John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
Did John B. Watson Really "Found" Behaviorism?
Malone, John C
2014-05-01
Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.
Rilling, M
2000-01-01
Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
The multiple personalities of Watson and Crick strands
Directory of Open Access Journals (Sweden)
Graur Dan
2011-02-01
Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.
A history of the term radical behaviorism: From Watson to Skinner
Schneider, Susan M.; Morris, Edward K.
1987-01-01
This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958
Weighted Watson-Crick automata
Energy Technology Data Exchange (ETDEWEB)
Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)
2014-07-10
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
Weighted Watson-Crick automata
International Nuclear Information System (INIS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-01-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power
Closure properties of Watson-Crick grammars
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
Data Discovery with IBM Watson
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
Distributional Watson transforms
Dijksma, A.; Snoo, H.S.V. de
1974-01-01
For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.
Multi-head Watson-Crick automata
Chatterjee, Kingshuk; Ray, Kumar Sankar
2015-01-01
Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.
Malone, John C; García-Penagos, Andrés
2014-07-25
Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
78 FR 43198 - Watson Cogeneration Company; Notice of Filing
2013-07-19
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...
Training IBM Watson using Automatically Generated Question-Answer Pairs
Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh
2016-01-01
IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...
Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje
Stojić, Igor
2016-01-01
Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
2006-01-01
Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...
Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities
Kidd, Gary R.
2004-05-01
Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
2013-03-20
... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
2013-10-25
... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...
Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory
International Nuclear Information System (INIS)
Geltman, S.
1996-01-01
Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society
On the scaling limits of Galton Watson processes in varying environment
Bansaye, V.; Simatos, F.
2011-01-01
Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition
Sommerfeld-Watson transformation for nuclear fission
International Nuclear Information System (INIS)
Alexandru, G.
1978-01-01
It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2005-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...
Graham Watson: Eesti vajab enam riigi sekkumist majandusse
Watson, Graham
2009-01-01
18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
Watson's theorem and resonant pion photoproduction amplitude in the delta channel
International Nuclear Information System (INIS)
Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.
1984-01-01
The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)
Watson's behaviorism: a comparison of the two editions (1925 and 1930).
Carpintero, Helio
2004-05-01
J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
A conversation with Geoff Watson
Beran, R. J.; Fisher, N. I.
1998-01-01
Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Elementary? Question Answering, IBM's Watson, and the Jeopardy ...
Indian Academy of Sciences (India)
IAS Admin
One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...
Relativistic generalisation of the Kroll-Watson formula
International Nuclear Information System (INIS)
Kaminski, J.Z.
1985-01-01
The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
International Nuclear Information System (INIS)
Fargher, H.E.; Roberts, M.J.
1983-01-01
Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)
Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and
International Nuclear Information System (INIS)
Catalan, G.; Roberts, M.J.
1979-01-01
A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)
O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante
Directory of Open Access Journals (Sweden)
Cláudio Ivan de Oliveira
Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.
A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3
International Nuclear Information System (INIS)
Roberts, M.J.
1988-01-01
Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)
The Game is aFoot, Watson: DeepQA systems and the future of HCI
Keates, Simeon; Varker, Philip
2012-01-01
In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...
Meijer, Rob R.
I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
Watson-Crick hydrogen bonding of unlocked nucleic acids
DEFF Research Database (Denmark)
Langkjær, Niels; Wengel, Jesper; Pasternak, Anna
2015-01-01
We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....
Watson, Skinner y Algunas Disputas dentro del Conductismo
Directory of Open Access Journals (Sweden)
RICARDO PELLÓN SUÁREZ DE PUGA
2013-01-01
Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-01-01
Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
Directory of Open Access Journals (Sweden)
Katy Shaw
2016-04-01
Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.
Watson: A new link in the IIE iron chain
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland
DEFF Research Database (Denmark)
Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.
2013-01-01
For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix
Impact parameter representation from the Watson-Sommerfeld transform
International Nuclear Information System (INIS)
Islam, M.M.
1976-01-01
Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)
Some Econometric Results for the Blanchard-Watson Bubble Model
DEFF Research Database (Denmark)
Johansen, Soren; Lange, Theis
The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist
Directory of Open Access Journals (Sweden)
Thaís Schossler
2008-01-01
Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.
Rao, B J; Radding, C M
1994-01-01
Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.
2006-01-01
Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues? In...
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-12-01
Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.
On the extension of the Fermi-Watson Theorem to high energy diffraction
International Nuclear Information System (INIS)
Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati
1995-12-01
The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
"Elementary, my dear Watson". Per una falsa citazione
Directory of Open Access Journals (Sweden)
Irene Minella
2014-12-01
Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-04-24
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that
2011-01-01
On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano. var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');
Building Watson: An Overview of the DeepQA Project
Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris
2010-01-01
IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
DEFF Research Database (Denmark)
Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent
2014-01-01
–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
AVE bond index in the H-bond of the Watson-Crick pairs
International Nuclear Information System (INIS)
Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.
1981-01-01
The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt
Eckert, Wallace John (1902-71)
Murdin, P.
2000-11-01
Computer scientist and astronomer. Born in Pittsburgh, PA, Eckert was a pioneer of the use of IBM punched card equipment for astronomical calculations. As director of the US Nautical Almanac Office he introduced computer methods to calculate and print tables instead of relying on human `computers'. When, later, he became director of the Watson Scientific Computing Laboratory at Columbia Universit...
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
Directory of Open Access Journals (Sweden)
Mei-Yu LEE
2014-11-01
Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson
The McLean-Watson line strength formula and its implementation
International Nuclear Information System (INIS)
Hey, J D
2009-01-01
We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the
Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season
Directory of Open Access Journals (Sweden)
Lina Affifatusholihah
2017-04-01
In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Directory of Open Access Journals (Sweden)
Luciane Favero
2009-01-01
Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
St. John Photo of Peter St. John Peter St. John Researcher III-Chemical Engineering Peter.StJohn @nrel.gov | 303-384-7969 Orcid ID http://orcid.org/0000-0002-7928-3722 Education Peter St. John received his engineering from the University of California at Santa Barbara in 2015. During his Ph.D., St. John applied
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
Kipnis, Victor; Midthune, Douglas; Buckman, Dennis W.; Dodd, Kevin W.; Guenther, Patricia M.; Krebs-Smith, Susan M.; Subar, Amy F.; Tooze, Janet A.; Carroll, Raymond J.; Freedman, Laurence S.
2009-01-01
Dietary assessment of episodically consumed foods gives rise to nonnegative data that have excess zeros and measurement error. Tooze et al. (2006, Journal of the American Dietetic Association 106, 1575-1587) describe a general statistical approach
Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia
Directory of Open Access Journals (Sweden)
Roberta Maria Savieto
2016-03-01
Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.
HISTORICAL NOTE JOHN HUNTER (SURGEON) John Hunter FRS ...
African Journals Online (AJOL)
JOHN HUNTER (SURGEON). John Hunter FRS (13 February 1728-16 October 1793) was a Scottish surgeon, one of the most distinguished scientists and surgeons of his day. He was an early advocate of careful observation and scientific method in medicine. He was the husband of Anne Hunter, a teacher, friend and ...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education. John Stachel. Articles written in Resonance – Journal of Science Education. Volume 3 Issue 8 August 1998 pp 76-92 Reflections. Albert Einstein-The Man Behind the Myths · John Stachel · More Details Fulltext PDF ...
Moore, J.
2011-01-01
Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Pittard, Julian M.
2015-03-01
John Dyson was born on the 7th January 1941 in Meltham Mills, West Yorkshire, England, and later grew up in Harrogate and Leeds. The proudest moment of John's early life was meeting Freddie Trueman, who became one of the greatest fast bowlers of English cricket. John used a state scholarship to study at Kings College London, after hearing a radio lecture by D. M. McKay. He received a first class BSc Special Honours Degree in Physics in 1962, and began a Ph.D. at the University of Manchester Department of Astronomy after being attracted to astronomy by an article of Zdenek Kopal in the semi-popular journal New Scientist. John soon started work with Franz Kahn, and studied the possibility that the broad emission lines seen from the Orion Nebula were due to flows driven by the photoevaporation of neutral globules embedded in a HII region. John's thesis was entitled ``The Age and Dynamics of the Orion Nebula`` and he passed his oral examination on 28th February 1966.
International Nuclear Information System (INIS)
Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.
2010-01-01
By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education. John P Craig. Articles written in Resonance – Journal of Science Education. Volume 17 Issue 10 October 2012 pp 924-925 Article-in-a-Box. S N De - An Appreciation · John P Craig · More Details Fulltext PDF ...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education. A John Wilson. Articles written in Resonance – Journal of Science Education. Volume 11 Issue 7 July 2006 pp 70-76 Classroom. Inverting Matrices Constructed from Roots of Unity · A John Wilson · More Details Fulltext PDF ...
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Foreword: Sir John Pendry FRS Sir John Pendry FRS
Inglesfield, John; Echenique, Pedro
2008-07-01
John Pendry John Inglesfield and Pedro Echenique write: John Pendry's 65th birthday is on 4 July 2008, and this issue of the Journal of Physics: Condensed Matter is dedicated to him, with articles by friends, colleagues, and former students. By any standards, John Pendry is a great scientist, who has made—and continues to make—an enormous contribution to physics; the wide range of his interests is reflected in the scope of these articles. Not many scientists can establish a completely new and unexpected area of research, but this has been John's achievement in the last few years in the field of metamaterials, materials whose electromagnetic properties depend on their structure rather than the materials of which the structure is built. In this way, structures with effectively negative electrical permittivity and negative magnetic permeability can be constructed, demonstrating negative refraction; through metamaterials scientists now have access to properties not found in nature, and never previously explored experimentally. Never a week goes by without a potential new application of metamaterials, whether it is perfect lensing, or the cloak of invisibility. This has certainly led to tremendous visibility for John himself, with guest lectures all over the world, and radio and television appearances. John Pendry's first paper was published exactly 40 years ago, 'Analytic properties of pseudopotentials' [1], and since then he has published 310 articles at the latest count. But this first paper already reflected something of the way John works. His PhD project, with Volker Heine at the Cavendish Laboratory, was to interpret the scattering of low energy electrons from surfaces, the technique of LEED which was to become the method of choice for determining surface structure. Although the energy of the electrons in LEED is relatively low—say 50 eV—it is much higher than the energy of the conduction electrons, for which pseudopotentials had been devised, and John
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
The herb St. John's Wort is believed to be helpful in relieving mild to moderate depression, but should only be taken under a physician's supervision. St. John's Wort may clash with other medications or ...
Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E
Czech Academy of Sciences Publication Activity Database
Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří
2003-01-01
Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Directory of Open Access Journals (Sweden)
Carme Ferré-Grau
2008-03-01
Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with
The Towers Watson Approach to Improving Corporate Wellness.
Wootton, Adam
2012-06-01
Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.
Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto
2016-01-01
In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...
Clopton, Robert W.
2015-01-01
The subject of the annual Presidential address of Phi Kappa Phi, presented on May 8, 1962, was John Dewey. Dewey is identified in the public mind chiefly as an educational philosopher. In this address, the author describes the life and work of John Dewey as an indefatigable student of life whose interests ranged, like those of Aristotle, over the…
77 FR 10604 - Qualification of Drivers; Exemption Applications; Vision
2012-02-22
... renewable two-year period. They are: William M. Arbogast (FL), Cris D. Bush (TN), John E. Cain (NM), Billy C.... Ferguson (VA), Randy M. Garcia (NM), John A. Graham (PA), Henry J. Gregoire, Jr. (MN), Jason L. Hoovan (UT.... Schneider (NM), James Vickery (KY), Norman J. Watson (NC), Lewis H. West, Jr. (MA), Billy R. Wilkey (TX...
Directory of Open Access Journals (Sweden)
Ingrid Meireles Gomes
2013-09-01
Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.
Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration
Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell
2018-01-01
Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.
Book in three volumes of dr. John Puricha: Theology and pedagogy of St. John Chrysostom
Directory of Open Access Journals (Sweden)
Parlić-Božović Jasna Lj.
2011-01-01
Full Text Available Before the is latest work of Bishop Dr John Puric, by its importance, analytically decorated works, an impressive and voluminous number of facts happy including pedagogical Serbian public. Specifically, our pedagogical public is missing in this way displayed the Orthodox point of view of observation pedagogical crown and top categories. Episkom John was the there / volume work attempted to provide the interested reader the personality profile of any precise data from the conception of St. John Crisostom by looking at the same time as its pedagogy, and theology. Moreover these two concepts and bringing them to their assence, John episcope them actually connects into one inseparable unity. Therefore, this work has a multiple value and importance esportance especially for educators, who have not tried or had the oppotunality to see and understand the pedagogy of Orthodox theology in general, decorated with the ideas of Saint John Chrysostom special. Mindfullpeace as heir and successor creative Cappadocia 'novonikejske' trijadologije, St. John Chrystom recognizes the statut of Divine pedagogy educational philanthropy and philanthropic saving of pedagogy in each of the three Divine Persons. God the Father is this part, written by Bishop John, and from the perspective of John Chrysostom, is uncreated and unborn educationak philanthropy source of grace of the Holy Trinity. God the Son, and of the Father, uncreated etrinilly born, only begotten Son of God, newborn Logos, Jesus Christ the God/ man, BewAdam is alive and saving, hypostatic Ikonomija God, great mystery of the faith- God is reported in the body, the Divine Krishna- resurrect pedagogy, in which the comic-eschatologiocal Body, Church of Heaven and Earth, The Secret New Substances contain - the salvation of all creation, all creatures animate and inanimate. The salvation of man and the world, in the Divine dispensation and the pedagogy of salvation invation involve all there persons of the Holy
DEFF Research Database (Denmark)
Raussen, Martin; Skau, Christian
2012-01-01
This interview was given by Professor John Milnor in connection to the Abel Prize 2011 ceremony. Originally the interview appeared in the September issue of the Newsletter of the European Mathematical Society......This interview was given by Professor John Milnor in connection to the Abel Prize 2011 ceremony. Originally the interview appeared in the September issue of the Newsletter of the European Mathematical Society...
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho
2018-04-01
Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Applications of the Galton-Watson process to human DNA evolution and demography
Neves, A G M
2005-01-01
We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...
John Donne no Brasil John Donne no Brasil
Directory of Open Access Journals (Sweden)
Jose Garcez Ghirardi
2008-04-01
Full Text Available O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I: 621 A citação acima, extraída de um artigo de Wilson Martins (in O Estado de São Paulo, 25/02/54, ilustra bem a posição reservada a John Donne, até então, por aqueles que, no Brasil, se dedicavam aos estudos de literatura. “A troco do que” - perguntava o autor - deveria ser o leitor de Correntes Cruzadas confrontado com o nome de Donne? Quem, até aquele momento, dele se ocupara? Ninguém, respondia o erudito articulista (nem mesmo o Sr. Afrânio Coutinho, embora reconhecendo que o nome do poeta pudesse ter sido fonte de algumas “leituras apaixonantes” . Interessava-lhe apontar enfaticamente, porém, que a lembrança de Donne surgia de maneira gratuita, desligada de qualquer argumentação ou contexto que a preparas se ou justificasse. Não apenas Afrânio Coutinho silenciara sobre a obra de Donne em seu livro; ninguém, de fato, havia, até aquele momento, dedicado, ao poeta, qualquer atenção mais demorada. Curiosamente, o próprio artigo, assim como o livro nele discutido, atestava, no entanto, que o esquecimento do nome de Donne estava por findar.
2005-01-01
A few weeks ago John Lindsay passed away unexpectedly at his home in St. Genis. With his death we have lost a pioneer in detector electronics and one of the founding fathers of the CERN Electronics Group. John came to CERN in 1956 to join the Electronics Group, which was being formed in the SC Division. He thus participated from the beginning in the design, development, production, commissioning and support of electronics for the experiments at the CERN accelerators, initially at the SC and finally at the SPS. From the University of Glasgow he brought his expertise on pulse height analyzers, which were called kick sorters in those days, and did pioneering work with it in the early CERN experiments. He designed read-out systems for successive generations of detectors, such as wire spark chambers, multiwire proportional chambers, calorimeters, etc., often coming up with innovative solutions. Surely one of his finest moments must have been when he worked on complex detector systems, such as liquid argon calo...
Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane
2013-11-01
William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.
WIT Diversity Talk with John Ellis
CERN. Geneva; Ellis, Jonathan R.
2017-01-01
Sudeshna Datta Cockerill, CERN Ombudsperson, will interview John Ellis, a renown British theoretical physicist with a long career both at CERN and externally. John Ellis has also been awarded several prizes for his work in physics. Among many other outstanding roles and positions, he was Division Leader of the Theory Division at CERN from 1988-1994. John Ellis is currently Clerk Maxwell Professor of Theoretical Physics at King's College London.
Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...
Obituary: John Louis Perdrix, 1926-2005
Orchiston, D. Wayne
2006-12-01
John Perdrix, astronomical historian and co-founder of the Journal of Astronomical History and Heritage, died on 27 June 2005. John Louis Perdrix was born in Adelaide, Australia, on 30 June 1926. After studying chemistry at Melbourne Technical College and working in industry, he joined the Commonwealth Scientific and Industrial Research Organisation's Division of Minerals and Geochemistry. In 1974 the Division relocated to the Western Australian capital, Perth, and John spent the rest of his working life there involved in geochemical research. From his teenage years John had a passion for astronomy, which he fine-tuned through the Astronomical Society of Victoria and the Victorian Branch of the British Astronomical Association. He was very active in both groups, serving as President of the former and Secretary/Treasurer of the latter. He was also an FRAS, and a member of the AAS, the BAA parent body, and the IAU (Commission 41)?no mean feat for an Australian amateur astronomer. Throughout his life, he was a strong advocate of close amateur-professional relations. John's main research interest was history of astronomy, and over the years he wrote a succession of research papers, mainly about aspects of Australian astronomy. His well-researched and neatly-illustrated papers on the Melbourne Observatory and the Great Melbourne Telescope are classics, and when the Observatory's future was in the balance they played a key role in the State Government's decision to convert this unique facility into a museum precinct. To support his research activities, John built up an amazing library that developed its own distinctive personality and quickly took over his house and garage before invading commercial storage facilities! Apart from writing papers, John had an even greater passion for editing and publishing. From 1985 to 1997 he produced the Australian Journal of Astronomy, and in 1998 this was replaced by the Journal of Astronomical History and Heritage (JAH2). Both
Bhattacharya, N. C.
1974-01-01
This article takes a brief but critical look at John Dewey's version of pragmatism, his contribution to philosophical scholarship generally as well as his theory and practice of liberalism. (Author/RK)
Directory of Open Access Journals (Sweden)
Paul Rousseau
2015-11-01
Full Text Available In this series of short films made by Jonathan Law, the art historian James Boaden, and the curator of The John Deakin Archive, Paul Rousseau, discuss the double-exposure images made by the photographer John Deakin (1912-1972 in the 1950s and 1960s. The films ask you, firstly, to look closely at the images being discussed. Each one begins with a sustained and intense shot of a single image before opening up to a wide-ranging discussion about Deakin, double exposures, and photography.
John Leask Lumley: Whither Turbulence?
Leibovich, Sidney; Warhaft, Zellman
2018-01-01
John Lumley's contributions to the theory, modeling, and experiments on turbulent flows played a seminal role in the advancement of our understanding of this subject in the second half of the twentieth century. We discuss John's career and his personal style, including his love and deep knowledge of vintage wine and vintage cars. His intellectual contributions range from abstract theory to applied engineering. Here we discuss some of his major advances, focusing on second-order modeling, proper orthogonal decomposition, path-breaking experiments, research on geophysical turbulence, and important contributions to the understanding of drag reduction. John Lumley was also an influential teacher whose books and films have molded generations of students. These and other aspects of his professional career are described.
Directory of Open Access Journals (Sweden)
Kevin Possin
2014-12-01
Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.
John Smithi kaks palet / Johannes Saar
Saar, Johannes, 1965-
2003-01-01
Näitus "John Smith. Marko ja Kaido" Tallinna Kunstihoones. Kaido Ole ja Marko Mäetamm esindavad rühmitusena "John Smith" Eestit 2003. a. Veneetsia biennaalil. Ilmunud ka kogumikus "Päevast päeva", lk. 90-96
2006-01-01
Our friend and colleague John Strong was cruelly taken from us by a brain tumour on 31 July, a few days before his 65th birthday. John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers. He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such h...
Wickens, F
Our friend and colleague John Strong was cruelly taken from us by a brain tumour on Monday 31st July, a few days before his 65th birthday John started his career working with a group from Westfield College, under the leadership of Ted Bellamy. He obtained his PhD and spent the early part of his career on experiments at Rutherford Appleton Laboratory (RAL), but after the early 1970s his research was focussed on experiments in CERN. Over the years he made a number of notable contributions to experiments in CERN: The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras to record the sparks in the spark chambers; He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems; He was responsible for the second level trigger system for the ALEPH detector and spent five years leading a team that designed and built the system, which ran for twelve years with only minor interventions. Following ALEPH he tur...
Obituary: John W. Firor (1927-2007)
Gilman, Peter A.
2009-12-01
John W. Firor, a former Director of the High Altitude Observatory and the National Center for Atmospheric Research, and a founder of the Solar Physics Division of the American Astronomical Society, died of Alzheimer's disease in Pullman, Washington on November 5, 2007, he was 80. He was born in Athens Georgia on October 18, 1927, where his father was a professor of agricultural economics. John had an unusually diverse scientific career. His interest in physics and astrophysics began while serving in the army, during which time he was assigned to the Los Alamos National Laboratory, where he guarded highly radioactive materials (many have heard him describe how informal the protections were compared to later times). After his service he returned to college and graduated in physics from Georgia Tech in 1949. He received his Ph.D. from the University of Chicago in 1954, writing his thesis on cosmic rays under John Simpson. John Firor would later remark that: "If you needed cosmic rays to actually do anything, you are sunk." That thought, partly in jest, may help explain his motivation for moving to so many new scientific and management pursuits. John moved from cosmic ray physics to radio astronomy (particularly of the Sun) when he began work at the Carnegie Institution of Washington's Department of Terrestrial Magnetism, where he remained until 1961. During this time, he met Walter Orr Roberts, then the Director of the High Altitude Observatory (HAO) in Boulder, Colorado. HAO was then affiliated with the University of Colorado. In 1959, a movement began to upgrade the atmospheric sciences in the United States by establishing a National Center, where the largest, most important atmospheric research problems could be addressed. Roberts became the first Director of NCAR, as well as the first president of the University Corporation for Atmospheric Research (UCAR), the consortium of universities that was commissioned to manage and staff the new Center. HAO became a
Thompson, Richard F.
