WorldWideScience

Sample records for watson john tooze

  1. John Watson's paradoxical struggle to explain Freud.

    Science.gov (United States)

    Rilling, M

    2000-03-01

    John Watson was fascinated by the discoveries of psychoanalysis, but he rejected Freud's central concept of the unconscious as incompatible with behaviorism. After failing to explain psychoanalysis in terms of William James's concept of habit, Watson borrowed concepts from classical conditioning to explain Freud's discoveries. Watson's famous experiment with Little Albert is interpreted not only in the context of Pavlovian conditioning but also as a psychoanalytically inspired attempt to capture simplified analogues of adult phobic behavior, including the "transference" of emotion in an infant. Watson used his behavioristic concept of conditioned emotional responses to compete with Freud's concepts of displacement and the unconscious transference of emotion. Behind a mask of anti-Freudian bias, Watson surprisingly emerges as a psychologist who popularized Freud and pioneered the scientific appraisal of his ideas in the laboratory.

  2. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  3. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  4. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  5. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  6. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  7. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  8. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  9. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  10. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  11. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  12. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    In this article, we start with John McCarthy's definition of. Artificial Intelligence and describe select approaches to its sub-areas: natural language processing and question answer- ing. We then outline the challenge that IBM Research under- took to build Watson, a question-answering computer system that would compete at ...

  13. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    http://www.ias.ac.in/article/fulltext/reso/019/03/0222-0241. Keywords. John McCarthy; artificial intelligence; natural language processing; question answering system; IBM; DeepQA; Watson; Jeopardy!; quiz show. Author Affiliations. Raman Chandrasekar1. ProQuest 501 North 34th Street Suite 300, Seattle, WA 98103, USA ...

  14. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  15. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  16. Ed Watson 1940-2006

    CERN Document Server

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  17. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  18. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  19. Validating the Watson Glaser Critical Thinking Appraisal

    Science.gov (United States)

    Hassan, Karma El; Madhum, Ghida

    2007-01-01

    This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…

  20. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  1. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  2. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  3. Antjie Krog, Stephen Watson and the Metaphysics of Presence ...

    African Journals Online (AJOL)

    In this paper I explore some of the questions that follow from Stephen Watson's assertions that Antjie Krog's the stars say 'tsau' exhibits elements of plagiarism. In particular, I examine different conceptions of originality that can be identified in Watson and Krog's statements concerning the reworking of the /Xam materials into ...

  4. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  5. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  6. An analysis and evaluation of Watson's theory of human care.

    Science.gov (United States)

    Sourial, S

    1996-08-01

    Despite a high priority placed on theory-testing in nursing, there continues to be minimal research undertaken which adequately tests nursing theories. A study was planned to contribute to theory-testing in nursing by testing an aspect of Watson's (1988) theory of human care. Watson essentially believes that nursing is an intersubjective human process and places a high value on the caring relationship between the nurse and the recipient of care. Before proceeding with the intended study, the following analysis and evaluation of Watson's theory presented here was undertaken, with guidance from a tool developed by Fawcett & Downs (1992). In this tool, the analysis identifies the concepts and propositions that make up the theory and the evaluation includes the criteria of significance, internal consistency, parsimony, testability and empirical adequacy of the theory being tested. Overall, this analysis and evaluation found two areas of Watson's work which were in need of further development.

  7. The Equivalence of Two Constructions of Galton-Watson Processes

    CERN Document Server

    Kurata, K

    2004-01-01

    In most textbooks on branching processes, the Galton-Watson process is defined as an integer valued Markov chain with a special kind of transition probability, somtimes supplemented with an intuitive description of random family trees. A precise construction of the Galton-Watson process on the space of trees was first given by R. Otter in 1949, and later independently by J. Neveu in 1986. In this note, we show that these two constructions are actually equivalent.

  8. Coalescing the theories of two nurse visionaries: Parse and Watson.

    Science.gov (United States)

    Walker, C A

    1996-11-01

    The theories of two nurse visionaries, Rosemarie Rizzo Parse and Jean Watson, are examined for areas of agreement and notable differences. Watson and Parse reject (or hold seriously suspect) traditional, positivistic methods of studying human behaviour and posit their theories as alternatives to the totality paradigm. Since both of these theories, Parse's theory of human becoming and Watson's theory of transpersonal care, borrow heavily from existential phenomenology, major tenets of this philosophic perspective are outlined. Each theory is then described with emphasis on anchoring motifs, concepts, and principles. Next both theories are analysed and critiqued simultaneously. Finally, the theories are applied to a case study with the intent of maximizing their mutual strengths and diminishing their limitations. Coalescence of compatible theories is recommended as a way of enhancing the application of nursing knowledge in practice.

