae Kyung [Korea Institute of Geology Mining and Materials, Taejon (Korea, Republic of)

    1996-12-01

    The reducing coal market has been enforcing the coal industry to make exceptional rationalization and restructuring efforts since the end of the eighties. To the competition from crude oil and natural gas has been added the growing pressure from rising wages and rising production cost as the workings get deeper. To improve the competitive position of the coal mines against oil and gas through cost reduction, studies to improve mining system have been carried out. To find fields requiring improvements most, the technologies using in Tae Bak Colliery which was selected one of long running mines were investigated and analyzed. The mining method appeared the field needing improvements most to reduce the production cost. The present method, so-called inseam roadway caving method presently is using to extract the steep and thick seam. However, this method has several drawbacks. To solve the problems, two mining methods are suggested for a long term and short term method respectively. Inseam roadway caving method with long-hole blasting method is a variety of the present inseam roadway caving method modified by replacing timber sets with steel arch sets and the shovel loaders with chain conveyors. And long hole blasting is introduced to promote caving. And pillar caving method with chock supports method uses chock supports setting in the cross-cut from the hanging wall to the footwall. Two single chain conveyors are needed. One is installed in front of chock supports to clear coal from the cutting face. The other is installed behind the supports to transport caved coal from behind. This method is superior to the previous one in terms of safety from water-inrushes, production rate and productivity. The only drawback is that it needs more investment. (author). 14 tabs., 34 figs.

  1. Projection Methods

    DEFF Research Database (Denmark)

    Wagner, Falko Jens; Poulsen, Mikael Zebbelin

    1999-01-01

    When trying to solve a DAE problem of high index with more traditional methods, it often causes instability in some of the variables, and finally leads to breakdown of convergence and integration of the solution. This is nicely shown in [ESF98, p. 152 ff.].This chapter will introduce projection...... methods as a way of handling these special problems. It is assumed that we have methods for solving normal ODE systems and index-1 systems....

  2. Discipline methods

    OpenAIRE

    Maria Kikila; Ioannis Koutelekos

    2012-01-01

    Child discipline is one of the most important elements of successful parenting. As discipline is defined the process that help children to learn appropriate behaviors and make good choices. Aim: The aim of the present study was to review the literature about the discipline methods. The method οf this study included bibliography research from both the review and the research literature, mainly in the pubmed data base which referred to the discipline methods. Results: In the literature it is ci...

  3. Maintenance methods

    International Nuclear Information System (INIS)

    Sanchis, H.; Aucher, P.

    1990-01-01

    The maintenance method applied at the Hague is summarized. The method was developed in order to solve problems relating to: the different specialist fields, the need for homogeneity in the maintenance work, the equipment diversity, the increase of the materials used at the Hague's new facilities. The aim of the method is to create a knowhow formalism, to facilitate maintenance, to ensure the running of the operations and to improve the estimation of the maintenance cost. One of the method's difficulties is the demonstration of the profitability of the maintenance operations [fr

  4. Spectroscopic methods

    International Nuclear Information System (INIS)

    Ivanovich, M.; Murray, A.

    1992-01-01

    The principles involved in the interaction of nuclear radiation with matter are described, as are the principles behind methods of radiation detection. Different types of radiation detectors are described and methods of detection such as alpha, beta and gamma spectroscopy, neutron activation analysis are presented. Details are given of measurements of uranium-series disequilibria. (UK)

  5. Method Mixins

    DEFF Research Database (Denmark)

    Ernst, Erik

    2002-01-01

    . Method mixins use shared name spaces to transfer information between caller and callee, as opposed to traditional invocation which uses parameters and returned results. This relieves a caller from dependencies on the callee, and it allows direct transfer of information further down the call stack, e......The procedure call mechanism has conquered the world of programming, with object-oriented method invocation being a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior, where traditional...

  6. Method Mixins

    DEFF Research Database (Denmark)

    Ernst, Erik

    2002-01-01

    invocation is optimized for as-is reuse of existing behavior. Tight coupling reduces flexibility, and traditional invocation tightly couples transfer of information and transfer of control. Method mixins decouple these two kinds of transfer, thereby opening the doors for new kinds of abstraction and reuse......The procedure call mechanism has conquered the world of programming, with object-oriented method invocation being a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior, where traditional....... Method mixins use shared name spaces to transfer information between caller and callee, as opposed to traditional invocation which uses parameters and returned results. This relieves a caller from dependencies on the callee, and it allows direct transfer of information further down the call stack, e...

  7. Dosimetry methods

    DEFF Research Database (Denmark)

    McLaughlin, W.L.; Miller, A.; Kovacs, A.

    2003-01-01

    Chemical and physical radiation dosimetry methods, used for the measurement of absorbed dose mainly during the practical use of ionizing radiation, are discussed with respect to their characteristics and fields of application....

  8. Method Mixins

    DEFF Research Database (Denmark)

    Ernst, Erik

    2005-01-01

    The world of programming has been conquered by the procedure call mechanism, including object-oriented method invocation which is a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior, ...... the call stack, e.g., to a callee's callee. The mechanism has been implemented in the programming language gbeta. Variants of the mechanism could be added to almost any imperative programming language.......The world of programming has been conquered by the procedure call mechanism, including object-oriented method invocation which is a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior...

  9. Ensemble Methods

    Science.gov (United States)

    Re, Matteo; Valentini, Giorgio

    2012-03-01

    Ensemble methods are statistical and computational learning procedures reminiscent of the human social learning behavior of seeking several opinions before making any crucial decision. The idea of combining the opinions of different "experts" to obtain an overall “ensemble” decision is rooted in our culture at least from the classical age of ancient Greece, and it has been formalized during the Enlightenment with the Condorcet Jury Theorem[45]), which proved that the judgment of a committee is superior to those of individuals, provided the individuals have reasonable competence. Ensembles are sets of learning machines that combine in some way their decisions, or their learning algorithms, or different views of data, or other specific characteristics to obtain more reliable and more accurate predictions in supervised and unsupervised learning problems [48,116]. A simple example is represented by the majority vote ensemble, by which the decisions of different learning machines are combined, and the class that receives the majority of “votes” (i.e., the class predicted by the majority of the learning machines) is the class predicted by the overall ensemble [158]. In the literature, a plethora of terms other than ensembles has been used, such as fusion, combination, aggregation, and committee, to indicate sets of learning machines that work together to solve a machine learning problem [19,40,56,66,99,108,123], but in this chapter we maintain the term ensemble in its widest meaning, in order to include the whole range of combination methods. Nowadays, ensemble methods represent one of the main current research lines in machine learning [48,116], and the interest of the research community on ensemble methods is witnessed by conferences and workshops specifically devoted to ensembles, first of all the multiple classifier systems (MCS) conference organized by Roli, Kittler, Windeatt, and other researchers of this area [14,62,85,149,173]. Several theories have been

  10. Method Mixins

    DEFF Research Database (Denmark)

    Ernst, Erik

    2005-01-01

    The world of programming has been conquered by the procedure call mechanism, including object-oriented method invocation which is a procedure call in context of an object. This paper presents an alternative, method mixin invocations, that is optimized for flexible creation of composite behavior...... of abstraction and reuse. Method mixins use shared name spaces to transfer information between caller and callee, as opposed to traditional invocation which uses parameters and returned results. This relieves the caller from dependencies on the callee, and it allows direct transfer of information further down...... the call stack, e.g., to a callee's callee. The mechanism has been implemented in the programming language gbeta. Variants of the mechanism could be added to almost any imperative programming language....

  11. A method to evaluate genome-wide methylation in archival formalin-fixed, paraffin-embedded ovarian epithelial cells.

    Directory of Open Access Journals (Sweden)

    Qiling Li

    Full Text Available The use of DNA from archival formalin and paraffin embedded (FFPE tissue for genetic and epigenetic analyses may be problematic, since the DNA is often degraded and only limited amounts may be available. Thus, it is currently not known whether genome-wide methylation can be reliably assessed in DNA from archival FFPE tissue.Ovarian tissues, which were obtained and formalin-fixed and paraffin-embedded in either 1999 or 2011, were sectioned and stained with hematoxylin-eosin (H&E.Epithelial cells were captured by laser micro dissection, and their DNA subjected to whole genomic bisulfite conversion, whole genomic polymerase chain reaction (PCR amplification, and purification. Sequencing and software analyses were performed to identify the extent of genomic methylation. We observed that 31.7% of sequence reads from the DNA in the 1999 archival FFPE tissue, and 70.6% of the reads from the 2011 sample, could be matched with the genome. Methylation rates of CpG on the Watson and Crick strands were 32.2% and 45.5%, respectively, in the 1999 sample, and 65.1% and 42.7% in the 2011 sample.We have developed an efficient method that allows DNA methylation to be assessed in archival FFPE tissue samples.

  12. Statistical methods

    CERN Document Server

    Szulc, Stefan

    1965-01-01

    Statistical Methods provides a discussion of the principles of the organization and technique of research, with emphasis on its application to the problems in social statistics. This book discusses branch statistics, which aims to develop practical ways of collecting and processing numerical data and to adapt general statistical methods to the objectives in a given field.Organized into five parts encompassing 22 chapters, this book begins with an overview of how to organize the collection of such information on individual units, primarily as accomplished by government agencies. This text then

  13. Sieve methods

    CERN Document Server

    Halberstam, Heine

    2011-01-01

    Derived from the techniques of analytic number theory, sieve theory employs methods from mathematical analysis to solve number-theoretical problems. This text by a noted pair of experts is regarded as the definitive work on the subject. It formulates the general sieve problem, explores the theoretical background, and illustrates significant applications.""For years to come, Sieve Methods will be vital to those seeking to work in the subject, and also to those seeking to make applications,"" noted prominent mathematician Hugh Montgomery in his review of this volume for the Bulletin of the Ameri

  14. Characterization methods

    Energy Technology Data Exchange (ETDEWEB)

    Glass, J.T. [North Carolina State Univ., Raleigh (United States)

    1993-01-01

    Methods discussed in this compilation of notes and diagrams are Raman spectroscopy, scanning electron microscopy, transmission electron microscopy, and other surface analysis techniques (auger electron spectroscopy, x-ray photoelectron spectroscopy, electron energy loss spectroscopy, and scanning tunnelling microscopy). A comparative evaluation of different techniques is performed. In-vacuo and in-situ analyses are described.

  15. Digital Methods

    NARCIS (Netherlands)

    Rogers, R.

    2013-01-01

    In Digital Methods, Richard Rogers proposes a methodological outlook for social and cultural scholarly research on the Web that seeks to move Internet research beyond the study of online culture. It is not a toolkit for Internet research, or operating instructions for a software package; it deals

  16. Chromatographic methods

    International Nuclear Information System (INIS)

    Marhol, M.; Stary, J.

    1975-01-01

    The characteristics are given of chromatographic separation and the methods are listed. Methods and data on materials used in partition, adsorption, precipitation and ion exchange chromatography are listed and conditions are described under which ion partition takes place. Special attention is devoted to ion exchange chromatography where tables are given to show the course of values of the partition coefficients of different ions in dependence on the concentration of agents and the course of equilibrium sorptions on different materials in dependence on the solution pH. A theoretical analysis is given and the properties of the most widely used ion exchangers are listed. Experimental conditions and apparatus used for each type of chromatography are listed. (L.K.)

  17. Numerical methods

    CERN Document Server

    Dahlquist, Germund

    1974-01-01

    ""Substantial, detailed and rigorous . . . readers for whom the book is intended are admirably served."" - MathSciNet (Mathematical Reviews on the Web), American Mathematical Society.Practical text strikes fine balance between students' requirements for theoretical treatment and needs of practitioners, with best methods for large- and small-scale computing. Prerequisites are minimal (calculus, linear algebra, and preferably some acquaintance with computer programming). Text includes many worked examples, problems, and an extensive bibliography.

  18. Sampling methods

    International Nuclear Information System (INIS)

    Loughran, R.J.; Wallbrink, P.J.; Walling, D.E.; Appleby, P.G.

    2002-01-01

    Methods for the collection of soil samples to determine levels of 137 Cs and other fallout radionuclides, such as excess 210 Pb and 7 Be, will depend on the purposes (aims) of the project, site and soil characteristics, analytical capacity, the total number of samples that can be analysed and the sample mass required. The latter two will depend partly on detector type and capabilities. A variety of field methods have been developed for different field conditions and circumstances over the past twenty years, many of them inherited or adapted from soil science and sedimentology. The use of them inherited or adapted from soil science and sedimentology. The use of 137 Cs in erosion studies has been widely developed, while the application of fallout 210 Pb and 7 Be is still developing. Although it is possible to measure these nuclides simultaneously, it is common for experiments to designed around the use of 137 Cs along. Caesium studies typically involve comparison of the inventories found at eroded or sedimentation sites with that of a 'reference' site. An accurate characterization of the depth distribution of these fallout nuclides is often required in order to apply and/or calibrate the conversion models. However, depending on the tracer involved, the depth distribution, and thus the sampling resolution required to define it, differs. For example, a depth resolution of 1 cm is often adequate when using 137 Cs. However, fallout 210 Pb and 7 Be commonly has very strong surface maxima that decrease exponentially with depth, and fine depth increments are required at or close to the soil surface. Consequently, different depth incremental sampling methods are required when using different fallout radionuclides. Geomorphic investigations also frequently require determination of the depth-distribution of fallout nuclides on slopes and depositional sites as well as their total inventories

  19. Decontaminating method

    International Nuclear Information System (INIS)

    Furukawa, Toshiharu; Shibuya, Kiichiro.

    1985-01-01

    Purpose: To provide a method of eliminating radioactive contaminations capable of ease treatment for decontaminated liquid wastes and grinding materials. Method: Those organic grinding materials such as fine wall nuts shell pieces cause no secondary contaminations since they are softer as compared with inorganic grinding materials, less pulverizable upon collision against the surface to be treated, being capable of reusing and producing no fine scattering powder. In addition, they can be treated by burning. The organic grinding material and water are sprayed by a nozzle to the surface to be treated, and decontaminated liquid wastes are separated into solid components mainly composed of organic grinding materials and liquid components mainly composed of water by filtering. The thus separated solid components are recovered in a storage tank for reuse as the grinding material and, after repeating use, subjected to burning treatment. While on the other hand, water is recovered into a storage tank and, after repeating use, purified by passing through an ion exchange resin-packed column and decontaminated to discharge. (Horiuchi, T.)

  20. WELDING METHOD

    Science.gov (United States)

    Cornell, A.A.; Dunbar, J.V.; Ruffner, J.H.

    1959-09-29

    A semi-automatic method is described for the weld joining of pipes and fittings which utilizes the inert gasshielded consumable electrode electric arc welding technique, comprising laying down the root pass at a first peripheral velocity and thereafter laying down the filler passes over the root pass necessary to complete the weld by revolving the pipes and fittings at a second peripheral velocity different from the first peripheral velocity, maintaining the welding head in a fixed position as to the specific direction of revolution, while the longitudinal axis of the welding head is disposed angularly in the direction of revolution at amounts between twenty minutas and about four degrees from the first position.

  1. Casting methods

    Science.gov (United States)

    Marsden, Kenneth C.; Meyer, Mitchell K.; Grover, Blair K.; Fielding, Randall S.; Wolfensberger, Billy W.

    2012-12-18

    A casting device includes a covered crucible having a top opening and a bottom orifice, a lid covering the top opening, a stopper rod sealing the bottom orifice, and a reusable mold having at least one chamber, a top end of the chamber being open to and positioned below the bottom orifice and a vacuum tap into the chamber being below the top end of the chamber. A casting method includes charging a crucible with a solid material and covering the crucible, heating the crucible, melting the material, evacuating a chamber of a mold to less than 1 atm absolute through a vacuum tap into the chamber, draining the melted material into the evacuated chamber, solidifying the material in the chamber, and removing the solidified material from the chamber without damaging the chamber.

  2. Radiochemical methods

    International Nuclear Information System (INIS)

    Geary, W.J.

    1986-01-01

    This little volume is one of an extended series of basic textbooks on analytical chemistry produced by the Analytical Chemistry by Open Learning project in the UK. Prefatory sections explain its mission, and how to use the Open Learning format. Seventeen specific sections organized into five chaptrs begin with a general discussion of nuclear properties, types, and laws of nuclear decay and proceeds to specific discussions of three published papers (reproduced in their entirety) giving examples of radiochemical methods which were discussed in the previous chapter. Each section begins with an overview, contains one or more practical problems (called self-assessment questions or SAQ's), and concludes with a summary and a list of objectives for the student. Following the main body are answers to the SAQ's, and several tables of physical constants, SI prefixes, etc. A periodic table graces the inside back cover

  3. Moment methods and Lanczos methods

    International Nuclear Information System (INIS)

    Whitehead, R.R.

    1980-01-01

    In contrast to many of the speakers at this conference I am less interested in average properties of nuclei than in detailed spectroscopy. I will try to show, however, that the two are very closely connected and that shell-model calculations may be used to give a great deal of information not normally associated with the shell-model. It has been demonstrated clearly to us that the level spacing fluctuations in nuclear spectra convey very little physical information. This is true when the fluctuations are averaged over the entire spectrum but not if one's interest is in the lowest few states, whose spacings are relatively large. If one wishes to calculate a ground state (say) accurately, that is with an error much smaller than the excitation energy of the first excited state, very high moments, μ/sub n/, n approx. 200, are needed. As I shall show, we use such moments as a matter of course, albeit without actually calculating them; in fact I will try to show that, if at all possible, the actual calculations of moments is to be avoided like the plague. At the heart of the new shell-model methods embodied in the Glasgow shell-model program and one or two similar ones is the so-called Lanczos method and this, it turns out, has many deep and subtle connections with the mathematical theory of moments. It is these connections that I will explore here

  4. A sensitive, support-vector-machine method for the detection of horizontal gene transfers in viral, archaeal and bacterial genomes.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In earlier work, we introduced and discussed a generalized computational framework for identifying horizontal transfers. This framework relied on a gene's nucleotide composition, obviated the need for knowledge of codon boundaries and database searches, and was shown to perform very well across a wide range of archaeal and bacterial genomes when compared with previously published approaches, such as Codon Adaptation Index and C + G content. Nonetheless, two considerations remained outstanding: we wanted to further increase the sensitivity of detecting horizontal transfers and also to be able to apply the method to increasingly smaller genomes. In the discussion that follows, we present such a method, Wn-SVM, and show that it exhibits a very significant improvement in sensitivity compared with earlier approaches. Wn-SVM uses a one-class support-vector machine and can learn using rather small training sets. This property makes Wn-SVM particularly suitable for studying small-size genomes, similar to those of viruses, as well as the typically larger archaeal and bacterial genomes. We show experimentally that the new method results in a superior performance across a wide range of organisms and that it improves even upon our own earlier method by an average of 10% across all examined genomes. As a small-genome case study, we analyze the genome of the human cytomegalovirus and demonstrate that Wn-SVM correctly identifies regions that are known to be conserved and prototypical of all beta-herpesvirinae, regions that are known to have been acquired horizontally from the human host and, finally, regions that had not up to now been suspected to be horizontally transferred. Atypical region predictions for many eukaryotic viruses, including the alpha-, beta- and gamma-herpesvirinae, and 123 archaeal and bacterial genomes, have been made available online at http://cbcsrv.watson.ibm.com/HGT_SVM/.