1994-01-01
The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)
Directory of Open Access Journals (Sweden)
Jose Garcez Ghirardi
2008-04-01
Full Text Available O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I:621
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
John Stuart Mill, John Rawls y Amartya Sen, los tres nombres de la equidad
Directory of Open Access Journals (Sweden)
María Teresa Lopera
1997-07-01
Full Text Available Tres autores como John Stuart Mill, John Rawls y Amartia Sen son objeto de análisis en este artículo que estudia el tema de la equidad en un contexto que se caracteriza por el abandono casi generalizado del estudio de los valores en relación a los grandes problemas económicos; el artículo defiende como necesaria la recuperación de las preocupaciones éticas en la ciencia económica. La segunda parte, presenta una bibliografía reciente presentada como respuesta a la obra de John Rawls a partir de 1985, cuando este autor da el llamado giro desde su teoría de la justicia como equidad hacia un reciente liberalismo político, período de gran interés para comprender las discusiones actuales de la filosofía política y el futuro de la discusión interdisciplinaria con la economía.
Indian Academy of Sciences (India)
IAS Admin
Resonance journal of science education. March 2014 Volume 19 Number 3. GENERALARTICLES. 198 John McCarthy – Father of Artificial Intelligence. V Rajaraman. 208 LISP. Harish Karnick. 222 Elementary? Question Answering, IBM's Watson, and the Jeopardy! Challenge. Raman Chandrasekar. 242 Cloud Computing.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
Directory of Open Access Journals (Sweden)
Susilawati Susilawati
2016-06-01
Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52
Obituary: John Leroy Climenhaga, 1916-2008
Scarfe, Colin
2009-01-01
John Leroy Climenhaga was born on 7 November 1916 on a farm some 10 km from Delisle, a small town on the Canadian prairies, located about 50 km south-west of Saskatoon, Saskatchewan, and died at his home in Victoria, British Columbia, on 27 May 2008. His parents, Reuben and Elizabeth (nee Bert) Climenhaga, were farming folk, and he carried their honest and open attitude to the world throughout his life. John was the seventh born, and last to die, of their ten children. His father also served as an ordained minister of the Brethren in Christ. In early adulthood, John worked on his father's farm, but then attended the University of Saskatchewan, obtaining a B.A. with Honors in Mathematics and Physics and an M.A. in Physics, in 1945 and 1949 respectively. Between these events he worked as a Physics Instructor at Regina College from 1946 to 1948. In 1949 Climenhaga joined the faculty of Victoria College, as one of only two physicists in a small institution that was then part of the University of British Columbia. He remained in Victoria for the rest of his career, playing a major role in the College's growth into a full-fledged university, complete with thriving graduate programs in physics and astronomy as well as in many other fields. He served as Head of the Physics Department during the 1960s, a period which saw the College become the University of Victoria, with a full undergraduate program in Physics, and campaigned successfully for the establishment of a program in Astronomy, which began in 1965. From 1969 until 1972 he held the position of Dean of Arts and Science, and championed the university's participation in the Tri-University Meson Facility, whose high-current medium-energy beam was ideal for the production and study of mesons and their physics. That period was a turbulent one in the university's history, but John's integrity and his balanced and fair-minded approach to conflicts were of immeasurable importance in steering the young institution through it
Directory of Open Access Journals (Sweden)
Jose Garcez Ghirardi
2003-04-01
Full Text Available http://dx.doi.org/10.5007/2175-8026.2003n45p77 O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I:621
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 1. John Archibald Wheeler - Man with Picturesque Imagination. Jayant V Narlikar. General Article Volume 18 Issue 1 January 2013 pp 22-28. Fulltext. Click here to view fulltext PDF. Permanent link:
Obituary: John Louis Africano III, 1951-2006
Barker, Edwin, S.
2007-12-01
The orbital debris, space surveillance, and astronomical communities lost a valued and beloved friend when John L. Africano passed away on July 27, 2006, at the young age of 55. John passed away in Honolulu, Hawaii, from complications following a heart attack suffered while playing racquetball, which was his avocation in life. Born on February 8, 1951, in Saint Louis, Missouri, John graduated with a B.S. in Physics from the University of Missouri at Saint Louis in 1973, and received a Master's degree in Astronomy from Vanderbilt University in 1974. John had a real love for astronomical observing and for conveying his many years of experience to others. He encouraged many young astronomers and mentored them in the basics of photometry and astronomical instrumentation. John was author or co-author on nearly one-hundred refereed publications ranging from analyses of cool stars to the timing of occultations to space surveillance. He was honored for his contributions to minor planet research when the Jet Propulsion Laboratory named Minor Planet 6391 (Africano) after him. John held operational staff positions at several major observatories including McDonald Observatory in Texas, Kitt Peak National Observatory in Arizona, and the Cloudcroft Telescope Facility in New Mexico. He observed at numerous observatories worldwide, including Cerro Tololo Inter-American Observatory (CTIO) in Chile, developing a world-wide network of friends and colleagues. John's ability to build diverse teams through his managerial and technical skills, not to mention his smiling personality, resulted in numerous successes in the observational astronomy and space surveillance arenas. As an astronomer for Boeing LTS Inc., he worked for many years at the Advanced Maui Optical and Space Surveillance site (AMOS) on Maui, Hawaii, where he contributed his operational and instrumental expertise to both the astronomy and space surveillance communities. He was also the co-organizer of the annual AMOS
John locke on personal identity.
Nimbalkar, Namita
2011-01-01
John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self) to be founded on consciousness (viz. memory), and not on the substance of either the soul or the body.
John Locke on Personal Identity**
Nimbalkar, Namita
2011-01-01
John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self) to be founded on consciousness (viz. memory), and not on the substance of either the soul or the body.
Bookshelf. John Adams biography
International Nuclear Information System (INIS)
Billinge, Roy
1993-01-01
Full text: When John Bertram Adams died on 3 March 1984, CERN lost one of its principal architects. The late Sir John Adams was a very private person who rarely confided in his colleagues. This made the job of his biographer particularly difficult. Michael Crowley- Milling has succeeded admirably, and has performed a very important service. Is it a potted history of CERN, or the story of the building of the PS, or of the SPS? Yes, all of these, but most of all it is a thoughtful and discerning biography and a fitting tribute to a veritable giant of European science and technology. The sub-title,' Engineer Extraordinary' refers not only to John's outstanding ability as a builder of accelerators, but perhaps even more importantly, as a builder of teams and an 'engineer of opinions'. The book describes how John's attention to detail and intuitive engineering skills developed during the early part of his career, when working in radar research, and how he emerged as a natural leader in the building of the CERN PS. Then later, how his statesmanship enabled him to ''...rescue it (the 300 GeV Programme) from seeming political disaster and nurse it through technical problems to a successful conclusion.'' One crucial part of this process described is the visit to CERN in 1970 by Margaret Thatcher, at that time UK Secretary of State for Education and Science, and her subsequent letters of thanks, not only to Bernard Gregory as Director General, but also to John. It is interesting to speculate to what extent the good impression made on that occasion helped many years later, when as Prime Minister Mrs Thatcher decided that Britain should stay in CERN! After the successful commissioning of the SPS, the book goes on to describe the period when the two CERN Laboratories were merged under two Directors General. Unfortunately I found this part a little too low key, given that John and Leon van Hove presided over what was undoubtedly
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society
Directory of Open Access Journals (Sweden)
Gerry Joseph Nagtzaam
2014-03-01
Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action. In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence. Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.
Titular Tilting in John Ashbery
DEFF Research Database (Denmark)
Balle, Søren Hattesen
2008-01-01
Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production. Their occurre......Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production....... Their occurrence neither follows any particular plan, nor do they form part of a larger poetic or thematic whole in the volumes where they have been published. Rather, they are perhaps better characterized as “typically atypical of Ashbery’s poetry” – to put it in paradoxical terms used by John Shoptaw in his 1994...
LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci
Energy Technology Data Exchange (ETDEWEB)
Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)
1994-09-01
The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
First John structure resolved: Exegetical analysis, Part 2
Directory of Open Access Journals (Sweden)
Ron J. Bigalke
2013-11-01
Full Text Available Numerous attempts have been suggested regarding the structure of First John. The only nearly unanimous agreement amongst commentators is concerning the prologue (1:1–4 and the conclusion (5:13–21. The lack of unanimity can be frustrating for the majority of those who seek to understand the macrostructure of the First Epistle of John. Consequentially, some commentators have opined that it is impossible to determine a notable structure of First John, and the epistle is thus regarded as a relatively imprecise series of various thoughts that were composed on the basis of mere association. Many exegetes have therefore proposed suggested outlines to aid the understanding of First John as opposed to providing genuine efforts to articulate a discernable structure of the epistle. The final part of this exegetical analysis seeks to demonstrate that exegetes need not succumb to such pessimism because there does appear to be a discernable structure to First John. Providing and stating resolve concerning the First John structure is fundamental for understanding the revealed contents of the epistle.
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 11. John Maynard Smith (1920-2004). Featured Scientist Volume 10 Issue 11 November 2005 pp 110-110. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/010/11/0110-0110. Resonance ...
John of Salisbury on Aristotelian Science
DEFF Research Database (Denmark)
Bloch, David
The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science.......The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science....
John Calvin and John Locke on the Sensus Divinitatis and Innatism
Directory of Open Access Journals (Sweden)
J. Caleb Clanton
2017-02-01
Full Text Available Inheritors of the Calvinist Reformed tradition have long disagreed about whether knowledge of God’s nature and existence can be or need be acquired inferentially by means of the standard arguments of natural theology. Nonetheless, they have traditionally coalesced around the thought that some sense or awareness of God is naturally implanted or innate in human beings. A root of this orientation can be found in John Calvin’s discussion of the sensus divinitatis in the first book of The Institutes of the Christian Religion. This paper outlines a pedagogical strategy for organizing and evaluating Calvin’s treatment of the sensus divinitatis, chiefly by putting it in tension with John Locke’s polemic against innatism in Book I of An Essay concerning Human Understanding. I begin by reconstructing Calvin’s depiction of the sensus divinitatis, as well as his case for thinking that it is innate. I then explain how Locke’s critique of innatism offers a fairly direct response to Calvin and, hence, a useful framework for exploring the limits of Calvin’s treatment of the sensus divinitatis.
Resonance – Journal of Science Education | Indian Academy of ...
Indian Academy of Sciences (India)
https://www.ias.ac.in/article/fulltext/reso/019/03/0222-0241. Keywords. John McCarthy; artificial intelligence; natural language processing; question answering system; IBM; DeepQA; Watson; Jeopardy!; quiz show. Author Affiliations. Raman Chandrasekar1. ProQuest 501 North 34th Street Suite 300, Seattle, WA 98103, USA ...
Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq
2018-04-01
This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.
Clavijo A., Arturo
2012-01-01
Según el conductismo, el comportamiento constituye la Psique y el tema de estudio de la psicología. Aunque algunos científicos habían realizado trabajos empíricos con métodos objetivos antes de 1913, año en el que John B. Watson publicó su manifiesto, este último fue el primero en intentar la sistematización de la conducta como equivalente a la Psique, esto es, como el objeto de estudio de la psicología. El artículo discute la noción de comportamiento de Watson y la compara con otras dos form...
Sassis tuumamajandus / John Carey
Carey, John
2008-01-01
USA presidendikandidaadi John McCaini energeetikakava kohaselt tuleks USA-sse ehitada 100 uut tuumaelektrijaama, neist esimesed 45 peaksid valmima aastaks 2030. Tuumaelektrijaamad aitaksid rahuldada USA energiavajadust ning võitleksid ka kliimasoojenemise vastu. Eksperdid on arengukava suhtes kriitilised
Obituary: John J. Hillman, 1938-2006
Chanover, Nancy
2007-12-01
John J. Hillman, a dedicated NASA civil servant, spectroscopist, astrophysicist, planetary scientist, and mentor, died on February 12, 2006 of ocular melanoma at his home in Columbia, Maryland. His professional and personal interests were wide-reaching and varied, and he devoted his career to the advancement of our understanding of the beauty and wonder in the world around us. His love of nature, art, and science made him a true Renaissance man. John was born in Fort Jay, New York, on November 22, 1938, and was raised in Washington, D.C. He received his B.S., M.S., and Ph.D. degrees in Physics from American University in 1967, 1970, and 1975, respectively. He began working at NASA's Goddard Space Flight Center, then in its infancy, in 1969, juggling a full-time position as a Research Physicist, the completion of his M.S. and Ph.D. degrees, and a young family. His background in molecular spectroscopy enabled him to apply his skills to numerous disciplines within NASA: infrared and radio astronomy; electronic, vibrational, and rotational structure of interstellar molecules; solar and stellar atmospheres; and planetary atmospheres. He published more than 70 journal papers in these disciplines. He was a frequent contributor to the Ohio State University International Symposium on Molecular Spectroscopy, and possessed a rare ability to bridge the gap between laboratory and remote sensing spectroscopy, bringing scientists from different disciplines together to understand our Universe. The last fifteen years of John's career were devoted to the development of acousto-optic tunable filter (AOTF) cameras. He championed this technology as a low-cost, low-power alternative to traditional imaging cameras for in situ or remotely sensed planetary exploration. It was within this context that I got to know John, and eventually worked closely with him on the demonstration and application of this technology for planetary science using ground-based telescopes in New Mexico, California
International Nuclear Information System (INIS)
Amaldi, E.
1986-01-01
In this first John Adams' Memorial Lecture, an outline is given of his work, especially from the beginning of CERN in 1952 until his death in 1984. The historical survey covers John Adams' technical and managerial contributions to the development of CERN and its accelerators, as well as to fusion research in Britain and Europe. Exemplified by his role as member and president of the International Committee for Future Accelerators (ICFA), Adams' interest in international co-operation is also stressed. In the spirit of this great European, arguments are given for CERN to continue to be the first-rate high-energy physics laboratory which it has been in the past. (orig.)
1999-01-01
Rockbändi "The Velvet Underground" asutajaliige John Cale avaldas oma autobiograafia "What's Welsh for Zen?". Koos biograafiakirjanik Victor Bockrisiga kirjutatud teos räägib 60ndate lõpu kultuurielust New Yorgis, koostööst Andy Warholiga jm.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-05-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Translating The Infinities by John Banville
Irene Abigail Piccinini
2015-01-01
Abstract - John Banville’s talent as a prose stylist is widely recognized. The polished elegance of his phrases constitutes a continuing and fascinating challenge for his translator, due to the intricacies of the source text, its manifold registers and lexical choices. In his novel The Infinities, in Italian Teoria degli Infiniti, John Banville takes cue from Kleist’s Amphytrion to devise a novel where classicality interweaves with science and science fiction through the invention of a world ...
International Nuclear Information System (INIS)
Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.
1988-01-01
The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs
International Nuclear Information System (INIS)
Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz
2007-01-01
The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
John Kotter on Leadership, Management and Change.
Bencivenga, Jim
2002-01-01
Excerpts from interview with John Kotter, Konosuke Matsushita Professor of Leadership at the Harvard Business School, about his thoughts on the role of the superintendent as leader and manager. Describes his recent book "John P. Kotter on What Leaders Really Do," 1999. Lists eight-step change process from his book "Leading Change," 1996. (PKP)
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
In memoriam: John Warren Aldrich, 1906-1995
Banks, Richard C.
1997-01-01
John Aldrich was born in Providence, Rhode Island, on 23 February 1906, and went to the Providence public schools. He developed a broad interest in natural history at an early age, being stimulated by his mother, a kindergarten teacher, who introduced him to nature books. His interest was strengthened by Harold L. Madison, Director of the Park Museum in Providence, an Associate ( = member) of the AOU. As a high school student, John taught nature study at the Rhode Island Boy Scout Camp in summers. John was President of his class at Classical High School, and manager of the school's football team in his senior year. Also in that year, 1923, John published his first paper, a note in Bird-Lore on the occurrence of the Mockingbird in Rhode Island. That paper is a literary gem, showing that his skill in writing developed as early as his knowledge of birds. His early interest in football continued as well; he was a devoted fan of the Washington Redskins in his later years.
Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model
Energy Technology Data Exchange (ETDEWEB)
Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)
2016-03-15
Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.
The case of the missing fingerprints or Dr Watson's cosmology
International Nuclear Information System (INIS)
Longair, M.S.
1987-01-01
The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)
Durgun Ozan, Yeter; Okumuş, Hülya
2017-06-01
Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.
Directory of Open Access Journals (Sweden)
Gonzalo Martínez Fernández
2016-01-01
Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.
Zoreda, Margaret Lee
This paper forms part of an investigation about how the philosophy of John Dewey (1859-1952) can illuminate the practice of the teaching of English as a foreign language. The paper seeks to interpret and synthesize John Dewey's philosophical works to construct a "Deweyian lens" with which to analyze and evaluate the field of the teaching…
Writing Assessment's "Debilitating Inheritance": Behaviorism's Dismissal of Experience
Wilson, Maja Joiwind
2013-01-01
In this project, I examine the legacy of behaviorism's dismissal of experience on contemporary writing assessment theory and practice within the field of composition studies. I use an archival study of John B. Watson's letters to Robert Mearns Yerkes to establish behaviorism's systematic denial of experience and its related constructs: mind,…
Resonance – Journal of Science Education | News
Indian Academy of Sciences (India)
John McCarthy – Father of Artificial Intelligence · V Rajaraman · More Details Fulltext PDF. pp 208-221 General Article. LISP · Harish Karnick · More Details Fulltext PDF. pp 222-241 General Article. Elementary? Question Answering, IBM's Watson, and the Jeopardy! Challenge · Raman Chandrasekar · More Details Fulltext ...
Anamnesis and the Silent Narrator in Plato and John
Directory of Open Access Journals (Sweden)
George L. Parsenios
2017-03-01
Full Text Available The Gospel of John is often compared to the dialogues of Plato by those who connect Johannine theology and Platonic philosophy. The comparison operates on the level of ideas. The present paper does not ignore issues of theology and philosophy but grounds a comparison of John and Plato first and foremost on the literary level. In several key places in John 1, 3, and 14, the Johannine narrator recedes from view and is unexpectedly silent where one would expect a narrator’s comment to organize the conversations and interactions between characters in John. Plato also renders the voice of the narrator silent in a dialogue like the Theaetetus. This paper argues that John and Plato both suppress the narrator’s voice in order to further their anamnetic efforts and to make later generations not only readers but participants in their original conversations.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
Obituary: John Daniel Kraus, 1910-2004
Kraus, John D., Jr.; Marhefka, Ronald J.
2005-12-01
John Daniel Kraus, 94, of Delaware, Ohio, director of the Ohio State University "Big Ear" Radio Observatory, physicist, inventor, and environmentalist died 18 July 2004 at his home in Delaware, Ohio. He was born on 28 June 1910 in Ann Arbor, Michigan. He received a Bachelor of Science in 1930, a Master of Science in 1931, and a PhD in physics in 1933 (at 23 years of age), all from the University of Michigan, Ann Arbor. During the 1930s at Michigan, he was involved in physics projects, antenna consulting, and in atomic-particle-accelerator research using the University of Michigan's premier cyclotron. Throughout the late 1920s and the 1930s, John was an avid radio amateur with call sign W8JK. He was back on the air in the 1970s. In 2001 the amateur radio magazine CQ named him to the inaugural class of its Amateur Radio Hall of Fame. He developed many widely used innovative antennas. The "8JK closely spaced array" and the "corner reflector" were among his early designs. Edwin H. Armstrong wrote John in July 1941 indicating in part, "I have read with interest your article in the Proceedings of the Institute on the corner reflector...Please let me congratulate you on a very fine piece of work." Perhaps John's most famous invention, and a product of his intuitive reasoning process, is the helical antenna, widely used in space communications, on global positioning satellites, and for other applications. During World War II, John was in Washington, DC as a civilian scientist with the U.S. Navy responsible for "degaussing" the electromagnetic fields of steel ships to make them safe from magnetic mines. He also worked on radar countermeasures at Harvard University's Radio Research Laboratory. He received the U.S. Navy Meritorious Civilian Service Award for his war work. In 1946 he took a faculty position at Ohio State University, becoming professor in 1949, and retiring in 1980 as McDougal Professor Emeritus of Electrical Engineering and Astronomy. Even so, he never retired
International Nuclear Information System (INIS)
Hulm, J.
1988-01-01
John Hulm has made profound contributions to the field of superconductivity as a research scientist and as an engineer. He and his colleagues discovered the superconducting materials in commercial use today, and he played a key role in the development of commercial superconducting magnets. Dr. Hulm now serves as Chief Scientist at Westinghouse Electric Corporation. This story describes many milestones in the history of superconductivity and offers personal insight into this distinguished scientist
75 FR 5803 - John Day/Snake Resource Advisory Council; Meetings
2010-02-04
...] John Day/Snake Resource Advisory Council; Meetings AGENCY: Bureau of Land Management, Interior. ACTION: Meeting Notice for the John Day/Snake Resource Advisory Council. SUMMARY: Pursuant to the Federal Land..., Bureau of Land Management (BLM) John Day/Snake Resource Advisory Council (JDSRAC) will meet as indicated...
J D Bernal: the sage of science
International Nuclear Information System (INIS)
Brown, Andrew P
2007-01-01
John Desmond Bernal (1901-1971) was one of the most influential and original scientists of the twentieth century. No less an authority than James Watson has stated that Bernal's genius inspired the birth of molecular biology. By examining Bernal's interactions with others, I attempt to illustrate his personality, brilliance, breadth, foibles and essential humanity
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Would John Stuart Mill have regulated pornography?
McGlynn, C.; Ward, I.
2014-01-01
John Stuart Mill dominates contemporary pornography debates where he is routinely invoked as an authoritative defence against regulation. This article, by contrast, argues that a broader understanding of Mill's ethical liberalism, his utilitarianism, and his feminism casts doubt over such an assumption. New insights into Mill's approach to sex, sexual activity, and the regulation of prostitution reveal an altogether more nuanced and activist approach. We conclude that John Stuart Mill would a...
2006-01-01
John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon Cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers. He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such has been the lasting impact of these measurements that the paper on the pion form-factor had been cited 323 times up to the time of J...
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Bertlmann, Reinhold A.
2015-07-15
John Bell, with whom I had a fruitful collaboration and warm friendship, is best known for his seminal work on the foundations of quantum physics, but he also made outstanding contributions to particle physics and accelerator physics.
International Nuclear Information System (INIS)
Bertlmann, Reinhold A.
2015-01-01
John Bell, with whom I had a fruitful collaboration and warm friendship, is best known for his seminal work on the foundations of quantum physics, but he also made outstanding contributions to particle physics and accelerator physics
17 JOHN 12,20-22 AS A MISSIONARY TEXT: AN EXEGETICAL ...
African Journals Online (AJOL)
(John 3,17) and executor of judgement (John 5,27). By this singular act of glorification, other sheep that are not of the fold would be gathered under one Shepherd (John 10,16; 11,49-52). John 12,22 is ladened with the verb of movement ― e;r cetai. First, it is Philip going to Andrew and then both of them going to Jesus.