  9. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  10. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  11. John Lindsay

    CERN Multimedia

    2005-01-01

    A few weeks ago John Lindsay passed away unexpectedly at his home in St. Genis. With his death we have lost a pioneer in detector electronics and one of the founding fathers of the CERN Electronics Group. John came to CERN in 1956 to join the Electronics Group, which was being formed in the SC Division. He thus participated from the beginning in the design, development, production, commissioning and support of electronics for the experiments at the CERN accelerators, initially at the SC and finally at the SPS. From the University of Glasgow he brought his expertise on pulse height analyzers, which were called kick sorters in those days, and did pioneering work with it in the early CERN experiments. He designed read-out systems for successive generations of detectors, such as wire spark chambers, multiwire proportional chambers, calorimeters, etc., often coming up with innovative solutions. Surely one of his finest moments must have been when he worked on complex detector systems, such as liquid argon calo...

  12. The Pragmatic Utility of Watson-Based Caring Measures.

    Science.gov (United States)

    Atiyeh, Huda; Ahmad, Muayyad; Alslman, Eman Tariq; Hani, Manar Ali Bani

    2016-12-01

    This study aims to clarify the caring concept with emphasis on the pragmatic utility of caring measures. The Morse et al. (Morse, Hupcey, Mitcham, & Lenz, 1996; Morse, Mitcham, Hupcey, & Tasón, 1996) criteria for concept maturity were used as a framework. A literature review of Watson-based caring concept was undertaken to evaluate the logical, epistemological, linguistical, and pragmatic parameters. The concept of caring as conceptualized by Watson and operationalized through different measures appeared mature. Despite differences, shorter scales of caring measures were effective to capture caring behavior. Caring concept was further clarified and more confidence in using caring measures for assessment, evaluation, and modification of caring behavior become more feasible.

  13. Watson-Crick hydrogen bonding of unlocked nucleic acids.

    Science.gov (United States)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-11-15

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  15. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  16. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics

    OpenAIRE

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-01-01

    Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistic...

  17. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  18. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  19. On the asymptotic behavior of the Durbin-Watson statistic for ARX processes in adaptive tracking

    OpenAIRE

    Bercu, Bernard; Portier, Bruno; Vazquez, V.

    2012-01-01

    International audience; A wide literature is available on the asymptotic behavior of the Durbin-Watson statistic for autoregressive models. However, it is impossible to find results on the Durbin-Watson statistic for autoregressive models with adaptive control. Our purpose is to fill the gap by establishing the asymptotic behavior of the Durbin Watson statistic for ARX models in adaptive tracking. On the one hand, we show the almost sure convergence as well as the asymptotic normality of the ...

  20. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  1. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  2. Durbin-Watson statistics for model life tables.

    Science.gov (United States)

    Smith, D P

    1983-05-01

    In populations with inaccurate age reporting, even very careful mortality surveys can produce implausible survival estimates because of age heaping, because of a mismatch between numerators and denominators (e.g., when deaths are taken from vital registration and population from a census), or because of a combination of the 2. The Brass logit regression enables one to smooth least squares values estimated from census or survey data to those of a reference life table, but the characteristics of human mortality are so strong, and the differences between related life tables so subtle, that it is often difficult to determine which model table gives the best fit. Standard tests, such as r squared by 2, t, and x squared by 2 tests, are generally not sensitive enough to help with our selection. The presence of a systematic pattern of errors, however, implies that the reference life table is not closely representative of the observed population (or that the data contain systematic biases). The Durbin-Watson test for serial correlation of errors is a powerful tool for detecting systematic error, and consequently, can be quite useful for determining the best reference table for a smoothing operation.

  3. St. John's Wort (image)

    Science.gov (United States)

    The herb St. John's Wort is believed to be helpful in relieving mild to moderate depression, but should only be taken under a physician's supervision. St. John's Wort may clash with other medications or foods ...

  4. John Dewey: Demokratiets filosof

    DEFF Research Database (Denmark)

    Christensen, Martin Ejsing

    2016-01-01

    Ide-og filosofihistorisk artikel om den rolle, som den amerikanske filosof John Dewey har spillet i den amerikanske offentlighed......Ide-og filosofihistorisk artikel om den rolle, som den amerikanske filosof John Dewey har spillet i den amerikanske offentlighed...