  5. On method

    Directory of Open Access Journals (Sweden)

    Frederik Kortlandt

    2018-01-01

    Full Text Available The basis of linguistic reconstruction is the comparative method, which starts from the assumption that there is “a stronger affinity, both in the roots of verbs and in the forms of grammar, than could possibly have been produced by accident”, implying the existence of a common source (thus Sir William Jones in 1786. It follows that there must be a possible sequence of developments from the reconstructed system to the attested data. These developments must have been either phonetically regular or analogical. The latter type of change requires a model and a motivation. A theory which does not account for the data in terms of sound laws and well-motivated analogical changes is not a linguistic reconstruction but philosophical speculation.The pre-laryngealist idea that any Proto-Indo-European long vowel became acute in Balto-Slavic is a typical example of philosophical speculation contradicted by the comparative evidence. Other examples are spontaneous glottalization (Jasanoff’s “acute assignment”, unattested anywhere in the world, Jasanoff’s trimoraic long vowels, Eichner’s law, Osthoff’s law, and Szemerényi’s law, which is an instance of circular reasoning. The Balto-Slavic acute continues the Proto-Indo-European laryngeals and the glottalic feature of the traditional Proto-Indo-European “unaspirated voiced” obstruents (Winter’s law. My reconstruction of Proto-Indo-European glottalic obstruents is based on direct evidence from Indo-Iranian, Armenian, Baltic and Germanic and indirect evidence from Indo-Iranian, Greek, Latin and Slavic.

  6. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  7. HuMiTar: A sequence-based method for prediction of human microRNA targets

    Directory of Open Access Journals (Sweden)

    Chen Ke

    2008-12-01

    Full Text Available Abstract Background MicroRNAs (miRs are small noncoding RNAs that bind to complementary/partially complementary sites in the 3' untranslated regions of target genes to regulate protein production of the target transcript and to induce mRNA degradation or mRNA cleavage. The ability to perform accurate, high-throughput identification of physiologically active miR targets would enable functional characterization of individual miRs. Current target prediction methods include traditional approaches that are based on specific base-pairing rules in the miR's seed region and implementation of cross-species conservation of the target site, and machine learning (ML methods that explore patterns that contrast true and false miR-mRNA duplexes. However, in the case of the traditional methods research shows that some seed region matches that are conserved are false positives and that some of the experimentally validated target sites are not conserved. Results We present HuMiTar, a computational method for identifying common targets of miRs, which is based on a scoring function that considers base-pairing for both seed and non-seed positions for human miR-mRNA duplexes. Our design shows that certain non-seed miR nucleotides, such as 14, 18, 13, 11, and 17, are characterized by a strong bias towards formation of Watson-Crick pairing. We contrasted HuMiTar with several representative competing methods on two sets of human miR targets and a set of ten glioblastoma oncogenes. Comparison with the two best performing traditional methods, PicTar and TargetScanS, and a representative ML method that considers the non-seed positions, NBmiRTar, shows that HuMiTar predictions include majority of the predictions of the other three methods. At the same time, the proposed method is also capable of finding more true positive targets as a trade-off for an increased number of predictions. Genome-wide predictions show that the proposed method is characterized by 1.99 signal

  8. Behaviorism

    Science.gov (United States)

    Moore, J.

    2011-01-01

    Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

  9. Development and testing of improved statistical wind power forecasting methods.

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, J.; Bessa, R.J.; Keko, H.; Sumaili, J.; Miranda, V.; Ferreira, C.; Gama, J.; Botterud, A.; Zhou, Z.; Wang, J. (Decision and Information Sciences); (INESC Porto)

    2011-12-06

    (with spatial and/or temporal dependence). Statistical approaches to uncertainty forecasting basically consist of estimating the uncertainty based on observed forecasting errors. Quantile regression (QR) is currently a commonly used approach in uncertainty forecasting. In Chapter 3, we propose new statistical approaches to the uncertainty estimation problem by employing kernel density forecast (KDF) methods. We use two estimators in both offline and time-adaptive modes, namely, the Nadaraya-Watson (NW) and Quantilecopula (QC) estimators. We conduct detailed tests of the new approaches using QR as a benchmark. One of the major issues in wind power generation are sudden and large changes of wind power output over a short period of time, namely ramping events. In Chapter 4, we perform a comparative study of existing definitions and methodologies for ramp forecasting. We also introduce a new probabilistic method for ramp event detection. The method starts with a stochastic algorithm that generates wind power scenarios, which are passed through a high-pass filter for ramp detection and estimation of the likelihood of ramp events to happen. The report is organized as follows: Chapter 2 presents the results of the application of ITL training criteria to deterministic WPF; Chapter 3 reports the study on probabilistic WPF, including new contributions to wind power uncertainty forecasting; Chapter 4 presents a new method to predict and visualize ramp events, comparing it with state-of-the-art methodologies; Chapter 5 briefly summarizes the main findings and contributions of this report.

  10. Determination of the Effects of Medium Composition on the Monochloramine Disinfection Kinetics of Nitrosomonas europaea by the Propidium Monoazide Quantitative PCR and Live/Dead BacLight Methods

    Science.gov (United States)

    Wahman, David G.; Schrantz, Karen A.; Pressman, Jonathan G.

    2010-01-01

    Various medium compositions (phosphate, 1 to 50 mM; ionic strength, 2.8 to 150 meq/liter) significantly affected Nitrosomonas europaea monochloramine disinfection kinetics, as determined by the Live/Dead BacLight (LD) and propidium monoazide quantitative PCR (PMA-qPCR) methods (lag coefficient, 37 to 490 [LD] and 91 to 490 [PMA-qPCR] mg·min/liter; Chick-Watson rate constant, 4.0 × 10−3 to 9.3 × 10−3 [LD] and 1.6 × 10−3 to 9.6 × 10−3 [PMA-qPCR] liter/mg·min). Two competing effects may account for the variation in disinfection kinetic parameters: (i) increasing kinetics (disinfection rate constant [k] increased, lag coefficient [b] decreased) with increasing phosphate concentration and (ii) decreasing kinetics (k decreased, b increased) with increasing ionic strength. The results support development of a standard medium for evaluating disinfection kinetics in drinking water. PMID:20952645

  11. Anger and Approach: Reply to Watson (2009) and to Tomarken and Zald (2009)

    Science.gov (United States)

    Carver, Charles S.; Harmon-Jones, Eddie

    2009-01-01

    C. S. Carver and E. Harmon-Jones reviewed evidence consistent with the idea that anger arises from a behavioral approach system. Commentary on that article by A. J. Tomarken and D. H. Zald raised questions about the many elements involved in acts of approach and limitations on what information can be provided by electroencephalograms. Commentary…

  12. Determining Baseline Emissions at Mississippi Power Company's Watson Electric Generating Station

    Science.gov (United States)

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  13. Finding Superman & Global Competitiveness: A Conversation with Arthur Levine & Watson Scott Swail. Policy Perspectives

    Science.gov (United States)

    Levine, Arthur; Swail, Watson Scott

    2014-01-01

    On March 21 2013, the "Educational Policy Institute" held the first day of the EPI Forum on Education & the Economy in Orlando, Florida. The Forum was designed to discuss critical issues related to the nexus of education and the workforce. This document presents the transcribed session that featured two of the authors of the Teachers…

  14. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  15. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  16. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    Science.gov (United States)

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  17. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  18. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  19. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  20. Molecular moment similarity between several nucleoside analogs of thymidine and thymidine. sil@watson.ibm.com.

    Science.gov (United States)

    Silverman, B D; Pitman, M C; Platt, D E

    1999-06-01

    Molecular moment descriptors of the shape and charge distributions of twenty five nucleoside structures have been examined. The structures include thymidine as well as the difluorotoluene nucleoside analog which has been found to pair efficiently with adenine by polymerase catalysis. The remaining twenty three structures have been chosen to be as structurally similar to thymidine and to the difluorotoluene nucleoside analog as possible. The moment descriptors which include a description of the relationship of molecular charge to shape show the difluorotoluene nucleoside to be one of the most proximate molecules to thymidine in the space of the molecular moments. The calculations, therefore, suggest that polymerase specificity might be not only a consequence of molecular steric features alone but also of the molecular electrostatic environment and its registration with molecular shape.

  1. E.L.C. Watson se pionierstog deur Suid-Afrika (1912) | van der ...

    African Journals Online (AJOL)

    In the light of the Victorian era with all its restrictions, this new freedom of movement was very alluring. The motorcycle evolved out of the bicycle. Following the first Isle of Man TT (Tourist Trophy) in 1907, there was no stopping the popularity of the motorcycle. This influence was felt even in South Africa. It was in this zeitgeist ...

  2. [Sherlock Holmes, Watson and cocaine. A literary contribution to the history of drug addiction].

    Science.gov (United States)

    Fouassier, E

    1994-01-01

    From 1887 to 1927, Conan Doyle devoted fifty-six short stories and four novels to the extraordinary investigations of Sherlock Holmes. Special passages from these works, gathered here in the form of long extracts, evoke the passion of the celebrated detective for cocaine and constitute rather generally an original sort of evidence on the emergence of drug addicts in Europe at the end of the 19th century.

  3. The development of a spiritual wellness framework for the work context / Francois Gerald Watson

    OpenAIRE

    Watson, Francois Gerald

    2007-01-01

    Today's organisations are faced with changes such as increased competition and technological changes, not to mention the impact of globalisation on South African organisations. In a sense, the 21" century brought forth a more positive outlook and is described by some as the century of fortegenic living and wellness. Organisations today are searching for programmes that support strengths and wellness, as opposed to the historic employee assistance programmes. Spiritual wellness ...

  4. VizieR Online Data Catalog: AAVSO International Variable Star Index VSX (Watson+, 2006-2014)

    Science.gov (United States)

    Watson, C.; Henden, A. A.; Price, A.

    2018-05-01

    This file contains Galactic stars known or suspected to be variable. It lists all stars that have an entry in the AAVSO International Variable Star Index (VSX; http://www.aavso.org/vsx). The database consisted initially of the General Catalogue of Variable Stars (GCVS) and the New Catalogue of Suspected Variables (NSV) and was then supplemented with a large number of variable star catalogues, as well as individual variable star discoveries or variables found in the literature. Effort has also been invested to update the entries with the latest information regarding position, type and period and to remove duplicates. The VSX database is being continually updated and maintained. For historical reasons some objects outside of the Galaxy have been included. (3 data files).

  5. Ensemble Data Mining Methods

    Data.gov (United States)

    National Aeronautics and Space Administration — Ensemble Data Mining Methods, also known as Committee Methods or Model Combiners, are machine learning methods that leverage the power of multiple models to achieve...

  6. BDF-methods

    DEFF Research Database (Denmark)

    Hostrup, Astrid Kuijers

    1999-01-01

    An introduction to BDF-methods is given. The use of these methods on differential algebraic equations (DAE's) with different indexes with respect to order, stability and convergens of the BDF-methods is presented.......An introduction to BDF-methods is given. The use of these methods on differential algebraic equations (DAE's) with different indexes with respect to order, stability and convergens of the BDF-methods is presented....

  7. Uranium price forecasting methods

    International Nuclear Information System (INIS)

    Fuller, D.M.

    1994-01-01

    This article reviews a number of forecasting methods that have been applied to uranium prices and compares their relative strengths and weaknesses. The methods reviewed are: (1) judgemental methods, (2) technical analysis, (3) time-series methods, (4) fundamental analysis, and (5) econometric methods. Historically, none of these methods has performed very well, but a well-thought-out model is still useful as a basis from which to adjust to new circumstances and try again

  8. Methods in aquatic bacteriology

    National Research Council Canada - National Science Library

    Austin, B

    1988-01-01

    .... Within these sections detailed chapters consider sampling methods, determination of biomass, isolation methods, identification, the bacterial microflora of fish, invertebrates, plants and the deep...

  9. Transport equation solving methods

    International Nuclear Information System (INIS)

    Granjean, P.M.

    1984-06-01

    This work is mainly devoted to Csub(N) and Fsub(N) methods. CN method: starting from a lemma stated by Placzek, an equivalence is established between two problems: the first one is defined in a finite medium bounded by a surface S, the second one is defined in the whole space. In the first problem the angular flux on the surface S is shown to be the solution of an integral equation. This equation is solved by Galerkin's method. The Csub(N) method is applied here to one-velocity problems: in plane geometry, slab albedo and transmission with Rayleigh scattering, calculation of the extrapolation length; in cylindrical geometry, albedo and extrapolation length calculation with linear scattering. Fsub(N) method: the basic integral transport equation of the Csub(N) method is integrated on Case's elementary distributions; another integral transport equation is obtained: this equation is solved by a collocation method. The plane problems solved by the Csub(N) method are also solved by the Fsub(N) method. The Fsub(N) method is extended to any polynomial scattering law. Some simple spherical problems are also studied. Chandrasekhar's method, collision probability method, Case's method are presented for comparison with Csub(N) and Fsub(N) methods. This comparison shows the respective advantages of the two methods: a) fast convergence and possible extension to various geometries for Csub(N) method; b) easy calculations and easy extension to polynomial scattering for Fsub(N) method [fr

  10. Advanced differential quadrature methods

    CERN Document Server

    Zong, Zhi

    2009-01-01

    Modern Tools to Perform Numerical DifferentiationThe original direct differential quadrature (DQ) method has been known to fail for problems with strong nonlinearity and material discontinuity as well as for problems involving singularity, irregularity, and multiple scales. But now researchers in applied mathematics, computational mechanics, and engineering have developed a range of innovative DQ-based methods to overcome these shortcomings. Advanced Differential Quadrature Methods explores new DQ methods and uses these methods to solve problems beyond the capabilities of the direct DQ method.After a basic introduction to the direct DQ method, the book presents a number of DQ methods, including complex DQ, triangular DQ, multi-scale DQ, variable order DQ, multi-domain DQ, and localized DQ. It also provides a mathematical compendium that summarizes Gauss elimination, the Runge-Kutta method, complex analysis, and more. The final chapter contains three codes written in the FORTRAN language, enabling readers to q...

  11. Inflow Turbulence Generation Methods

    Science.gov (United States)

    Wu, Xiaohua

    2017-01-01

    Research activities on inflow turbulence generation methods have been vigorous over the past quarter century, accompanying advances in eddy-resolving computations of spatially developing turbulent flows with direct numerical simulation, large-eddy simulation (LES), and hybrid Reynolds-averaged Navier-Stokes-LES. The weak recycling method, rooted in scaling arguments on the canonical incompressible boundary layer, has been applied to supersonic boundary layer, rough surface boundary layer, and microscale urban canopy LES coupled with mesoscale numerical weather forecasting. Synthetic methods, originating from analytical approximation to homogeneous isotropic turbulence, have branched out into several robust methods, including the synthetic random Fourier method, synthetic digital filtering method, synthetic coherent eddy method, and synthetic volume forcing method. This article reviews major progress in inflow turbulence generation methods with an emphasis on fundamental ideas, key milestones, representative applications, and critical issues. Directions for future research in the field are also highlighted.

  12. Methods of nonlinear analysis

    CERN Document Server

    Bellman, Richard Ernest

    1970-01-01

    In this book, we study theoretical and practical aspects of computing methods for mathematical modelling of nonlinear systems. A number of computing techniques are considered, such as methods of operator approximation with any given accuracy; operator interpolation techniques including a non-Lagrange interpolation; methods of system representation subject to constraints associated with concepts of causality, memory and stationarity; methods of system representation with an accuracy that is the best within a given class of models; methods of covariance matrix estimation;methods for low-rank mat

  13. Consumer Behavior Research Methods

    DEFF Research Database (Denmark)

    Chrysochou, Polymeros

    2017-01-01

    This chapter starts by distinguishing consumer behavior research methods based on the type of data used, being either secondary or primary. Most consumer behavior research studies phenomena that require researchers to enter the field and collect data on their own, and therefore the chapter...... emphasizes the discussion of primary research methods. Based on the nature of the data primary research methods are further distinguished into qualitative and quantitative. The chapter describes the most important and popular qualitative and quantitative methods. It concludes with an overall evaluation...... of the methods and how to improve quality in consumer behavior research methods....

  14. Dissolution Methods Database

    Data.gov (United States)

    U.S. Department of Health & Human Services — For a drug product that does not have a dissolution test method in the United States Pharmacopeia (USP), the FDA Dissolution Methods Database provides information on...

  15. The three circle method

    International Nuclear Information System (INIS)

    Garncarek, Z.

    1989-01-01

    The three circle method in its general form is presented. The method is especially useful for investigation of shapes of agglomerations of objects. An example of its applications to investigation of galaxies distribution is given. 17 refs. (author)

  16. Design Methods in Practice

    DEFF Research Database (Denmark)

    Jensen, Torben Elgaard; Andreasen, Mogens Myrup

    2010-01-01

    The paper challenges the dominant and widespread view that a good design method will guarantee a systematic approach as well as certain results. First, it explores the substantial differences between on the one hand the conception of methods implied in Pahl & Beitz’s widely recognized text book...... on engineering design, and on the other hand the understanding of method use, which has emerged from micro-sociological studies of practice (ethnomethodology). Second, it reviews a number of case studies conducted by engineering students, who were instructed to investigate the actual use of design methods...... in Danish companies. The paper concludes that design methods in practice deviate substantially from Pahl & Beitz’s description of method use: The object and problems, which are the starting points for method use, are more contested and less given than generally assumed; The steps of methods are often...

  17. Advances in Numerical Methods

    CERN Document Server

    Mastorakis, Nikos E

    2009-01-01

    Features contributions that are focused on significant aspects of current numerical methods and computational mathematics. This book carries chapters that advanced methods and various variations on known techniques that can solve difficult scientific problems efficiently.

  18. Basic Finite Element Method

    International Nuclear Information System (INIS)

    Lee, Byeong Hae

    1992-02-01

    This book gives descriptions of basic finite element method, which includes basic finite element method and data, black box, writing of data, definition of VECTOR, definition of matrix, matrix and multiplication of matrix, addition of matrix, and unit matrix, conception of hardness matrix like spring power and displacement, governed equation of an elastic body, finite element method, Fortran method and programming such as composition of computer, order of programming and data card and Fortran card, finite element program and application of nonelastic problem.

  19. Conformable variational iteration method

    Directory of Open Access Journals (Sweden)

    Omer Acan

    2017-02-01

    Full Text Available In this study, we introduce the conformable variational iteration method based on new defined fractional derivative called conformable fractional derivative. This new method is applied two fractional order ordinary differential equations. To see how the solutions of this method, linear homogeneous and non-linear non-homogeneous fractional ordinary differential equations are selected. Obtained results are compared the exact solutions and their graphics are plotted to demonstrate efficiency and accuracy of the method.

  20. VALUATION METHODS- LITERATURE REVIEW

    OpenAIRE

    Dorisz Talas

    2015-01-01

    This paper is a theoretical overview of the often used valuation methods with the help of which the value of a firm or its equity is calculated. Many experts (including Aswath Damodaran, Guochang Zhang and CA Hozefa Natalwala) classify the methods. The basic models are based on discounted cash flows. The main method uses the free cash flow for valuation, but there are some newer methods that reveal and correct the weaknesses of the traditional models. The valuation of flexibility of managemen...

  1. Mixed methods research.

    Science.gov (United States)

    Halcomb, Elizabeth; Hickman, Louise

    2015-04-08

    Mixed methods research involves the use of qualitative and quantitative data in a single research project. It represents an alternative methodological approach, combining qualitative and quantitative research approaches, which enables nurse researchers to explore complex phenomena in detail. This article provides a practical overview of mixed methods research and its application in nursing, to guide the novice researcher considering a mixed methods research project.