J D Bernal: the sage of science
Energy Technology Data Exchange (ETDEWEB)
Brown, Andrew P [Belfer Center for Science and International Affairs, John F Kennedy School of Government, Harvard University, 79 John F Kennedy Street, Cambridge, MA 02138 (United States)
2007-02-02
John Desmond Bernal (1901-1971) was one of the most influential and original scientists of the twentieth century. No less an authority than James Watson has stated that Bernal's genius inspired the birth of molecular biology. By examining Bernal's interactions with others, I attempt to illustrate his personality, brilliance, breadth, foibles and essential humanity.
Geology of St. John, U.S. Virgin Islands
Rankin, Douglas W.
2002-01-01
The rocks of St. John, which is located near the eastern end of the Greater Antilles and near the northeastern corner of the Caribbean plate, consist of Cretaceous basalt, andesite, keratophyre, their volcaniclastic and hypabyssal intrusive equivalents, and minor calcareous rocks and chert. These rocks were intruded by Tertiary mafic dikes and tonalitic plutons. The oldest rocks formed in an extensional oceanic environment characterized by abundant keratophyre and sheeted dikes. Subduction-related volcanism of the east-west-trending marine Greater Antilles volcanic arc began on St. John near the transition between the Early and Late Cretaceous. South-directed compression, probably caused by the initial collision between the Greater Antilles arc of the Caribbean plate and the Bahama platform of the North American plate, deformed the Cretaceous strata into east-west-trending folds with axial-plane cleavage. Late Eocene tonalitic intrusions, part of the Greater Antilles arc magmatism, produced a contact aureole that is as much as two kilometers wide and that partly annealed the axial-plane cleavage. East-west compression, possibly related to the relative eastward transport of the Caribbean plate in response to the beginning of spreading at the Cayman Trough, produced long-wavelength, low-amplitude folds whose axes plunge gently north and warp the earlier folds. A broad north-plunging syncline-anticline pair occupies most of St. John. The last tectonic event affecting St. John is recorded by a series of post-late Eocene sinistral strike-slip faults related to the early stages of spreading at the Cayman Trough spreading center and sinistral strike-slip accommodation near the northern border of the Caribbean plate. Central St. John is occupied by a rhomb horst bounded by two of these sinistral faults. Unlike other parts of the Greater Antilles, evidence for recent tectonic movement has not been observed on St. John.
a speech act analysis of John 9: 35
African Journals Online (AJOL)
The significance of Jesus' utterance in relation to the Johannine son of man: a speech act analysis of John 9: 35: research. ... In order to accomplish that, this article will examine the significance of Jesus' utterance in John 9: 35, which contains some difficulty in interpreting the meaning of the title Son of Man.
John Ellis considers cosmology, colloquiums and new collaborations
Katarina Anthony
2011-01-01
On 13 September, physicists from around the world joined John Ellis in a colloquium to celebrate his 65th birthday. In our last issue, we talked to John about the Higgs, the lack of the Higgs and extra dimensions. In this second part of the interview, John speaks about the colloquium and the wide range of topics it covered, all inspired by his career. John Ellis in his office (July 2011). How did your birthday colloquium come about? When physicists here at CERN reach a “certain age” – or reach a transition point in their careers – it is traditional to hold some kind of colloquium. I had previously resisted pressure to hold one of these events. But this year, my official duties for the Organization have come to an end. While it is unlikely you will see any difference in my working habits, it was a milestone that proved too important to not give into requests for an event. Rather than a very long sequence of people talking about what they d...
Case of the missing fingerprints or Dr. Watson's cosmology
Energy Technology Data Exchange (ETDEWEB)
Longair, M.S.
1987-01-01
The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).
Directory of Open Access Journals (Sweden)
Gabriele Guidi
2016-07-01
Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.
Indian Academy of Sciences (India)
IAS Admin
of matter and the development of science in the world, especially in. Europe. During ... He belonged to a family of Quakers. (Society of ... During this period, Dalton came under the influence of John Gough, who suggested that he maintain a ...
John Hennessey, Barrier Breaker
Nelson, Stephen J.
2018-01-01
John Hennessey lived a remarkable, full life as a professor, as a leader in his field of management and business, and moral, ethical leadership, and as dean at Dartmouth College's Tuck School of Business and provost at the University of Vermont. He was extraordinary on many fronts, a great man who lived in tumultuous times marked by world war as a…
International Nuclear Information System (INIS)
Hey, J D
2014-01-01
As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Clarke, R W
1997-01-01
Oliver St John Gogarty--Otolaryngologist to fashionable Edwardian Dublin--was a distinguished poet and a Senator in the fledgling Irish Free State after its establishment in 1922. He numbered amongst his acquaintances the poet William Butler Yeats, the novelist James Joyce and a host of political and literary persona who helped to shape modern Ireland. He was satirised as 'stately plump Buck Mulligan' in Joyce's novel Ulysses.
Thomas, John Meurig
2013-10-11
"My greatest achievement has been to combine being a teacher, a researcher, and a popularizer of science for over 50 years. My worst nightmare is to find myself dumbstruck when I am about to give a lecture …︁" This and more about Sir John Meurig Thomas can be found on page 10938. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A New Reading of Shakespeare's King John.
Usher, Peter D.
1995-12-01
Shakespeare wrote King John c.1594, six years after the defeat of the Spanish Armada, and ~ 50 years after publication of the Copernican heliocentric hypothesis. It is said to be the most unhistorical of the History Plays, ``anomalous'', ``puzzling'', and ``odd'', and as such it has engendered far more than the customary range of interpretive opinion. I suggest that the play alerts Elizabethans not just to military and political threats, but to a changing cosmic world view, all especially threatening as they arise in Catholic countries. (a) Personification characterizes the play. John personifies the old order, while Arthur and the Dauphin's armies personify the new. I suggest that Shakespeare decenters King John just as Copernicus decentered the world. (b) Hubert menaces Arthur's eyes for a whole scene (4.1), but the need for such cruelty is not explained and is especially odd as Arthur is already under sentence of death (3.3.65-66). This hitherto unexplained anomaly suggests that the old order fears what the new might see. (c) Eleanor's confession is made only to Heaven and to her son the King (1.1.42-43), yet by echoing and word play the Messenger from France later reveals to John that he is privy to it (4.2.119-124). This circumstance has not been questioned heretofore. I suggest that the Messenger is like the wily Hermes (Mercury), chief communicator of the gods and patron of the sciences; by revealing that he moves in the highest circles, he tells John that he speaks with an authority that transcends even that of a king. The message from on high presages more than political change; it warns of a new cosmic and religious world order (d) Most agree that John is a weak king, so Shakespeare must have suspected flaws in the old ways. He would have known that Tycho Brahe's new star of 1572, the comet of 1577, and the 1576 model of his compatriot Thomas Digges, were shattering old ideas. (e) The tensions of the play are not resolved because in 1594 the new order was
John Maynard Smith (1920-2004)
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 11. John Maynard Smith (1920-2004) - “One of the last Grand Evolutionary Theorists of the 20th Century”. Vidyanand Nanjundiah. General Article Volume 10 Issue 11 November 2005 pp 70-78 ...
Directory of Open Access Journals (Sweden)
Claire Kimberly
2013-10-01
Full Text Available Since Extension agents work with a variety of families, there is a desperate need to further our understanding of how to educate diverse communities on a family-related topic. Focused on assisting those teaching marital education to a diverse population, this study attempts to understand how individual differences impact relationship satisfaction and marital communication. Based on John Gottman’s research on marital communication and John Lee’s six loves styles, 653 participants completed a survey to further understanding of the relationship between inter- and intrapersonal variables. Results revealed that marital communication and love styles accounted for 54.6% of the variance in marital satisfaction regardless of difference in demographics. Results of this study provide a resource for educators and practitioners to use with diverse clientele, while also emphasizing the need to understand both intra- and interpersonal variables when working with families.
Kuus kirja / John Keats ; tlk. Märt Väljataga
Keats, John
2004-01-01
Sisu: Benjamin Bailey'le, 22. novembril 1817 ; George ja Tom Keatsile, 21., 27. (?) detsembril 1817 ; John Taylorile, 27. veebruaril 1818 ; John Hamilton Reynoldsile, 3. mail 1818 ; Richard Woodhouse'ile, 27. oktoobril 1818 ; George ja Georgiana Keatsile, 14. veebruar-3. mai 1819. Saatesõna lk. 84
Rees, Prof. Lord Martin (John)
Indian Academy of Sciences (India)
Home; Fellowship. Fellow Profile. Elected: 1991 Honorary. Rees, Prof. Lord Martin (John) FRS. Date of birth: 23 June 1942. Address: Emeritus professor of Cosmology & Astrophysics, Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA, U.K.. Contact: Office: (+44-1223) 33 7548
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
John von Neumann selected letters
2005-01-01
John von Neuman was perhaps the most influential mathematician of the twentieth century, especially if his broad influence outside mathematics is included. Not only did he contribute to almost all branches of mathematics and created new fields, but he also changed post-World War II history with his work on the design of computers and with being a sought-after technical advisor to many figures in the U.S. military-political establishment in the 1940s and 1950s. The present volume is the first substantial collection of (previously mainly unpublished) letters written by von Neumann to colleagues, friends, government officials, and others. The letters give us a glimpse of the thinking of John von Neumann about mathematics, physics, computer science, science management, education, consulting, politics, and war. Readers of quite diverse backgrounds will find much of interest in this fascinating first-hand look at one of the towering figures of twentieth century science.
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Johns Hopkins Particulate Matter Research Center
Federal Laboratory Consortium — The Johns Hopkins Particulate Matter Research Center will map health risks of PM across the US based on analyses of national databases on air pollution, mortality,...
Patrice Loiez
1999-01-01
UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.
2003-01-01
Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003
Indian Academy of Sciences (India)
Thomas, Prof. Sir John Meurig FRS. Date of birth: 15 December 1932. Address: Department of Materials Science and, Metallurgy, New Museums Site, 27, Babbage ... Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the Three Science Academies of India on the teaching of the theory of evolution more.
Directory of Open Access Journals (Sweden)
Alútiz, Juan Carlos
2004-12-01
Full Text Available This article shows a global vision of the work of John Rawls, describing the evolution of his thought since his initial and original proposal of «Justice as Faimess», to his last contributions about Political Liberalism.
El presente artículo trata de ofrecer una visión panorámica de la obra de John Rawls, describiendo la evolución de su pensamiento desde su inicial y original propuesta de «Justicia como equidad», hasta sus últimas aportaciones en tomo al Liberalismo político
Vähesed head portfellihaldurid / John Mauldin
Mauldin, John
2005-01-01
USA investeerimisnõustaja olulisematest põhimõtetest ja -reeglitest portfellihaldurite valikul. Investeerimissüsteemi analüüsist, minevikutootluse väheolulisusest ja fondimaailmas ellujäämisvõimalustest. Vt. samas: John Maudlin
John Kjaer : Nõukogude Liitu ja euroliitu seob vaid sõna "liit" / John Kjaer ; interv. Tuuli Koch
Kjaer, John
2003-01-01
Euroopa Komisjoni delegatsiooni juht Eestis John Kjaer vastab küsimustele, mis puudutavad Edgar Savisaare kõnet Keskerakonna kongressil, kus ta võrdles NSV Liitu Euroopa Liiduga; peamisi erinevusi EL-i ja totalitaarriigi vahel, otsuste langetamise põhimõtteid EL-is
John Dewey--Philosopher and Educational Reformer
Talebi, Kandan
2015-01-01
John Dewey was an American philosopher and educator, founder of the philosophical movement known as pragmatism, a pioneer in functional psychology, and a leader of the progressive movement in education in the United States.
An Interview with John Liontas
Sadeghi, Karim
2017-01-01
John I. Liontas, Ph.D. is an associate professor of foreign languages, English for speakers of other languages (ESOL), and technology in education and second language acquisition (TESLA), and director and faculty of the TESLA doctoral program at the University of South Florida. Dr. Liontas is a distinguished thought leader, author, and…
Dr. John Marburger visits DESY
2003-01-01
Dr. John Marburger, Director of the United States Office of Science and Technology Policy, visited the research center DESY in Hamburg. The American physicist wanted to inform himself about the status of the TESLA X-ray laser and the TESLA linear collider as well as the international collaboration at DESY (1/2 page).
John Bell and the Identical Twins
1984-01-01
A biographical profile of John S.Bell is presented based on extensive interviews the author had with Bell. Bell’s vierws on the quantum theory are presented along with a simple explanation of his idenity.
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
Tribes of Men: John Joseph Mathews and Indian Internationalism
Lutenski, Emily
2012-01-01
In this article, the author discusses John Joseph Mathews and Indian internationalism. As an old man, Osage intellectual, writer, and historian, John Joseph Mathews recalled his expatriation from the United States during the 1920s. After growing up in Pawhuska, Oklahoma, seat of the Osage Nation, where he had been born in 1894 to a white mother…
MoKS teistes koostööprojektides / John Grzinich
Grzinich, John
2005-01-01
13. III Genfis toimunud helikunstiüritusest "VernalFLUX / Kevadvool", millest Eestist võtsid osa MoKS'i koordinaatorid John Grzinich ja Evelyn Müürsepp, nende performance'ist "Maaheli. Unustatud unistused". Uuest organisatsioonist Claudmirror, mis on välja andnud seitse CD-ROM-i, nende seas John Grzinichi CD-ROM-i "Võrdsed ja kauged jooned"
The manifesto as genre in Ibsen's John Gabriel Borkman
Directory of Open Access Journals (Sweden)
Christine Korte
2015-02-01
Full Text Available This article examines John Gabriel Borkman’s neo-aristocratic performance of power and authority in Ibsen’s eponymously titled play (1896. After his downfall, John Gabriel has retreated into his once grand reception hall wherein he has become like a petrified relic from a preceding era. His performance within the “fading glory” of the upstairs hall– a veritable theatre for his delusions of grandeur – is one of an outmoded type of bourgeois “hero” whose flagrantly illicit dealings are no longer tenable as capitalism becomes ever-more “rational” and bureaucratic in its façade. The article focuses on John Gabriel’s performance of a “sovereign” or charismatic authority and examines his future visions as “manifestos”. The manifesto is a form belonging to a feudal era of rule by divine right – one that is necessarily “theatrical” in its performance of a legitimate authority. Assuming the voice of the sovereign, John Gabriel attempts to address the needs of the iron-ore miners – a desiring, albeit latent force in Ibsen’s text. The desires of the workers, however, are continually effaced by the bewitching powers of capitalist abstraction, which account for the alienation of family and individuals in Ibsen’s play. Comparing John Gabriel’s manifesto with Marx and Engels’ Communist Manifesto not only accounts for the end of an age of neo-aristocratic bourgeois decadence, but also marks labour as the definitive socio-political issue of the late 19th century. Where John Gabriel uses a dramaturgy rooted in past models of rule to address the workers in his vision of a benevolent “kingdom”, the Communist Manifesto heralds the death of his class and replaces the voice of the “sovereign authority” with the self-authorising voice of the workers themselves. Borkman’s fatal flaw then is failing to sufficiently address the plight of the iron-ore miners with whom he claims intimate acquaintance but with whom
Directory of Open Access Journals (Sweden)
Marta Vaamonde Gamo
2016-07-01
Full Text Available This article demonstrates how feminism welcomed and was influenced by the pragmatism of John Dewey. While in real terms his impact on European feminism has been minimal, this was not the case in contemporary America. In this article we study both how Dewey’s ideas were received amongst American feminists, as well as certain aspects of his thinking that could be enormously useful in present-day debates between critical and postmodern feminists. We compare the Deweyan and feminist arguments against the traditional dualisms that acted as philosophical support for social inequality, paying particular attention to mind–body dualism, and the consequent undervaluation of physical and emotional wellbeing. We also show that John Dewey’s proposals were, in fact, more radical than those of the feminists of the day. Indeed, democracy has to be understood as a way of life that affects every dimension of experience, and is crucial to the personal and social growth that enables the unjust social inequalities between men and women to be overcome.
John Hejduk ja tema Wall House 2 = John Hejduk and his Wall House 2 / Vilen Künnapu
Künnapu, Vilen, 1948-
2010-01-01
Ameerika arhitekt John Hejdukist ja tema mõjust 20. sajandi lõpukümnendite arhitektuurimõttele. Ka 1973. aastal projekteeritud eramust Wall House 2, mis valmis alles 2001. aastal Groningenis. Kommentaar Soome arhitektuuriprofessor Juhani Pallasmaalt
Memorial—John A. Washington II, M.D.▿
2010-01-01
John A. Washington II, M.D., former Head of Clinical Microbiology at the Mayo Clinic from 1972 to 1986 and Chairman of the Department of Microbiology at the Cleveland Clinic from 1986 to 1992, died on 5 September 2010 at the age of 74. John was an internationally recognized, widely respected leader in the disciplines of clinical microbiology and infectious diseases, authoring more than 450 scientific articles, books, and book chapters and training scores of pathology residents and clinical mi...
John Smith - eesti kunstnik / Ants Juske
Juske, Ants, 1956-2016
2006-01-01
Marko Mäetamme ja Kaido Ole kollektiivsest loomingust, mida esitatakse John Smithi autorinime all, mõnda ka salapärase J. Smithi nn. biograafiast. Illustratsiooniks J. Smith'i "Jumalate maailm I (fragment). Õli, lõuend, 2002. Erakogu
Coy, Mary
2010-01-01
In their 2005 exhibit of John Biggers' work, the New Orleans Museum of Art described it as being inspired by "African art and culture, the injustices of a segregated United States, the stoic women in his own family, and the heroes of everyday survival." In this article, the author describes how her students reinterpreted Biggers' work.…
John Holt Stanway: Gone to Texas
Bryan, J.
2008-01-01
John Holt Stanway (1799Ð1872) was an amateur astronomer who lived in Manchester, England until 1845. He was in contact with the English Ôgrand amateurÕ astronomer, William Henry Smyth, who supported him for Fellowship of the Royal Astronomical Society and evidently advised him on how to build and equip an observatory. Apparently, Stanway had an observatory at Chorlton-cum-Hardy in 1837. In 1845, Stanway left for the United States in response to serious business problems. En route, he met Ashbel Smith, a representative of the government of the Republic of Texas, who convinced Stanway to go to Texas. There he changed his name to John H. Smythe Stanley and settled in Houston, where he re-established his observatory. He became a commercial photographer and wrote about astronomy and other scientific subjects in Houston newspapers until his death in 1872.
77 FR 2317 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2012-01-17
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a... Columbia,'' tracing the 1607-1609 voyages of Captain John Smith to chart the land and waterways of the...
76 FR 26767 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2011-05-09
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...
77 FR 12324 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2012-02-29
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...
76 FR 52691 - Captain John Smith Chesapeake National Historic Trail Advisory Council
2011-08-23
... DEPARTMENT OF THE INTERIOR National Park Service Captain John Smith Chesapeake National Historic... that the Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...
A Summary of the Technical Pilot Selection Literature
2011-10-01
Thorndike -Kelly Athletic Interest Inventory ...............................................6 Developing Apparatus-based Pilot Selection Tests—Spring, 1917...chaired by H.E. Burtt, followed by G. Stratton, and finally by E.L. Thorndike (Yerkes, 1919). This committee also included John B. Watson, Warner...World War I was the Mental Alertness Test, which was developed by E.L. Thorndike . Thorndike (1919) realized that success as a military pilot required
Kaminsky, James S.
2010-01-01
It is argued here that understanding John Dewey's thought as that of a prodigal liberal or a fellow traveller does not capture the complexity of his work. It is also important to recognise the portion of his work that is "historie morale." In the very best sense it is epic, encapsulating the hopes and dreams of a history of the American people in…
Williams, Jerry L.
2016-01-01
This essay examines the poetry of John Dewey, 101 poems in total. Characteristic of the rhymed and metered poetry of the period, they show a very human side of Dewey. This analysis argues that many of his poems deal with existential themes--love, finitude, and God, for example. On a deeper level these poems are also show connections to Dewey's…
John Deweys kritik af liberal education
DEFF Research Database (Denmark)
Huggler, Jørgen
2017-01-01
The paper deals with John Dewey's aversion against liberal education and his concern about a 'dual track' educational system separating liberal education and vocational education. It investigates the reason why Dewey maintains that the philosophical 'dualisms' culminate in the question on vocation....
Commemorating John F. MacDonald and the Art of Being a Mentor.
Jackson, Michael F; Prado, Vania F; Prado, Marco A M
2016-09-01
John F. MacDonald was a close friend and mentor whose life was ended far too soon on April 22, 2014. To those who knew him, John was an endearing blend of fiery Scotsman, compassionate socialist, dedicated family man, and tireless investigator. Those close to him valued his loyalty and friendship, relished his biting wit, and puzzled at his self-deprecating manner. His career spanned a remarkable period of discovery from the early identification of excitatory amino acid, to the molecular cloning and characterization of glutamate receptors and the elucidation of mechanisms responsible for regulating their function. A true pioneer in each of these areas, John's research has had a lasting impact on our understanding of excitatory synaptic transmission and its plasticity. Our intent in commemorating John's work is to focus on some notable discoveries that highlight the impact and innovative aspects of John's work. In doing so, we also wish to highlight just how greatly our understanding of the glutamate transmitter systems has advanced since the late 1970s, when John first launched his independent neuroscience career.
John Dewey, William Wirt and the Gary Schools Plan: A Centennial Reappraisal
Thorburn, Malcolm
2017-01-01
A century on from the height of John Dewey's educational writings and the reputation of the Gary Schools Plan as a model of progressive education, the paper reappraises two key matters: the relationship between John Dewey and William Wirt, the first superintendent of the Gary Schools in Gary Indiana, and the coherence between John Dewey's…
Charles Darwin and John Herschel
Warner, B.
2009-11-01
The influence of John Herschel on the philosophical thoughts of Charles Darwin, both through the former's book, Natural Philosophy, and through their meeting in 1836 at the Cape of Good Hope, is discussed. With Herschel having himself speculated on evolution just a few months before he met Darwin, it is probable that he stimulated at least the beginnings of the latter's lifelong work on the subject.
Celebrating the Life and Legacy of Dr. John Hope Franklin
Harris, Robert L., Jr.; Levering-Lewis, David; French, John D.; Wharton, Clifton R., Jr.
2009-01-01
Dr. John Hope Franklin chronicled the experiences of African-Americans like no one before him, forcing America to recognize Black history as American history. His contributions were innumerable and his impact was abiding. In celebration of his life and legacy, the authors profile the celebrated scholar and activist, Dr. John Hope Franklin.