  5. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  6. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  7. A Durbin-Watson serial correlation test for ARX processes via excited adaptive tracking

    Science.gov (United States)

    Bercu, Bernard; Portier, Bruno; Vazquez, Victor

    2015-12-01

    We propose a new statistical test for the residual autocorrelation in ARX adaptive tracking. The introduction of a persistent excitation in the adaptive tracking control allows us to build a bilateral statistical test based on the well-known Durbin-Watson statistic. We establish the almost sure convergence and the asymptotic normality for the Durbin-Watson statistic leading to a powerful serial correlation test. Numerical experiments illustrate the good performances of our statistical test procedure.

  8. A Durbin-Watson serial correlation test for ARX processes via excited adaptive tracking

    OpenAIRE

    Bercu, Bernard; Portier, Bruno; Vazquez, Victor

    2014-01-01

    We propose a new statistical test for the residual autocorrelation in ARX adaptive tracking. The introduction of a persistent excitation in the adaptive tracking control allows us to build a bilateral statistical test based on the well-known Durbin-Watson statistic. We establish the almost sure convergence and the asymptotic normality for the Durbin-Watson statistic leading to a powerful serial correlation test. Numerical experiments illustrate the good performances of our statistical test pr...

  9. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  10. A John Peter

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. A John Peter. Articles written in Resonance – Journal of Science Education. Volume 3 Issue 3 March 1998 pp 41-45 General Article. Plant Glandular Trichomes Chemical Factories with Many Potential Uses · A John Peter Thomas G Shanower · More Details ...

  11. John Dewey, an Appreciation

    Science.gov (United States)

    Clopton, Robert W.

    2015-01-01

    The subject of the annual Presidential address of Phi Kappa Phi, presented on May 8, 1962, was John Dewey. Dewey is identified in the public mind chiefly as an educational philosopher. In this address, the author describes the life and work of John Dewey as an indefatigable student of life whose interests ranged, like those of Aristotle, over the…

  12. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  13. The Watson-Forbes Biogeographical Controversy Untangled 170 Years Later.

    Science.gov (United States)

    Fattorini, Simone

    2017-08-01

    Hewett Cottrell Watson and Edward Forbes were two naturalists of the Victorian age. They were protagonists on a dispute that generated comment and serves as an illuminating case study of misunderstanding in priority issues. Watson accused Forbes of having plagiarized his original classification of the British plants into groups on the basis of their geographical distribution. This controversy originated mostly from a so-far-ignored basic difference in Watson's and Forbes' ideas about biogeographical regionalization. Watson's classification of the British flora into groups of species with similar distribution was probably the first application of the concept of "regional chorotype." By contrast, the biogeographical classification of the British flora proposed by Forbes belongs to the concept of "element," because it was based on assumed species history (i.e. colonization routes). The two approaches may produce similar outcomes, but remain conceptually different. Although personal reasons may have contributed to exacerbate the Watson-Forbes controversy, failure in recognizing this distinction by its actors and their contemporaries, such as Hooker and Darwin, was the most important cause.

  14. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  15. [Embracing Jean Watson's theory of Human Caring through a reflective practice within a clinical situation].

    Science.gov (United States)

    Cara, Chantal; O'Reilly, Louise

    2008-12-01

    Essentially based on humanistic values of respect, collaboration, and uniqueness rather than on objectification, control, and categorization of the person cared-for, a professional's practice rooted in caring is aimed at helping individuals and their families, which can only be carried out through respect for human dignity. If we are to consider caring as the core of nursing, nurses will undoubtedly have to make a conscious effort to preserve human caring within their clinical practice (Cara, 2004b; O'Reilly, 2008, Watson, 2002). However, to support this endeavour, caring theories, such as the one proposed by Jean Watson, are essential. Inspired by Cara's (2003) continuing education paper, this reflection paper takes a pragmatic approach to promote the understanding of key elements involved in Watson's caring theory through a process of reflective practice within a rehabilitation clinical situation.

  16. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  17. A case study based on Watson's theory of human caring: being an infertile woman in Turkey.

    Science.gov (United States)

    Ozkan, Ilkay Arslan; Okumus, Hülya; Buldukoglu, Kadriye; Watson, Jean

    2013-10-01

    Nursing theories and models form a framework for systematizing nursing practices. In Turkey, nurses are generally organized on the basis of the medical model, which makes the essence of nursing invisible. The authors here aim to explain how to maintain a theory-based care approach for nurses working with persons experiencing infertility. The interaction between an infertile woman and a nurse is shared within the framework of Watson's theory of human caring. Watson's theory has been found useful for the infertile group in practice.