  2. Possibilities of roentgenological method

    International Nuclear Information System (INIS)

    Sivash, Eh.S.; Sal'man, M.M.

    1980-01-01

    Literary and experimental data on estimating possibilities of roentgenologic investigations using an electron optical amplifier, X-ray television and roentgen cinematography are generalized. Different methods of studying gastro-intestinal tract are compared. The advantage of the roentgenologic method over the endoscopic method after stomach resection is shown [ru

  3. The Generalized Sturmian Method

    DEFF Research Database (Denmark)

    Avery, James Emil

    2011-01-01

    these ideas clearly so that they become more accessible. By bringing together these non-standard methods, the book intends to inspire graduate students, postdoctoral researchers and academics to think of novel approaches. Is there a method out there that we have not thought of yet? Can we design a new method...... generations of researchers were left to work out how to achieve this ambitious goal for molecular systems of ever-increasing size. This book focuses on non-mainstream methods to solve the molecular electronic Schrödinger equation. Each method is based on a set of core ideas and this volume aims to explain...

  4. Mimetic discretization methods

    CERN Document Server

    Castillo, Jose E

    2013-01-01

    To help solve physical and engineering problems, mimetic or compatible algebraic discretization methods employ discrete constructs to mimic the continuous identities and theorems found in vector calculus. Mimetic Discretization Methods focuses on the recent mimetic discretization method co-developed by the first author. Based on the Castillo-Grone operators, this simple mimetic discretization method is invariably valid for spatial dimensions no greater than three. The book also presents a numerical method for obtaining corresponding discrete operators that mimic the continuum differential and

  5. DOE methods compendium

    International Nuclear Information System (INIS)

    Leasure, C.S.

    1992-01-01

    The Department of Energy (DOE) has established an analytical methods compendium development program to integrate its environmental analytical methods. This program is administered through DOE's Laboratory Management Division (EM-563). The primary objective of this program is to assemble a compendium of analytical chemistry methods of known performance for use by all DOE Environmental Restoration and Waste Management program. This compendium will include methods for sampling, field screening, fixed analytical laboratory and mobile analytical laboratory analyses. It will also include specific guidance on the proper selection of appropriate sampling and analytical methods in using specific analytical requirements

  6. Methods for assessing geodiversity

    Science.gov (United States)

    Zwoliński, Zbigniew; Najwer, Alicja; Giardino, Marco

    2017-04-01

    The accepted systematics of geodiversity assessment methods will be presented in three categories: qualitative, quantitative and qualitative-quantitative. Qualitative methods are usually descriptive methods that are suited to nominal and ordinal data. Quantitative methods use a different set of parameters and indicators to determine the characteristics of geodiversity in the area being researched. Qualitative-quantitative methods are a good combination of the collection of quantitative data (i.e. digital) and cause-effect data (i.e. relational and explanatory). It seems that at the current stage of the development of geodiversity research methods, qualitative-quantitative methods are the most advanced and best assess the geodiversity of the study area. Their particular advantage is the integration of data from different sources and with different substantive content. Among the distinguishing features of the quantitative and qualitative-quantitative methods for assessing geodiversity are their wide use within geographic information systems, both at the stage of data collection and data integration, as well as numerical processing and their presentation. The unresolved problem for these methods, however, is the possibility of their validation. It seems that currently the best method of validation is direct filed confrontation. Looking to the next few years, the development of qualitative-quantitative methods connected with cognitive issues should be expected, oriented towards ontology and the Semantic Web.

  7. Methods of Software Verification

    Directory of Open Access Journals (Sweden)

    R. E. Gurin

    2015-01-01

    Full Text Available This article is devoted to the problem of software verification (SW. Methods of software verification designed to check the software for compliance with the stated requirements such as correctness, system security and system adaptability to small changes in the environment, portability and compatibility, etc. These are various methods both by the operation process and by the way of achieving result. The article describes the static and dynamic methods of software verification and paid attention to the method of symbolic execution. In its review of static analysis are discussed and described the deductive method, and methods for testing the model. A relevant issue of the pros and cons of a particular method is emphasized. The article considers classification of test techniques for each method. In this paper we present and analyze the characteristics and mechanisms of the static analysis of dependencies, as well as their views, which can reduce the number of false positives in situations where the current state of the program combines two or more states obtained both in different paths of execution and in working with multiple object values. Dependences connect various types of software objects: single variables, the elements of composite variables (structure fields, array elements, the size of the heap areas, the length of lines, the number of initialized array elements in the verification code using static methods. The article pays attention to the identification of dependencies within the framework of the abstract interpretation, as well as gives an overview and analysis of the inference tools.Methods of dynamic analysis such as testing, monitoring and profiling are presented and analyzed. Also some kinds of tools are considered which can be applied to the software when using the methods of dynamic analysis. Based on the work a conclusion is drawn, which describes the most relevant problems of analysis techniques, methods of their solutions and

  8. Radiometric dating methods

    International Nuclear Information System (INIS)

    Bourdon, B.

    2003-01-01

    The general principle of isotope dating methods is based on the presence of radioactive isotopes in the geologic or archaeological object to be dated. The decay with time of these isotopes is used to determine the 'zero' time corresponding to the event to be dated. This paper recalls the general principle of isotope dating methods (bases, analytical methods, validation of results and uncertainties) and presents the methods based on natural radioactivity (Rb-Sr, Sm-Nd, U-Pb, Re-Os, K-Ar (Ar-Ar), U-Th-Ra- 210 Pb, U-Pa, 14 C, 36 Cl, 10 Be) and the methods based on artificial radioactivity with their applications. Finally, the methods based on irradiation damages (thermoluminescence, fission tracks, electron spin resonance) are briefly evoked. (J.S.)

  9. Performative Schizoid Method

    DEFF Research Database (Denmark)

    Svabo, Connie

    2016-01-01

    is presented and an example is provided of a first exploratory engagement with it. The method is used in a specific project Becoming Iris, making inquiry into arts-based knowledge creation during a three month visiting scholarship at a small, independent visual art academy. Using the performative schizoid......A performative schizoid method is developed as a method contribution to performance as research. The method is inspired by contemporary research in the human and social sciences urging experimentation and researcher engagement with creative and artistic practice. In the article, the method...... method in Becoming Iris results in four audio-visual and performance-based productions, centered on an emergent theme of the scholartist as a bird in borrowed feathers. Interestingly, the moral lesson of the fable about the vain jackdaw, who dresses in borrowed peacock feathers and becomes a castout...

  10. Spectral density regression for bivariate extremes

    KAUST Repository

    Castro Camilo, Daniela; de Carvalho, Miguel

    2016-01-01

    can be seen as an extension of the Nadaraya–Watson estimator where the usual scalar responses are replaced by mean constrained densities on the unit interval. Numerical experiments with the methods illustrate their resilience in a variety of contexts

  11. Behaviorism and Neuroscience.

    Science.gov (United States)

    Thompson, Richard F.

    1994-01-01

    The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)

  12. Angular correlation methods

    International Nuclear Information System (INIS)

    Ferguson, A.J.

    1974-01-01

    An outline of the theory of angular correlations is presented, and the difference between the modern density matrix method and the traditional wave function method is stressed. Comments are offered on particular angular correlation theoretical techniques. A brief discussion is given of recent studies of gamma ray angular correlations of reaction products recoiling with high velocity into vacuum. Two methods for optimization to obtain the most accurate expansion coefficients of the correlation are discussed. (1 figure, 53 references) (U.S.)

  13. Maximum Quantum Entropy Method

    OpenAIRE

    Sim, Jae-Hoon; Han, Myung Joon

    2018-01-01

    Maximum entropy method for analytic continuation is extended by introducing quantum relative entropy. This new method is formulated in terms of matrix-valued functions and therefore invariant under arbitrary unitary transformation of input matrix. As a result, the continuation of off-diagonal elements becomes straightforward. Without introducing any further ambiguity, the Bayesian probabilistic interpretation is maintained just as in the conventional maximum entropy method. The applications o...

  14. Rossi Alpha Method

    International Nuclear Information System (INIS)

    Hansen, G.E.

    1985-01-01

    The Rossi Alpha Method has proved to be valuable for the determination of prompt neutron lifetimes in fissile assemblies having known reproduction numbers at or near delayed critical. This workshop report emphasizes the pioneering applications of the method by Dr. John D. Orndoff to fast-neutron critical assemblies at Los Alamos. The value of the method appears to disappear for subcritical systems where the Rossi-α is no longer an α-eigenvalue

  15. Qualitative methods textbooks

    OpenAIRE

    Barndt, William

    2003-01-01

    Over the past few years, the number of political science departments offering qualitative methods courses has grown substantially. The number of qualitative methods textbooks has kept pace, providing instructors with an overwhelming array of choices. But how to decide which text to choose from this exhortatory smorgasbord? The scholarship desperately needs evaluated. Yet the task is not entirely straightforward: qualitative methods textbooks reflect the diversity inherent in qualitative metho...

  16. The Box Method

    DEFF Research Database (Denmark)

    Nielsen, Peter Vilhelm

    The velocity level in a room ventilated by jet ventilation is strongly influenced by the supply conditions. The momentum flow in the supply jets controls the air movement in the room and, therefore, it is very important that the inlet conditions and the numerical method can generate a satisfactor...... description of this momentum flow. The Box Method is a practical method for the description of an Air Terminal Device which will save grid points and ensure the right level of the momentum flow....

  17. Applied Bayesian hierarchical methods

    National Research Council Canada - National Science Library

    Congdon, P

    2010-01-01

    ... . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2 Posterior Inference from Bayes Formula . . . . . . . . . . . . 1.3 Markov Chain Monte Carlo Sampling in Relation to Monte Carlo Methods: Obtaining Posterior...

  18. [Methods of quantitative proteomics].

    Science.gov (United States)

    Kopylov, A T; Zgoda, V G

    2007-01-01

    In modern science proteomic analysis is inseparable from other fields of systemic biology. Possessing huge resources quantitative proteomics operates colossal information on molecular mechanisms of life. Advances in proteomics help researchers to solve complex problems of cell signaling, posttranslational modification, structure and functional homology of proteins, molecular diagnostics etc. More than 40 various methods have been developed in proteomics for quantitative analysis of proteins. Although each method is unique and has certain advantages and disadvantages all these use various isotope labels (tags). In this review we will consider the most popular and effective methods employing both chemical modifications of proteins and also metabolic and enzymatic methods of isotope labeling.

  19. Methods in ALFA Alignment

    CERN Document Server

    Melendez, Jordan

    2014-01-01

    This note presents two model-independent methods for use in the alignment of the ALFA forward detectors. Using a Monte Carlo simulated LHC run at \\beta = 90m and \\sqrt{s} = 7 TeV, the Kinematic Peak alignment method is utilized to reconstruct the Mandelstam momentum transfer variable t for single-diractive protons. The Hot Spot method uses fluctuations in the hitmap density to pinpoint particular regions in the detector that could signal a misalignment. Another method uses an error function fit to find the detector edge. With this information, the vertical alignment can be determined.

  20. Method of chronokinemetrical invariants

    International Nuclear Information System (INIS)

    Vladimirov, Yu.S.; Shelkovenko, A.Eh.

    1976-01-01

    A particular case of a general dyadic method - the method of chronokinemetric invariants is formulated. The time-like dyad vector is calibrated in a chronometric way, and the space-like vector - in a kinemetric way. Expressions are written for the main physical-geometrical values of the dyadic method and for differential operators. The method developed may be useful for predetermining the reference system of a single observer, and also for studying problems connected with emission and absorption of gravitational and electromagnetic waves [ru

  1. Nondestructive testing method

    International Nuclear Information System (INIS)

    Porter, J.F.

    1996-01-01

    Nondestructive testing (NDT) is the use of physical and chemical methods for evaluating material integrity without impairing its intended usefulness or continuing service. Nondestructive tests are used by manufaturer's for the following reasons: 1) to ensure product reliability; 2) to prevent accidents and save human lives; 3) to aid in better product design; 4) to control manufacturing processes; and 5) to maintain a uniform quality level. Nondestructive testing is used extensively on power plants, oil and chemical refineries, offshore oil rigs and pipeline (NDT can even be conducted underwater), welds on tanks, boilers, pressure vessels and heat exchengers. NDT is now being used for testing concrete and composite materials. Because of the criticality of its application, NDT should be performed and the results evaluated by qualified personnel. There are five basic nondestructive examination methods: 1) liquid penetrant testing - method used for detecting surface flaws in materials. This method can be used for metallic and nonmetallic materials, portable and relatively inexpensive. 2) magnetic particle testing - method used to detect surface and subsurface flaws in ferromagnetic materials; 3) radiographic testing - method used to detect internal flaws and significant variation in material composition and thickness; 4) ultrasonic testing - method used to detect internal and external flaws in materials. This method uses ultrasonics to measure thickness of a material or to examine the internal structure for discontinuities. 5) eddy current testing - method used to detect surface and subsurface flaws in conductive materials. Not one nondestructive examination method can find all discontinuities in all of the materials capable of being tested. The most important consideration is for the specifier of the test to be familiar with the test method and its applicability to the type and geometry of the material and the flaws to be detected

  2. Methods for data classification

    Science.gov (United States)

    Garrity, George [Okemos, MI; Lilburn, Timothy G [Front Royal, VA

    2011-10-11

    The present invention provides methods for classifying data and uncovering and correcting annotation errors. In particular, the present invention provides a self-organizing, self-correcting algorithm for use in classifying data. Additionally, the present invention provides a method for classifying biological taxa.

  3. Computational methods working group

    International Nuclear Information System (INIS)

    Gabriel, T.A.

    1997-09-01

    During the Cold Moderator Workshop several working groups were established including one to discuss calculational methods. The charge for this working group was to identify problems in theory, data, program execution, etc., and to suggest solutions considering both deterministic and stochastic methods including acceleration procedures.

  4. Method for exchanging data

    NARCIS (Netherlands)

    2014-01-01

    The present invention relates to a method for exchanging data between at least two servers with use of a gateway. Preferably the method is applied to healthcare systems. Each server holds a unique federated identifier, which identifier identifies a single patient (P). Thus, it is possible for the

  5. WWW: The Scientific Method

    Science.gov (United States)

    Blystone, Robert V.; Blodgett, Kevin

    2006-01-01

    The scientific method is the principal methodology by which biological knowledge is gained and disseminated. As fundamental as the scientific method may be, its historical development is poorly understood, its definition is variable, and its deployment is uneven. Scientific progress may occur without the strictures imposed by the formal…

  6. Methods of numerical relativity

    International Nuclear Information System (INIS)

    Piran, T.

    1983-01-01

    Numerical Relativity is an alternative to analytical methods for obtaining solutions for Einstein equations. Numerical methods are particularly useful for studying generation of gravitational radiation by potential strong sources. The author reviews the analytical background, the numerical analysis aspects and techniques and some of the difficulties involved in numerical relativity. (Auth.)

  7. Differential equation method

    International Nuclear Information System (INIS)

    Kotikov, A.V.

    1993-01-01

    A new method of massive Feynman diagrams calculation is presented. It provides a fairly simple procedure to obtain the result without the D-space integral calculation (for the dimensional regularization). Some diagrams are calculated as an illustration of this method capacities. (author). 7 refs

  8. DISCOURSE ON METHODS.

    Science.gov (United States)

    BOUCHER, JOHN G.

    THE AUTHOR STATES THAT BEFORE PRESENT FOREIGN LANGUAGE TEACHING METHODS CAN BE DISCUSSED INTELLIGENTLY, THE RESEARCH IN PSYCHOLOGY AND LINGUISTICS WHICH HAS INFLUENCED THE DEVELOPMENT OF THESE METHODS MUST BE CONSIDERED. MANY FOREIGN LANGUAGE TEACHERS WERE BEGINNING TO FEEL COMFORTABLE WITH THE AUDIOLINGUAL APPROACH WHEN NOAM CHOMSKY, IN HIS 1966…

  9. Research Methods in Education

    Science.gov (United States)

    Check, Joseph; Schutt, Russell K.

    2011-01-01

    "Research Methods in Education" introduces research methods as an integrated set of techniques for investigating questions about the educational world. This lively, innovative text helps students connect technique and substance, appreciate the value of both qualitative and quantitative methodologies, and make ethical research decisions.…

  10. Attribute-Based Methods

    Science.gov (United States)

    Thomas P. Holmes; Wiktor L. Adamowicz

    2003-01-01

    Stated preference methods of environmental valuation have been used by economists for decades where behavioral data have limitations. The contingent valuation method (Chapter 5) is the oldest stated preference approach, and hundreds of contingent valuation studies have been conducted. More recently, and especially over the last decade, a class of stated preference...

  11. Proven Weight Loss Methods

    Science.gov (United States)

    Fact Sheet Proven Weight Loss Methods What can weight loss do for you? Losing weight can improve your health in a number of ways. It can lower ... at www.hormone.org/Spanish . Proven Weight Loss Methods Fact Sheet www.hormone.org

  12. Radiation borehole logging method

    International Nuclear Information System (INIS)

    Wylie, A.; Mathew, P.J.

    1977-01-01

    A method of obtaining an indication of the diameter of a borehole is described. The method comprises subjecting the walls of the borehole to monoenergetic gamma radiation and making measurements of the intensity of gamma radiation backscattered from the walls. The energy of the radiation is sufficiently high for the shape to be substantially independent of the density and composition of the borehole walls

  13. Isotope methods in hydrology

    International Nuclear Information System (INIS)

    Moser, H.; Rauert, W.

    1980-01-01

    Of the investigation methods used in hydrology, tracer methods hold a special place as they are the only ones which give direct insight into the movement and distribution processes taking place in surface and ground waters. Besides the labelling of water with salts and dyes, as in the past, in recent years the use of isotopes in hydrology, in water research and use, in ground-water protection and in hydraulic engineering has increased. This by no means replaces proven methods of hydrological investigation but tends rather to complement and expand them through inter-disciplinary cooperation. The book offers a general introduction to the application of various isotope methods to specific hydrogeological and hydrological problems. The idea is to place the hydrogeologist and the hydrologist in the position to recognize which isotope method will help him solve his particular problem or indeed, make a solution possible at all. He should also be able to recognize what the prerequisites are and what work and expenditure the use of such methods involves. May the book contribute to promoting cooperation between hydrogeologists, hydrologists, hydraulic engineers and isotope specialists, and thus supplement proven methods of investigation in hydrological research and water utilization and protection wherever the use of isotope methods proves to be of advantage. (orig./HP) [de

  14. Essential numerical computer methods

    CERN Document Server

    Johnson, Michael L

    2010-01-01

    The use of computers and computational methods has become ubiquitous in biological and biomedical research. During the last 2 decades most basic algorithms have not changed, but what has is the huge increase in computer speed and ease of use, along with the corresponding orders of magnitude decrease in cost. A general perception exists that the only applications of computers and computer methods in biological and biomedical research are either basic statistical analysis or the searching of DNA sequence data bases. While these are important applications they only scratch the surface of the current and potential applications of computers and computer methods in biomedical research. The various chapters within this volume include a wide variety of applications that extend far beyond this limited perception. As part of the Reliable Lab Solutions series, Essential Numerical Computer Methods brings together chapters from volumes 210, 240, 321, 383, 384, 454, and 467 of Methods in Enzymology. These chapters provide ...