John Napier life, logarithms, and legacy
Havil, Julian
2014-01-01
John Napier (1550–1617) is celebrated today as the man who invented logarithms—an enormous intellectual achievement that would soon lead to the development of their mechanical equivalent in the slide rule: the two would serve humanity as the principal means of calculation until the mid-1970s. Yet, despite Napier’s pioneering efforts, his life and work have not attracted detailed modern scrutiny. John Napier is the first contemporary biography to take an in-depth look at the multiple facets of Napier’s story: his privileged position as the eighth Laird of Merchiston and the son of influential Scottish landowners; his reputation as a magician who dabbled in alchemy; his interest in agriculture; his involvement with a notorious outlaw; his staunch anti-Catholic beliefs; his interactions with such peers as Henry Briggs, Johannes Kepler, and Tycho Brahe; and, most notably, his estimable mathematical legacy. Julian Havil explores Napier’s original development of logarithms, the motivations for his approa...
Jesus, moral regeneration and crime in the Gospel of John | Ras ...
African Journals Online (AJOL)
A structural and text-immanent approach to the Gospel of John reveals that ... regeneration, is, anthropologically-speaking, according to the rational-choice ... In terms of the explicatio-applicatio model, the intended kerygmatic message of John ...
International Nuclear Information System (INIS)
Stafford, G.H.
1986-01-01
This is the biography of a man obviously much liked and respected. It gives some personal details but is mainly concerned with his scientific work and achievements on major projects. Thus, some background information on those projects is also given as a context to the work of John Adams. The biography is written in sections; early years, the creation of CERN, Adams at CERN 1953-61, Adams and thermonuclear research 1958-69, (which includes his Directorship of the Culham Laboratory), Adams and the Ministry of Technology 1965-66, member for research of the UK Atomic Energy Authority 1966-69, Adams at CERN 1969-84 (as Director General of the SPS, as Executive Director-General of CERN 1979-81 and work at CERN up to 1984). (UK)
International Nuclear Information System (INIS)
Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt
2000-01-01
This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds
Geologic setting of the John Day Country, Grant County, Oregon
Thayer, Thomas P.
1977-01-01
One of the Pacific Northwest's most notable outdoor recreation areas, the "John Day Country" in northeastern Oregon, is named after a native Virginian who was a member of the Astor expedition to the mouth of the Columbia River in 1812. There is little factual information about John Day except that he was born in Culpeper County, Virginia, about 1770. It is known also that in 1810 this tall pioneer "with an elastic step as if he trod on springs" joined John Jacob Astor's overland expedition under Wilson Price Hunt to establish a vast fur-gathering network in the Western States based on a major trading post at the mouth of the Columbia River.
In Memoriam: Dr. Frank John Fenner
Centers for Disease Control (CDC) Podcasts
This podcast reflects on one of the greatest pioneers in virology, Dr. Frank John Fenner. Dr. Frederick Murphy, a member of EID's editorial board and the Institute of Medicine, and professor of Pathology at the University of Texas Medical Branch in Galveston, shares professional and personal stories of Dr. Frank Fenner.
El último libro de John Strachey
Directory of Open Access Journals (Sweden)
Helcías Martán Góngora
1965-08-01
Full Text Available Fue muy largo el sendero ideológico que hubo de recorrer el inglés John Strachey en la busqueda íntima de una respuesta a su inquirir constante. En su viaje interior escuchó, a la siniestra, también la voz de las sirenas socialistas.
Directory of Open Access Journals (Sweden)
ARTURO CLAVIJO A.
2013-01-01
Full Text Available Según el conductismo, el comportamiento constituye la Psique y el tema de estudio de la psicología. Aunque algunos científicos habían realizado trabajos empíricos con métodos objetivos antes de 1913, año en el que John B. Watson publicó su manifiesto, este último fue el primero en intentar la sistematización de la conducta como equivalente a la Psique, esto es, como el objeto de estudio de la psicología. El artículo discute la noción de comportamiento de Watson y la compara con otras dos formas de conductismo: el conductismo radical de Skinner y el conductismo molar, con el fin de ilustrar la forma en que el concepto de comportamiento ha cambiado y sigue cambiando.
St. John Shallow-water Ground Validation Sites
National Oceanic and Atmospheric Administration, Department of Commerce — Benthic habitat maps of the nearshore marine environment of St. John, U.S. Virgin Islands were created by visual interpretation of remotely sensed imagery. The...
Brice, Maximilien
2014-01-01
Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO
Memories of John N. Brady: scientist, mentor and friend
Directory of Open Access Journals (Sweden)
Marriott Susan J
2009-05-01
Full Text Available Abstract Friends and colleagues remember John N. Brady, Ph.D., Chief of the Virus Tumor Biology Section of the Laboratory of Cellular Oncology, who died much too young at the age of 57 on April 27, 2009 of colon cancer. John grew up in Illinois and received his Ph.D. with Dr. Richard Consigli at Kansas State University studying the molecular structure of polyomavirus. In 1984 John came to the National Institutes of Health as a Staff Fellow in the laboratory of Dr. Norman Salzman, Laboratory of Biology of Viruses NIAID, where he was among the first to analyze SV40 transcription using in vitro transcription systems and to analyze regulatory sequences for SV40 late transcription. He then trained with Dr. George Khoury in the Laboratory of Molecular Virology NCI, where he identified SV40 T-antigen as a transcriptional activator protein. His research interests grew to focus on the human retroviruses: human T-cell lymphotropic virus type I (HTLV-I and human immunodeficiency virus (HIV, analyzing how interactions between these viruses and the host cell influence viral gene regulation, viral pathogenesis and viral transformation. His research also impacted the fields of eukaryotic gene regulation and tumor suppressor proteins. John is survived by his wife, Laraine, and two sons, Matt and Kevin.
2008 St. Johns County, FL Countywide Lidar
National Oceanic and Atmospheric Administration, Department of Commerce — Airborne terrestrial LiDAR was collected for St. Johns County, FL. System Parameters/Flight Plan. The LiDAR system acquisition parameters were developed based on a...
John Malkovich ikka oskab / Kätlin Kaldmaa
Kaldmaa, Kätlin, 1970-
2006-01-01
Edinburghi filmifestivalil esilinastus "Colour Me Kubrick" (stsenarist Anthony Frewin, režissöör Brian Cook, peaosas John Malkovich) mehest, kes režissööri eluajal 1996.a. esines Stanley Kubrick'una
We, John Dewey's Audience of Today
da Cunha, Marcus Vinicius
2016-01-01
This article suggests that John Dewey's "Democracy and Education" does not describe education in an existing society, but it conveys a utopia, in the sense coined by Mannheim: utopian thought aims at instigating actions towards the transformation of reality, intending to attain a better world in the future. Today's readers of Dewey (his…
John Dewey on Philosophy and Childhood
Gregory, Maughn; Granger, David
2012-01-01
John Dewey was not a philosopher of education in the now-traditional sense of a doctor of philosophy who examines educational ends, means, and controversies through the disciplinary lenses of epistemology, ethics, and political theory, or of agenda-driven schools such as existentialism, feminism, and critical theory. Rather, Dewey was both an…
Atmintis ir sielvartas John Banville romane „Jūra“
Vaičiulaitytė, Giedrė
2016-01-01
Memory and Grief in John Banville’s Novel “The Sea” John Banville‘s novel The Sea (2005) details the journey of a retired art historian Max while he navigates through his memories and places from his childhood after the untimely death of his wife. Therefore, the focus of this BA paper is revealing the grief within the narrative and unveiling the relationship between memory, place and identity. The meticulous style of narration, attention to smallest details and the narrator‘s emotional detach...
The History of Heart Surgery at The Johns Hopkins Hospital.
Patel, Nishant D; Alejo, Diane E; Cameron, Duke E
2015-01-01
Johns Hopkins has made many lasting contributions to cardiac surgery, including the discovery of heparin and the Blalock-Taussig Shunt, which represents the dawn of modern cardiac surgery. Equally important, Johns Hopkins has trained some of the world's leaders in academic cardiac surgery, and is committed to training the future leaders in our specialty. Copyright © 2015. Published by Elsevier Inc.
John Glenn Biomedical Engineering Consortium
Nall, Marsha
2004-01-01
The John Glenn Biomedical Engineering Consortium is an inter-institutional research and technology development, beginning with ten projects in FY02 that are aimed at applying GRC expertise in fluid physics and sensor development with local biomedical expertise to mitigate the risks of space flight on the health, safety, and performance of astronauts. It is anticipated that several new technologies will be developed that are applicable to both medical needs in space and on earth.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
de Prunele, E.
1983-01-01
The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
John Paul College: The Professional Renewal Journey
Directory of Open Access Journals (Sweden)
Pauline Mundie
2014-09-01
Full Text Available John Paul College, a K-12 School in Queensland, Australia, recognises the centrality of classroom teachers to the ongoing improvement of student outcomes. The college has implemented a multi-tiered professional renewal and assessment process. These changes of emphasis are the result of significant research and subsequent/associated professional discussion and were supported during the EBA decision-making in 2012. The professional renewal process at John Paul College guides teachers through a cycle of goal setting (related to any aspect of teacher practice which aims to improve student learning and achievement; ongoing discussion between the teacher and a mentor which determines actions; directed classroom observations (3 per term and associated pre and post reflection/discussion; leading to application of changed practice toward achieving the criteria of the goals. The principles of the professional renewal program are to: enhance development along accepted school-wide, team and department goals; encourage professional pedagogical reflections and conversations with a colleague/mentor; motivate improved performance and highlight the next steps in a teacher’s development. Through the introduction of professional renewal, attestation and exemplary teacher processes, the leadership and teachers of John Paul College have achieved an appropriate and innovative balance between self-directed, peer supported/directed and college-wide, strategic initiatives. Each member of the teaching team, from graduate to senior leaders are actively engaged in personalised programs of professional growth which is specifically aimed at improved learning and outcomes of the college’s students.
DEFF Research Database (Denmark)
Svensson, Palle
Over recent years there has been a tendency to present John Locke as an equalitarian democrat (Ashcraft) and being close to the political views of the levellers (Waldron). This is not a completely new interpretation (Kendall, 1941), but contrasts with the prevalent view presented in textbooks (......, criteria for a democratic process, and the institutions of polyarchy. The conclusion has implications for the relationship between political liberalism and constitutionalism on the one hand and democracy on the other....
Jean Piaget's Debt to John Dewey
Tanner, Daniel
2016-01-01
Jean Piaget became a veritable institution unto himself in education and psychology, largely as the result of his developmental-stage theory advanced over the second quarter of the twentieth century. Not until Piaget was 73 did he make mention of John Dewey's work at Dewey's laboratory school, founded in 1894 at the University of Chicago. But here…
Bathymetry (2011) for Fish Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Fish Bay, St. John in the U.S. Virgin Islands (USVI). The...
Bathymetry (2011) for Coral Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Coral Bay, St. John in the U.S. Virgin Islands (USVI). The...
A Conversation with John Nelder
Senn, Stephen
2003-01-01
John Ashworth Nelder was born in 1924 in Dulverton, Somerset, England. He received his secondary education in nearby Tiverton at Blundell's, a "public" [that is to say, privately funded] school that he attended as a day pupil. In 1942, he entered Sidney Sussex College, Cambridge University, to read mathematics. His studies were interrupted after one year by war service and he trained as an RAF navigator in South Africa. He returned to Cambridge in 1946 and complete his studies, graduating a "...
Astronaut John Glenn Enters Friendship 7
1962-01-01
Astronaut John Glenn enters the Mercury spacecraft, Friendship 7, prior to the launch of MA-6 on February 20, 1961 and became the first American who orbited the Earth. The MA-6 mission was the first manned orbital flight boosted by the Mercury-Atlas vehicle, a modified Atlas ICBM (Intercontinental Ballistic Missile), lasted for five hours, and orbited the Earth three times.
John Dewey's Visits to Hawai'i
McEwan, Hunter
2015-01-01
John Dewey visited Hawai'i on three separate occasions. Of all three trips, by far the most important, as far as Dewey's influence on education in Hawai'i is concerned, was in 1899 when he came with his wife, Alice Chipman Dewey, to help launch the University Extension program in Honolulu. The Deweys' second trip was a very brief one--twenty years…
Läänemere kallastel / John Allyne Gade ; tõlk. Jonatan Heinap
Gade, John Allyne
2008-01-01
USA erivoliniku John Allyne Gade mälestused 1919. aasta külaskäigust Eestisse. Siin tegutses ta USA valitsuse vahemehena uue Eesti valitsuse, Eesti sõjaväe ning Vene valgete loodearmee vahel. Eestile osutatud teenete eest on ta autasustatud Eesti Vabadusristiga. - Lisa: Eric A. Johnson. John Allyne Gade. Lk. 300-301
Directory of Open Access Journals (Sweden)
Jean Berton
2009-07-01
Full Text Available This article aims to show how far Hogg’s archetypal character, Gil-Martin, influenced Charlotte Brontë’s enigmatic character, St. John, who appears in chapters XXVI to XXXV and is mentioned again in the conclusion of Jane Eyre. Some unexpected words, like “glen”, in a greater Yorkshire area, operate as keywords to a “deep context” study in a neo-contextualist approach. Even though St. John cannot be mistaken for a double of Gil-Martin, a fair number of details tend to prove that James Hogg’s Private Memoirs and Confessions of a Justified Sinner deeply influenced Charlotte Brontë—both pride-driven St. John and Gil-Martin stand for demonic despotism. Yet, if Gil-Martin is a straightforward Gothic illustration of Satan, St. John is a reincarnation of a marble-cold Apollo in a dogma-trapped Calvinist. Brontë’s intention was not so much to denounce noxious excesses in religious beliefs as to set her heroine’s wise independence against nefarious male domination: whereas victimised Robert Wringhim is driven to despair and suicide, self-reliant Jane Eyre escapes from St. John’s grip. In both narratives relationships between men and women are shown as tragically warped by religious behavioural extravagance, but only the female character is granted a positive outcome to serve an optimistic view on life: Robert Wringhim is violently wrung out of the society of men and women, St. John Rivers, from “Marsh End”, blindly drifts away to his death in India, and airy Jane, of “Moor House”, wafts away to anchor to Edward Rochester, the sender of the airwave-born call.
Preparing for Citizenship: Bring Back John Dewey
Pring, Richard
2016-01-01
The paper traces the development of citizenship in the curriculum in England since the 1960s, emerging particularly from the Crick report. It argues for lessons to be learnt from John Dewey's "Democracy and education", the centenary of which is being celebrated this year.
INDUSTRIAL RELATIONS IN THE PERSPECTIVE OF JUSTICE THEORY BY JOHN RAWLS
Directory of Open Access Journals (Sweden)
Ari Hernawan
2014-11-01
Full Text Available Conflict of interest between employee and employer has a complexity since its biopsychology and sosioeconomic in nature. As its implication, it is difficult to create a consensus between two different interest within a legal perspective. Justice theory by John Rawls has answered the respective problem by giving legal priority upon the group of people who have less capacity in sosial and economic. According to John Rawls, law shall give orientation toward marginalized group. In industrial relations, law shall take side upon the employee who are in subordinate position. Pertentangan kepentingan antara pekerja dan pengusaha memiliki kompleksitas karena bersifat biopsikologis dan sosio-ekonomi. Sebagai implikasinya, sulit mempertemukan dua kepentingan yang berbeda tersebut dalam satu rumusan hukum. Teori keadilan dari John Rawls telah menjawab persoalan tersebut dengan memberi prioritas hukum kepada orang-orang yang secara sosial ekonomi kurang beruntung. Hukum menurut John Rawls harus berorientasi kepada kelompok marjinal. Dalam hubungan industrial, hukum harus berpihak kepada pekerja yang berada dalam posisi subordinat.
INDUSTRIAL RELATIONS IN THE PERSPECTIVE OF JUSTICE THEORY BY JOHN RAWLS
Directory of Open Access Journals (Sweden)
Ari Hernawan
2014-11-01
Full Text Available Conflict of interest between employee and employer has a complexity since its biopsychology and sosioeconomic in nature. As its implication, it is difficult to create a consensus between two different interest within a legal perspective. Justice theory by John Rawls has answered the respective problem by giving legal priority upon the group of people who have less capacity in sosial and economic. According to John Rawls, law shall give orientation toward marginalized group. In industrial relations, law shall take side upon the employee who are in subordinate position. Pertentangan kepentingan antara pekerja dan pengusaha memiliki kompleksitas karena bersifat biopsikologis dan sosio-ekonomi. Sebagai implikasinya, sulit mempertemukan dua kepentingan yang berbeda tersebut dalam satu rumusan hukum. Teori keadilan dari John Rawls telah menjawab persoalan tersebut dengan memberi prioritas hukum kepada orang-orang yang secara sosial ekonomi kurang beruntung. Hukum menurut John Rawls harus berorientasi kepada kelompok marjinal. Dalam hubungan industrial, hukum harus berpihak kepada pekerja yang berada dalam posisi subordinat.
John Stuart Mill: utilitarismo e liberalismo = John Stuart Mill: utilitarianism and liberalism
Directory of Open Access Journals (Sweden)
Simões, Mauro Cardoso
2013-01-01
Full Text Available Meu objetivo, neste trabalho, é investigar a compatibilidade das teses utilitaristas e liberais de John Stuart Mill. Apresentarei, inicialmente, os principais críticos da filosofia moral e política de Mill, para os quais o discípulo de Bentham teria abandonado o utilitarismo ou, ainda, não esclarecido suficientemente seu princípio da liberdade, o que o tornaria um pensador assistemático e inconsistente. Minha tese é contrária a tais interpretações, uma vez que sustenta ser Mill consistente. Em seguida, defenderei uma interpretação do princípio da liberdade e da individualidade, procurando demonstrar que seu utilitarismo é compatível com seu liberalismo
Nietzsche, autobiography, history: mourning and Martin and John.
Champagne, J
1998-01-01
How might gay and lesbian literature be read not as a mimetic representation of homosexuality, but as an activity linked to problems of subjectivity and historiography? Reading Dale Peck's novel Martin and John alongside passages from Friedrich Nietzsche's "On the Uses and Disadvantages of History for Life" and Sigmund Freud's "Mourning and Melancholia," this essay argues for an understanding of Peck's text as an attempt to link two apparently different processes of import to contemporary gay male subjects in particular: the writing of what Nietzsche terms "critical history," and the mourning of those lost to HIV disease. It concludes by linking Martin and John to feminist critiques of identity and traditional historiography, as well as noting the connection between these two critiques.
The Bildungsroman in Cameroon Anglophone Literature: John ...
African Journals Online (AJOL)
This paper investigates the bildungsroman genre in postcolonial Cameroon Anglophone fiction through a textual analysis of John Nkemngong Nkengasong's Across the Mongolo and Margaret Afuh's Born before Her Time. It seeks to show that these two writers have borrowed a foreign genre and successfully manipulated ...
John White on Philosophy of Education and Philosophy
Siegel, Harvey
2014-01-01
John White offers a provocative characterization of philosophy of education. In this brief reaction, I evaluate the characterization and urge the maintenance of a strong connection between philosophy of education and philosophy.
Bandyopadhyay, D; Bhattacharyya, D
2006-10-15
It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Taylor, C.R.; Hawk, J.L.M. [St Thomas` Hospital, London (United Kingdom). St John`s Institute of Dermatology
1995-12-01
Our 10-year experience with PUVA treatment for alopecia areata, partialis, totalis and universalis was retrospectively reviewed using charts and follow-up questionnaires for 70 patients at St John`s Institute of Dermatology. In all cases, several previous therapies were judged to be unsatisfactory prior to starting PUVA, and many cases were already deemed clinically refractory prior to referral for PUVA. If cases of vellus hair growth are excluded, and those who lost their PUVA-induced regrowth rapidly on follow-up, the effective success rate was at best 6.3% for alopecia areata partialis, 12.5% for alopecia areata totalis and 13.3% for alopecia areata universalis. We affirm that PUVA is generally not an effective treatment for alopecia areata. (Author).
The Trieste Lecture of John Stewart Bell
Energy Technology Data Exchange (ETDEWEB)
Bassi, Angelo; Ghirardi, GianCarlo
2007-03-23
Delivered at Trieste on the occasion of the 25th Anniversary of the International Centre for Theoretical Physics, 2 November 1989. The video of this lecture is available here. Please see the PDF for the transcript of the lecture. General remarks by Angelo Bassi and GianCarlo Ghirardi During the autumn of 1989 the International Centre for Theoretical Physics, Trieste, celebrated the 25th anniversary of its creation. Among the many prestigious speakers, who delivered extremely interesting lectures on that occasion, was the late John Stewart Bell. All lectures have been recorded on tape. We succeeded in getting a copy of John's lecture. In the lecture, many of the arguments that John had lucidly stressed in his writings appear once more, but there are also extremely interesting new remarks which, to our knowledge, have not been presented elsewhere. In particular he decided, as pointed out by the very choice of the title of his lecture, to call attention to the fact that the theory presents two types of difficulties, which Dirac classified as first and second class. The former are those connected with the so-called macro-objectification problem, the latter with the divergences characterizing relativistic quantum field theories. Bell describes the precise position of Dirac on these problems and he stresses appropriately how, contrary to Dirac's hopes, the steps which have led to a partial overcoming of the second class difficulties have not helped in any way whatsoever to overcome those of the first class. He then proceeds to analyse the origin and development of the Dynamical Reduction Program and draws attention to the problems that still affect it, in particular that of a consistent relativistic generalization. When the two meetings Are there quantum jumps? and On the present status of Quantum Mechanics were organized in Trieste and Losinj (Croatia), on 5-10 September 2005, it occurred to us that this lecture, which has never been published, might represent
The Trieste Lecture of John Stewart Bell
International Nuclear Information System (INIS)
Bassi, Angelo; Ghirardi, GianCarlo
2007-01-01
Delivered at Trieste on the occasion of the 25th Anniversary of the International Centre for Theoretical Physics, 2 November 1989. The video of this lecture is available here. Please see the PDF for the transcript of the lecture. General remarks by Angelo Bassi and GianCarlo Ghirardi During the autumn of 1989 the International Centre for Theoretical Physics, Trieste, celebrated the 25th anniversary of its creation. Among the many prestigious speakers, who delivered extremely interesting lectures on that occasion, was the late John Stewart Bell. All lectures have been recorded on tape. We succeeded in getting a copy of John's lecture. In the lecture, many of the arguments that John had lucidly stressed in his writings appear once more, but there are also extremely interesting new remarks which, to our knowledge, have not been presented elsewhere. In particular he decided, as pointed out by the very choice of the title of his lecture, to call attention to the fact that the theory presents two types of difficulties, which Dirac classified as first and second class. The former are those connected with the so-called macro-objectification problem, the latter with the divergences characterizing relativistic quantum field theories. Bell describes the precise position of Dirac on these problems and he stresses appropriately how, contrary to Dirac's hopes, the steps which have led to a partial overcoming of the second class difficulties have not helped in any way whatsoever to overcome those of the first class. He then proceeds to analyse the origin and development of the Dynamical Reduction Program and draws attention to the problems that still affect it, in particular that of a consistent relativistic generalization. When the two meetings Are there quantum jumps? and On the present status of Quantum Mechanics were organized in Trieste and Losinj (Croatia), on 5-10 September 2005, it occurred to us that this lecture, which has never been published, might represent an
Directory of Open Access Journals (Sweden)
Lamberto Amistadi
2014-05-01
Full Text Available Un disegno di John Hejduk è l'occasione per riflettere sul rapporto tra ideazione, rappresentazione e realizzazione dell'opera di architettura, seguendo i ragionamenti del maestro americano. Attraverso i mezzi che le sono propri, walls, roofs, boundaries, l'immagine architettonica ha la capacità di evocare e richiamare il senso profondo di situazioni inattese, “rinfrescare” la nostra visione delle cose contro il pericolo dell'automatizzazione. Ne esce un quadro in cui, nel circolo creativo che coinvolge artefice e fruitore, la realtà dell'architettura contribuisce per la sua parte al progetto di “fabbricazione del mondo”. / A drawing by John Hejduk is an opportunity to reflect on the relationship between the creation, representation and realisation of a work of architecture, following the reasoning of the American maestro. Through its own means - walls, roofs, boundaries - the architectural image has the capacity to evoke and invoke the profound sense of unexpected situations, to "refresh" our vision of things against the danger of automation. What emerges is a scenario in which, in the creative circle involving maker and spectator, the reality of architecture contributes to its part in the project of "manufacturing the world"
John Greenleaf's life of science.