  18. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    OpenAIRE

    Roberta Maria Savieto; Eliseth Ribeiro Leão

    2016-01-01

    Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-...

  19. Teaching holistic child health promotion using Watson's theory of human science and human care.

    Science.gov (United States)

    Sessanna, Loralee

    2003-02-01

    "Preservation and advancement of human care is a critical issue for nursing today in our increasingly depersonalized society. The mandate for nursing within science as well as within society is a demand for cherishing of the wholeness of human personality" (Watson, 1999, p. 29). Children today are being faced with having to deal with this societal "depersonalization." How children grow up to perceive themselves and others is crucial in developing future adults who genuinely care about themselves and humankind in its totality. Watson's (1999) human science and human care theory was incorporated into teaching health promotion to a group of preadolescent children. Copyright 2003, Elsevier Science (USA). All rights reserved.

  20. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  1. Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors

    Science.gov (United States)

    Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.

    2005-01-01

    The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…

  2. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  3. N. Watson- A. Parker (eds). Sports and Christianity.Historical and Contemporary Perspectives.

    OpenAIRE

    Páramo, Víctor; Sebastián Solanes, Raúl F.

    2013-01-01

    El estudio de la relación entre el deporte y las religiones en general ha proliferado en los últimos años, como evidencia la ingente cantidad de investigaciones llevadas a cabo y que los editores de la obra, Nick J. Watson y Andrew Parker, detallan al término de la Introducción.

  4. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  5. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Unknown

    [Chandrasekhar K and Malathi R 2003 Non-Watson Crick base pairs might stabilize RNA structural motifs in ribozymes – A comparative study of group-I intron structures; ... recognition sites for proteins, metal ions and small mole- cules (Jeffrey et al 1999; ..... From the sequence analysis (table 1, figure 1) we find an extreme ...

  6. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  7. E.L.C. Watson se pionierstog deur Suid-Afrika (1912) | van der ...

    African Journals Online (AJOL)

    E.L.C. Watson's pioneering trip through South Africa (1912): The pre-First World War era in South Africa can undoubtedly be characterised by a number of aspects. However, two widely divergent aspects with a common denominator have been selected as the topic. On the one hand there was the struggle for women's rights ...

  8. "I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"

    Science.gov (United States)

    McNair, Jonda C.

    2008-01-01

    This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…

  9. John Deakin: Double Exposures

    Directory of Open Access Journals (Sweden)

    Paul Rousseau

    2015-11-01

    Full Text Available In this series of short films made by Jonathan Law, the art historian James Boaden, and the curator of The John Deakin Archive, Paul Rousseau, discuss the double-exposure images made by the photographer John Deakin (1912-1972 in the 1950s and 1960s. The films ask you, firstly, to look closely at the images being discussed. Each one begins with a sustained and intense shot of a single image before opening up to a wide-ranging discussion about Deakin, double exposures, and photography.

  10. John Maynard Smith

    Indian Academy of Sciences (India)

    Unknown

    2004-04-19

    Apr 19, 2004 ... The evolutionary biology community has been saddened and depleted this month by the loss of Prof. John Maynard. Smith who made many important contributions to evolu- tionary theory, including the now ubiquitous concept of an evolutionarily stable strategy (ESS). In a half-century long working career ...

  11. Cockcroft, Prof. John Douglas

    Indian Academy of Sciences (India)

    John Douglas Nobel Laureate (Physics) - 1951. Date of birth: 27 May 1897. Date of death: 18 September 1967. YouTube; Twitter; Facebook ... Summer Schools. Posted on 21 December 2017. ASTROPHYSICS: An Observational View of the Universe. Math Art and Design: MAD about Math, Math Education and Outreach.

  12. Russell, Prof. John

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1935 Honorary. Russell, Prof. John. Date of birth: 31 October 1872. Date of death: 12 July 1965 ... Posted on 21 December 2017. ASTROPHYSICS: An Observational View of the Universe. Math Art and Design: MAD about Math, Math Education and Outreach. Math and Finance ...

  13. John Ruskin as Zoologist

    NARCIS (Netherlands)

    Hammen, van der L.