  15. Adaptive method of lines

    CERN Document Server

    Saucez, Ph

    2001-01-01

    The general Method of Lines (MOL) procedure provides a flexible format for the solution of all the major classes of partial differential equations (PDEs) and is particularly well suited to evolutionary, nonlinear wave PDEs. Despite its utility, however, there are relatively few texts that explore it at a more advanced level and reflect the method''s current state of development.Written by distinguished researchers in the field, Adaptive Method of Lines reflects the diversity of techniques and applications related to the MOL. Most of its chapters focus on a particular application but also provide a discussion of underlying philosophy and technique. Particular attention is paid to the concept of both temporal and spatial adaptivity in solving time-dependent PDEs. Many important ideas and methods are introduced, including moving grids and grid refinement, static and dynamic gridding, the equidistribution principle and the concept of a monitor function, the minimization of a functional, and the moving finite elem...

  16. Bayesian Monte Carlo method

    International Nuclear Information System (INIS)

    Rajabalinejad, M.

    2010-01-01

    To reduce cost of Monte Carlo (MC) simulations for time-consuming processes, Bayesian Monte Carlo (BMC) is introduced in this paper. The BMC method reduces number of realizations in MC according to the desired accuracy level. BMC also provides a possibility of considering more priors. In other words, different priors can be integrated into one model by using BMC to further reduce cost of simulations. This study suggests speeding up the simulation process by considering the logical dependence of neighboring points as prior information. This information is used in the BMC method to produce a predictive tool through the simulation process. The general methodology and algorithm of BMC method are presented in this paper. The BMC method is applied to the simplified break water model as well as the finite element model of 17th Street Canal in New Orleans, and the results are compared with the MC and Dynamic Bounds methods.

  17. Methods in Modern Biophysics

    CERN Document Server

    Nölting, Bengt

    2006-01-01

    Incorporating recent dramatic advances, this textbook presents a fresh and timely introduction to modern biophysical methods. An array of new, faster and higher-power biophysical methods now enables scientists to examine the mysteries of life at a molecular level. This innovative text surveys and explains the ten key biophysical methods, including those related to biophysical nanotechnology, scanning probe microscopy, X-ray crystallography, ion mobility spectrometry, mass spectrometry, proteomics, and protein folding and structure. Incorporating much information previously unavailable in tutorial form, Nölting employs worked examples and 267 illustrations to fully detail the techniques and their underlying mechanisms. Methods in Modern Biophysics is written for advanced undergraduate and graduate students, postdocs, researchers, lecturers and professors in biophysics, biochemistry and related fields. Special features in the 2nd edition: • Illustrates the high-resolution methods for ultrashort-living protei...

  18. The surface analysis methods

    International Nuclear Information System (INIS)

    Deville, J.P.

    1998-01-01

    Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.)

  19. Cooperative method development

    DEFF Research Database (Denmark)

    Dittrich, Yvonne; Rönkkö, Kari; Eriksson, Jeanette

    2008-01-01

    The development of methods tools and process improvements is best to be based on the understanding of the development practice to be supported. Qualitative research has been proposed as a method for understanding the social and cooperative aspects of software development. However, qualitative...... research is not easily combined with the improvement orientation of an engineering discipline. During the last 6 years, we have applied an approach we call `cooperative method development', which combines qualitative social science fieldwork, with problem-oriented method, technique and process improvement....... The action research based approach focusing on shop floor software development practices allows an understanding of how contextual contingencies influence the deployment and applicability of methods, processes and techniques. This article summarizes the experiences and discusses the further development...

  20. Engaging with mobile methods

    DEFF Research Database (Denmark)

    Jensen, Martin Trandberg

    2014-01-01

    This chapter showcases how mobile methods are more than calibrated techniques awaiting application by tourism researchers, but productive in the enactment of the mobile (Law and Urry, 2004). Drawing upon recent findings deriving from a PhD course on mobility and mobile methods it reveals...... the conceptual ambiguousness of the term ‘mobile methods’. In order to explore this ambiguousness the chapter provides a number of examples deriving from tourism research, to explore how mobile methods are always entangled in ideologies, predispositions, conventions and practice-realities. Accordingly......, the engagements with methods are acknowledged to be always political and contextual, reminding us to avoid essentialist discussions regarding research methods. Finally, the chapter draws on recent fieldwork to extend developments in mobilities-oriented tourism research, by employing auto-ethnography to call...

  1. Determination method of radiostrontium

    International Nuclear Information System (INIS)

    1984-01-01

    This manual provides determination methods of strontium-90 and strontium-89 in the environment released from nuclear facilities, and it is a revised edition of the previous manual published in 1974. As for the preparation method of radiation counting sample, ion exchange method, oxalate separation method and solvent extraction method were adopted in addition to the method of fuming nitric acid separation adopted in the previous edition. Strontium-90 is determined by the separation and radioactivity determination of yttrium-90 in radioequilibrium with strontium-90. Strontium-89 is determined by subtraction of radioactivity of strontium-90 plus yttrium-90 from gross radioactivity of isolated strontium carbonate. Radioactivity determination should be carried out with a low-background 2 π-gas-flow counting system for the mounted sample on a filter having a chemical form of ferric hydroxide, yttrium oxalate or strontium carbonate. This manual describes sample preparation procedures as well as radioactivity counting procedures for environmental samples of precipitates as rain or snow, airborne dust, fresh water, sea water and soil, and also for ash sample made from biological or food samples such as grains, vegetables, tea leaves, pine needle, milk, marine organisms, and total diet, by employing a method of fuming nitric acid separation, ion exchange separation, oxalate precipitate separation or solvent extraction separation (only for an ash sample). Procedures for reagent chemicals preparation is also attached to this manual. (Takagi, S.)

  2. Basics of Bayesian methods.

    Science.gov (United States)

    Ghosh, Sujit K

    2010-01-01

    Bayesian methods are rapidly becoming popular tools for making statistical inference in various fields of science including biology, engineering, finance, and genetics. One of the key aspects of Bayesian inferential method is its logical foundation that provides a coherent framework to utilize not only empirical but also scientific information available to a researcher. Prior knowledge arising from scientific background, expert judgment, or previously collected data is used to build a prior distribution which is then combined with current data via the likelihood function to characterize the current state of knowledge using the so-called posterior distribution. Bayesian methods allow the use of models of complex physical phenomena that were previously too difficult to estimate (e.g., using asymptotic approximations). Bayesian methods offer a means of more fully understanding issues that are central to many practical problems by allowing researchers to build integrated models based on hierarchical conditional distributions that can be estimated even with limited amounts of data. Furthermore, advances in numerical integration methods, particularly those based on Monte Carlo methods, have made it possible to compute the optimal Bayes estimators. However, there is a reasonably wide gap between the background of the empirically trained scientists and the full weight of Bayesian statistical inference. Hence, one of the goals of this chapter is to bridge the gap by offering elementary to advanced concepts that emphasize linkages between standard approaches and full probability modeling via Bayesian methods.

  3. Methods in mummy research

    DEFF Research Database (Denmark)

    Lynnerup, Niels

    2009-01-01

    Mummies are human remains with preservation of non-bony tissue. Many mummy studies focus on the development and application of non-destructive methods for examining mummies, including radiography, CT-scanning with advanced 3-dimensional visualisations, and endoscopic techniques, as well as minima......Mummies are human remains with preservation of non-bony tissue. Many mummy studies focus on the development and application of non-destructive methods for examining mummies, including radiography, CT-scanning with advanced 3-dimensional visualisations, and endoscopic techniques, as well...... as minimally-destructive chemical, physical and biological methods for, e.g., stable isotopes, trace metals and DNA....

  4. Montessori Method and ICTs

    Directory of Open Access Journals (Sweden)

    Athanasios Drigas

    2016-03-01

    Full Text Available This article bridges the gap between the Montessori Method and Information and Communication Technologies (ICTs in contemporary education. It reviews recent research works which recall the Montessori philosophy, principles and didactical tools applying to today’s computers and supporting technologies in children’s learning process. This article reviews how important the stimulation of human senses in the learning process is, as well as the development of Montessori materials using the body and the hand in particular, all according to the Montessori Method along with recent researches over ICTs. Montessori Method within information society age acquires new perspectives, new functionality and new efficacy.

  5. Rubidium-strontium method

    International Nuclear Information System (INIS)

    Dubansky, A.

    1980-01-01

    The rubidium-strontium geological dating method is based on the determination of the Rb and Sr isotope ratio in rocks, mainly using mass spectrometry. The method is only practical for silicate minerals and rocks, potassium feldspars and slates. Also described is the rubidium-strontium isochrone method. This, however, requires a significant amount of experimental data and an analysis of large quantities of samples, often of the order of tons. The results are tabulated of rubidium-strontium dating of geological formations in the Czech Socialist Republic. (M.S.)

  6. Structural Reliability Methods

    DEFF Research Database (Denmark)

    Ditlevsen, Ove Dalager; Madsen, H. O.

    The structural reliability methods quantitatively treat the uncertainty of predicting the behaviour and properties of a structure given the uncertain properties of its geometry, materials, and the actions it is supposed to withstand. This book addresses the probabilistic methods for evaluation...... of structural reliability, including the theoretical basis for these methods. Partial safety factor codes under current practice are briefly introduced and discussed. A probabilistic code format for obtaining a formal reliability evaluation system that catches the most essential features of the nature...... of the uncertainties and their interplay is the developed, step-by-step. The concepts presented are illustrated by numerous examples throughout the text....

  7. Catalytic reforming methods

    Science.gov (United States)

    Tadd, Andrew R; Schwank, Johannes

    2013-05-14

    A catalytic reforming method is disclosed herein. The method includes sequentially supplying a plurality of feedstocks of variable compositions to a reformer. The method further includes adding a respective predetermined co-reactant to each of the plurality of feedstocks to obtain a substantially constant output from the reformer for the plurality of feedstocks. The respective predetermined co-reactant is based on a C/H/O atomic composition for a respective one of the plurality of feedstocks and a predetermined C/H/O atomic composition for the substantially constant output.

  8. Nuclear physics mathematical methods

    International Nuclear Information System (INIS)

    Balian, R.; Gervois, A.; Giannoni, M.J.; Levesque, D.; Maille, M.

    1984-01-01

    The nuclear physics mathematical methods, applied to the collective motion theory, to the reduction of the degrees of freedom and to the order and disorder phenomena; are investigated. In the scope of the study, the following aspects are discussed: the entropy of an ensemble of collective variables; the interpretation of the dissipation, applying the information theory; the chaos and the universality; the Monte-Carlo method applied to the classical statistical mechanics and quantum mechanics; the finite elements method, and the classical ergodicity [fr

  9. Methods for RNA Analysis

    DEFF Research Database (Denmark)

    Olivarius, Signe

    of the transcriptome, 5’ end capture of RNA is combined with next-generation sequencing for high-throughput quantitative assessment of transcription start sites by two different methods. The methods presented here allow for functional investigation of coding as well as noncoding RNA and contribute to future...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA...

  10. Electromigration method in radiochemistry

    International Nuclear Information System (INIS)

    Makarova, T.P.; Stepanov, A.V.

    1977-01-01

    Investigations are reviewd of the period 1969-1975 accomplished by such methods as zonal electrophoresis in countercurrent, focusing electrophoresis, isotachophoresis, electrophoresis with elution, continuous two-dimensional electrophoresis. Since the methods considered are based on the use of porous fillers for stabilizing the medium, some attention is given to the effect of the solid-solution interface on the shape and rate of motion of the zones of the rare-earth elements investigated, Sr and others. The trend of developing electrophoresis as a method for obtaining high-purity elements is emphasized

  11. Numerical methods using Matlab

    CERN Document Server

    Lindfield, George

    2012-01-01

    Numerical Methods using MATLAB, 3e, is an extensive reference offering hundreds of useful and important numerical algorithms that can be implemented into MATLAB for a graphical interpretation to help researchers analyze a particular outcome. Many worked examples are given together with exercises and solutions to illustrate how numerical methods can be used to study problems that have applications in the biosciences, chaos, optimization, engineering and science across the board. Numerical Methods using MATLAB, 3e, is an extensive reference offering hundreds of use

  12. Model Correction Factor Method

    DEFF Research Database (Denmark)

    Christensen, Claus; Randrup-Thomsen, Søren; Morsing Johannesen, Johannes

    1997-01-01

    The model correction factor method is proposed as an alternative to traditional polynomial based response surface techniques in structural reliability considering a computationally time consuming limit state procedure as a 'black box'. The class of polynomial functions is replaced by a limit...... of the model correction factor method, is that in simpler form not using gradient information on the original limit state function or only using this information once, a drastic reduction of the number of limit state evaluation is obtained together with good approximations on the reliability. Methods...

  13. Imaging methods in otorhinolaryngology

    International Nuclear Information System (INIS)

    Frey, K.W.; Mees, K.; Vogl, T.

    1989-01-01

    This book is the work of an otorhinolaryngologist and two radiologists, who combined their experience and efforts in order to solve a great variety and number of problems encountered in practical work, taking into account the latest technical potentials and the practical feasibility, which is determined by the equipment available. Every chapter presents the full range of diagnostic methods applicable, starting with the suitable plain radiography methods and proceeding to the various tomographic scanning methods, including conventional tomography. Every technique is assessed in terms of diagnostic value and drawbacks. (orig./MG) With 778 figs [de

  14. Generalized subspace correction methods

    Energy Technology Data Exchange (ETDEWEB)

    Kolm, P. [Royal Institute of Technology, Stockholm (Sweden); Arbenz, P.; Gander, W. [Eidgenoessiche Technische Hochschule, Zuerich (Switzerland)

    1996-12-31

    A fundamental problem in scientific computing is the solution of large sparse systems of linear equations. Often these systems arise from the discretization of differential equations by finite difference, finite volume or finite element methods. Iterative methods exploiting these sparse structures have proven to be very effective on conventional computers for a wide area of applications. Due to the rapid development and increasing demand for the large computing powers of parallel computers, it has become important to design iterative methods specialized for these new architectures.

  15. Concrete compositions and methods

    Science.gov (United States)

    Chen, Irvin; Lee, Patricia Tung; Patterson, Joshua

    2015-06-23

    Provided herein are compositions, methods, and systems for cementitious compositions containing calcium carbonate compositions and aggregate. The compositions find use in a variety of applications, including use in a variety of building materials and building applications.

  16. Ensemble Data Mining Methods

    Science.gov (United States)

    Oza, Nikunj C.

    2004-01-01

    Ensemble Data Mining Methods, also known as Committee Methods or Model Combiners, are machine learning methods that leverage the power of multiple models to achieve better prediction accuracy than any of the individual models could on their own. The basic goal when designing an ensemble is the same as when establishing a committee of people: each member of the committee should be as competent as possible, but the members should be complementary to one another. If the members are not complementary, Le., if they always agree, then the committee is unnecessary---any one member is sufficient. If the members are complementary, then when one or a few members make an error, the probability is high that the remaining members can correct this error. Research in ensemble methods has largely revolved around designing ensembles consisting of competent yet complementary models.

  17. Diagnostic method and reagent

    International Nuclear Information System (INIS)

    Edgington, T.S.; Plow, E.F.

    1979-01-01

    The discovery of an isomeric species of carcinoembryonic antigen and methods of isolation, identification and utilization as a radiolabelled species of the same as an aid in the diagnosis of adenocarcinomas of the gastrointestinal tract are disclosed. 13 claims

  18. Methods of dating

    Energy Technology Data Exchange (ETDEWEB)

    Gatty, B

    1986-04-01

    Scientific methods of dating, born less than thirty years ago, have recently improved tremendously. First the dating principles will be given; then it will be explained how, through natural radioactivity, we can have access to the age of an event or an object; the case of radiocarbon will be especially emphasized. The principle of relative methods such as thermoluminescence or paleomagnetism will also be shortly given. What is the use for dating. The fields of its application are numerous; through these methods, relatively precise ages can be given to the major events which have been keys in the history of universe, life and man; thus, dating is a useful scientific tool in astrophysics, geology, biology, anthropology and archeology. Even if certain ages are still subject to controversies, we can say that these methods have confirmed evolution's continuity, be it on a cosmic, biologic or human scale, where ages are measured in billions, millions or thousands of years respectively.

  19. Energy consumption assessment methods

    Energy Technology Data Exchange (ETDEWEB)

    Sutherland, K S

    1975-01-01

    The why, what, and how-to aspects of energy audits for industrial plants, and the application of energy accounting methods to a chemical plant in order to assess energy conservation possibilities are discussed. (LCL)

  20. Stochastic optimization methods

    CERN Document Server

    Marti, Kurt

    2005-01-01

    Optimization problems arising in practice involve random parameters. For the computation of robust optimal solutions, i.e., optimal solutions being insensitive with respect to random parameter variations, deterministic substitute problems are needed. Based on the distribution of the random data, and using decision theoretical concepts, optimization problems under stochastic uncertainty are converted into deterministic substitute problems. Due to the occurring probabilities and expectations, approximative solution techniques must be applied. Deterministic and stochastic approximation methods and their analytical properties are provided: Taylor expansion, regression and response surface methods, probability inequalities, First Order Reliability Methods, convex approximation/deterministic descent directions/efficient points, stochastic approximation methods, differentiation of probability and mean value functions. Convergence results of the resulting iterative solution procedures are given.

  1. Predictive Methods of Pople

    Indian Academy of Sciences (India)

    Chemistry for their pioneering contri butions to the development of computational methods in quantum chemistry and density functional theory .... program of Pop Ie for ab-initio electronic structure calculation of molecules. This ab-initio MO ...

  2. Methods for cellobiosan utilization

    Energy Technology Data Exchange (ETDEWEB)

    Linger, Jeffrey; Beckham, Gregg T.

    2017-07-11

    Disclosed herein are enzymes useful for the degradation of cellobiosan in materials such a pyrolysis oils. Methods of degrading cellobiosan using enzymes or organisms expressing the same are also disclosed.

  3. Methods of neutron spectrometry

    International Nuclear Information System (INIS)

    Doerschel, B.

    1981-01-01

    The different methods of neutron spectrometry are based on the direct measurement of neutron velocity or on the use of suitable energy-dependent interaction processes. In the latter case the measuring effect of a detector is connected with the searched neutron spectrum by an integral equation. The solution needs suitable unfolding procedures. The most important methods of neutron spectrometry are the time-of-flight method, the crystal spectrometry, the neutron spectrometry by use of elastic collisions with hydrogen nuclei, and neutron spectrometry with the aid of nuclear reactions, especially of the neutron-induced activation. The advantages and disadvantages of these methods are contrasted considering the resolution, the measurable energy range, the sensitivity, and the experimental and computational efforts. (author)

  4. Methods in Modern Biophysics

    CERN Document Server

    Nölting, Bengt

    2010-01-01

    Incorporating recent dramatic advances, this textbook presents a fresh and timely introduction to modern biophysical methods. An array of new, faster and higher-power biophysical methods now enables scientists to examine the mysteries of life at a molecular level. This innovative text surveys and explains the ten key biophysical methods, including those related to biophysical nanotechnology, scanning probe microscopy, X-ray crystallography, ion mobility spectrometry, mass spectrometry, proteomics, and protein folding and structure. Incorporating much information previously unavailable in tutorial form, Nölting employs worked examples and about 270 illustrations to fully detail the techniques and their underlying mechanisms. Methods in Modern Biophysics is written for advanced undergraduate and graduate students, postdocs, researchers, lecturers, and professors in biophysics, biochemistry and related fields. Special features in the 3rd edition: Introduces rapid partial protein ladder sequencing - an important...