Watenpaugh, Donald E
2012-12-01
This article summarizes the life and career of John E. Greenleaf, PhD. It complements an interview of Dr. Greenleaf sponsored by the American Physiological Society Living History Project found on the American Physiological Society website. Dr. Greenleaf is a "thought leader" and internationally renowned physiologist, with extensive contributions in human systems-level environmental physiology. He avoided self-aggrandizement and believed that deeds rather than words define one's legacy. Viewed another way, however, Greenleaf's words define his deeds: 48% of his 185 articles are first author works, which is an unusually high proportion for a scientist of his stature. He found that writing a thorough and thoughtful discussion section often led to novel ideas that drove future research. Beyond Greenleaf's words are the many students, postdocs, and collaborators lucky enough to have worked with him and thus learn and carry on his ways of science. His core principles included the following: avoid research "fads," embrace diversity, be the first subject in your own research, adhere to rules of fiscal responsibility, and respect administrative forces-but never back down from them when you know you are right. Greenleaf's integrity ensured he was usually right. He thrived on the axiom of many successful scientists: avoid falling in love with hypotheses, so that when unexpected findings appear, they arouse curiosity instead of fear. Dr. Greenleaf's legacy will include the John and Carol Greenleaf Award for prolific environmental and exercise-related publication in the Journal of Applied Physiology.
John Dewey in the 21st Century
Williams, Morgan K.
2017-01-01
John Dewey was a pragmatist, progressivist, educator, philosopher, and social reformer (Gutek, 2014). Dewey's various roles greatly impacted education, and he was perhaps one of the most influential educational philosophers known to date (Theobald, 2009). Dewey's influence on education was evident in his theory about social learning; he believed…
Development of a novel oral vaccine against Mycobacterium avium paratuberculosis and Johne disease
Johnston, C; Coffey, A; Sleator, RD
2010-01-01
Mycobacterium avium subsp. paratuberculosis (MAP) is the etiological agent of Johne disease, a granulomatous enteritis of cattle and other domesticated and wild ruminant species. Johne disease is prevalent worldwide and has a significant impact on the global agricultural economy. Current vaccines against Johne are insufficient in stemming its spread, and associated side-effects prevent their widespread use in control programs. Effective and safe vaccine strategies are needed. The main purpose of this paper is to propose and evaluate the development of a novel oral subunit-vaccine using a patho-biotechnological approach. This novel strategy, which harnesses patho-genetic elements from the intracellular pathogen Listeria monocytogenes, may provide a realistic route towards developing an effective next generation subunit vaccine against Johne disease and paratuberculosis. PMID:21326921
Sundelevitsh, Ilja
2003-01-01
John Smithi (Marko Mäetamm ja Kaido Ole) näitusest Tallinna Kunstihoones. John Smithi biograafia. Sirje Helme koostatud näitusest "Leidlaps" galeriis 008 (Tallinna Viru keskuses kaupluse Sity Sokos tühjaksjäänud ruumides). Esile tõstetud Jüri Kase töid
PH Department
2010-01-01
13 December 2010 14:30 - Council Chamber, Bldg.503-1-001 Accelerator Breakthroughs, Achievements and Lessons from the Tevatron Collider V. Shiltsev / Fermilab’s Accelerator Physics Centre This year we celebrate the 25th anniversary of the first proton-antiproton collisions in the Tevatron. For two and a half decades the Tevatron at Fermilab (Batavia, IL, USA) was a centerpiece of the US and world’s High Energy Physics as the world’s highest energy particle collider at 1.8 TeV center of mass energy. While funding agencies are deciding on a 3-year extension of the Collider Run II operation through 2014, we – in this 2010 John Adams Lecture - will take a look in exciting story of the Tevatron: the story of long preparations, great expectations, numerous difficulties, years of “blood and sweat”, continuous upgrades, exceeding original goals (by a factor of 400) and high emotions. An accelerator scientist prospective will be given on a wide spectrum o...
The Johns Hopkins Hospital: A Summer Internship
Smith, Adam
2016-01-01
Adam Smith, a native of Richmond, Indiana, is an advanced pharmacy practice student in the College of Pharmacy at Purdue University. In this article, he describes how career exploration through a summer internship with The Johns Hopkins Hospital in Baltimore, Maryland solidified his desire to pursue a career in pharmacy administration.
Process and progress: John Hughlings Jackson's philosophy of science.
Jacyna, L Stephen
2011-10-01
Some scepticism has been voiced over whether the work of John Hughlings Jackson possesses any significant philosophical orientation. This article argues that Hughlings Jackson was acquainted with the work of a wide range of philosophers. In particular, certain aspects of the writings of John Stuart Mill are reflected in Hughlings Jackson's own work. From early in his career, Hughlings Jackson adopted a critical stance in his neurological papers, seeking to expose shortcomings in the conventional practices of his peers and urging greater methodological rigour and sophistication in order to advance their science. This critical and 'procedurist' bias endows Hughlings Jackson's writings with a characteristically modern character.
Directory of Open Access Journals (Sweden)
Siddharth Jain
Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.
33 CFR 165.720 - Safety/Security Zone: St. Johns River, Jacksonville, FL.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Safety/Security Zone: St. Johns... OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY REGULATED NAVIGATION AREAS AND LIMITED... § 165.720 Safety/Security Zone: St. Johns River, Jacksonville, FL. (a) Location. The water and the land...
Filsafat Multikulturalisme John Rawls
Directory of Open Access Journals (Sweden)
Rina Rehayati
2012-12-01
Full Text Available Terjadinya konflik horizontal yang mengatasnamakan identitas kelompok (etnis, suku, keyakinan dan seterusnya dikarenakan adanya phobia terhadap perbedaan. Padahal perbedaan suatu keniscayaan, karena manusia tidak akan mampu menyeragamkan atau menuntut orang lain untuk sama dengan dirinya, baik pada aspek pemikiran, keyakinan, etnis, suku, budaya, dan sebagainya. Filsafat multikulturalisme John Rawls merupakan alternatif tawaran politik kebudayaan untuk mengatasi konflik horizontal. Menurut Rawls, suatu masyarakat yang adil bukanlah hanya menjamin “the greatest happiness for the greatest number” yang selama ini terkenal dalam prinsip demokrasi. Tetapi, masyarakat yang adil menurutnya adalah adanya pengakuan dan penerimaan terhadap perbedaan dan keberagaman. Pendapatnya ini dia rangkai dalam pokok-pokok pemikirannya tentang keadilan, seperti: Justice as Fairness, Veil of Ignorance, Principle of Equal Liberty, Maximin Rule, Lexical Order dan Reflective Equilibrium.
John R. Commons: Pioneer in Labor Economics.
Barbash, Jack
1989-01-01
John R. Commons has contributed in one way or another to pratically every piece of social and labor legislation that has been enacted in the twentieth century. He has made his mark on such diverse aspects of American labor as apprenticeship, vocational education, workers' compensation, and the administration of labor law. (Author/JOW)
MPI Enhancements in John the Ripper
International Nuclear Information System (INIS)
Sykes, Edward R; Lin, Michael; Skoczen, Wesley
2010-01-01
John the Ripper (JtR) is an open source software package commonly used by system administrators to enforce password policy. JtR is designed to attack (i.e., crack) passwords encrypted in a wide variety of commonly used formats. While parallel implementations of JtR exist, there are several limitations to them. This research reports on two distinct algorithms that enhance this password cracking tool using the Message Passing Interface. The first algorithm is a novel approach that uses numerous processors to crack one password by using an innovative approach to workload distribution. In this algorithm the candidate password is distributed to all participating processors and the word list is divided based on probability so that each processor has the same likelihood of cracking the password while eliminating overlapping operations. The second algorithm developed in this research involves dividing the passwords within a password file equally amongst available processors while ensuring load-balanced and fault-tolerant behavior. This paper describes John the Ripper, the design of these two algorithms and preliminary results. Given the same amount of time, the original JtR can crack 29 passwords, whereas our algorithms 1 and 2 can crack an additional 35 and 45 passwords respectively.
MPI Enhancements in John the Ripper
Sykes, Edward R.; Lin, Michael; Skoczen, Wesley
2010-11-01
John the Ripper (JtR) is an open source software package commonly used by system administrators to enforce password policy. JtR is designed to attack (i.e., crack) passwords encrypted in a wide variety of commonly used formats. While parallel implementations of JtR exist, there are several limitations to them. This research reports on two distinct algorithms that enhance this password cracking tool using the Message Passing Interface. The first algorithm is a novel approach that uses numerous processors to crack one password by using an innovative approach to workload distribution. In this algorithm the candidate password is distributed to all participating processors and the word list is divided based on probability so that each processor has the same likelihood of cracking the password while eliminating overlapping operations. The second algorithm developed in this research involves dividing the passwords within a password file equally amongst available processors while ensuring load-balanced and fault-tolerant behavior. This paper describes John the Ripper, the design of these two algorithms and preliminary results. Given the same amount of time, the original JtR can crack 29 passwords, whereas our algorithms 1 and 2 can crack an additional 35 and 45 passwords respectively.
Electromagnetic noise spectrum at John TS [transmission station
International Nuclear Information System (INIS)
Hatanaka, G.K.
1992-01-01
Canadian National (CN) is proposing the development of a commercial office tower on a site directly south of John Transmission Station (TS). CN is concerned about the potential effects of fields originating from John TS and other nearby sources on the operation of sensitive equipment and occupants of the building. Potential equipment and tenants might include data processing equipment and television and radio broadcasting companies. A study was conducted to characterize the severity of the electromagnetic environment at the site in order to address these concerns. Measurements of the electromagnetic spectrum from 100 kHz to 300 MHz were performed from a mobile test facility that features a 5 kW diesel generator and an extendible antenna mast. Peak measurements were made using a selectable measurement time of 0.05 s. It was found that the highest noise levels result from micro-gap discharges under dry weather conditions. The micro-gap discharges are characteristic of defect noise sources associated with substation hardware. At 0.5 MHz the noise levels are typical of median noise levels expected for the International Radio Consultive Committee (CCIR) defined business environment. At 74 MHz the noise levels are more severe than the expected levels for this type of environment. However, levels more representative of the business environment will be achieved by eliminating the micro-gap noise sources attributed to John TS. 6 refs., 11 figs., 2 tabs
In Memoriam: Dr. Frank John Fenner
Centers for Disease Control (CDC) Podcasts
2011-04-22
This podcast reflects on one of the greatest pioneers in virology, Dr. Frank John Fenner. Dr. Frederick Murphy, a member of EID's editorial board and the Institute of Medicine, and professor of Pathology at the University of Texas Medical Branch in Galveston, shares professional and personal stories of Dr. Frank Fenner. Created: 4/22/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID). Date Released: 4/26/2011.
Orthophoto Mosaic (2012) for Coral Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This 0.3x0.3 meter imagery mosaic of Coral Bay, St. John in the U.S. Virgin Islands was created by the National Oceanic and Atmospheric Administration (NOAA) using a...
Orthophoto Mosaic (2012) for Fish Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This 0.3x0.3 meter imagery mosaic of Fish Bay, St. John in the U.S. Virgin Islands was created by the National Oceanic and Atmospheric Administration (NOAA) using a...
Fossil Flora of the John Day Basin, Oregon
Knowlton, Frank Hall
1902-01-01
For a number of years I have been gradually accumulating material for a thorough revision of the Tertiary floras of the Pacific slope. Fossil plants are known to occur at numerous points within this area, and their study and identification has already furnished valuable data bearing on the geological history of the region, and when still further exploited it is confidently expected that they will afford more exact data for the use of geologists. This investigation is progressing satisfactorily, and at no distant day it is hoped to have it in form for final publication. From time to time various members of the United States Geological Survey, as well as others not connected with this organization, have sent in small collections of fossil plants for determination. These have been studied and reported upon as fully as the condition of the problem permitted, so that the determinations could be immediately available to geologists, but with the reservation that none of the questions could be fully settled until all known material had been studied and properly correlated. The rich fossil plant deposits in the John Day Basin, as set forth more fully in the historical account which follows, have been known for a period of nearly fifty years, but their study has been carried on in a more or less desultory manner. There has also been considerable confusion as to the horizons whence these plants came. As various species of plants described originally from the John Day region were detected in various other localities in Oregon, and in surrounding areas, as central Washington, western Idaho, and northern California, it became more than ever apparent that a thorough study of all material obtainable from this type area would be necessary before any definite or satisfactory conclusions could be reached. The immediate incentive for this revision was furnished by the receipt of a considerable collection of plants, made by Dr. John C. Merriam in 1900 while he was in charge of an
John Dewey's Influence on Turkish Education System in the Early Republic Era
Sahin, Mustafa
2017-01-01
In this research, the influence of John Dewey's visit to Turkey in 1924, his report on Turkish education system and its influence on Turkish education system in the early republic era were discussed. John Dewey was invited by Ministry of Education in 1924. He made investigations concerning the education system, participated in interviews, and…
Disability in the Family: John and Alice Dewey Raising Their Son Sabino
Danforth, Scot
2018-01-01
Background/Context: The current biographic understanding of John Dewey's experience adopting and raising an Italian boy named Sabino emphasizes the theme of finding an emotional replacement for Morris and Gordon, two young sons who had tragically died on family trips to Europe. Lacking is substantive attention to the fact that John Dewey's son had…
Capitalism in Six Westerns by John Ford
Braun, Carlos Rodriguez
2011-01-01
The economic and institutional analysis of capitalism can be illustrated through John Ford's Westerns. This article focuses on six classics by Ford that show the move toward modern order, the creation of a new society, and the rule of law. Economic features are pervading, from property rights and contracts to markets, money, and trade. Ford has…
78 FR 64236 - Notice of Public Meeting for the John Day; Snake Resource Advisory Council
2013-10-28
...] Notice of Public Meeting for the John Day; Snake Resource Advisory Council AGENCY: Bureau of Land... Interior, Bureau of Land Management (BLM), the John Day--Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The John Day--Snake RAC will hold a public meeting Thursday and Friday, November 14...
Translating The Infinities by John Banville
Directory of Open Access Journals (Sweden)
Irene Abigail Piccinini
2015-12-01
Full Text Available Abstract - John Banville’s talent as a prose stylist is widely recognized. The polished elegance of his phrases constitutes a continuing and fascinating challenge for his translator, due to the intricacies of the source text, its manifold registers and lexical choices. In his novel The Infinities, in Italian Teoria degli Infiniti, John Banville takes cue from Kleist’s Amphytrion to devise a novel where classicality interweaves with science and science fiction through the invention of a world where the ancient gods intermingle with the humans while waiting for the death of Adam Godley, a famous mathematician who explained how an infinity of worlds exist and interact with each other. To translate this book I had not only to work extensively on lexis and style, but also to do considerable research to render the many literary and non literary references. Some examples of these struggles with the source text during the translation process are given in the present paper. Riassunto - John Banville, autore irlandese noto per la sua prosa raffinata, scrive in una lingua che rappresenta una sfida continua e affascinante per chi lo traduce. La sua complessità stilistica, che sfrutta molteplici registri linguistici e si avvale di scelte lessicali cui spesso è arduo trovare un traducente italiano soddisfacente, costringe il traduttore a fare ricorso a tutte le sottigliezze del proprio mestiere per restituire quanto più possibile l’eleganza dell’originale nella propria lingua. Nel romanzo The Infinities, tradotto in italiano come Teoria degli infiniti (Guanda, Parma 2011, Banville prende spunto dall’Anfitrione di Kleist per costruire un romanzo che guarda alla classicità sconfinando in un misto di scienza e fantascienza con la concezione di un’infinità di mondi paralleli teorizzata dal matematico Adam Godley, il protagonista morente al cui capezzale si radunano uomini e antichi dei in attesa che il cerchio della vita e della morte si compia
78 FR 76175 - Notice of Public Meeting for the John Day-Snake Resource Advisory Council
2013-12-16
...] Notice of Public Meeting for the John Day-Snake Resource Advisory Council AGENCY: Bureau of Land... Interior, Bureau of Land Management (BLM), the John Day-Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The John Day-Snake RAC will hold a public meeting Thursday and Friday, January 9 and...
Of Curriculum Conceptions, Orientations, and Cultures: A Rejoinder to John E. Hull
Van Brummelen, Harro
2009-01-01
In this article, the author presents a rejoinder to John E. Hull. Van Brummelen first states his appreciation of John Hull's thoughtful evaluation of his views of curriculum, views in which many Christian educators have played a part. It has been several decades since the author spelled out what Hull calls an "education for discipleship"…
MANUSIA DAN PENDIDIKAN MENURUT PEMIKIRAN IBN KHALDUN DAN JOHN DEWEY
Directory of Open Access Journals (Sweden)
T. Saiful Akbar
2015-02-01
Full Text Available This study aims to understand the concept of human and Ibn Khaldun's ideas of education; to understand the concept of human and educational thought of John Dewey; to know the similarities and differences between the ideas of Ibn Khaldun and John Dewey on the concept of human and education. Various problems have been addressed through the library research method. The study produced several findings: First, human beings according to Ibn Khaldun as a creation of God with all the potential fitted to the five senses and intellect become intellect. The purpose of education opens the mind and maturity of the individual to the advancement of religious, industrial and social system. Material teaching is as educational planning. The method is to advocate phasing method, repetition, widya-tours and training (practice. Secondly, according to John Dewey man is a subject that has the ability, strength, personality, and existence who are capable of changing realities. The goal of education is only to gain happiness in the world life. The method of education is including problem solving, learning by doing and discipline. Third, the thought of Ibn Khaldun is much more religious because it is influenced by its control logic in religious knowledge, so that emphazises more on human spirituality in building civilization. While John Dewey is more radical and extreme, He proposed progressive education which strives against traditional teaching authority. Both Ibn Khaldūn dan Dewey are arise from inhuman socio-cultural environment and recognize the existence of human existence with nature and humanity impulse.
Directory of Open Access Journals (Sweden)
Henning Melber
2012-01-01
Full Text Available Review of the monograph: John S. Saul, Liberation Lite: The Roots of Recolonization in Southern Africa, Trenton, N.J.: Africa World Press, 2011, ISBN 978-1-59221-835-6, 133 pagesBesprechung der Monographie: John S. Saul, Liberation Lite: The Roots of Recolonization in Southern Africa, Trenton, N.J.: Africa World Press, 2011, ISBN 978-1-59221-835-6, 133 Seiten
Development of the Dutch Johne's disease control program supported by a simulation model
Groenendaal, H.; Nielen, M.; Hesselink, J.W.
2003-01-01
The development of a simulation model, "JohneSSim", was part of a research program aimed at designing a national Johne's disease control program for The Netherlands. Initially, the focus was mainly directed towards different compulsory "test-and-cull" strategies. However, the results from the
65 Year Birthday Celebration's Prof. John Ellis.
Benoit Jeannet
2011-01-01
On 13 September, physicists from around the world joined John Ellis at a colloquium to celebrate his 65th birthday, and as he ended his long career as a distinguished CERN staff member and joins King’s College London. Here he is in the audience with fellow theorists, Nobel laureate Gerard ’t Hooft and Chris Llewellyn Smith, former director-general of CERN.
'Pinning and flux dynamics I' in the memory of Professor John Clem
Weber, Harald W.
2014-04-01
The local Organizing Committee and the International Advisory Committee of EUCAS 2013 decided to dedicate the Session 'Pinning and Flux Dynamics I' to the memory of Professor John Clem, who passed away on 2 August 2013. Let me briefly summarize John's career and try to convey the incredible loss for the whole superconductor community. John was born in 1938 in Waukegan, a small town in Illinois. After school he obtained several scholarships at the University of Illinois. There he received a BSc in Engineering Physics in 1960, followed by an MSc in Physics in 1962, and earned a PhD focusing on the theory of superconductivity under John Bardeen in 1965. After two years of postdoctoral positions at the University of Maryland and the Technical University of Munich, he joined the Physics Department of the Iowa State University and the Ames Laboratory in 1967, where he spent the rest of his scientific career. He became Full Professor at ISU and Senior Physicist at the Ames Lab in 1975 and was Chairman of the Physics Department from 1982 to 1985. He spent several sabbaticals in the US at IBM Yorktown Heights, Stanford and EPRI in Palo Alto, was named 'Distinguished Professor' at ISU, was a Fellow of the American Physical Society and the Institute of Physics in London and, at the ASC 2012 in Portland he received the IEEE Award for 'Continuing and Significant Contributions in the Field of Applied Superconductivity', especially for his theoretical insight into the nature of vortices in 2D superconductors, which he called 'pancake vortices'. John, who married his high school sweetheart Judy right after college graduation, immediately turned Ames into a much-visited center for scientists from all over the world (including myself), who were interested in vortex physics and the properties of the flux line lattice, flux pinning, flux cutting and vortex dynamics. But it was not only the science at ISU that attracted us, it was also the warm atmosphere created by John and Judy at
Video of Christian Skau and Martin Raussen's interview with the Abel Prize Winner John Milnor
DEFF Research Database (Denmark)
Skau, Christian
2011-01-01
The television interview with Abel Laureate John Milnor that was broadcasted on Norwegian television in June is now available on the Abel Prize multimedia page. John Milnor received the Abel Prize «for pioneering discoveries in topology, geometry and algebra» to quote the Abel Committee. King...... Harald presented the Abel Prize to John Milnor at the award ceremony in Oslo, Norway on 24 May. Before the interview there is a short presentation of the award ceremony. John Milnor is interviewed by Martin Raussen and Christian Skau. The Abel Prize that carries a cash award of NOK 6 million (about EUR...