    1983-01-01

    A study is made of John Ruskin's work in the field of zoology. It is demonstrated that Ruskin's early interest in zoology was connected with his study of ornament, whilst his later studies are connected with his Oxford teaching and his social work. Ruskin's interest in zoology concerned groups

  14. John Archibald Wheeler

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 1. John Archibald Wheeler - Man with Picturesque Imagination. Jayant V Narlikar. General Article Volume 18 Issue 1 January 2013 pp 22-28. Fulltext. Click here to view fulltext PDF. Permanent link:

  15. John Archibald Wheeler

    Indian Academy of Sciences (India)

    IAS Admin

    John Archibald Wheeler was born in 1911 in Jacksonville, Florida – he adopted the Archibald from his mother's side. His upbringing was in many parts of the US given his father's job as a librarian, nd he even spent a year in a small rural school in which there was only one teacher for all classes! His early interests included ...

  16. John Cale avaldas memuaarid

    Index Scriptorium Estoniae

    1999-01-01

    Rockbändi "The Velvet Underground" asutajaliige John Cale avaldas oma autobiograafia "What's Welsh for Zen?". Koos biograafiakirjanik Victor Bockrisiga kirjutatud teos räägib 60ndate lõpu kultuurielust New Yorgis, koostööst Andy Warholiga jm.

  17. John Cage Discusses Fluxus.

    Science.gov (United States)

    Snyder, Ellsworth

    1992-01-01

    Presents an informal discussion with composer John Cage which includes his response to George Maciunas' work, his recollections of Marcel Duchamp, the complex relationship between inelegant material and revealing works of art, neo-Dada and neo-Fluxus, Wittgenstein and the artist's ultimate responsibility to initiate a change in the viewer or…

  18. Eccles, Prof. John Carew

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1968 Honorary. Eccles, Prof. John Carew Nobel Laureate (Medicine) - 1963. Date of birth: 27 January 1903. Date of death: 2 May 1997. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the Three ...

  19. Joel John Taura

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Astrophysics and Astronomy. Joel John Taura. Articles written in Journal of Astrophysics and Astronomy. Volume 35 Issue 2 June 2014 pp 107-119. Stability of Triangular Equilibrium Points in the Photogravitational Restricted Three-Body Problem with Oblateness and Potential from a Belt.

  20. Anderson, Prof. John Stuart

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1978 Honorary. Anderson, Prof. John Stuart. Date of birth: 9 January 1908. Date of death: 25 December 1990. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. Theory Of Evolution. Posted on 23 January 2018. Joint Statement by the Three Science Academies of India ...

  1. John Archibald Wheeler

    Indian Academy of Sciences (India)

    IAS Admin

    to promote teaching and research in astronomy in the universities. He has written extensively in. English and Marathi to popularize science. John Archibald Wheeler was a researcher and teacher par excellence who was responsible for popularizing the theory of general relativity amongst the academics in the United States.

  2. Conversations with John Williams

    Science.gov (United States)

    Sullivan, Jack

    2007-01-01

    In this article, the author shares the views of John Williams, Hollywood's premier composer, who has written more than 300 scores, about the future of classical and film music. A gregarious person in a field requiring monklike isolation, Williams values the "association with the soloists, and the wonderful inspiration from players." His…

  3. Goodenough, Prof. John B

    Indian Academy of Sciences (India)

    Fellow Profile. Elected: 1980 Honorary. Goodenough, Prof. John B. Date of birth: 25 July 1922. Address: Virginia H Cockrell Centennial, Professor of Engineering, University of Texat at Austin, ETC 9.184, Stop C2200, Austin, TX 78712, U.S.A.. Contact: Office: (+1-512) 471 1646. Email: jgoodenough@mail.utexas.edu.

  4. John Hatties feedbackmodel

    DEFF Research Database (Denmark)

    Hyldahl, Kirsten Kofod

    2015-01-01

    Med afsæt i den newzealandske professor John Hatties feedbackmodel giver denne artikel et perspektiv på, hvordan der kan arbejdes med effektiv feedback i undervisningen. Artiklen belyser hvordan en god feedbackkultur har betydning for, at læringsmål og feedbackprocesser anvendes konstruktivt og e...... effektivt i elevernes læreprocesser. Der gives desuden et eksempel på differentiering af fælles læringsmål og hvordan feedback, med afsæt i elevernes forudsætninger, kan gives i henhold til aktuelle læringsmål.......Med afsæt i den newzealandske professor John Hatties feedbackmodel giver denne artikel et perspektiv på, hvordan der kan arbejdes med effektiv feedback i undervisningen. Artiklen belyser hvordan en god feedbackkultur har betydning for, at læringsmål og feedbackprocesser anvendes konstruktivt og...