  5. Lean Government Methods Guide

    Science.gov (United States)

    This Guide focuses primarily on Lean production, which is an organizational improvement philosophy and set of methods that originated in manufacturing but has been expanded to government and service sectors.

  6. Number projection method

    International Nuclear Information System (INIS)

    Kaneko, K.

    1987-01-01

    A relationship between the number projection and the shell model methods is investigated in the case of a single-j shell. We can find a one-to-one correspondence between the number projected and the shell model states

  7. Etching method employing radiation

    International Nuclear Information System (INIS)

    Chapman, B.N.; Winters, H.F.

    1982-01-01

    This invention provides a method for etching a silicon oxide, carbide, nitride, or oxynitride surface using an electron or ion beam in the presence of a xenon or krypton fluoride. No additional steps are required after exposure to radiation

  8. GEM simulation methods development

    International Nuclear Information System (INIS)

    Tikhonov, V.; Veenhof, R.

    2002-01-01

    A review of methods used in the simulation of processes in gas electron multipliers (GEMs) and in the accurate calculation of detector characteristics is presented. Such detector characteristics as effective gas gain, transparency, charge collection and losses have been calculated and optimized for a number of GEM geometries and compared with experiment. A method and a new special program for calculations of detector macro-characteristics such as signal response in a real detector readout structure, and spatial and time resolution of detectors have been developed and used for detector optimization. A detailed development of signal induction on readout electrodes and electronics characteristics are included in the new program. A method for the simulation of charging-up effects in GEM detectors is described. All methods show good agreement with experiment

  9. Improved radioanalytical methods

    International Nuclear Information System (INIS)

    Erickson, M.D.; Aldstadt, J.H.; Alvarado, J.S.; Crain, J.S.; Orlandini, K.A.; Smith, L.L.

    1995-01-01

    Methods for the chemical characterization of the environment are being developed under a multitask project for the Analytical Services Division (EM-263) within the US Department of Energy (DOE) Office of Environmental Management. This project focuses on improvement of radioanalytical methods with an emphasis on faster and cheaper routine methods. We have developed improved methods, for separation of environmental levels of technetium-99 and strontium-89/90, radium, and actinides from soil and water; and for separation of actinides from soil and water matrix interferences. Among the novel separation techniques being used are element- and class-specific resins and membranes. (The 3M Corporation is commercializing Empore trademark membranes under a cooperative research and development agreement [CRADA] initiated under this project). We have also developed methods for simultaneous detection of multiple isotopes using inductively coupled plasma-mass spectrometry (ICP-MS). The ICP-MS method requires less rigorous chemical separations than traditional radiochemical analyses because of its mass-selective mode of detection. Actinides and their progeny have been isolated and concentrated from a variety of natural water matrices by using automated batch separation incorporating selective resins prior to ICP-MS analyses. In addition, improvements in detection limits, sample volume, and time of analysis were obtained by using other sample introduction techniques, such as ultrasonic nebulization and electrothermal vaporization. Integration and automation of the separation methods with the ICP-MS methodology by using flow injection analysis is underway, with an objective of automating methods to achieve more reproducible results, reduce labor costs, cut analysis time, and minimize secondary waste generation through miniaturization of the process

  10. Continuation Newton methods

    Czech Academy of Sciences Publication Activity Database

    Axelsson, Owe; Sysala, Stanislav

    2015-01-01

    Roč. 70, č. 11 (2015), s. 2621-2637 ISSN 0898-1221 R&D Projects: GA ČR GA13-18652S Institutional support: RVO:68145535 Keywords : system of nonlinear equations * Newton method * load increment method * elastoplasticity Subject RIV: IN - Informatics, Computer Science Impact factor: 1.398, year: 2015 http://www.sciencedirect.com/science/article/pii/S0898122115003818

  11. Nuclear methods monitor nutrition

    International Nuclear Information System (INIS)

    Allen, B.J.

    1988-01-01

    Neutron activation of nitrogen and hydrogen in the body, the isotope dilution technique and the measurement of naturally radioactive potassium in the body are among the new nuclear methods, now under collaborative development by the Australian Nuclear Scientific and Technology Organization and medical specialists from several Sydney hospitals. These methods allow medical specialists to monitor the patient's response to various diets and dietary treatments in cases of cystic fibrosis, anorexia nervosa, long-term surgical trauma, renal diseases and AIDS. ills

  12. The fission track method

    International Nuclear Information System (INIS)

    Hansen, K.

    1990-01-01

    During the last decade fission track (FT) analysis has evolved as an important tool in exploration for hydrocarbon resources. Most important is this method's ability to yield information about temperatures at different times (history), and thus relate oil generation and time independently of other maturity parameters. The purpose of this paper is to introduce the basics of the method and give an example from the author's studies. (AB) (14 refs.)

  13. Experimental physics method

    International Nuclear Information System (INIS)

    Jeong, Yang Su; Oh, Byeong Seong

    2010-05-01

    This book introduces measurement and error, statistics of experimental data, population, sample variable, distribution function, propagation of error, mean and measurement of error, adjusting to rectilinear equation, common sense of error, experiment method, and record and statement. It also explains importance of error of estimation, systematic error, random error, treatment of single variable, significant figure, deviation, mean value, median, mode, sample mean, sample standard deviation, binomial distribution, gauss distribution, and method of least squares.

  14. Methods for measuring shrinkage

    OpenAIRE

    Chapman, Paul; Templar, Simon

    2006-01-01

    This paper presents findings from research amongst European grocery retailers into their methods for measuring shrinkage. The findings indicate that: there is no dominant method for valuing or stating shrinkage; shrinkage in the supply chain is frequently overlooked; data is essential in pinpointing where and when loss occurs and that many retailers collect data at the stock-keeping unit (SKU) level and do so every 6 months. These findings reveal that it is difficult to benc...

  15. Method of saccharifying cellulose

    Science.gov (United States)

    Johnson, E.A.; Demain, A.L.; Madia, A.

    1983-05-13

    A method is disclosed of saccharifying cellulose by incubation with the cellulase of Clostridium thermocellum in a broth containing an efficacious amount of thiol reducing agent. Other incubation parameters which may be advantageously controlled to stimulate saccharification include the concentration of alkaline earth salts, pH, temperature, and duration. By the method of the invention, even native crystalline cellulose such as that found in cotton may be completely saccharified.

  16. Method of treating depression

    Science.gov (United States)

    Henn, Fritz [East Patchogue, NY

    2012-01-24

    Methods for treatment of depression-related mood disorders in mammals, particularly humans are disclosed. The methods of the invention include administration of compounds capable of enhancing glutamate transporter activity in the brain of mammals suffering from depression. ATP-sensitive K.sup.+ channel openers and .beta.-lactam antibiotics are used to enhance glutamate transport and to treat depression-related mood disorders and depressive symptoms.

  17. Methods of experimental physics

    CERN Document Server

    Williams, Dudley

    1962-01-01

    Methods of Experimental Physics, Volume 3: Molecular Physics focuses on molecular theory, spectroscopy, resonance, molecular beams, and electric and thermodynamic properties. The manuscript first considers the origins of molecular theory, molecular physics, and molecular spectroscopy, as well as microwave spectroscopy, electronic spectra, and Raman effect. The text then ponders on diffraction methods of molecular structure determination and resonance studies. Topics include techniques of electron, neutron, and x-ray diffraction and nuclear magnetic, nuclear quadropole, and electron spin reson

  18. The ICARE Method

    Science.gov (United States)

    Henke, Luke

    2010-01-01

    The ICARE method is a flexible, widely applicable method for systems engineers to solve problems and resolve issues in a complete and comprehensive manner. The method can be tailored by diverse users for direct application to their function (e.g. system integrators, design engineers, technical discipline leads, analysts, etc.). The clever acronym, ICARE, instills the attitude of accountability, safety, technical rigor and engagement in the problem resolution: Identify, Communicate, Assess, Report, Execute (ICARE). This method was developed through observation of Space Shuttle Propulsion Systems Engineering and Integration (PSE&I) office personnel approach in an attempt to succinctly describe the actions of an effective systems engineer. Additionally it evolved from an effort to make a broadly-defined checklist for a PSE&I worker to perform their responsibilities in an iterative and recursive manner. The National Aeronautics and Space Administration (NASA) Systems Engineering Handbook states, engineering of NASA systems requires a systematic and disciplined set of processes that are applied recursively and iteratively for the design, development, operation, maintenance, and closeout of systems throughout the life cycle of the programs and projects. ICARE is a method that can be applied within the boundaries and requirements of NASA s systems engineering set of processes to provide an elevated sense of duty and responsibility to crew and vehicle safety. The importance of a disciplined set of processes and a safety-conscious mindset increases with the complexity of the system. Moreover, the larger the system and the larger the workforce, the more important it is to encourage the usage of the ICARE method as widely as possible. According to the NASA Systems Engineering Handbook, elements of a system can include people, hardware, software, facilities, policies and documents; all things required to produce system-level results, qualities, properties, characteristics

  19. VALUATION METHODS- LITERATURE REVIEW

    Directory of Open Access Journals (Sweden)

    Dorisz Talas

    2015-07-01

    Full Text Available This paper is a theoretical overview of the often used valuation methods with the help of which the value of a firm or its equity is calculated. Many experts (including Aswath Damodaran, Guochang Zhang and CA Hozefa Natalwala classify the methods. The basic models are based on discounted cash flows. The main method uses the free cash flow for valuation, but there are some newer methods that reveal and correct the weaknesses of the traditional models. The valuation of flexibility of management can be conducted mainly with real options. This paper briefly describes the essence of the Dividend Discount Model, the Free Cash Flow Model, the benefit from using real options and the Residual Income Model. There are a few words about the Adjusted Present Value approach as well. Different models uses different premises, and an overall truth is that if the required premises are real and correct, the value will be appropriately accurate. Another important condition is that experts, analysts should choose between the models on the basis of the purpose of valuation. Thus there are no good or bad methods, only methods that fit different goals and aims. The main task is to define exactly the purpose, then to find the most appropriate valuation technique. All the methods originates from the premise that the value of an asset is the present value of its future cash flows. According to the different points of view of different techniques the resulted values can be also differed from each other. Valuation models and techniques should be adapted to the rapidly changing world, but the basic statements remain the same. On the other hand there is a need for more accurate models in order to help investors get as many information as they could. Today information is one of the most important resources and financial models should keep up with this trend.

  20. Solution of the neutron transport equation by the Method of Characteristics using a linear representation of the source within a mesh

    International Nuclear Information System (INIS)

    Mazumdar, Tanay; Degweker, S.B.

    2017-01-01

    Highlights: • In Method of Characteristics, the neutron source within a mesh is expanded up to linear term. • This expansion reduces the number of meshes as compared to flat source assumption. • Poor representation of circular geometry with coarser meshes is corrected. • Few benchmark problems are solved to show the advantages of linear expansion of source. • The advantage of the present formalism is quite visible in problems with large flux gradient. - Abstract: A common assumption in the solution of the neutron transport equation by the Method of Characteristics (MOC) is that the source (or flux) is constant within a mesh. This assumption is adequate provided the meshes are small enough so that the spatial variation of flux within a mesh may be ignored. Whether a mesh is small enough or not depends upon the flux gradient across a mesh, which in turn depends on factors like the presence of strong absorbers, localized sources or vacuum boundaries. The flat flux assumption often requires a very large number of meshes for solving the neutron transport equation with acceptable accuracy as was observed in our earlier work on the subject. A significant reduction in the required number of meshes is attainable by using a higher order representation of the flux within a mesh. In this paper, we expand the source within a mesh up to first order (linear) terms, which permits the use of larger sized (and therefore fewer) meshes and thereby reduces the computation time without compromising the accuracy of calculation. Since the division of the geometry into meshes is through an automatic triangulation procedure using the Bowyer-Watson algorithm, representation of circular objects (cylindrical fuel rods) with coarse meshes is poorer and causes geometry related errors. A numerical recipe is presented to make a correction to the automatic triangulation process and thereby eliminate this source of error. A number of benchmark problems are analyzed to emphasize the

  1. The lod score method.

    Science.gov (United States)

    Rice, J P; Saccone, N L; Corbett, J

    2001-01-01

    The lod score method originated in a seminal article by Newton Morton in 1955. The method is broadly concerned with issues of power and the posterior probability of linkage, ensuring that a reported linkage has a high probability of being a true linkage. In addition, the method is sequential, so that pedigrees or lod curves may be combined from published reports to pool data for analysis. This approach has been remarkably successful for 50 years in identifying disease genes for Mendelian disorders. After discussing these issues, we consider the situation for complex disorders, where the maximum lod score (MLS) statistic shares some of the advantages of the traditional lod score approach but is limited by unknown power and the lack of sharing of the primary data needed to optimally combine analytic results. We may still learn from the lod score method as we explore new methods in molecular biology and genetic analysis to utilize the complete human DNA sequence and the cataloging of all human genes.

  2. Advances in iterative methods

    International Nuclear Information System (INIS)

    Beauwens, B.; Arkuszewski, J.; Boryszewicz, M.

    1981-01-01

    Results obtained in the field of linear iterative methods within the Coordinated Research Program on Transport Theory and Advanced Reactor Calculations are summarized. The general convergence theory of linear iterative methods is essentially based on the properties of nonnegative operators on ordered normed spaces. The following aspects of this theory have been improved: new comparison theorems for regular splittings, generalization of the notions of M- and H-matrices, new interpretations of classical convergence theorems for positive-definite operators. The estimation of asymptotic convergence rates was developed with two purposes: the analysis of model problems and the optimization of relaxation parameters. In the framework of factorization iterative methods, model problem analysis is needed to investigate whether the increased computational complexity of higher-order methods does not offset their increased asymptotic convergence rates, as well as to appreciate the effect of standard relaxation techniques (polynomial relaxation). On the other hand, the optimal use of factorization iterative methods requires the development of adequate relaxation techniques and their optimization. The relative performances of a few possibilities have been explored for model problems. Presently, the best results have been obtained with optimal diagonal-Chebyshev relaxation

  3. Independent random sampling methods

    CERN Document Server

    Martino, Luca; Míguez, Joaquín

    2018-01-01

    This book systematically addresses the design and analysis of efficient techniques for independent random sampling. Both general-purpose approaches, which can be used to generate samples from arbitrary probability distributions, and tailored techniques, designed to efficiently address common real-world practical problems, are introduced and discussed in detail. In turn, the monograph presents fundamental results and methodologies in the field, elaborating and developing them into the latest techniques. The theory and methods are illustrated with a varied collection of examples, which are discussed in detail in the text and supplemented with ready-to-run computer code. The main problem addressed in the book is how to generate independent random samples from an arbitrary probability distribution with the weakest possible constraints or assumptions in a form suitable for practical implementation. The authors review the fundamental results and methods in the field, address the latest methods, and emphasize the li...

  4. Grid generation methods

    CERN Document Server

    Liseikin, Vladimir D

    2017-01-01

    This new edition provides a description of current developments relating to grid methods, grid codes, and their applications to actual problems. Grid generation methods are indispensable for the numerical solution of differential equations. Adaptive grid-mapping techniques, in particular, are the main focus and represent a promising tool to deal with systems with singularities. This 3rd edition includes three new chapters on numerical implementations (10), control of grid properties (11), and applications to mechanical, fluid, and plasma related problems (13). Also the other chapters have been updated including new topics, such as curvatures of discrete surfaces (3). Concise descriptions of hybrid mesh generation, drag and sweeping methods, parallel algorithms for mesh generation have been included too. This new edition addresses a broad range of readers: students, researchers, and practitioners in applied mathematics, mechanics, engineering, physics and other areas of applications.

  5. Bayesian methods in reliability

    Science.gov (United States)

    Sander, P.; Badoux, R.

    1991-11-01

    The present proceedings from a course on Bayesian methods in reliability encompasses Bayesian statistical methods and their computational implementation, models for analyzing censored data from nonrepairable systems, the traits of repairable systems and growth models, the use of expert judgment, and a review of the problem of forecasting software reliability. Specific issues addressed include the use of Bayesian methods to estimate the leak rate of a gas pipeline, approximate analyses under great prior uncertainty, reliability estimation techniques, and a nonhomogeneous Poisson process. Also addressed are the calibration sets and seed variables of expert judgment systems for risk assessment, experimental illustrations of the use of expert judgment for reliability testing, and analyses of the predictive quality of software-reliability growth models such as the Weibull order statistics.

  6. Energy methods in dynamics

    CERN Document Server

    Le, Khanh Chau

    2012-01-01

    The above examples should make clear the necessity of understanding the mechanism of vibrations and waves in order to control them in an optimal way. However vibrations and waves are governed by differential equations which require, as a rule, rather complicated mathematical methods for their analysis. The aim of this textbook is to help students acquire both a good grasp of the first principles from which the governing equations can be derived, and the adequate mathematical methods for their solving. Its distinctive features, as seen from the title, lie in the systematic and intensive use of Hamilton's variational principle and its generalizations for deriving the governing equations of conservative and dissipative mechanical systems, and also in providing the direct variational-asymptotic analysis, whenever available, of the energy and dissipation for the solution of these equations. It will be demonstrated that many well-known methods in dynamics like those of Lindstedt-Poincare, Bogoliubov-Mitropolsky, Ko...

  7. Nuclear methods for tribology

    International Nuclear Information System (INIS)

    Racolta, P.M.

    1994-01-01

    The tribological field of activity is mainly concerned with the relative movement of different machine components, friction and wear phenomena and their dependence upon lubrication. Tribological studies on friction and wear processes are important because they lead to significant parameter-improvements of engineering tools and machinery components. A review of fundamental aspects of both friction and wear phenomena is presented. A number of radioindicator-based methods have been known for almost four decades, differing mainly with respect to the mode of introducing the radio-indicators into the machine part to be studied. All these methods briefly presented in this paper are based on the measurement of the activity of wear products and therefore require high activity levels of the part. For this reason, such determinations can be carried out only in special laboratories and under conditions which do not usually agree with the conditions of actual use. What is required is a sensitive, fast method allowing the determination of wear under any operating conditions, without the necessity of stopping and disassembling the machine. The above mentioned requirements are the features that have made the Thin Layer Activation technique (TLA) the most widely used method applied in wear and corrosion studies in the last two decades. The TLA principle, taking in account that wear and corrosion processes are characterised by a loss of material, consists in an ion beam irradiation of a well defined volume of a machine part subjected to wear. The radioactivity level changes can usually be measured by gamma-ray spectroscopy methods. A review of both main TLA fields of application in major laboratories abroad and of those performed at the U-120 cyclotron of I.P.N.E.-Bucharest together with the existing trends to extend other nuclear analytical methods to tribological studies is presented as well. (author). 25 refs., 6 figs., 2 tabs

  8. Methods for pretreating biomass

    Science.gov (United States)

    Balan, Venkatesh; Dale, Bruce E; Chundawat, Shishir; Sousa, Leonardo

    2017-05-09

    A method for pretreating biomass is provided, which includes, in a reactor, allowing gaseous ammonia to condense on the biomass and react with water present in the biomass to produce pretreated biomass, wherein reactivity of polysaccharides in the biomass is increased during subsequent biological conversion as compared to the reactivity of polysaccharides in biomass which has not been pretreated. A method for pretreating biomass with a liquid ammonia and recovering the liquid ammonia is also provided. Related systems which include a biochemical or biofuel production facility are also disclosed.