John W. Daly - An Appreciation
Kirk, Kenneth L.
2015-01-01
John W. Daly was engaged in groundbreaking basic research for nearly 50 years at NIH in Bethesda, Maryland. A primary focus of his research included the discovery, structure elucidation, synthesis and pharmacology of alkaloids and other biologically active natural products. However, he earned further acclaim in other areas that included the investigation of the structure-activity relationships for agonists/antagonists at adenosine, adrenergic, histamine, serotonin, and acetylcholine receptors. In addition he was a pioneer in studies of the modulation and functional relationships for systems involving calcium, cyclic nucleotides, ion channels and phospholipids and in the mechanism of actions of caffeine and other xanthines. PMID:26160996
Church, Russell M.
2002-04-28
This article provides an overview of the published research of John Gibbon. It describes his experimental research on scalar timing and his development of scalar timing theory. It also describes his methods of research which included mathematical analysis, conditioning methods, psychophysical methods and secondary data analysis. Finally, it describes his application of scalar timing theory to avoidance and punishment, autoshaping, temporal perception and timed behavior, foraging, circadian rhythms, human timing, and the effect of drugs on timed perception and timed performance of Parkinson's patients. The research of Gibbon has shown the essential role of timing in perception, classical conditioning, instrumental learning, behavior in natural environments and in neuropsychology.
John Knopfmacher, [Abstract] Analytic Number Theory, and the ...
African Journals Online (AJOL)
Abstract. In this paper some important contributions of John Knopfmacher to ' Analytic Number Theory' are described. This theory investigates semigroups with countably many generators (generalized 'primes'), with a norm map (or a 'degree map'), and satisfying certain conditions on the number of elements with norm less
2011-09-13
...] Meeting of the John H. Chafee Blackstone River Valley National Heritage Corridor Commission AGENCY: National Heritage Corridor Commission, John H. Chafee Blackstone River Valley, National Park Service... Advisory Committee Act, 5 U.S.C. Appendix, that the John H. Chafee Blackstone River Valley National...
John Rawls's Constructivism & the Theory of Constructional Perceptions
Directory of Open Access Journals (Sweden)
M. Zamani
2010-01-01
Full Text Available John Rawls, American contemporary philosopher, has chosen the title of constructivism for his views on philosophy of ethics and politics. The base of his veiws is the same as the theory of social contract which has been discussed before by John Locke and Imanuel Kant. Rawls completes this view by the condition of impartiality and fairness , which is distinguished by ignorance about the position of self (the veil of ignorance in primary situation. Rawls criticises intutionism and utilitarianism and holds an antirealistic approach towards ethics . The theory that has been delivered by Allame Tabatabee (the constructional perception caused agreements and disagreements, but his idea seems to be new and effective in Islamic philosophy. Based on this idea many conceptions are constructive including goodness , badness and justice. The aim of this paper is to analyse and give a comparison between these ideas and studies similarities and differences with regard to topics such as antirealism, objectivity, criteria of justification and separation of science and ethics.
The Inner Child and Other Conceptualizations of John Bradshaw.
Bordan, Terry
1994-01-01
Interviewed John Bradshaw on radio talk show. Bradshaw contributed to a greater understanding of factors that foster and maintain substance abuse and dysfunctional families. Focused on his concept of the inner child. (JBJ)
76 FR 67206 - Notice of Public Meeting, John Day-Snake Resource Advisory Council
2011-10-31
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLORV00000.L10200000.DD0000; HAG 12-0022] Notice of Public Meeting, John Day-Snake Resource Advisory Council AGENCY: Bureau of Land Management... (BLM) John Day-Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The meeting...
77 FR 16257 - Notice of Public Meeting, John Day-Snake Resource Advisory Council
2012-03-20
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLORV00000.L10200000.DD0000; HAG 12-0117] Notice of Public Meeting, John Day-Snake Resource Advisory Council AGENCY: Bureau of Land Management... (BLM) John Day-Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The business...
76 FR 78691 - Notice of Public Meeting, John Day-Snake Resource Advisory Council
2011-12-19
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLORV00000.L10200000.DD0000; HAG 12-0056] Notice of Public Meeting, John Day-Snake Resource Advisory Council AGENCY: Bureau of Land Management... (BLM) John Day-Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The meeting...
The John Zink Hamworthy combustion handbook
Baukal, Charles E
2013-01-01
Despite the length of time it has been around, its importance, and vast amounts of research, combustion is still far from being completely understood. Issues regarding the environment, cost, and fuel consumption add further complexity, particularly in the process and power generation industries. Dedicated to advancing the art and science of industrial combustion, The John Zink Hamworthy Combustion Handbook, Second Edition: Volume 3 - Applications offers comprehensive, up-to-date coverage of equipment used in the process and power generation industries. Under the leadership of Charles E. Baukal
John Dewey's Democracy and Education: A British Tribute
Higgins, Steve, Ed.; Coffield, Frank, Ed.
2016-01-01
In 1916 John Dewey published "Democracy and Education: An introduction to the philosophy of education". In this book some of today's foremost historians, philosophers, psychologists, and sociologists of education mark the anniversary of Dewey's work by reviewing and reflecting, from a British perspective, on Dewey's contribution to our…
John McArthur | IDRC - International Development Research Centre
International Development Research Centre (IDRC) Digital Library (Canada)
John serves as a Senior Fellow at The Brookings Institution and as a Senior Advisor on Sustainable Development to the United Nations Foundation. He previously served as CEO of Millennium Promise Alliance; as faculty member at Columbia University, School of International and Public Affairs; and as Manager and ...
Las ideas lingüísticas de John R. Firth
Battaner Moro, Elena
2014-01-01
Esta monografía es la primera publicada a nivel nacional e internacional que describe y analiza la obra y la teoría lingüística de John R. Firth (1890-1960). John Rupert Firth (1890-1960) fue un lingüista británico que expuso sus tesis sobre el lenguaje, las lenguas y la lingüística entre los años 1930 y 1960. Desarrolló su trabajo principalmente en la Universidad de Londres; en concreto, en el Departamento de Lingüística y Fonética de la School of Oriental and African Studies (SOAS), cuya di...
From Diagnosis, to Life Saving Therapy, to Hollywood: The Journey of John Crowley
Apel, Laura
2010-01-01
In February of 2000, "Exceptional Parent" introduced readers to the Crowley family. The author profiled John, Aileen, and their three children: Megan, Patrick, and John Jr. They told "Exceptional Parent" that in 1998 both Megan and Patrick were diagnosed with Pompe disease, a progressive, multisystemic, debilitating, and often fatal muscular…
A Star in the Western Sky: John Birmingham, Astronomer and Poet
Mohr, P.
John Birmingham (1814-1884) of Millbrook, County Galway, was an outstanding amateur astronomer, now completely forgotten. He discovered the 1866 nova, T Coronae Borealis. Later his name was assigned to a feature near Anaxagoras on the Moon. In 1884 the Royal Irish Academy awarded him its Cunningham Gold Medal for his catalogue of the red variable stars. John Birmingham was not only an acute observer, he also wrote numerous semi-popular articles on many aspects of astronomy. He was also active in geology and railway surveying.
Discursive investigation into John's internalised spirit identity and its ...
African Journals Online (AJOL)
2016-05-31
May 31, 2016 ... Learning about John's community from the history and experiences of South Africa reminds us of .... In addition to the illustrated recent views, ..... idenfity in South Africa, Germany and Canada, Sun Press, Stellenbosch.
SuchThatCast Episode 9: John Dupré
Soraker, Johnny
2013-01-01
John Dupré is the director of the ESRC Centre for Genomics in Society and professor of philosophy at the University of Exeter. Dupré was educated at the University of Oxford and the University of Cambridge and taught at Oxford, Stanford University and Birkbeck College of the University of London
Suehiro Jurisprudence and John R. Commons
DEFF Research Database (Denmark)
Tackney, Charles T.
This is a comparative history study at the interface of industrial / employment relations and stakeholder theory. The focus concerns decades of post-World War II Japanese and U.S. path dependent national divergence from common labor legislation enactments separated by only 15 years: 1933...... or Suehiro hōgaku) document a dramatic, fascinating historical parting of two nations due to Japanese deep appreciation of the labor law and institutional economics research legacy of John R. Commons, the father of U.S. industrial relations. Understanding this common, shared source opens industrial relations...
Biographical Sketch: John Royal Moore, MD 1899–1988
Brand, Richard A.
2011-01-01
This biographical sketch on John R. Moore corresponds to the historic text, The Classic: Cartilaginous-cup Arthroplasty in Ununited Fractures of the Neck of the Femur (1948), available at DOI 10.1007/s11999-011-1974-z.
John Ellis discusses the Higgs, the lack of the Higgs, and extra dimensions
Katarina Anthony
2011-01-01
On 13 September, CERN will be hosting a colloquium to mark John Ellis' 65th birthday. The colloquium comes as John ends his long career as a distinguished CERN staff member and makes a transition to Clerk Maxwell Professor of Theoretical Physics at King’s College London. The Bulletin took the opportunity to ask John to share his expectations from the LHC during this long-awaited data-taking phase... John Ellis in his office (July 2011). So, let’s start from the Higgs boson: does it exist and where is it? The million-dollar question… Sometime in the next few months, I think we will finally get clarity on the Higgs boson. While it has been with us as a hypothesis since 1964, I think we are finally closing in on it now. However, in every possible discovery scenario, clarity on the Higgs will lead to new physics. Let me explain... Experiments have left only three possible mass ranges where the Higgs – or a Higgs-like particl...
Huang Zongxi's and John Locke's Rhetoric toward Modernity
Wang, Xiaobo
2012-01-01
Huang Zongxi was an influential seventeenth century Chinese political and social theorist who is considered by many to be the inspiration and founding father of democracy and human rights in China. This article examines the many similarities in thought and social influence between Huang and his contemporary, the English philosopher John Locke.…
The ethical implications of 2 John 10�11
Directory of Open Access Journals (Sweden)
Jan van der Watt
2015-03-01
Full Text Available The imperative in 2 John 10�11 not to receive a visitor with a false doctrine into one�s house is one of the most controversial prohibitions in the New Testament, especially in light of the commandment of love, ancient hospitality conventions, and modern-day expectations of open discussion. This raises the question what this prohibition is specifically about and whether hospitality is really asked for. This question is considered in some detail in this article. A widely held view is that the prohibition in 2 John 10 is not in line with generally accepted Christian ethics, since it militates against the attitude of love, care, and hospitality. This view is dominant in commentaries. This article aims at countering this view by proposing that the issue is not hospitality but endangering the identity and tradition of the group. This should be regarded as a positive Christian value.Intradisciplinary and/or interdisciplinary implications: I challenge theological readings of 2 John 10�11 that regard the text as unchristian in its exhortation. The results of the research show that hospitality is not the communicative centre of the text, but protection of the group, which was a common feature, not only in Christianity, but also in the ancient world in general. The future discourse should now move from focusing on moral issues related to hospitality to issues related to preserving tradition within a religion.
John Pope - Failure at Second Battle of Bull Run
National Research Council Canada - National Science Library
Morio, Daniel
2002-01-01
Was the failure of the Army of Virginia at the Second Battle of Bull Run a result of General John Pope being a failure as a leader or were there other circumstances that helped him in his loss? Conclusion...
Exploring the Universe with John Milton and Mary Shelley.
Poston, David
1989-01-01
Presents an approach to teaching John Milton's "Paradise Lost" in conjunction with Mary Shelley's "Frankenstein." Notes that a study of these works stimulates vigorous discussions on theological and moral issues, human nature, and the cultural past and future. (MM)
The Urgency for Peace in Teachings of John Paul II
Directory of Open Access Journals (Sweden)
Jerzy Lewandowski
2014-04-01
Full Text Available Peace has always been a topic of great importance. Its presence is desired by all nations and societies. It brings the world together in unity. John Paul II considered peace to be an integral part in creation of an independent and healthy society. Papal encyclicals and messages, intended to present the response of the teaching Church to problems that arise from time to time, often dwell on the principles that advocate peace. Since freedom and peace are in many cases a privilege for many nations, the mentioned pope commits himself to speak about the cruelty and evilness of wars and national conflicts. Pope John Paul II denounces intolerance as denial of freedom for many people, and consequently a great threat to peace. The pope teaches that peace has its roots in the family. Yet, in many societies, the family is deprived of the utmost importance that it certainly deserves. Without the adequate means for a decent livelihood, families can experience hardship in committing themselves to promote solidarity and a proper social fabric worthy of human dignity. For John Paul II, a nation’s freedom and peace are safeguarded and promoted through particular attention and a much-devoted effort by strong and healthy families.
Justice John Paul Stevens and the Erotic Boomerang.
Lieberman, Marc
Justice John Paul Stevens of the United States Supreme Court has ruled on obscenity cases in seven instances since his appointment. His rulings reveal that he regards obscenity as a nuisance rather than as a danger threatening to undermine the nation's morality, that he supports a nationwide standard to adjudicate obscenity cases, and that he…
Scapegoat: John Dewey and the Character Education Crisis
White, Brian
2015-01-01
Many conservatives, including some conservative scholars, blame the ideas and influence of John Dewey for what has frequently been called a crisis of character, a catastrophic decline in moral behavior in the schools and society of North America. Dewey's critics claim that he is responsible for the undermining of the kinds of instruction that…
Professor John Scott, folate and neural tube defects.
Hoffbrand, A Victor
2014-02-01
John Scott (1940-2013) was born in Dublin where he was to spend the rest of his career, both as an undergraduate and subsequently Professor of Biochemistry and Nutrition at Trinity College. His research with the talented group of scientists and clinicians that he led has had a substantial impact on our understanding of folate metabolism, mechanisms of its catabolism and deficiency. His research established the leading theory of folate involvement with vitamin B12 in the pathogenesis of vitamin B12 neuropathy. He helped to establish the normal daily intake of folate and the increased requirements needed either in food or as a supplement before and during pregnancy to prevent neural tube defects. He also suggested a dietary supplement of vitamin B12 before and during pregnancy to reduce the risk of neural tube defects. It would be an appropriate epitaph if fortification of food with folic acid became mandatory in the UK and Ireland, as it is in over 70 other countries. © 2013 John Wiley & Sons Ltd.
Música y sensación sonora: John Tavener
Directory of Open Access Journals (Sweden)
Alvarado, Boris
2014-12-01
Full Text Available This article aims to examine the act of sound sensation in John Tavener Work (1944-2013 following the idea of logic of sensation created by Gilles Deleuze (1925-1995 and phenomenology of the body Xavie Zubiri (1898-1983. Through the concepts of from both philosophers it might be possible to draw the sound experience of vibration that proposes the sacred art of minimalism in the Anglo- Saxon composer.Lo que busca este artículo es investigar el bello y difícil acto de la sensación sonora de la obra de John Tavener (1944-2013 a la luz de una lógica de la sensación de Gilles Deleuze (1925-1995 y de la fenomenología del cuerpo de Xavie Zubiri (1898-1983. Creemos que con los conceptos acuñados por ambos filósofos pueden dar cuenta de un modo más acabado de ese estilo único de la experiencia sonora en la vibración que propone el arte sacro de la música minimal del compositor anglosajón.
Principal Component Surface (2011) for Fish Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Fish Bay, St. John in the U.S. Virgin Islands (USVI). It was...
Principal Component Surface (2011) for Coral Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Coral Bay, St. John in the U.S. Virgin Islands (USVI). It was...
Directory of Open Access Journals (Sweden)
María L. Román-Miranda
2013-01-01
Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Does John 17:11b, 21−23 refer to church unity?
Directory of Open Access Journals (Sweden)
Gert J. Malan
2011-04-01
Full Text Available In ecumenical circles, John 17:11b, 21–23 has been understood as Jesus’ prayer for church unity, be it confessional or structural. This article questioned such readings and conclusions from historical, literary and sosio-cultural viewpoints. The Fourth Gospel’s language is identified as ’antilanguage’ typical of an ’antisociety’, like that of the Hermetic, Mandean and Qumran sects. Such a society is a separate entity within society at large, but opposes it. Read as a text of an antisociety, John 17:11b, 21–23 legitimises the unity of the separatist Johannine community, which could have comprised several such communities. This community opposed the Judean religion, Gnosticism, the followers of John the Baptist and three major groups in early Christianity. As text from the canon, this Johannine text legitimates tolerance of diversity rather than the confessional or structural unity of the church.
2011-05-25
... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,839] St. John Knits, Inc..., 2011, applicable to workers of St. John Knits, Inc., Irvine, California. The workers are engaged in the... adjustment assistance was issued for all workers of St. John Knits, Sample Manufacturing Department, Irvine...
2011-03-23
... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,839] St. John Knits, Inc..., 2011, applicable to workers of St. John Knits, Inc., Irvine, California. The workers are engaged in the... adjustment assistance was issued for all workers of St. John Knits, Sample Manufacturing Department, Irvine...
Camera aboard 'Friendship 7' photographs John Glenn during spaceflight
1962-01-01
A camera aboard the 'Friendship 7' Mercury spacecraft photographs Astronaut John H. Glenn Jr. during the Mercury-Atlas 6 spaceflight (00302-3); Photographs Glenn as he uses a photometer to view the sun during sunsent on the MA-6 space flight (00304).
Special article: Horace Nelson MD, John Webster LDS--unrecognized Canadian anesthesia pioneers.
Craig, Douglas; Chartrand, Daniel
2014-03-01
The timing of the earliest reported ether anesthetics in early 1847, in regions to become Canada in July 1867, was examined using information from on-line and library-based sources. Previous authors had identified the first reported ether anesthetic given by a visiting American dentist in January 1847 in Saint John, New Brunswick. Nevertheless, they had reported three different anesthetics as the second occurrence - which would denote the first anesthetic given by a resident of Canada. We confirmed that there were no reports of ether anesthetics being given in Canada before that reported on January 18, 1847 in Saint John. The information available for our review indicates that the second ether anesthetic, and the first by a Canadian, was given in Montreal by a dentist, Dr. John Horatio Webster, on February 20, 1847. The surgical assistant for that operation, Dr. Horace Nelson, later reported on animal and human experiments with ether, which he had led in Montreal starting in January 1847. Earlier authors, who may not have had access to the information now available, came to incorrect conclusions about the first ether anesthetic reported to have been given by a Canadian. Current information indicates that John Webster gave the first reported anesthetic in Montreal on February 20, 1847 following experiments with ether led by Horace Nelson. Both Webster and Nelson deserve recognition as Canadian anesthesia pioneers.
2010-01-01
... official Johne's disease test during interstate movement. 80.4 Section 80.4 Animals and Animal Products... animals positive to an official Johne's disease test during interstate movement. Animals that are positive... from the animals positive to an official Johne's disease test to the healthy animals in the vehicle. ...
Obituary: John Norris Bahcall, 1934-2005
Striker, Jeremiah P.; Bahcall, Neta A.
2007-12-01
John Norris Bahcall, one of the most creative and influential astrophysicists of his generation — a scientist who helped prove what makes the Sun shine and helped make the Hubble Space Telescope a reality — passed away in Pasadena, California, on 17 August 2005. Bahcall died peacefully in his sleep from a rare blood disorder. For the past 35 years, Bahcall was the Richard Black Professor of Natural Sciences at the Institute for Advanced Study in Princeton, New Jersey, where he created one of the leading astrophysics programs in the world. Active and working to the end, Bahcall said that he was always grateful for a full and happy life that exceeded his wildest expectations. Bahcall died as he lived, surrounded by the family he loved, embracing life to its fullest, happy, working and joking to the end. Bahcall's stellar career encompassed seminal contributions in numerous fields of astrophysics as well as extraordinary leadership on behalf of the scientific community, including the American Astronomical Society, the American Physical Society, the National Academy of Sciences, NASA, and Congress. Bahcall's contributions made him one of the scientific leaders of his time. He had been recognized by numerous awards including the 1998 National Medal of Science from President Clinton, the Gold Medal of the Royal Astronomical Society, the Medal of the Swedish Royal Academy, the Dan David Award, the Fermi Award, the first Hans Bethe Prize, the Franklin Medal, the Comstock Prize in physics, NASA's Exceptional Scientific Achievement Medal, NASA's Distinguished Public Service Medal, and the top awards of the American Astronomical Society — including the Russell Award, the Heineman Prize, and the Warner Prize. Bahcall was elected to the National Academy of Sciences in 1976 and to the American Philosophical Society in 2001. He was the recipient of Honorary Degrees from numerous universities around the world. Bahcall's scientific interests and expertise ranged from neutrino
Historical Footage of John Glenn Friendship 7
1962-01-01
The Friendship mission launch on the 20th day of February marked the first time that an American attempts to orbit the Earth. Historical footage of John Glenn's suit up, ride out to the launch pad, countdown, liftoff, booster engine cutoff, and separation of the booster engine escape tower is shown. Views of the Earth, Glenn's manual control of the electrical fly-by wire system, and the recovery of the landing vehicle from the ocean are presented.
John Locke on persons and personal identity
Boeker, Ruth
2013-01-01
John Locke claims both that ‘person’ is a forensic term and that personal identity consists in sameness of consciousness. The aim of my dissertation is to explain and critically assess how Locke links his moral and legal account of personhood to his account of personal identity in terms of sameness of consciousness. My interpretation of Locke’s account of persons and personal identity is embedded in Locke’s sortal-dependent account of identity. Locke’s sortal-dependent ac...
John Stuart Mill's Concepts of Quality and Pedagogical Norms.
Kim, Ki Su
1986-01-01
Considers the paradoxical relationship between two pervasive educational goals--quality and equality. Sees this paradox embedded in John Stuart Mill's writings on education, which attempted to reconcile the utilitarian pleasure principle (which emphasizes quantitative measures), with a traditional differentiation among levels and kinds of desires…
9 CFR 80.3 - Movement of domestic animals that are positive to an official Johne's disease test.
2010-01-01
... positive to an official Johne's disease test. 80.3 Section 80.3 Animals and Animal Products ANIMAL AND... animals that are positive to an official Johne's disease test. (a) Movement of domestic animals for slaughter. Domestic animals that are positive to an official Johne's disease test may be moved interstate...