  9. Exploring Monte Carlo methods

    CERN Document Server

    Dunn, William L

    2012-01-01

    Exploring Monte Carlo Methods is a basic text that describes the numerical methods that have come to be known as "Monte Carlo." The book treats the subject generically through the first eight chapters and, thus, should be of use to anyone who wants to learn to use Monte Carlo. The next two chapters focus on applications in nuclear engineering, which are illustrative of uses in other fields. Five appendices are included, which provide useful information on probability distributions, general-purpose Monte Carlo codes for radiation transport, and other matters. The famous "Buffon's needle proble

  10. Research on teaching methods.

    Science.gov (United States)

    Oermann, M H

    1990-01-01

    Research on teaching methods in nursing education was categorized into studies on media, CAI, and other nontraditional instructional strategies. While the research differed, some generalizations may be made from the findings. Multimedia, whether it is used for individual or group instruction, is at least as effective as traditional instruction (lecture and lecture-discussion) in promoting cognitive learning, retention of knowledge, and performance. Further study is needed to identify variables that may influence learning and retention. While learner attitudes toward mediated instruction tended to be positive, investigators failed to control for the effect of novelty. Control over intervening variables was lacking in the majority of studies as well. Research indicated that CAI is as effective as other teaching methods in terms of knowledge gain and retention. Attitudes toward CAI tended to be favorable, with similar problems in measurement as those evidenced in studies of media. Chang (1986) also recommends that future research examine the impact of computer-video interactive instruction on students, faculty, and settings. Research is needed on experimental teaching methods, strategies for teaching problem solving and clinical judgment, and ways of improving the traditional lecture and discussion. Limited research in these areas makes generalizations impossible. There is a particular need for research on how to teach students the diagnostic reasoning process and encourage critical thinking, both in terms of appropriate teaching methods and the way in which those strategies should be used. It is interesting that few researchers studied lecture and lecture-discussion except as comparable teaching methods for research on other strategies. Additional research questions may be generated on lecture and discussion in relation to promoting concept learning, an understanding of nursing and other theories, transfer of knowledge, and development of cognitive skills. Few

  11. Carbon 14 dating method

    International Nuclear Information System (INIS)

    Fortin, Ph.

    2000-01-01

    This document gives a first introduction to 14 C dating as it is put into practice at the radiocarbon dating centre of Claude-Bernard university (Lyon-1 univ., Villeurbanne, France): general considerations and recalls of nuclear physics; the 14 C dating method; the initial standard activity; the isotopic fractioning; the measurement of samples activity; the liquid-scintillation counters; the calibration and correction of 14 C dates; the preparation of samples; the benzene synthesis; the current applications of the method. (J.S.)

  12. Methods of Multivariate Analysis

    CERN Document Server

    Rencher, Alvin C

    2012-01-01

    Praise for the Second Edition "This book is a systematic, well-written, well-organized text on multivariate analysis packed with intuition and insight . . . There is much practical wisdom in this book that is hard to find elsewhere."-IIE Transactions Filled with new and timely content, Methods of Multivariate Analysis, Third Edition provides examples and exercises based on more than sixty real data sets from a wide variety of scientific fields. It takes a "methods" approach to the subject, placing an emphasis on how students and practitioners can employ multivariate analysis in real-life sit

  13. Tautomerism methods and theories

    CERN Document Server

    Antonov, Liudmil

    2013-01-01

    Covering the gap between basic textbooks and over-specialized scientific publications, this is the first reference available to describe this interdisciplinary topic for PhD students and scientists starting in the field. The result is an introductory description providing suitable practical examples of the basic methods used to study tautomeric processes, as well as the theories describing the tautomerism and proton transfer phenomena. It also includes different spectroscopic methods for examining tautomerism, such as UV-VIs, time-resolved fluorescence spectroscopy, and NMR spectrosc

  14. Speeding Fermat's factoring method

    Science.gov (United States)

    McKee, James

    A factoring method is presented which, heuristically, splits composite n in O(n^{1/4+epsilon}) steps. There are two ideas: an integer approximation to sqrt(q/p) provides an O(n^{1/2+epsilon}) algorithm in which n is represented as the difference of two rational squares; observing that if a prime m divides a square, then m^2 divides that square, a heuristic speed-up to O(n^{1/4+epsilon}) steps is achieved. The method is well-suited for use with small computers: the storage required is negligible, and one never needs to work with numbers larger than n itself.

  15. High frequency asymptotic methods

    International Nuclear Information System (INIS)

    Bouche, D.; Dessarce, R.; Gay, J.; Vermersch, S.

    1991-01-01

    The asymptotic methods allow us to compute the interaction of high frequency electromagnetic waves with structures. After an outline of their foundations with emphasis on the geometrical theory of diffraction, it is shown how to use these methods to evaluate the radar cross section (RCS) of complex tri-dimensional objects of great size compared to the wave-length. The different stages in simulating phenomena which contribute to the RCS are reviewed: physical theory of diffraction, multiple interactions computed by shooting rays, research for creeping rays. (author). 7 refs., 6 figs., 3 insets

  16. Practical methods of optimization

    CERN Document Server

    Fletcher, R

    2013-01-01

    Fully describes optimization methods that are currently most valuable in solving real-life problems. Since optimization has applications in almost every branch of science and technology, the text emphasizes their practical aspects in conjunction with the heuristics useful in making them perform more reliably and efficiently. To this end, it presents comparative numerical studies to give readers a feel for possibile applications and to illustrate the problems in assessing evidence. Also provides theoretical background which provides insights into how methods are derived. This edition offers rev

  17. Electrorheological fluids and methods

    Science.gov (United States)

    Green, Peter F.; McIntyre, Ernest C.

    2015-06-02

    Electrorheological fluids and methods include changes in liquid-like materials that can flow like milk and subsequently form solid-like structures under applied electric fields; e.g., about 1 kV/mm. Such fluids can be used in various ways as smart suspensions, including uses in automotive, defense, and civil engineering applications. Electrorheological fluids and methods include one or more polar molecule substituted polyhedral silsesquioxanes (e.g., sulfonated polyhedral silsesquioxanes) and one or more oils (e.g., silicone oil), where the fluid can be subjected to an electric field.

  18. Method of sterilization

    International Nuclear Information System (INIS)

    Peel, J.L.; Waites, W.M.

    1981-01-01

    A method of sterilisation of food packaging is described which comprises treating microorganisms with an ultraviolet irradiated solution of hydrogen peroxide to render the microorganisms non-viable. The wavelength of ultraviolet radiation used is wholly or predominantly below 325 nm and the concentration of the hydrogen peroxide is no greater than 10% by weight. The method is applicable to a wide variety of microorganisms including moulds, yeasts, bacteria, viruses and protozoa and finds particular application in the destruction of spore-forming bacteria, especially those which are dairy contaminants. (U.K.)

  19. Unorthodox theoretical methods

    Energy Technology Data Exchange (ETDEWEB)

    Nedd, Sean [Iowa State Univ., Ames, IA (United States)

    2012-01-01

    The use of the ReaxFF force field to correlate with NMR mobilities of amine catalytic substituents on a mesoporous silica nanosphere surface is considered. The interfacing of the ReaxFF force field within the Surface Integrated Molecular Orbital/Molecular Mechanics (SIMOMM) method, in order to replicate earlier SIMOMM published data and to compare with the ReaxFF data, is discussed. The development of a new correlation consistent Composite Approach (ccCA) is presented, which incorporates the completely renormalized coupled cluster method with singles, doubles and non-iterative triples corrections towards the determination of heats of formations and reaction pathways which contain biradical species.

  20. Monte Carlo methods

    Directory of Open Access Journals (Sweden)

    Bardenet Rémi

    2013-07-01

    Full Text Available Bayesian inference often requires integrating some function with respect to a posterior distribution. Monte Carlo methods are sampling algorithms that allow to compute these integrals numerically when they are not analytically tractable. We review here the basic principles and the most common Monte Carlo algorithms, among which rejection sampling, importance sampling and Monte Carlo Markov chain (MCMC methods. We give intuition on the theoretical justification of the algorithms as well as practical advice, trying to relate both. We discuss the application of Monte Carlo in experimental physics, and point to landmarks in the literature for the curious reader.

  1. The SPH homogeneization method

    International Nuclear Information System (INIS)

    Kavenoky, Alain

    1978-01-01

    The homogeneization of a uniform lattice is a rather well understood topic while difficult problems arise if the lattice becomes irregular. The SPH homogeneization method is an attempt to generate homogeneized cross sections for an irregular lattice. Section 1 summarizes the treatment of an isolated cylindrical cell with an entering surface current (in one velocity theory); Section 2 is devoted to the extension of the SPH method to assembly problems. Finally Section 3 presents the generalisation to general multigroup problems. Numerical results are obtained for a PXR rod bundle assembly in Section 4

  2. Splines and variational methods

    CERN Document Server

    Prenter, P M

    2008-01-01

    One of the clearest available introductions to variational methods, this text requires only a minimal background in calculus and linear algebra. Its self-contained treatment explains the application of theoretic notions to the kinds of physical problems that engineers regularly encounter. The text's first half concerns approximation theoretic notions, exploring the theory and computation of one- and two-dimensional polynomial and other spline functions. Later chapters examine variational methods in the solution of operator equations, focusing on boundary value problems in one and two dimension

  3. Probabilistic methods for physics

    International Nuclear Information System (INIS)

    Cirier, G

    2013-01-01

    We present an asymptotic method giving a probability of presence of the iterated spots of R d by a polynomial function f. We use the well-known Perron Frobenius operator (PF) that lets certain sets and measure invariant by f. Probabilistic solutions can exist for the deterministic iteration. If the theoretical result is already known, here we quantify these probabilities. This approach seems interesting to use for computing situations when the deterministic methods don't run. Among the examined applications, are asymptotic solutions of Lorenz, Navier-Stokes or Hamilton's equations. In this approach, linearity induces many difficult problems, all of whom we have not yet resolved.

  4. METHOD OF ROLLING URANIUM

    Science.gov (United States)

    Smith, C.S.

    1959-08-01

    A method is described for rolling uranium metal at relatively low temperatures and under non-oxidizing conditions. The method involves the steps of heating the uranium to 200 deg C in an oil bath, withdrawing the uranium and permitting the oil to drain so that only a thin protective coating remains and rolling the oil coated uranium at a temperature of 200 deg C to give about a 15% reduction in thickness at each pass. The operation may be repeated to accomplish about a 90% reduction without edge cracking, checking or any appreciable increase in brittleness.

  5. Supercritical fluid analytical methods

    International Nuclear Information System (INIS)

    Smith, R.D.; Kalinoski, H.T.; Wright, B.W.; Udseth, H.R.

    1988-01-01

    Supercritical fluids are providing the basis for new and improved methods across a range of analytical technologies. New methods are being developed to allow the detection and measurement of compounds that are incompatible with conventional analytical methodologies. Characterization of process and effluent streams for synfuel plants requires instruments capable of detecting and measuring high-molecular-weight compounds, polar compounds, or other materials that are generally difficult to analyze. The purpose of this program is to develop and apply new supercritical fluid techniques for extraction, separation, and analysis. These new technologies will be applied to previously intractable synfuel process materials and to complex mixtures resulting from their interaction with environmental and biological systems

  6. A flexible homework method

    Science.gov (United States)

    Bao, Lei; Stonebraker, Stephen R.; Sadaghiani, Homeyra

    2008-09-01

    The traditional methods of assigning and grading homework in large enrollment physics courses have raised concerns among many instructors and students. In this paper we discuss a cost-effective approach to managing homework that involves making half of the problem solutions available to students before the homework is due. In addition, students are allowed some control in choosing which problems to solve. This paper-based approach to homework provides more detailed and timely support to students and increases the amount of self-direction in the homework process. We describe the method and present preliminary results on how students have responded.

  7. Molecular methods for biofilms

    KAUST Repository

    Ferrera, Isabel; Balagué , Vanessa; Voolstra, Christian R.; Aranda, Manuel; Bayer, Till; Abed, Raeid M.M.; Dobretsov, Sergey; Owens, Sarah M.; Wilkening, Jared; Fessler, Jennifer L.; Gilbert, Jack A.

    2014-01-01

    This chapter deals with both classical and modern molecular methods that can be useful for the identification of microorganisms, elucidation and comparison of microbial communities, and investigation of their diversity and functions. The most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples; these are discussed in the first part. The second part provides an overview over DNA polymerase chain reaction (PCR) amplification and DNA sequencing methods. Protocols and analysis software as well as potential pitfalls associated with application of these methods are discussed. Community fingerprinting analyses that can be used to compare multiple microbial communities are discussed in the third part. This part focuses on Denaturing Gradient Gel Electrophoresis (DGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP) and Automated rRNA Intergenic Spacer Analysis (ARISA) methods. In addition, classical and next-generation metagenomics methods are presented. These are limited to bacterial artificial chromosome and Fosmid libraries and Sanger and next-generation 454 sequencing, as these methods are currently the most frequently used in research. Isolation of nucleic acids: This chapter discusses, the most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples. Nucleic acid isolation methods generally include three steps: cell lysis, removal of unwanted substances, and a final step of DNA purification and recovery. The first critical step is the cell lysis, which can be achieved by enzymatic or mechanical procedures. Removal of proteins, polysaccharides and other unwanted substances is likewise important to avoid their interference in subsequent analyses. Phenol-chloroform-isoamyl alcohol is commonly used to recover DNA, since it separates nucleic acids into an aqueous phase and precipitates proteins and

  8. Molecular methods for biofilms

    KAUST Repository

    Ferrera, Isabel

    2014-08-30

    This chapter deals with both classical and modern molecular methods that can be useful for the identification of microorganisms, elucidation and comparison of microbial communities, and investigation of their diversity and functions. The most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples; these are discussed in the first part. The second part provides an overview over DNA polymerase chain reaction (PCR) amplification and DNA sequencing methods. Protocols and analysis software as well as potential pitfalls associated with application of these methods are discussed. Community fingerprinting analyses that can be used to compare multiple microbial communities are discussed in the third part. This part focuses on Denaturing Gradient Gel Electrophoresis (DGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP) and Automated rRNA Intergenic Spacer Analysis (ARISA) methods. In addition, classical and next-generation metagenomics methods are presented. These are limited to bacterial artificial chromosome and Fosmid libraries and Sanger and next-generation 454 sequencing, as these methods are currently the most frequently used in research. Isolation of nucleic acids: This chapter discusses, the most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples. Nucleic acid isolation methods generally include three steps: cell lysis, removal of unwanted substances, and a final step of DNA purification and recovery. The first critical step is the cell lysis, which can be achieved by enzymatic or mechanical procedures. Removal of proteins, polysaccharides and other unwanted substances is likewise important to avoid their interference in subsequent analyses. Phenol-chloroform-isoamyl alcohol is commonly used to recover DNA, since it separates nucleic acids into an aqueous phase and precipitates proteins and

  9. Software specification methods

    CERN Document Server

    Habrias, Henri

    2010-01-01

    This title provides a clear overview of the main methods, and has a practical focus that allows the reader to apply their knowledge to real-life situations. The following are just some of the techniques covered: UML, Z, TLA+, SAZ, B, OMT, VHDL, Estelle, SDL and LOTOS.

  10. Leak detection method

    International Nuclear Information System (INIS)

    1978-01-01

    This invention provides a method for removing nuclear fuel elements from a fabrication building while at the same time testing the fuel elements for leaks without releasing contaminants from the fabrication building or from the fuel elements. The vacuum source used, leak detecting mechanism and fuel element fabrication building are specified to withstand environmental hazards. (UK)

  11. Photovoltaic device and method

    Science.gov (United States)

    Cleereman, Robert J; Lesniak, Michael J; Keenihan, James R; Langmaid, Joe A; Gaston, Ryan; Eurich, Gerald K; Boven, Michelle L

    2015-01-27

    The present invention is premised upon an improved photovoltaic device ("PVD") and method of use, more particularly to an improved photovoltaic device with an integral locator and electrical terminal mechanism for transferring current to or from the improved photovoltaic device and the use as a system.

  12. Methods for Risk Analysis

    International Nuclear Information System (INIS)

    Alverbro, Karin

    2010-01-01

    Many decision-making situations today affect humans and the environment. In practice, many such decisions are made without an overall view and prioritise one or other of the two areas. Now and then these two areas of regulation come into conflict, e.g. the best alternative as regards environmental considerations is not always the best from a human safety perspective and vice versa. This report was prepared within a major project with the aim of developing a framework in which both the environmental aspects and the human safety aspects are integrated, and decisions can be made taking both fields into consideration. The safety risks have to be analysed in order to be successfully avoided and one way of doing this is to use different kinds of risk analysis methods. There is an abundance of existing methods to choose from and new methods are constantly being developed. This report describes some of the risk analysis methods currently available for analysing safety and examines the relationships between them. The focus here is mainly on human safety aspects

  13. HEV and cirrhosis: methods

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. HEV and cirrhosis: methods. Study group. Patients with cirrhosis and recent jaundice for <30 d. Controls. Patients with liver cirrhosis but no recent worsening. Exclusions. Significant alcohol consumption. Recent hepatotoxic drugs. Recent antiviral therapy. Recent ...

  14. Method of killing microorganisms

    International Nuclear Information System (INIS)

    Tensmeyer, L.G.

    1980-01-01

    A method of sterilizing the contents of containers involves exposure to a plasma induced therein by focusing a high-power laser beam in an electromagnetic field preferably for a period of from 1.0 millisec to 1.0 secs. (U.K.)

  15. Method of signal analysis

    International Nuclear Information System (INIS)

    Berthomier, Charles

    1975-01-01

    A method capable of handling the amplitude and the frequency time laws of a certain kind of geophysical signals is described here. This method is based upon the analytical signal idea of Gabor and Ville, which is constructed either in the time domain by adding an imaginary part to the real signal (in-quadrature signal), or in the frequency domain by suppressing negative frequency components. The instantaneous frequency of the initial signal is then defined as the time derivative of the phase of the analytical signal, and his amplitude, or envelope, as the modulus of this complex signal. The method is applied to three types of magnetospheric signals: chorus, whistlers and pearls. The results obtained by analog and numerical calculations are compared to results obtained by classical systems using filters, i.e. based upon a different definition of the concept of frequency. The precision with which the frequency-time laws are determined leads then to the examination of the principle of the method and to a definition of instantaneous power density spectrum attached to the signal, and to the first consequences of this definition. In this way, a two-dimensional representation of the signal is introduced which is less deformed by the analysis system properties than the usual representation, and which moreover has the advantage of being obtainable practically in real time [fr

  16. TRAC methods and models

    International Nuclear Information System (INIS)

    Mahaffy, J.H.; Liles, D.R.; Bott, T.F.

    1981-01-01

    The numerical methods and physical models used in the Transient Reactor Analysis Code (TRAC) versions PD2 and PF1 are discussed. Particular emphasis is placed on TRAC-PF1, the version specifically designed to analyze small-break loss-of-coolant accidents

  17. The Prescribed Velocity Method

    DEFF Research Database (Denmark)

    Nielsen, Peter Vilhelm

    The- velocity level in a room ventilated by jet ventilation is strongly influenced by the supply conditions. The momentum flow in the supply jets controls the air movement in the room and, therefore, it is very important that the inlet conditions and the numerical method can generate a satisfactory...

  18. Immunocytochemical methods and protocols

    National Research Council Canada - National Science Library

    Javois, Lorette C

    1999-01-01

    ... monoclonal antibodies to study cell differentiation during embryonic development. For a select few disciplines volumes have been published focusing on the specific application of immunocytochemical techniques to that discipline. What distinguished Immunocytochemical Methods and Protocols from earlier books when it was first published four years ago was i...

  19. Adhesive compositions and methods

    Science.gov (United States)

    Allen, Scott D.; Sendijarevic, Vahid; O'Connor, James

    2017-12-05

    The present invention encompasses polyurethane adhesive compositions comprising aliphatic polycarbonate chains. In one aspect, the present invention encompasses polyurethane adhesives derived from aliphatic polycarbonate polyols and polyisocyanates wherein the polyol chains contain a primary repeating unit having a structure:. In another aspect, the invention provides articles comprising the inventive polyurethane compositions as well as methods of making such compositions.

  20. Ferrari's Method and Technology

    Science.gov (United States)

    Althoen, Steve

    2005-01-01

    Some tips that combine knowledge of mathematics history and technology for adapting Ferrar's method to factor quintics with a TI-83 graphing calculator are presented. A demonstration on the use of the root finder and regression capabilities of the graphing calculator are presented, so that the tips can be easily adapted for any graphing calculator…

  1. Truth and Methods.

    Science.gov (United States)

    Dasenbrock, Reed Way

    1995-01-01

    Examines literary theory's displacing of "method" in the New Historicist criticism. Argues that Stephen Greenblatt and Lee Paterson imply that no objective historical truth is possible and as a result do not give methodology its due weight in their criticism. Questions the theory of "truth" advanced in this vein of literary…

  2. Sparse Classification - Methods & Applications

    DEFF Research Database (Denmark)

    Einarsson, Gudmundur

    for analysing such data carry the potential to revolutionize tasks such as medical diagnostics where often decisions need to be based on only a few high-dimensional observations. This explosion in data dimensionality has sparked the development of novel statistical methods. In contrast, classical statistics...

  3. Method of complex scaling

    International Nuclear Information System (INIS)

    Braendas, E.

    1986-01-01

    The method of complex scaling is taken to include bound states, resonances, remaining scattering background and interference. Particular points of the general complex coordinate formulation are presented. It is shown that care must be exercised to avoid paradoxical situations resulting from inadequate definitions of operator domains. A new resonance localization theorem is presented

  4. Alternative methods in criticality

    International Nuclear Information System (INIS)

    Pedicini, J.M.

    1982-01-01

    In this thesis two new methods of calculating the criticality of a nuclear system are introduced and verified. Most methods of determining the criticality of a nuclear system depend implicitly upon knowledge of the angular flux, net currents, or moments of the angular flux, on the system surface in order to know the leakage. For small systems, leakage is the predominant element in criticality calculations. Unfortunately, in these methods the least accurate fluxes, currents, or moments are those occurring near system surfaces or interfaces. This is due to a mathematical inability to satisfy rigorously with a finite order angular polynomial expansion or angular difference technique the physical boundary conditions which occur on these surfaces. Consequently, one must accept large computational effort or less precise criticality calculations. The methods introduced in this thesis, including a direct leakage operator and an indirect multiple scattering leakage operator, obviate the need to know angular fluxes accurately at system boundaries. Instead, the system wide scalar flux, an integral quantity which is substantially easier to obtain with good precision is sufficient to obtain production, absorption, scattering, and leakage rates

  5. Materials and Methods

    African Journals Online (AJOL)

    David Norris

    genetic variance and its distribution in the population structure can lead to the design of optimum ... Recent developments in statistical methods and computing algorithms ..... This may be an indication of the general effect of the population structure. .... Presentation at the 40th anniversary, Institute of Genetics and Animal.

  6. Biomass treatment method

    Science.gov (United States)

    Friend, Julie; Elander, Richard T.; Tucker, III; Melvin P.; Lyons, Robert C.

    2010-10-26

    A method for treating biomass was developed that uses an apparatus which moves a biomass and dilute aqueous ammonia mixture through reaction chambers without compaction. The apparatus moves the biomass using a non-compressing piston. The resulting treated biomass is saccharified to produce fermentable sugars.

  7. Embodied Design Ideation methods

    DEFF Research Database (Denmark)

    Wilde, Danielle; Vallgårda, Anna; Tomico, Oscar

    2017-01-01

    Embodied design ideation practices work with relationships between body, material and context to enliven design and research potential. Methods are often idiosyncratic and – due to their physical nature – not easily transferred. This presents challenges for designers wishing to develop and share ...

  8. gel template method

    Indian Academy of Sciences (India)

    TiO2 nanotubes have been synthesized by sol–gel template method using alumina membrane. Scanning electron microscopy (SEM), transmission electron microscopy (TEM), Raman spectroscopy, UV absorption spectrum and X-ray diffraction techniques have been used to investigate the structure, morphology and optical ...

  9. Audience Methods and Gratifications.

    Science.gov (United States)

    Lull, James

    A model of need gratification inspired by the work of K.E. Rosengren suggests a theoretical framework making it possible to identify, measure, and assess the components of the need gratification process with respect to the mass media. Methods having cognitive and behavioral components are designed by individuals to achieve need gratification. Deep…

  10. Method for forming ammonia

    Science.gov (United States)

    Kong, Peter C.; Pink, Robert J.; Zuck, Larry D.

    2008-08-19

    A method for forming ammonia is disclosed and which includes the steps of forming a plasma; providing a source of metal particles, and supplying the metal particles to the plasma to form metal nitride particles; and providing a substance, and reacting the metal nitride particles with the substance to produce ammonia, and an oxide byproduct.

  11. Fashion, Mediations & Method Assemblages

    DEFF Research Database (Denmark)

    Sommerlund, Julie; Jespersen, Astrid Pernille

    of handling multiple, fluid realities with multiple, fluid methods. Empirically, the paper works with mediation in fashion - that is efforts the active shaping of relations between producer and consumer through communication, marketing and PR. Fashion mediation is by no means simple, but organise complex...

  12. Universal Image Steganalytic Method

    Directory of Open Access Journals (Sweden)

    V. Banoci

    2014-12-01

    Full Text Available In the paper we introduce a new universal steganalytic method in JPEG file format that is detecting well-known and also newly developed steganographic methods. The steganalytic model is trained by MHF-DZ steganographic algorithm previously designed by the same authors. The calibration technique with the Feature Based Steganalysis (FBS was employed in order to identify statistical changes caused by embedding a secret data into original image. The steganalyzer concept utilizes Support Vector Machine (SVM classification for training a model that is later used by the same steganalyzer in order to identify between a clean (cover and steganographic image. The aim of the paper was to analyze the variety in accuracy of detection results (ACR while detecting testing steganographic algorithms as F5, Outguess, Model Based Steganography without deblocking, JP Hide and Seek which represent the generally used steganographic tools. The comparison of four feature vectors with different lengths FBS (22, FBS (66 FBS(274 and FBS(285 shows promising results of proposed universal steganalytic method comparing to binary methods.

  13. Ergonomics research methods

    Science.gov (United States)

    Uspenskiy, S. I.; Yermakova, S. V.; Chaynova, L. D.; Mitkin, A. A.; Gushcheva, T. M.; Strelkov, Y. K.; Tsvetkova, N. F.

    1973-01-01

    Various factors used in ergonomic research are given. They are: (1) anthrometric measurement, (2) polyeffector method of assessing the functional state of man, (3) galvanic skin reaction, (4) pneumography, (5) electromyography, (6) electrooculography, and (7) tachestoscopy. A brief summary is given of each factor and includes instrumentation and results.

  14. Research Methods in Sociolinguistics

    Science.gov (United States)

    Hernández-Campoy, Juan Manuel

    2014-01-01

    The development of Sociolinguistics has been qualitatively and quantitatively outstanding within Linguistic Science since its beginning in the 1950s, with a steady growth in both theoretical and methodological developments as well as in its interdisciplinary directions within the spectrum of language and society. Field methods in sociolinguistic…

  15. Kriging : Methods and Applications

    NARCIS (Netherlands)

    Kleijnen, J.P.C.

    2017-01-01

    In this chapter we present Kriging— also known as a Gaussian process (GP) model— which is a mathematical interpolation method. To select the input combinations to be simulated, we use Latin hypercube sampling (LHS); we allow uniform and non-uniform distributions of the simulation inputs. Besides

  16. Sampling system and method

    Science.gov (United States)

    Decker, David L.; Lyles, Brad F.; Purcell, Richard G.; Hershey, Ronald Lee

    2013-04-16

    The present disclosure provides an apparatus and method for coupling conduit segments together. A first pump obtains a sample and transmits it through a first conduit to a reservoir accessible by a second pump. The second pump further conducts the sample from the reservoir through a second conduit.

  17. Six Sigma method

    NARCIS (Netherlands)

    Does, R.J.M.M.; de Mast, J.; Balakrishnan, N.; Brandimarte, P.; Everitt, B.; Molenberghs, G.; Piegorsch, W.; Ruggeri, F.

    2015-01-01

    Six Sigma is built on principles and methods that have proven themselves over the twentieth century. It has incorporated the most effective approaches and integrated them into a full program. It offers a management structure for organizing continuous improvement of routine tasks, such as

  18. Modern Reduction Methods

    CERN Document Server

    Andersson, Pher G

    2008-01-01

    With its comprehensive overview of modern reduction methods, this book features high quality contributions allowing readers to find reliable solutions quickly and easily. The monograph treats the reduction of carbonyles, alkenes, imines and alkynes, as well as reductive aminations and cross and heck couplings, before finishing off with sections on kinetic resolutions and hydrogenolysis. An indispensable lab companion for every chemist.

  19. Methods of information processing

    Energy Technology Data Exchange (ETDEWEB)

    Kosarev, Yu G; Gusev, V D

    1978-01-01

    Works are presented on automation systems for editing and publishing operations by methods of processing symbol information and information contained in training selection (ranking of objectives by promise, classification algorithm of tones and noise). The book will be of interest to specialists in the automation of processing textural information, programming, and pattern recognition.

  20. Dual completion method

    Energy Technology Data Exchange (ETDEWEB)

    Mamedov, N Ya; Kadymova, K S; Dzhafarov, Sh T

    1963-10-28

    One type of dual completion method utilizes a single tubing string. Through the use of the proper tubing equipment, the fluid from the low-productive upper formation is lifted by utilizing the surplus energy of a submerged pump, which handles the production from the lower stratum.

  1. Methods Evolved by Observation

    Science.gov (United States)

    Montessori, Maria

    2016-01-01

    Montessori's idea of the child's nature and the teacher's perceptiveness begins with amazing simplicity, and when she speaks of "methods evolved," she is unveiling a methodological system for observation. She begins with the early childhood explosion into writing, which is a familiar child phenomenon that Montessori has written about…

  2. Alternative methods in criticality

    International Nuclear Information System (INIS)

    Pedicini, J.M.

    1982-01-01

    Two new methods of calculating the criticality of a nuclear system are introduced and verified. Most methods of determining the criticality of a nuclear system depend implicitly upon knowledge of the angular flux, net currents, or moments of the angular flux, on the system surface in order to know the leakage. For small systems, leakage is the predominant element in criticality calculations. Unfortunately, in these methods the least accurate fluxes, currents, or moments are those occuring near system surfaces or interfaces. This is due to a mathematical inability to satisfy rigorously with a finite order angular polynomial expansion or angular difference technique the physical boundary conditions which occur on these surfaces. Consequently, one must accept large computational effort or less precise criticality calculations. The methods introduced in this thesis, including a direct leakage operator and an indirect multiple scattering leakage operator, obviate the need to know angular fluxes accurately at system boundaries. Instead, the system wide scalar flux, an integral quantity which is substantially easier to obtain with good precision, is sufficient to obtain production, absorption, scattering, and leakage rates

  3. WATER CHEMISTRY ASSESSMENT METHODS

    Science.gov (United States)

    This section summarizes and evaluates the surfce water column chemistry assessment methods for USEPA/EMAP-SW, USGS-NAQA, USEPA-RBP, Oho EPA, and MDNR-MBSS. The basic objective of surface water column chemistry assessment is to characterize surface water quality by measuring a sui...

  4. Analysis of numerical methods

    CERN Document Server

    Isaacson, Eugene

    1994-01-01

    This excellent text for advanced undergraduates and graduate students covers norms, numerical solution of linear systems and matrix factoring, iterative solutions of nonlinear equations, eigenvalues and eigenvectors, polynomial approximation, and other topics. It offers a careful analysis and stresses techniques for developing new methods, plus many examples and problems. 1966 edition.

  5. Die singulation method

    Science.gov (United States)

    Swiler, Thomas P.; Garcia, Ernest J.; Francis, Kathryn M.

    2013-06-11

    A method is disclosed for singulating die from a semiconductor substrate (e.g. a semiconductor-on-insulator substrate or a bulk silicon substrate) containing an oxide layer (e.g. silicon dioxide or a silicate glass) and one or more semiconductor layers (e.g. monocrystalline or polycrystalline silicon) located above the oxide layer. The method etches trenches through the substrate and through each semiconductor layer about the die being singulated, with the trenches being offset from each other around at least a part of the die so that the oxide layer between the trenches holds the substrate and die together. The trenches can be anisotropically etched using a Deep Reactive Ion Etching (DRIE) process. After the trenches are etched, the oxide layer between the trenches can be etched away with an HF etchant to singulate the die. A release fixture can be located near one side of the substrate to receive the singulated die.

  6. Epitope prediction methods

    DEFF Research Database (Denmark)

    Karosiene, Edita

    Analysis. The chapter provides detailed explanations on how to use different methods for T cell epitope discovery research, explaining how input should be given as well as how to interpret the output. In the last chapter, I present the results of a bioinformatics analysis of epitopes from the yellow fever...... peptide-MHC interactions. Furthermore, using yellow fever virus epitopes, we demonstrated the power of the %Rank score when compared with the binding affinity score of MHC prediction methods, suggesting that this score should be considered to be used for selecting potential T cell epitopes. In summary...... immune responses. Therefore, it is of great importance to be able to identify peptides that bind to MHC molecules, in order to understand the nature of immune responses and discover T cell epitopes useful for designing new vaccines and immunotherapies. MHC molecules in humans, referred to as human...

  7. Methods for forming particles

    Science.gov (United States)

    Fox, Robert V.; Zhang, Fengyan; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin

    2016-06-21

    Single source precursors or pre-copolymers of single source precursors are subjected to microwave radiation to form particles of a I-III-VI.sub.2 material. Such particles may be formed in a wurtzite phase and may be converted to a chalcopyrite phase by, for example, exposure to heat. The particles in the wurtzite phase may have a substantially hexagonal shape that enables stacking into ordered layers. The particles in the wurtzite phase may be mixed with particles in the chalcopyrite phase (i.e., chalcopyrite nanoparticles) that may fill voids within the ordered layers of the particles in the wurtzite phase thus produce films with good coverage. In some embodiments, the methods are used to form layers of semiconductor materials comprising a I-III-VI.sub.2 material. Devices such as, for example, thin-film solar cells may be fabricated using such methods.

  8. Motor degradation prediction methods

    Energy Technology Data Exchange (ETDEWEB)

    Arnold, J.R.; Kelly, J.F.; Delzingaro, M.J.

    1996-12-01

    Motor Operated Valve (MOV) squirrel cage AC motor rotors are susceptible to degradation under certain conditions. Premature failure can result due to high humidity/temperature environments, high running load conditions, extended periods at locked rotor conditions (i.e. > 15 seconds) or exceeding the motor`s duty cycle by frequent starts or multiple valve stroking. Exposure to high heat and moisture due to packing leaks, pressure seal ring leakage or other causes can significantly accelerate the degradation. ComEd and Liberty Technologies have worked together to provide and validate a non-intrusive method using motor power diagnostics to evaluate MOV rotor condition and predict failure. These techniques have provided a quick, low radiation dose method to evaluate inaccessible motors, identify degradation and allow scheduled replacement of motors prior to catastrophic failures.

  9. The random projection method

    CERN Document Server

    Vempala, Santosh S

    2005-01-01

    Random projection is a simple geometric technique for reducing the dimensionality of a set of points in Euclidean space while preserving pairwise distances approximately. The technique plays a key role in several breakthrough developments in the field of algorithms. In other cases, it provides elegant alternative proofs. The book begins with an elementary description of the technique and its basic properties. Then it develops the method in the context of applications, which are divided into three groups. The first group consists of combinatorial optimization problems such as maxcut, graph coloring, minimum multicut, graph bandwidth and VLSI layout. Presented in this context is the theory of Euclidean embeddings of graphs. The next group is machine learning problems, specifically, learning intersections of halfspaces and learning large margin hypotheses. The projection method is further refined for the latter application. The last set consists of problems inspired by information retrieval, namely, nearest neig...

  10. Grid generation methods

    CERN Document Server

    Liseikin, Vladimir D

    2010-01-01

    This book is an introduction to structured and unstructured grid methods in scientific computing, addressing graduate students, scientists as well as practitioners. Basic local and integral grid quality measures are formulated and new approaches to mesh generation are reviewed. In addition to the content of the successful first edition, a more detailed and practice oriented description of monitor metrics in Beltrami and diffusion equations is given for generating adaptive numerical grids. Also, new techniques developed by the author are presented, in particular a technique based on the inverted form of Beltrami’s partial differential equations with respect to control metrics. This technique allows the generation of adaptive grids for a wide variety of computational physics problems, including grid clustering to given function values and gradients, grid alignment with given vector fields, and combinations thereof. Applications of geometric methods to the analysis of numerical grid behavior as well as grid ge...

  11. Cross-impact method

    Directory of Open Access Journals (Sweden)

    Suzić Nenad

    2014-01-01

    Full Text Available The paper displays the application of the Cross-Impact method in pedagogy, namely a methodological approach which crosses variables in a novel, but statistically justified manner. The method is an innovation in pedagogy as well as in research methodology of social and psychological phenomena. Specifically, events and processes are crossed, that is, experts' predictions of about future interaction of events and processes. Therefore, this methodology is futuristic; it concerns predicting future, which is of key importance for pedagogic objectives. The paper presents two instances of the cross-impact approach: the longer, displayed in fourteen steps, and the shorter, in four steps. They are both accompanied with mathematic and statistical formulae allowing for quantification, that is, a numerical expression of the probability of a certain event happening in the future. The advantage of this approach is that it facilitates planning in education which so far has been solely based on lay estimates and assumptions.

  12. Method through motion

    DEFF Research Database (Denmark)

    Steijn, Arthur

    2016-01-01

    Contemporary scenography often consists of video-projected motion graphics. The field is lacking in academic methods and rigour: descriptions and models relevant for the creation as well as in the analysis of existing works. In order to understand the phenomenon of motion graphics in a scenographic...... construction as a support to working systematically practice-led research project. The design model is being developed through design laboratories and workshops with students and professionals who provide feedback that lead to incremental improvements. Working with this model construction-as-method reveals...... context, I have been conducting a practice-led research project. Central to the project is construction of a design model describing sets of procedures, concepts and terminology relevant for design and studies of motion graphics in spatial contexts. The focus of this paper is the role of model...

  13. Semiconductor testing method

    International Nuclear Information System (INIS)

    Brown, Stephen.

    1992-01-01

    In a method of avoiding use of nuclear radiation, eg gamma rays, X-rays, electron beams, for testing semiconductor components for resistance to hard radiation, which hard radiation causes data corruption in some memory devices and 'latch-up' in others, similar fault effects can be achieved using a xenon or other 'light' flash gun even though the penetration of light is significantly less than that of gamma rays. The method involves treating a device with gamma radiation, measuring a particular fault current at the onset of a fault event, repeating the test with light to confirm the occurrence of the fault event at the same measured fault current, and using the fault current value as a reference for future tests using light on similar devices. (author)

  14. Quaternary dating methods

    International Nuclear Information System (INIS)

    Mahaney, W.C.