Energy Technology Data Exchange (ETDEWEB)
Berends, E. [Grenco, Den Bosch (Netherlands)
2005-02-15
Some historical aspects are given of the development of the first ice skating rink (Glaciarium) that was opened in 1876 in Chelsea, London, UK. Also attention is paid to the inventor of the skating rink, professor dr. John Gamgee and some of the other inventions of this remarkable person. [Dutch] De historie van de eerste kunstijsbaan (Glaciarium) die in 1876 in Chelsea in Londen werd geopend, wordt uit de doeken gedaan. Daarnaast wordt aandacht geschonken aan de uitvinder, professor dr. John Gamgee, en worden enkele andere uitvindingen van deze opmerkelijke man belicht.
Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M
2011-08-01
The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.
Master John of Arderne (1307-1380): a founder of modern surgery.
Pearn, John
2012-01-01
John of Arderne (1307-1380) was one founder of surgery as the profession is known today. He was the first English surgeon of whom biographic details survive. Born on the Arderne Estates at Newark, England, he served as a military surgeon in France in campaigns where gunpowder was used in combat for the first time. His best-known work, the Practica (De Arte Phisicali et de Cirurgia), formed the basis of practical surgical teaching in the medical schools of medieval Europe. Biographic research of primary and secondary archives and documents. John of Arderne's surgical practice was undertaken against a background of turbulent political, military and medical events. He survived the Black Death (1347) and its cyclical recurrences. He lived through the turbulent reigns of Edward II and Edward III and practised in London in the decades preceding the simmering unrest which preceded the Peasant's Revolt of 1381. Surgical and medical practice in the late Middle Ages was enmeshed in astrological beliefs. It was greatly influenced by church doctrine of disease causation. In this paper, the known details of John of Arderne's life are placed in the perspective of these societal and professional influences. He is one of several pre-Renaissance European doctors who were the first to challenge the received medical lore of Galen and later Arabic surgeons. Writing when he was 70 years of age, John of Arderne was the first to advocate that surgeons should trust their own clinical experience 'Wele ymagynyng subtile things' rather than following the directions of others, even including those advocated by himself. © 2011 The Author. ANZ Journal of Surgery © 2011 Royal Australasian College of Surgeons.
Two Faces of Art – Public and Private – in John Dewey’s in John Dewey’s Aesthetic Experience
Chudoba, Ewa
2016-01-01
According to American pragmatist John Dewey (1859–1952), art is an experience (not necessarily an object) and as such it might potentially cover all human interactions. To put it otherwise, an aesthetic experience is needed to create a meaningful piece of art. For human beings, the most stimulating environment for having aesthetic experiences is social life. Two main spheres of the aesthetic experience are distinguished: private and public. At first it seems that Dewey followed the modernist ...
John Rawls\\'s Constructivism & the Theory of Constructional Perceptions
Directory of Open Access Journals (Sweden)
M Zamani
2010-03-01
Full Text Available John Rawls, American contemporary philosopher, has chosen the title of constructivism for his views on philosophy of ethics and politics. The base of his veiws is the same as the theory of social contract which has been discussed before by John Locke and Imanuel Kant. Rawls completes this view by the condition of impartiality and fairness , which is distinguished by ignorance about the position of self (the veil of ignorance in primary situation. Rawls criticises intutionism and utilitarianism and holds an antirealistic approach towards ethics . The theory that has been delivered by Allame Tabatabee (the constructional perception caused agreements and disagreements, but his idea seems to be new and effective in Islamic philosophy. Based on this idea many conceptions are constructive including goodness , badness and justice. The aim of this paper is to analyse and give a comparison between these ideas and studies similarities and differences with regard to topics such as antirealism, objectivity, criteria of justification and separation of science and ethics.
John Rawls: a economia moral da justiça
Directory of Open Access Journals (Sweden)
Hermano Roberto Thiry-Cherques
2011-12-01
Full Text Available Neste texto, descrevo como o filósofo norte-americano John Rawls reformulou o pensamento moral contemporâneo, ao propor a subordinação da ética à justiça. Resumo a defesa que apresentou para uma moral fundada em um pacto que compensasse, sem tentar anulá-las, as assimetrias econômico-sociais do mundo em que vivemos. Concluo com uma discussão sobre as dificuldades teóricas que encontrou para absorver o pluralismo cultural, filosófico, político e religioso do Ocidente.In this article I describe how the North-American philosopher John Rawls has reformulated contemporary moral thinking in proposing subordination of ethics to justice. I synthesize his defense of a morality based on an agreement that compensates, without attempting to nullify, current socio-economic asymmetries. I conclude with a discussion of the theoretical difficulties he encountered in absorbing cultural, philosophical, political and religious Western pluralism in his theory.
John Archibald Wheeler: A study of mentoring in modern physics
Christensen, Terry M.
This dissertation has two objectives. The first objective is to determine where best to situate the study of mentoring (i.e. the 'making of scientists') on the landscape of the history of science and science studies. This task is accomplished by establishing mentoring studies as a link between the robust body of literature dealing with Research Schools and the emerging scholarship surrounding the development, dispersion, and evolution of pedagogy in the training of twentieth century physicists. The second, and perhaps more significant and novel objective, is to develop a means to quantitatively assess the mentoring workmanship of scientific craftsmen who preside over the final stages of preparation when apprentices are transformed into professional scientists. The project builds upon a 2006 Master's Thesis that examined John Archibald Wheeler's work as a mentor of theoretical physicists at Princeton University in the years 1938--1976. It includes Wheeler's work as a mentor at the University of Texas and is qualitatively and quantitatively enhanced by virtue of the author having access to five separate collections with archival holdings of John Wheeler's papers and correspondence, as well as having access to thirty one tape recorded interviews that feature John Wheeler as either the interviewee or a prominent subject of discussion. The project also benefited from the opportunity to meet with and gather background information from a number of John Wheeler's former colleagues and students. Included in the dissertation is a content analysis of the acknowledgements in 949 Ph.D. dissertations, 122 Master's Theses, and 670 Senior Theses that were submitted during Wheeler's career as an active mentor. By establishing a census of the students of the most active mentors at Princeton and Texas, it is possible to tabulate the publication record of these apprentice groups and obtain objective measures of mentoring efficacy. The dissertation concludes by discussing the wider
JOHN STUART MILL'İN FAYDACI AHLKI
Aydın, Metin
2014-01-01
Utilitarianism, systematised by Jeremy Bentham (1748–1832) in 18th century, is a theory having strong effects in many different areas from economy and ethics to politic and law especially in England and geopraphies in which anglo-saxon culture reigns. John Stuart Mill (1806 – 1873) reinterpreted Utilitrianism which was inherited from Bentham, in the context of critics of utilitarianism and his own thoughts. In this essay, Mill’s utilitarianism will be examined. In this context, I will discuss...
Does John 17:11b, 21−23 refer to church unity? | Malan | HTS ...
African Journals Online (AJOL)
Read as a text of an antisociety, John 17:11b, 21–23 legitimises the unity of the separatist Johannine community, which could have comprised several such communities. This community opposed the Judean religion, Gnosticism, the followers of John the Baptist and three major groups in early Christianity. As text from the ...
John Stuart Mill on Freedom, Education, and Social Reform.
Carbone, Peter F.
1983-01-01
Examines the social philosophy of John Stuart Mill, emphasizing his views on freedom, education, and social reform. Considers Mill's individualism and reformism, the conflict between freedom and control that characterizes his work, and the importance of freedom and education. Suggests caution in drawing educational implications from his work. (DAB)
The Role of St Johns Wort (Hypericum Perforatum and Orphanin Interaction on Depression Treatment
Directory of Open Access Journals (Sweden)
Sena Yalcin
2015-12-01
Full Text Available St. John's Wort (Hypericum perforatum/ Cantarion has been well-studied which has been showed to have antidepressant, antiviral, and antibacterial effects. St Johns Wort gained popularity as an alternative treatment for mild to moderate depression. On the other hand, the neuropeptide, orphanin FQ/nociceptin (OFQ/N, is expressed in both neuronal and non-neuronal tissue. In the brain, OFQ/N has been investigated in relation to stress, anxiety, learning and memory, and addiction. The purpose opf this article is to review the current pharmacological, and clinical papers on St. John's wort, to provide information on orphanin FQ/nociceptin and finally to evaluate probable interaction between two. [Archives Medical Review Journal 2015; 24(4.000: 531-541
John Stuart Mill's Philosophy of Persuasion
Directory of Open Access Journals (Sweden)
Helen Ruth McCabe
2014-02-01
Full Text Available In his youth, John Stuart Mill followed his father’s philosophy of persuasion but, in 1830, Mill adopted a new philosophy of persuasion, trying to lead people incrementally towards the truth from their original stand-points rather than engage them antagonistically. Understanding this change helps us understand apparent contradictions in Mill’s cannon, as he disguises some of his more radical ideas in order to bring his audience to re-assess and authentically change their opinions. It also suggests a way of re-assessing the relationship between Mill’s public and private works, to which we should look if we are attempting to understand his thought.
Remembering John M. Olson (1929-2017).
Blankenship, Robert E; Brune, Daniel C; Olson, Jon C
2018-02-19
Here we provide reflections of and a tribute to John M. Olson, a pioneering researcher in photosynthesis. We trace his career, which began at Wesleyan University and the University of Pennsylvania, and continued at Utrech in The Netherlands, Brookhaven National Laboratory, and Odense University in Denmark. He was the world expert on pigment organization in the green photosynthetic bacteria, and discovered and characterized the first chlorophyll-containing protein, which has come to be known as the Fenna-Matthews-Olson (FMO) protein. He also thought and wrote extensively on the origin and early evolution of photosynthesis. We include personal comments from Brian Matthews, Raymond Cox, Paolo Gerola, Beverly Pierson and Jon Olson.
Astronaut John W. Young during water egress training
1966-01-01
Astronaut John W. Young, prime crew command pilot for the Gemini 10 space flight, sits in Static Article 5 during water egress training activity on board the NASA Motor Vessel Retriever. The SA-5 will be placed in the water and he and Astronaut Michael Collins, will then practice egress and water survival techniques. At right is Gordon Harvey, Spacecraft Operations Branch, Flight Crew Support Division.
Astronaut John Young in Command Module Simulator during Apollo Simulation
1968-01-01
Astronaut John W. Young, command module pilot, inside the Command Module Simulator in bldg 5 during an Apollo Simulation. Astronauts Thomas P. Stafford, commander and Eugene A. Cernan, lunar module pilot are out of the view.
Saint John lateral pipeline project: comprehensive study report
International Nuclear Information System (INIS)
1999-02-01
A descripion is given of the results of an environmental impact assessment of the construction of a natural gas pipeline that will bring gas from Maritimes and Northeast Pipeline Management Ltd.'s (M and NP) main transmission pipeline to clients in Lake Utopia and Saint John, NB. It will be 110 km long, and the Saint John lateral will join the mainline approximately 2 km south of Big Kedron Lake, NB. Various institutional, industrial, commercial and residential clients will be able to access the pipeline in the future, and it is intended to be capable of future expansion for markets along its route and for markets that become economically feasible in the future. A matrix was developed that relates environmental resources to Environmental Components of Concern (ECCs), and to the rationale for exclusion/inclusion of the ECC as a Valued Environmental Component (VECs). The positive benefits of the pipeline to clients in the Saint John area include: reduced dependence on foreign oil, fuel switching and price competition, lower air emission pollution, increased energy efficiency, and a source of energy that is secure and reliable. VECs were selected based on: concerns of various stakeholders including the public, community groups, scientific parties, Aboriginal groups, government officials and agencies, relevant regulations; relevant literature; and past evaluation experiences, including future developments of the proposed study area. Further selection of the VECs required an examination of the issues picked out via scoping to determine the ways in which the overall project could affect the ECCs, and included construction, operation, decommissioning/abandonment, malfunctions and accidents of the pipeline. The phases of the project as they impacted residually and cumulatively on the VECs were evaluated, and impacts on Valued Socio-Economic Components (VSCs) were assessed also. The mitigation efforts taken will minimize the potential effects of the project on VECs and VSCs
SIR JOHN CRAWFORD MEMORIAL ADDRESS: Agriculture: The challenges of the 21st century
Beddington, Sir John
2012-01-01
The Sir John Crawford Memorial Address has been presented since 1985, in honour of the distinguished Australian civil servant, educator and agriculturalist in whose name the Crawford Fund was established. Sir John Crawford was a remarkable Australian who contributed at the highest levels, and was a passionate supporter of international agricultural research for development. This talk draws attention to four current and interrelated trends that suggest the world will be rather different by 202...
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Cultivating Hygiene as a Science: The Welch-Rose Report's Influence at Johns Hopkins and Beyond.
Thomas, Karen Kruse
2016-03-01
In 1915, William Henry Welch and Wickliffe Rose submitted a report to the Rockefeller Foundation that became the template for public health professional education in the United States and abroad. Based on the Welch-Rose Report's recommendations, the Foundation awarded a grant to Johns Hopkins University in 1916 to establish the first independent graduate school of public health, with Welch serving as the founding dean. The Welch-Rose Report and, by extension, the Johns Hopkins School of Hygiene and Public Health established and transmitted a new model of scientific training that wove the laboratory mindset together with the methods of public health administration and epidemiologic fieldwork. During the School's first quarter-century, faculty and alumni were remarkably active in frontline public health problem-solving, as well as launching public health agencies and schools of all types and sizes. The most lasting contribution of the Welch-Rose Report and the Johns Hopkins School of Hygiene and Public Health, now the Johns Hopkins Bloomberg School of Public Health, has been to "cultivate the science of hygiene" to bring about exponential growth in the evidence base for public health. The schools that have adopted the Johns Hopkins model of public health education worldwide have produced professionals who have worked to achieve wide-ranging reforms dedicated to preserving life, protecting health, and preventing injury across populations and continents. © The Author 2016. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Two Key Theories in Education: Confucius and John Dewey
Bonnie, Michael G.
2010-01-01
The following describes the philosophies of Confucius (Confucianism) and John Dewey (pragmatism/instrumentalism/experimentalism) and their views toward vocational, technical, general academic instruction, and the development of morals and values as espoused throughout Asia and America during a span of history from 551 BCE to 1949 CE. This is not…
Festivals, cultural intertextuality, and the Gospel of John's rhetoric of ...
African Journals Online (AJOL)
Test
2011-06-07
Jun 7, 2011 ... offers a good starting place for exploring their interface with ..... Millar, F., 1977, The Emperor in the Roman World, Duckworth, London. ... Yee, G., 1989, Jewish feasts and the Gospel of John, Michael Glazier, Wilmington.
Reflections on Cambridge: John Maynard Keynes at King's College Cambridge
Macfarlane, Alan
2012-01-01
.mp4 video file The economist John Maynard Keynes spent much of his life in Cambridge, connected to King's College. Alan Macfarlane reflects on a few aspects of his life and work. Filmed by Xu Bei in 2010
Review: John S. Saul, Liberation Lite: The Roots of Recolonization in Southern Africa (2011)
Henning Melber; Dag Hammarskjöld Foundation
2012-01-01
Review of the monograph: John S. Saul, Liberation Lite: The Roots of Recolonization in Southern Africa, Trenton, N.J.: Africa World Press, 2011, ISBN 978-1-59221-835-6, 133 pages Besprechung der Monographie: John S. Saul, Liberation Lite: The Roots of Recolonization in Southern Africa, Trenton, N.J.: Africa World Press, 2011, ISBN 978-1-59221-835-6, 133 Seiten
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Faith of a novelist : religion in John Galsworthy's work
Knoester, Maarten Willem
2006-01-01
Most readers are familiar with the British author John Galsworthy (1867-1933) through his The Forsyte Saga (1922), A Modern Comedy (1929) and The End of the Chapter (1934). He wrote many other novels as well, and in his own times he was also known as a leading dramatist. Literary criticism and
Why Should Scholars Keep Coming Back to John Dewey?
Gordon, Mordechai
2016-01-01
This essay attempts to explain why philosophers, philosophers of education, and scholars of democracy should keep coming back to John Dewey for insights and inspiration on issues related to democracy and education. Mordechai Gordon argues that there are four major reasons that contribute to scholars' need to keep returning to Dewey for inspiration…
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false St. Johns River, Atlantic Ocean... AND RESTRICTED AREA REGULATIONS § 334.500 St. Johns River, Atlantic Ocean, Sherman Creek; restricted areas and danger zone, Naval Station Mayport, Florida. (a) The areas. (1) The St. Johns River restricted...
Part Twelve. The Voyages of John Matthias
Printz-Påhlson, Göran
2013-01-01
In August 1974, when the Watergate scandal was moving into its last phase, the American poet John Matthias returned to his home, in South Bend, Indiana, after a year’s stay in England, traveling on the Polish ocean-liner Stefan Bathory. In June of 1976 he set out to sea again, this time on a Russian ship, the Mikhail Lermontov, in order to spend another year in England, as a Visiting Fellow in Poetry in Clare Hall, Cambridge. The voyages took approximately nine days each, and on both ships he...
Unity in John 17 and in IQS I-IX: A comparative study
Directory of Open Access Journals (Sweden)
B. W. de Wet
1997-08-01
Full Text Available The unity theme as it is found in John 17 and in IQS I-IX provides sufficient comparative material to give an indication of the extent to which John�s theology flourished within the contemporary Jewish context. It is argued that the events surrounding Christ constituted for John the central point of orientation according to which the typical Jewish ideas could be interpreted and reformulated. It is finally concluded that, according to this radical and exclusive Christian dynamic approach, certain elements within Judaism, also found among members of the Qumran community, were reinterpreted, while others were either continued or discontinued.
Collected works of John Tate part I (1951--1975)
Tate, John; Serre, Jean-Pierre
2016-01-01
In these volumes, a reader will find all of John Tate's published mathematical papers-spanning more than six decades-enriched by new comments made by the author. Included also is a selection of his letters. His letters give us a close view of how he works and of his ideas in process of formation.
Collected works of John Tate part II (1976--2006)
Tate, John; Serre, Jean-Pierre
2016-01-01
In these volumes, a reader will find all of John Tate's published mathematical papers-spanning more than six decades-enriched by new comments made by the author. Included also is a selection of his letters. His letters give us a close view of how he works and of his ideas in process of formation.
'Epistemology models ontology'− In gesprek met John Polkinghorne ...
African Journals Online (AJOL)
The famous premise of John Polkinghorne, 'epistemology models ontology', has been assessed in this article. It is interpreted that its logic is based on a linear trajectory of knowledge → being. Polkinghorne places much emphasis on the fact that he pursues a 'bottom-up' approach, that is, an inductive way of going about ...
"Aesthetic Emotion": An Ambiguous Concept in John Dewey's Aesthetics
Hohr, H.
2010-01-01
This article analyses the concept of "aesthetic emotion" in John Dewey's "Art as experience". The analysis shows that Dewey's line of investigation offers valuable insights as to the role of emotion in experience: it shows emotion as an integral part and structuring force, as a cultural and historical category. However, the notion of aesthetic…
Discursive investigation into John's internalised spirit identity and its ...
African Journals Online (AJOL)
What does it mean to live in a society where everything good is located within one ethnicity, and geography? In reading the gospel of John, one gets the impression that faithful disciples, the Holy Spirit and morality are exclusively located within the Johannine community and can only permeate to the outside through the ...
John C. Mather, the Big Bang, and the COBE
Bang theory and showing that the Big Bang was complete in the first instants, with only a tiny fraction dropdown arrow Site Map A-Z Index Menu Synopsis John C. Mather, the Big Bang, and the COBE Resources with collaborative work on understanding the Big Bang. Mather and Smoot analyzed data from NASA's Cosmic Background
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
John Tweedie and Charles Darwin in Buenos Aires.
Ollerton, Jeff; Chancellor, Gordon; van Wyhe, John
2012-06-20
The journey of exploration undertaken by Charles Darwin FRS during the voyage of HMS Beagle has a central place within the historical development of evolutionary theory and has been intensively studied. Despite this, new facts continue to emerge about some of the details of Darwin's activities. Drawing on recently published Darwin material and unpublished letters in the archives of the Royal Botanic Gardens, Kew, we document a hitherto unexamined link between Darwin and John Tweedie (1775-1862), a relatively obscure Scottish gardener turned South American plant collector. All of the available evidence points to a meeting between the two men in Buenos Aires in 1832. Tweedie provided Darwin with information about the geography of the Rio Paraná, including the locality of fossilized wood eroding from the river bank. It also seems likely that Tweedie supplied Darwin with seeds that he later shipped back to John Stevens Henslow in Cambridge. Although this brief meeting was at the time relatively unimportant to either man, echoes of that encounter have resonated with Tweedie's descendants to the present day and have formed the basis for a family story about a written correspondence between Darwin and Tweedie. Local information supplied to Darwin by residents such as Tweedie was clearly important and deserves further attention.
John Sidney McCain III. Elukaptenist sirgus sõjakangelane / Hendrik Vosman
Vosman, Hendrik
2008-01-01
Ilmunud ka: Postimees : na russkom jazõke 15. veebr. lk. 9. USA presidendivalimiste vabariiklaste kandidaadi John Sidney McCain III osalemisest Vietnami sõjas ning tegevusest poliitiku ja senati liikmena
Lord John, 2nd Baron Wrottesley and the Wrottesley Hall Observatory
Armitage, J.
2006-12-01
Lord John Wrottesley (1798-1867) was a man of considerable importance in the field of 19th century science, particularly during the first three decades of the Victorian era. He held a number of important offices during this time, including being President of the Royal Astronomical Society (1841 to 1843), of which he was a founder member in 1820; President of the Royal Society 1854 to 1857; and President of the British Association for the Advancement of Science for 1860. He was always to seek a good understanding between scientists and government, and also to promote the general public understanding of science. Although today the name of Lord John Wrottesley is largely forgotten, he created a legacy that remains with us to the present day.
John Scott Haldane: The father of oxygen therapy
Directory of Open Access Journals (Sweden)
K C Sekhar
2014-01-01
Full Text Available John Scott Haldane was a versatile genius who solved several problems of great practical significance. His ability to look beyond the laboratory and investigate theory added crucial findings in the field of respiratory physiology. His work on high altitude physiology, diving physiology, oxygen therapy, and carbon monoxide poisoning led to a sea change in clinical medicine and improved safety and reduced mortality and morbidity in many high risk situations.
Meharry-Johns Hopkins Center for Prostate Cancer Research
2015-11-01
formerly at the Institute for Health, Social, and Community Research (IHSCR) Center for Survey Research ( CSR ) at Shaw University in Raleigh, NC...survey will be conducted at CSR which is now located at Johns Hopkins Bloomberg School of Public Health (JHBSPH) located in Raleigh, NC. The Sons...the strategy to contact sons for whom she had no address or phone number. It was hoped that the father will notify the son to contact the study
A Science of Social Work? Response to John Brekke
Shaw, Ian
2014-01-01
I take the opportunity provided by John Brekke's (2012) article to respond to the general assumptions and approaches that may be brought when considering the question of a science of social work. I consider first, what should be our frames of reference, our communities of interest, or our boundaries of inclusion, for such a discussion?…
John Tyndall's religion: a fragment
Cantor, Geoffrey
2015-01-01
Both contemporaries and historians have focused on the high-profile 1874 Belfast Address in which John Tyndall was widely perceived as promulgating atheism. Although some historians have instead interpreted him as a pantheist or an agnostic, it is clear that any such labels do not accurately capture Tyndall's religious position throughout his life. By contrast, this paper seeks to chart Tyndall's religious journey from 1840 (when he was in his late teens) to the autumn of 1848 when he commenced his scientific studies at Marburg. Although he had been imbued with his father's stern conservative Irish Protestantism and opposition to Catholicism, as a youth he seems for a time to have been attracted to Methodism. Later, however, he questioned and rejected his father's religious views and was increasingly drawn to the more spiritual outlook of Ralph Waldo Emerson and Thomas Carlyle, along with a more radical attitude to politics.
John Nelson Darby: His Contributions to Evangelical Christian Higher Education
Sutherland, Winston Terrance
2010-01-01
The study reported in this article focused on the contributions of John Nelson Derby to biblical hermeneutics and contemporary eschatological thought. Darby continues to exert a great influence on Christianity, particularly conservative evangelical Christianity. This research provides a discussion of Darby's contributions to contemporary…
Ruthless reductionism: Review essay of John Bickle - Philosophy and Neuroscience
Looren De Jong, H.
2005-01-01
John Bickle's new book on philosophy and neuroscience is aptly subtitled 'a ruthlessly reductive account'. His 'new wave metascience' is a massive attack on the relative autonomy that psychology enjoyed until recently, and goes even beyond his previous (Bickle, J. (1998). Psychoneural reduction: The
The contract of language: John Searle’s philosophy of society
Leezenberg, M.
2011-01-01
In Making the Social World, John Searle develops what he calls a "philosophy of society", which explores the ontological status and logical structure of institutional facts like universities and baseball games. This philosophy of society crucially depends on Searle's earlier work in the philosophy
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
John Paul II in the face of the reality of Auschwitz
Directory of Open Access Journals (Sweden)
Stanisław Wronka
2014-06-01
Full Text Available In the context of the canonization of John Paul II, the author reflects on his experience of the concentration camp at Auschwitz. It is a difficult experience, therefore it can more reveal the Pope as a man and a pastor, his way of thinking and perceiving reality. Through canonization this way is indicated to us as a pattern. John Paul came often to Auschwitz, where he saw the place of denial of God and man, but also a place of victory of man over contempt, hatred and death through faith in God, which generates love for Him and for man. The symbol of such a victory is St. Maximilian Maria Kolbe, martyr of love that as Christ gave his life for the fellow prisoner Francis Gajowniczek. In this heroic deed – in the opinion of the Pope – Christ himself was present, so the camp at Auschwitz is not only hell on earth, but also the Golgotha of our times, the cemetery of the martyrs, the sanctuary of the patron of difficult century. Pope John Paul II arrived there to pray and make a reflection on the contemporary man’s condition, who in Christ the Redeemer can still conquer evil with good and to build the peace based on respect for the rights of person and nations.
2011-07-07
... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R4-R-2011-N053; 40136-1265-0000-S3] St... conservation plan and environmental assessment (Draft CCP/EA) for St. Johns National Wildlife Refuge (NWR) in... Complex, P.O. Box 2683, Titusville, FL 32781, or via e-mail at [email protected] , or St. Johns CCP...
The Fundamentals of Civil Disobedience in John Rawls
Directory of Open Access Journals (Sweden)
Eduardo Baldissera Carvalho Salles
2016-11-01
Full Text Available Investigating civil disobedience from a liberal perspective, the working thread through the thought of John Rawls, exposed in the work A Theory of Justice, presenting the phenomenon as a kind of political resistance as well as the theoretical framework that legitimizes as processing instrument contemporary society and guarantor of individual rights. Thus, discusses the duty to obey unjust laws defining what the justification of civil disobedience, designed to Rawls just almost just, democratic and orderly.
El constitucionalismo según John Rawls
Directory of Open Access Journals (Sweden)
Roberto Gargarella
2005-01-01
Full Text Available El término democracia se encuentra completamente ausente del famoso libro de John Rawls, Teoría de la justicia. En Liberalismo político, en cambio, Rawls discute varios de los muchos temas sobre los que el concepto de democracia nos invita a reflexionar. En este escrito concentro mi atención en una de esas discusiones: la tensión entre constitucionalismo y democracia. Más específicamente, procuro examinar de qué modo Rawls trata de afirmar el doble compromiso que toda constitución quiere honrar, esto es, el compromiso con el ideal de la autonomía individual, y el compromiso con el ideal del auto-gobierno colectivo.
John Adams and CERN: Personal Recollections
Brianti, Giorgio
2013-01-01
By any standards, John Adams had a most remarkable career. He was involved in three important, emerging technologies, radar, particle accelerators and controlled fusion, and had an outstanding impact on the last two. Without a university education, he attained hierarchical positions of the highest level in prestigious national and international organizations. This article covers the CERN part of his career, by offering some personal insights into the different facets of his contributions to major accelerator projects, from the first strong-focusing synchrotron, the PS, to the SPS and its conversion to a proton–antiproton collider. In particular, it outlines his abilities as a leader of an international collaboration, which has served as an example for international initiatives in other disciplines.
Practice Makes Pedagogy--John Dewey and Skills-Based Sustainability Education
Tarrant, Seaton Patrick; Thiele, Leslie Paul
2016-01-01
Purpose: The purpose of this paper is to ground contemporary sustainability education in John Dewey's democratic pedagogy. Specifically, the authors argue that Dewey's thought anticipates, and theoretically informs, the sustainability skill set required of contemporary citizens in a complex and changing world. Design/methodology/approach: For…
Het slavernijverleden van John Locke : Naar een minder wit curriculum?
Veraart, W.J.; Van Beers, Britta; Van Domselaar, Iris
2017-01-01
In this contribution I critically address the practical and theoretical attitude of the philosopher John Locke towards the trans-Atlantic slave trade and the colonial system of chattel slavery of people of African descent, in connection with the question how we should deal with the colonial context
History of Philosophy in John Dewey’s discourse on morals
Directory of Open Access Journals (Sweden)
Paulo Fernando Aleixo da Cruz
2016-06-01
Full Text Available Abstract This article follows Chaïm Perelman and Stephen Toulmin’s theoretical and methodological guidelines which foundations are found in the contemporary revision movement of Aristotle’s philosophy. It aims at performing the rhetorical analysis of the essay “Intelligence and Morals” by John Dewey, published in 1908, in which the author advances the thesis that since Renaissance moral has become unrelated of transcendental ends, being hence based on intelligence. The exam of the essay reveals the use of the discursive strategy called “recourse to origin”, which consists of elaborating a genealogical narrative about the history of philosophy in order to sustain the author’s thesis. This article suggests that this form of reasoning is frequently found in Dewey’s work: it can also be observed in the book Democracy and education, in which the philosopher discourses about history of philosophy to show that philosophical reflection on education emerges from social problems. Keywords: John Dewey. Rhetoric. Philosophy and Education.
Writing under cover: Cristina Campo as translator of John Donne
Directory of Open Access Journals (Sweden)
Maria Panarello
2009-12-01
Full Text Available The study of Cristina Campo’s translations offers a precious contribution to those of us who are attempting to investigate the unknown area that lies in the shadowy zone between the source text and its translation. Vittoria Guerrini, a rather solitary and reticent figure in 20th-century Italian literature, wrote under several pen names, of which her favourite was Cristina Campo, the masque she chose for her beautiful and intense translations of a small but significant collection of poems by John Donne. This paper aims at exploring Cristina Campo’s attitude towards translation and the unique relationship she established with the poets she translated. John Donne’s translations reflect a singular solidarity displaying points of affinity between two extremely complex personalities. The dialogic rapport abolishes difference in space and time, as well as difference in language, as author and translator testify the same supreme tension towards beauty, truth and perfection. Translation in this perspective is a sacred gesture of mediation.
Festivals, cultural intertextuality, and the Gospel of John's rhetoric of ...
African Journals Online (AJOL)
Imperial and civic-religious festivals pervaded the late first-century city of Ephesus where John's Gospel was, if not written, at least read or heard. How did Jesus-believers as likely members of somewhat participationist synagogue communities negotiate such pervasive and public celebration of festivals? Did they participate ...
2016-2017 Travel Expense Reports for John McArthur, Governor
International Development Research Centre (IDRC) Digital Library (Canada)
Beata Bialic
Purpose: Board meetings. Date(s):. 2016-06-20 to 2016-06-22. Destination(s):. Ottawa. Airfare: $1,011.70. Other. Transportation: $0.00. Accommodation: $393.40. Meals and. Incidentals: $0.00. Other: $0.00. Total: $1,405.10. Comments: 2016-2017 Travel Expense Reports for John. McArthur, Governor.
2016-2017 Travel Expense Reports for John McArthur, Governor
International Development Research Centre (IDRC) Digital Library (Canada)
Chantal Taylor
Purpose: Board meetings. Date(s):. 2016-11-21 to 2016-11-23. Destination(s):. Ottawa. Airfare: $707.13. Other. Transportation: $88.55. Accommodation: $393.40. Meals and. Incidentals: $76.79. Other: $0.00. Total: $1,265.87. Comments: 2016-2017 Travel Expense Reports for John. McArthur, Governor.
Astronaut John Young during final suiting operations for Apollo 10 mission
1969-01-01
A technician attaches hose from test stand to spacesuit of Astronaut John W. Young, Apollo 10 command module pilot, during final suiting operations for the Apollo 10 lunar orbit mission. Another technician makes adjustment behind Young.
Shallow-water Benthic Habitat Map (2013) for Coral Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This shapefile contains information about the shallow-water (<40 meters) geology and biology of the seafloor in Coral Bay, St. John in the U.S. Virgin Islands...
Looking to the future of organs-on-chips: interview with Professor John Wikswo.
Wikswo, John P
2017-06-01
John Wikswo talks to Francesca Lake, Managing Editor: John is the founding Director of the Vanderbilt Institute for Integrative Biosystems Research and Education (VIIBRE). He is also the Gordon A Cain University Professor; a B learned Professor of Living State Physics; and a Professor of Biomedical Engineering, Molecular Physiology and Biophysics, and Physics. John earned his PhD in physics at Stanford University (CA, USA). After serving as a Research Fellow in Cardiology at Stanford, he joined the Department of Physics and Astronomy at Vanderbilt University (TN, USA), where he went on to make the first measurement of the magnetic field of an isolated nerve. He founded VIIBRE at Vanderbilt in 2001 in order to foster and enhance interdisciplinary research in the biophysical sciences, bioengineering and medicine. VIIBRE efforts have led to the development of devices integral to organ-on-chip research. He is focusing on the neurovascular unit-on-a-chip, heart-on-a-chip, a missing organ microformulator, and microfluidic pumps and valves to control and analyze organs-on-chips.
DEFF Research Database (Denmark)
Strange, Michael Stewart
2009-01-01
Book Review: John M. Hobson and Leonard Seabrooke (2007) (eds) Everyday Politics of the World Economy (Cambridge: Cambridge University Press), 254pp. Udgivelsesdato: 2009......Book Review: John M. Hobson and Leonard Seabrooke (2007) (eds) Everyday Politics of the World Economy (Cambridge: Cambridge University Press), 254pp. Udgivelsesdato: 2009...
Secrets of Thomas Hardy’s Biography: The Attempt of Reading in John Fowles’ Works
Levytska, Oksana
2014-01-01
Hardy’s personality as a writer and a man invariably accompanies John Fowles’ texts, he repeatedly clearly and sometimes with hints and allusions appeals to the creativity of this outstanding writer of the Victorian era, uses as an epigraph quotes from his texts, reveals little known facts of his biography, conducts the biographical analysis of his works, etc. John Fowles’ permanent appeal to Thomas Hardy’s personality the author himself explains by close proximity and affinity of writer's wo...
A Contribuição de John Dewey para a Educação. The contribution of John Dewey for Education
Directory of Open Access Journals (Sweden)
Pereira, Eliana Alves
2009-05-01
Full Text Available Considerado o maior teórico norte-americano do século XX, John Dewey faleceu em 1952 aos noventa e dois anos, deixando imensas contribuições educacionais distribuídas em diversas publicações científicas. Com a teoria Escola Nova, o autor contrapôs ao sistema tradicional de educação, propondo o modelo de ensino-aprendizagem focado no aluno como sujeito da mesma. A teoria prevê ainda, que a aprendizagem deve partir da problematização dos conhecimentos prévios do aluno. Importante ativista e defensor da democracia, também participou de movimentos em defesa das causas sociais.He is considered the greater North American theoretical of the twentieth century, John Dewey died in 1952, with ninety-two years, and he left immense distributed educational contributions in diverse scientific publications. With his theory of the New School, the author opposed to the traditional system of education, considering the model of teach-learning focused in the pupil as subject of the same one. The theory still foresees that learning must leave from the problematization of the previous knowledge of the pupil. He was an important activist and defender of the democracy, also he participated of movements in defense of the social causes.
Gerechtigkeit denken. John Rawls' politische Philosophie aus sozialethischer Perspektive.
Frühbauer, Johannes J.
2004-01-01
John Rawls' "Eine Theorie der Gerechtigkeit" wird grundlegend dargestellt. Zentrale Begriffe und Konzeptionen werden benannt und erläutert; hierzu zählen der Urzustand, der Gerechtigkeitsbegriff, die Gerechtigkeitsgrundsätze, das Differenzprinzip, das Überlegungsgleichgewicht, die wohlgeordnete Gesellschaft, die politische Pflicht und der zivile Ungehorsam. In einem weiteren Schritt werden grundsätzliche Strömungen der Kritik (Libertarianismus, Kommunitarismus, Feminismus) und zwei herausra...
Astronaut John Grunsfeld during EVA training in the WETF
1995-01-01
Astronaut John M. Grunsfeld, STS-67 mission specialist, gives a salute as he is about to be submerged in a 25-feet deep pool in JSC's Weightless Environment Training Facility (WETF). Wearing a special training version of the Extravehicular Mobility Unit (EMU) space suit and assisted by several JSC SCUBA-equipped divers, Grunsfeld was later using the pool to rehearse contingency space walk chores.
Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.
2018-01-01
The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.
John Hick's Philosophy of Religious Pluralism in the Context of ...
African Journals Online (AJOL)
This article is an interpretation of John Hick's philosophy of religious pluralism in the context of traditional Yoruba religion. The ultimate goal of the article is pragmatic, viz. to provide a theoretical basis for peaceful coexistence among different religions in Nigeria. The methods adopted to achieve this objective are ...
John Nelson Darby: Scholarship that Influenced the Bible College Movement
Sutherland, Winston Terrance
2010-01-01
The study reported in this article focused on the scholastic life of John Nelson Darby and his contributions to the Bible college movement. Darby continues to exert a great influence on Christianity, particularly conservative evangelical Christianity. This research provides a discussion of the forces that conspired to shape the direction of…
Linking Past and Present: John Dewey and Assessment for Learning
Kucey, Sharen; Parsons, Jim
2017-01-01
This collection of extracts is drawn from an article originally published in the "Journal of Teaching and Learning" (2012). It provides an important reminder to understand Assessment for Learning in depth, by relating some of its key features to aspects of John Dewey's educational and political philosophy of democratic participation.
Expression, Imagination, and Organic Unity: John Dewey's Aesthetics and Romanticism
Granger, David
2003-01-01
We are presently witnessing a renewed interest in the aesthetics of philosopher and educator John Dewey. And it would seem that this interest marks a significant intellectual reorientation and not simply a passing fad. The publications Educational Theory, Studies in Philosophy and Education, The Journal of Aesthetic Education, The Journal of…
LiDAR Relative Reflectivity Surface (2011) for Coral Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution relative seafloor reflectivity surface for Coral Bay, St. John in the U.S....
Children's Rights, "die Antipadagogen," and the Paternalism of John Stuart Mill.
Nordenbo, Sven Erik
1989-01-01
Examines how John Stuart Mill would have viewed present-day educational liberalists' claims that children should be included in Mill's principle of individual liberty. Concludes that educational liberalists cannot rightly claim Mill as spokesman for their views. (KO)
LiDAR Relative Reflectivity Surface (2011) for Fish Bay, St. John
National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution relative seafloor reflectivity surface for Fish Bay, St. John in the U.S....
Caruso St John y Robert Smithson: Interferencias
Directory of Open Access Journals (Sweden)
Emilia Hernández Pezzi
2016-05-01
Full Text Available Resumen Los discursos cruzados son el soporte común del presente número de Cuadernos. El cruce que planteamos tiene como protagonistas al artista Robert Smithson y a los arquitectos Adam Caruso y Peter St John. Estos últimos hacen mención del trabajo del artista norteamericano para explicar su proyecto de remodelación de Stortorget, la plaza de la catedral en el centro de Kalmar, Suecia. A partir de aquí, comenzamos una exploración del trabajo y las preocupaciones de ambos que nos permite dibujar convergencias y sintonías procesuales por encima de las diferencias temáticas, ideológicas y estilísticas. Al disponer en paralelo la obra de Smithson y Caruso St John descubrimos vibraciones y resonancias que muestran una interacción productiva de sus preocupaciones. La materia se convierte en sus propuestas en un objeto activo y sensible, un depósito energético con el que operar. El traslado de piedras en Stortorget convoca la memoria de la ciudad del mismo modo que el basalto y la sal del Spiral Jetty, erosionados por el tiempo, nos hablan de procesos abiertos. El tiempo y la memoria pasan a ser soportes estratégicos con los que construyen sus miradas. Los objetos se disuelven en las relaciones que establecen con su entorno produciendo equilibrios frágiles e instantáneos. De esta manera el artículo pretende generar un vórtice de reflexión, una espiral en cuyo recorrido se manifiesten las tensiones parciales del cruce propuesto, sus fijezas momentáneas.
St. John's wort significantly increased the systemic exposure and toxicity of methotrexate in rats
International Nuclear Information System (INIS)
Yang, Shih-Ying; Juang, Shin-Hun; Tsai, Shang-Yuan; Chao, Pei-Dawn Lee; Hou, Yu-Chi
2012-01-01
St. John's wort (SJW, Hypericum perforatum) is one of the popular nutraceuticals for treating depression. Methotrexate (MTX) is an immunosuppressant with narrow therapeutic window. This study investigated the effect of SJW on MTX pharmacokinetics in rats. Rats were orally given MTX alone and coadministered with 300 and 150 mg/kg of SJW, and 25 mg/kg of diclofenac, respectively. Blood was withdrawn at specific time points and serum MTX concentrations were assayed by a specific monoclonal fluorescence polarization immunoassay method. The results showed that 300 mg/kg of SJW significantly increased the AUC 0−t and C max of MTX by 163% and 60%, respectively, and 150 mg/kg of SJW significantly increased the AUC 0−t of MTX by 55%. In addition, diclofenac enhanced the C max of MTX by 110%. The mortality of rats treated with SJW was higher than that of controls. In conclusion, coadministration of SJW significantly increased the systemic exposure and toxicity of MTX. The combined use of MTX with SJW would need to be with caution. -- Highlights: ► St. John's wort significantly increased the AUC 0−t and C max of methotrexate. ► Coadministration of St. John's wort increased the exposure and toxicity of methotrexate. ► The combined use of methotrexate with St. John's wort will need to be with caution.
Johns Hopkins Bloomberg School of Public Health OpenCourseWare
Kanchanaraksa, Sukon; Gooding, Ira; Klaas, Brian; Yager, James D.
2009-01-01
The need for public health knowledge is ever increasing, but the educational options have been limited to coursework delivered by academics to individuals who can afford the cost of tuition at public health institutions. To overcome this disparity, Johns Hopkins Bloomberg School of Public Health (JHSPH) has joined the Massachusetts Institute of…
Paradigm Lost: Public Administration at Johns Hopkins University, 1884-96.
Hoffman, M. Curtis
2002-01-01
Discusses the history of public administration at Johns Hopkins University from the late 1800s when a curriculum was developed to educate public servants. Suggests that the program made notable contributions to progressivism but was eclipsed by scientific management; however, it has new relevance in the current climate. (Contains 46 references.)…
John Deweys pædagogik som filosofisk livskunst
DEFF Research Database (Denmark)
Dræby, Anders
De senere år har der været forøget fokus på John Deweys slægtskab med antikkens filosofiske tradition. Oplægget stiller i den forbindelse skarpt på spørgsmålet om, hvorvidt og hvordan det giver mening at forstå Deweys pædagogiske filosofi i sammenhæng med Hellenismens og Romerrigets filosofiske...... livskunst. Er det med andre ord muligt at begribe Deweys pædagogik som en særlig form for filosofisk livskunst?...
Märkusi Peeter Tali arvustuse kohta John Keegani raamatust / Peeter Helme
Helme, Peeter, 1978-
2004-01-01
Rets. rmt. John Keegan. Sõjakunsti ajalugu. Tallinn : Varrak, 2004. Vastukaja Peeter Tali samateemalise artiklile Eesti Päevalehes 23. juulil 2004. Vt. ka: Peeter Tali vastust 6. aug. Eesti Päevalehes lk. 15 "Peeter Helme märkuste kohta Keegani asjus"
Musica come divenire. Il paesaggio sonoro secondo John cage
Directory of Open Access Journals (Sweden)
Francesca Aste
2008-12-01
Full Text Available John Cage ha dedicato tutta la sua vita all’indagine delle possibilità di relazione dell’uomo con i suoni che lo circondano, allargando il campo dell’arte musicale a quello dell’etica e dell’ecologia. Cage non si è occupato di soundscape come un genere compositivo specifico, come forse oggi potremmo identificarlo, tuttavia l’ambiente occupa un ruolo centrale in relazione al suo modo di comporre.
George Berkeley’s criticism to John Locke’s representationalism
Directory of Open Access Journals (Sweden)
Alberto Oya
2018-03-01
Full Text Available In his Treatise concerning the Principles of Human Knowledge, George Berkeley offers some arguments in order to criticize the materialist position. My aim in this paper is to expound and analyze in detail these arguments. Given that Berkeley’s criticism to materialism is, at the end, a criticism to John Locke’s representationalism, I will begin this paper explaining which are the core ideas of Locke’s proposal.
Kablilt Casablancasse : Eesti suurim seikleja John Robert Ignace Lepp 100 / Vello Salo
Salo, Vello, 1925-
2009-01-01
Eesti päritolu seikleja John Robert Lepp, Prantsusmaal tuntud kui katoliku kiriku preester Ignace Lepp, avaldas prantsuse ja saksa keeles hulgaliselt raamatuid psühholoogia, filosoofia ja religiooni valdkonnast