    1984-01-01

    The papers in this book cover absolute, relative and multiple dating methods, and have been written by specialists from a number of different earth sciences disciplines - their common interest being the dating of geological materials within the Quaternary. Papers on absolute dating methods discuss radiocarbon, uranium-series, potassium argon, 40 Ar/ 39 Ar, paleomagnetic, obsidian hydration, thermoluminescence, amino acid racemization, tree rings, and lichenometric techniques. Those on relative dating include discussions on various geomorphic relative age indicators such as drainage density changes, hypsometric integrals, bifurcation ratios, stream junction angles, spur morphology, hillslope geometry, and till sheet characteristics. The papers on multiple dating cite examples from the Rocky Mountains, Australia, Lake Agassiz Basin, and the Southern Andes. Also included is the panel discussion which reviews and assesses the information presented, and a field trip guide which discusses the sequences of Wisconian tills and interlayered lacustrine and fluvial sediments. (orig.)

  15. method with pseudopotentials

    International Nuclear Information System (INIS)

    Szasz, L.

    1980-01-01

    The Xα method for an atom or molecule is transformed into an all-electron pseudopotential formalism. The equations of the Xα method are exactly transformed into pseudo-orbital equations and the resulting pseudopotentials are replaced by simple density-dependent potentials derived from Thomas-Fermi model. It is shown that the new formalism satisfies the virial theorem. As the first application it is shown that the model explains the shell-structure of atoms by the property that the pseudo-orbitals for the (ns), (np), (nd) etc. electrons are, in a very good approximation, the solutions of the same equation and have their maxima at the same point thereby creating the peaks in the radial density characterizing the shell structure. (orig.)

  16. Developments in Surrogating Methods

    Directory of Open Access Journals (Sweden)

    Hans van Dormolen

    2005-11-01

    Full Text Available In this paper, I would like to talk about the developments in surrogating methods for preservation. My main focus will be on the technical aspects of preservation surrogates. This means that I will tell you something about my job as Quality Manager Microfilming for the Netherlands’ national preservation program, Metamorfoze, which is coordinated by the National Library. I am responsible for the quality of the preservation microfilms, which are produced for Metamorfoze. Firstly, I will elaborate on developments in preservation methods in relation to the following subjects: · Preservation microfilms · Scanning of preservation microfilms · Preservation scanning · Computer Output Microfilm. In the closing paragraphs of this paper, I would like to tell you something about the methylene blue test. This is an important test for long-term storage of preservation microfilms. Also, I will give you a brief report on the Cellulose Acetate Microfilm Conference that was held in the British Library in London, May 2005.

  17. Motor degradation prediction methods

    International Nuclear Information System (INIS)

    Arnold, J.R.; Kelly, J.F.; Delzingaro, M.J.

    1996-01-01

    Motor Operated Valve (MOV) squirrel cage AC motor rotors are susceptible to degradation under certain conditions. Premature failure can result due to high humidity/temperature environments, high running load conditions, extended periods at locked rotor conditions (i.e. > 15 seconds) or exceeding the motor's duty cycle by frequent starts or multiple valve stroking. Exposure to high heat and moisture due to packing leaks, pressure seal ring leakage or other causes can significantly accelerate the degradation. ComEd and Liberty Technologies have worked together to provide and validate a non-intrusive method using motor power diagnostics to evaluate MOV rotor condition and predict failure. These techniques have provided a quick, low radiation dose method to evaluate inaccessible motors, identify degradation and allow scheduled replacement of motors prior to catastrophic failures

  18. Thermoluminescence dating method

    International Nuclear Information System (INIS)

    Zink, A.

    2004-01-01

    A crystal that is submitted to radiation stores energy and releases this energy under the form of light whenever it is heated. These 2 properties: the ability to store energy and the ability to reset the energy stored are the pillars on which time dating methods like thermoluminescence are based. A typical accuracy of the thermoluminescence method is between 5 to 7% but an accuracy of 3% can be reached with a sufficient number of measurement. This article describes the application of thermoluminescence to the dating of a series of old terra-cotta statues. This time measurement is absolute and does not require any calibration, it represents the time elapsed since the last heating of the artifact. (A.C.)

  19. Method of reducing zirconium

    International Nuclear Information System (INIS)

    Megy, J.A.

    1980-01-01

    A method was developed for making nuclear-grade zirconium from a zirconium compound, which ismore economical than previous methods since it uses aluminum as the reductant metal rather than the more expensive magnesium. A fused salt phase containing the zirconium compound to be reduced is first prepared. The fused salt phase is then contacted with a molten metal phase which contains aluminum and zinc. The reduction is effected by mutual displacment. Aluminum is transported from the molten metal phase to the fused salt phase, replacing zirconium in the salt. Zirconium is transported from the fused salt phase to the molten metal phase. The fused salt phase and the molten metal phase are then separated, and the solvent metal and zirconium are separated by distillation or other means. (DN)

  20. INNOVATIVE SALES METHODS

    Directory of Open Access Journals (Sweden)

    Roxana L. IONESCU

    2014-06-01

    Full Text Available Companies operating in a global economy that is constantly changing and developming, especially during the financial crisis and political instability. It is necessary to adapt and develop sales methods in such environment. For large companies who base their activity on sales it has become a necessity to learn different types of sales approaches because their knowledge enables them to grow the number of customers and therefore the sales and the turnover. This paper aims to exame the most effective sales methods used on the highly sensitive economic and social environment – the insurance market. In the field of insurances, the sales process is even more important because sellers need to sell an intangible product that may materialize in the future, but there is no certainty.

  1. in the DSMC Method

    Directory of Open Access Journals (Sweden)

    Fong-Zhi Chen

    2001-01-01

    Full Text Available In this study, the Plücker coordinates representation is used to formulate the ruled surface and the molecular path for pumping speed performance evaluation of a molecular vacuum pump. The ruled surface represented by the Pliicker coordinates is used to develop a criterion for when gas molecules hit the pump surface wall. The criterion is applied to analyze the flow rate of a new developed vacuum pump in transition regimes by using the DSMC (Direct Simulation Monte Carlo method. When a molecule flies in a neutral electrical field its path is a straight line. If the molecular path and the generators of a ruled surface are both represented by the Pliicker coordinates, the position of the molecular hit on the wall can be verified by the reciprocal condition of the lines. The Plücker coordinates representation is quite convenient in the DSMC method for this three-dimensional molecular flow simulation.

  2. Method card design dimensions

    DEFF Research Database (Denmark)

    Wölfel, Christiane; Merritt, T.

    2013-01-01

    There are many examples of cards used to assist or provide structure to the design process, yet there has not been a thorough articulation of the strengths and weaknesses of the various examples. We review eighteen card-based design tools in order to understand how they might benefit designers....... The card-based tools are explained in terms of five design dimensions including the intended purpose and scope of use, duration of use, methodology, customization, and formal/material qualities. Our analysis suggests three design patterns or archetypes for existing card-based design method tools...... and highlights unexplored areas in the design space. The paper concludes with recommendations for the future development of card-based methods for the field of interaction design....

  3. Ion sensing method

    Science.gov (United States)

    Smith, Richard Harding; Martin, Glenn Brian

    2004-05-18

    The present invention allows the determination of trace levels of ionic substances in a sample solution (ions, metal ions, and other electrically charged molecules) by coupling a separation method, such as liquid chromatography, with ion selective electrodes (ISE) prepared so as to allow detection at activities below 10.sup.-6 M. The separation method distributes constituent molecules into fractions due to unique chemical and physical properties, such as charge, hydrophobicity, specific binding interactions, or movement in an electrical field. The separated fractions are detected by means of the ISE(s). These ISEs can be used singly or in an array. Accordingly, modifications in the ISEs are used to permit detection of low activities, specifically, below 10.sup.-6 M, by using low activities of the primary analyte (the molecular species which is specifically detected) in the inner filling solution of the ISE. Arrays constructed in various ways allow flow-through sensing for multiple ions.

  4. Laser device and method

    International Nuclear Information System (INIS)

    Myers, J.D.

    1986-01-01

    A method is described of treatment of opacity of the lens of an eye resulting from foreign matter at the back surface of the eye lens within the vitreous fluid body of the eye with a passively Q-switched laser device. The method consists of: (a) generating a single lasing pulse emitted from the laser device focused within the eye vitreous fluid body, spaced from the lens back surface, creating a microplasma dot in the vitreous fluid body (b) then increasing the frequency of the lasing pulses emitted from the lasing device having a frequency greater than the life of the microplasma to generate an elongated lasing plasma within the eye vitreous fluid moving toward the lens back surface, until the elongated lasing plasma contacts and destroys the foreign matter

  5. Dislocation-dynamics method

    International Nuclear Information System (INIS)

    Van Brutzel, L.

    2015-01-01

    Dislocation-Dynamics (DD) technique is identified as the method able to model the evolution of material plastic properties as a function of the microstructural transformation predicted at the atomic scale. Indeed, it is the only simulation method capable of taking into account the collective behaviour of a large number of dislocations inside a realistic microstructure. DD simulations are based on the elastic dislocation theory following rules inherent to the dislocation core structure often call 'local rules'. All the data necessary to establish the local rules for DD have to come directly from experiment or alternatively from simulations carried out at the atomic scale such as molecular dynamics or ab initio calculations. However, no precise information on the interaction between two dislocations or between dislocations and defects induced by irradiation are available for nuclear fuels. Therefore, in this article the DD technique will be presented and some examples are given of what can be achieved with it. (author)

  6. The Montessori Method

    Directory of Open Access Journals (Sweden)

    Cathleen HASKINS

    2010-12-01

    Full Text Available Dr. Maria Montessori provided the world with a powerful philosophy and practice for the advancement of humanity: change how we educate children and we change the world. She understood two things very clearly: One, that we can build a better world, a more just and peaceful place, when we educate for the realization of the individual and collective human potential; and two, that the only way to create an educational system that will that will serve this end is to scrap the current system entirely and replace it with a completely new system. She gave us a system through which to accomplish that goal: The Montessori Method. The following is a personal and professional account of the Montessori Method of educating children.

  7. Stereoscopic methods in TEM

    International Nuclear Information System (INIS)

    Thomas, L.E.

    1975-07-01

    Stereoscopic methods used in TEM are reviewed. The use of stereoscopy to characterize three-dimensional structures observed by TEM has become widespread since the introduction of instruments operating at 1 MV. In its emphasis on whole structures and thick specimens this approach differs significantly from conventional methods of microstructural analysis based on three-dimensional image reconstruction from a number of thin-section views. The great advantage of stereo derives from the ability to directly perceive and measure structures in three-dimensions by capitalizing on the unsurpassed human ability for stereoscopic matching of corresponding details on picture pairs showing the same features from different viewpoints. At this time, stereo methods are aimed mainly at structural understanding at the level of dislocations, precipitates, and irradiation-induced point-defect clusters in crystal and on the cellular irradiation-induced point-defect clusters in crystal and on the cellular level of biological specimens. 3-d reconstruction methods have concentrated on the molecular level where image resolution requirements dictate the use of very thin specimens. One recent application of three-dimensional coordinate measurements is a system developed for analyzing depth variations in the numbers, sizes and total volumes of voids produced near the surfaces of metal specimens during energetic ion bombardment. This system was used to correlate the void volumes at each depth along the ion range with the number of atomic displacements produced at that depth, thereby unfolding the entire swelling versus dose relationship from a single stereo view. A later version of this system incorporating computer-controlled stereo display capabilities is now being built

  8. Polymer compositions and methods

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Scott D.; Willkomm, Wayne R.

    2018-02-06

    The present invention encompasses polyurethane compositions comprising aliphatic polycarbonate chains. In one aspect, the present invention encompasses polyurethane foams, thermoplastics and elastomers derived from aliphatic polycarbonate polyols and polyisocyanates wherein the polyol chains contain a primary repeating unit having a structure: ##STR00001## In another aspect, the invention provides articles comprising the inventive foam and elastomer compositions as well as methods of making such compositions.

  9. Methods of celestial mechanics

    CERN Document Server

    Brouwer, Dirk

    2013-01-01

    Methods of Celestial Mechanics provides a comprehensive background of celestial mechanics for practical applications. Celestial mechanics is the branch of astronomy that is devoted to the motions of celestial bodies. This book is composed of 17 chapters, and begins with the concept of elliptic motion and its expansion. The subsequent chapters are devoted to other aspects of celestial mechanics, including gravity, numerical integration of orbit, stellar aberration, lunar theory, and celestial coordinates. Considerable chapters explore the principles and application of various mathematical metho

  10. Assessment methods for rehabilitation.

    Science.gov (United States)

    Biefang, S; Potthoff, P

    1995-09-01

    Diagnostics and evaluation in medical rehabilitation should be based on methods that are as objective as possible. In this context quantitative methods are an important precondition. We conducted for the German Pensions Insurance Institutions (which are in charge of the medical and vocational rehabilitation of workers and employees) a survey on assessment methods for rehabilitation which included an evaluation of American literature, with the aim to indicate procedures that can be considered for adaptation in Germany and to define further research requirements. The survey identified: (1) standardized procedures and instrumented tests for the assessment of musculoskeletal, cardiopulmonary and neurophysiological function; (2) personality, intelligence, achievement, neuropsychological and alcoholism screening tests for the assessment of mental or cognitive function; (3) rating scales and self-administered questionnaires for the assessment of Activities of Daily Living and Instrumental Activities of Daily Living (ADL/IADL Scales); (4) generic profiles and indexes as well as disease-specific measures for the assessment of health-related quality of life and health status; and (5) rating scales for vocational assessment. German equivalents or German versions exist only for a part of the procedures identified. Translation and testing of Anglo-Saxon procedures should have priority over the development of new German methods. The following procedures will be taken into account: (a) instrumented tests for physical function, (b) IADL Scales, (c) generic indexes of health-related quality of life, (d) specific quality of life and health status measures for disorders of the circulatory system, metabolic system, digestive organs, respiratory tract and for cancer, and (e) vocational rating scales.

  11. Method to liquefy coal

    Energy Technology Data Exchange (ETDEWEB)

    Cronauer, D.C.; Kehl, W.L.

    1977-06-08

    In a method to liquify coal in the presence of hydrogen and hydrogen-transfer solvents, a hydrogenation catalyst is used in which an amorphous aluminium phosphate is taken as catalyst carrier. The particular advantage of aluminium phosphate catalyst carriers is their property of not loosing their mechanical strength even after manifold oxidizing regeneration (burning off the deposited carbon). The quantity of carbon deposited on the catalyst when using an aluminium phosphate carrier is considerably loss than with usual catalyst carriers.

  12. Methods of risk assessment

    International Nuclear Information System (INIS)

    Jones, D.R.

    1981-01-01

    The subject is discussed under the headings: introduction (identification, quantification of risk); some approaches to risk evaluation (use of the 'no risk' principle; the 'acceptable risk' method; risk balancing; comparison of risks, benefits and other costs); cost benefit analysis; an alternative approach (tabulation and display; description and reduction of the data table); identification of potential decision sets consistent with the constraints. Some references are made to nuclear power. (U.K.)

  13. METHODS OF CONTENTS CURATOR

    Directory of Open Access Journals (Sweden)

    V. Kukharenko

    2013-03-01

    Full Text Available Content curated - a new activity (started in 2008 qualified network users with process large amounts of information to represent her social network users. To prepare content curators developed 7 weeks distance course, which examines the functions, methods and tools curator. Courses showed a significant relationship success learning on the availability of advanced personal learning environment and the ability to process and analyze information.

  14. AUDIT plan documenting method

    International Nuclear Information System (INIS)

    Cornecsu, M.

    1995-01-01

    The work describes a method of documenting the AUDIT plan upon the basis of two quantitative elements resulting from quality assurance program appraisal system function implementation degree as established from the latest AUDIT performed an system function weight in QAP, respectively, appraised by taking into account their significance for the activities that are to be performed in the period for which the AUDITs are planned. (Author) 3 Figs., 2 Refs

  15. Method for separating isotopes

    International Nuclear Information System (INIS)

    Jepson, B.E.

    1976-01-01

    The invention comprises a method for separating different isotopes of elements from each other by contacting a feed solution containing the different isotopes with a macrocyclic polyether to preferentially form a macrocyclic polyether complex with the lighter of the different isotopes. The macrocyclic polyether complex is then separated from the lighter isotope depleted feed solution. A chemical separation of isotopes is carried out in which a constant refluxing system permits a continuous countercurrent liquid-liquid extraction. (LL)

  16. Methods of Stegoanalysis

    Directory of Open Access Journals (Sweden)

    A. S. Borsch

    2010-03-01

    Full Text Available In this paper we consider two different approaches to the methods stegoanalysis applicable to common multimedia formats. The first approach uses the verification and the analysis of changes in the fields of media files that must remain constant throughout the bit stream of potential container file. The second approach is more complicated for implementation and involves collecting of information by means of many experiments.

  17. Situational Method Engineering

    OpenAIRE

    Henderson-Sellers, Brian; Ralyte, Jolita; Par, Agerfalk; Rossi, Matti

    2014-01-01

    While previously available methodologies for software – like those published in the early days of object technology – claimed to be appropriate for every conceivable project, situational method engineering (SME) acknowledges that most projects typically have individual characteristics and situations. Thus, finding the most effective methodology for a particular project needs specific tailoring to that situation. Such a tailored software development methodology needs to take into account all t...

  18. Situational method engineering

    CERN Document Server

    Henderson-Sellers, Brian; Ågerfalk, Pär J; Rossi, Matti

    2014-01-01

    While previously available methodologies for software ? like those published in the early days of object technology ? claimed to be appropriate for every conceivable project, situational method engineering (SME) acknowledges that most projects typically have individual characteristics and situations. Thus, finding the most effective methodology for a particular project needs specific tailoring to that situation. Such a tailored software development methodology needs to take into account all the bits and pieces needed for an organization to develop software, including the software process, the

  19. Method for scavenging mercury

    Science.gov (United States)

    Chang, Shih-ger [El Cerrito, CA; Liu, Shou-heng [Kaohsiung, TW; Liu, Zhao-rong [Beijing, CN; Yan, Naiqiang [Berkeley, CA

    2009-01-20

    Disclosed herein is a method for removing mercury from a gas stream comprising contacting the gas stream with a getter composition comprising bromine, bromochloride, sulphur bromide, sulphur dichloride or sulphur monochloride and mixtures thereof. In one preferred embodiment the getter composition is adsorbed onto a sorbent. The sorbent may be selected from the group consisting of flyash, limestone, lime, calcium sulphate, calcium sulfite, activated carbon, charcoal, silicate, alumina and mixtures thereof. Preferred is flyash, activated carbon and silica.

  20. Method for making nanomaterials

    Science.gov (United States)

    Fan, Hongyou; Wu, Huimeng

    2013-06-04

    A method of making a nanostructure by preparing a face centered cubic-ordered metal nanoparticle film from metal nanoparticles, such as gold and silver nanoparticles, exerting a hydrostatic pressure upon the film at pressures of several gigapascals, followed by applying a non-hydrostatic stress perpendicularly at a pressure greater than approximately 10 GPA to form an array of nanowires with individual nanowires having a relatively uniform length, average diameter and density.