  5. John Ruskin as Zoologist

    OpenAIRE

    Hammen, van der, L.

    1983-01-01

    A study is made of John Ruskin's work in the field of zoology. It is demonstrated that Ruskin's early interest in zoology was connected with his study of ornament, whilst his later studies are connected with his Oxford teaching and his social work. Ruskin's interest in zoology concerned groups frequently represented in art (particularly birds and snakes). Of these groups he studied, in a fragmentary way, the artistic morphology, the life-habits, the particular position to art and literature, ...

  6. John Strong (1941 - 2006)

    CERN Document Server

    Wickens, F

    Our friend and colleague John Strong was cruelly taken from us by a brain tumour on Monday 31st July, a few days before his 65th birthday John started his career working with a group from Westfield College, under the leadership of Ted Bellamy. He obtained his PhD and spent the early part of his career on experiments at Rutherford Appleton Laboratory (RAL), but after the early 1970s his research was focussed on experiments in CERN. Over the years he made a number of notable contributions to experiments in CERN: The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras to record the sparks in the spark chambers; He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems; He was responsible for the second level trigger system for the ALEPH detector and spent five years leading a team that designed and built the system, which ran for twelve years with only minor interventions. Following ALEPH he tur...

  7. The practice of nurses caring for families of pediatric inpatients in light of Jean Watson.

    Science.gov (United States)

    Santos, Maiara Rodrigues Dos; Bousso, Regina Szylit; Vendramim, Patrícia; Baliza, Michelle Freire; Misko, Maira Deguer; Silva, Lucía

    2014-08-01

    Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children's families in the light of Jean Watson's Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson's theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family's relationship. Results The theory favored reflections about self, about the institutions and about nurses' relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child's family in hospital.

  8. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  9. Moderate deviations for the Durbin-Watson statistic related to the first-order autoregressive process

    OpenAIRE

    Bitseki Penda, Valère; Djellout, Hacène; Proïa, Frédéric

    2012-01-01

    24 pages.; The purpose of this paper is to investigate moderate deviations for the Durbin-Watson statistic associated with the stable first-order autoregressive process where the driven noise is also given by a first-order autoregressive process. We first establish a moderate deviation principle for both the least squares estimator of the unknown parameter of the autoregressive process as well as for the serial correlation estimator associated with the driven noise. It enables us to provide a...

  10. Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories

    OpenAIRE

    Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein

    2017-01-01

    Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker?Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans tak...

  11. John Campbell Begg

    Science.gov (United States)

    Campbell, Robert

    2002-03-01

    John Campbell Begg born in Dunedin in 1876 was the son of Alexander Campbell Begg and Katherine Begg, early Otago settlers. He studied physics and philosophy at the University of Otago before turning to business and rural pursuits. He died in Dunedin in 1965 age 89. The Begg family were foundation members of the Otago Astronomical Society. Visits to the Tanna Hill Observatory were made in 1915. The astronomical observatory which stands in Robin Hood Park, Roslyn, Dunedin bears his name; Beverly Begg Observatory

  12. John Adams in 1959

    CERN Document Server

    1959-01-01

    On 24 November 1959, the Proton Synchrotron accelerated particles to 24 GeV. John Adams, leader of the construction team, announced the achievement in the Main Auditorium. In his hand can be seen an empty vodka bottle, which he had received from Nikitin with the message that it was to be drunk when CERN passed Dubna's world record energy of 10 Gev. The bottle now contains a polaroid photograph of the 24 GeV pulse ready to be sent to the Soviet Union.

  13. Two portraits of caring: a comparison of the artists, Leininger and Watson.

    Science.gov (United States)

    Cohen, J A

    1991-08-01

    Two nursing leaders, Madeleine Leininger and Jean Watson, have devoted their careers to studying and evolving the meaning of caring. The theme of caring as presented by each theorist was explored along with their views of the nature of nursing, use of theory development strategies, and their individual contributions to the development of nursing knowledge. Both identify nursing as a humanistic science, with the concept of caring being the central unifying domain of nursing. Consistent with their belief that the humanistic sciences require a different research methodology to study that which is uniquely human, both have utilized qualitative research methodologies in their study of care. The evolution of each theorist perspective of care reflects their own background and experiences. Each theorist, therefore, has painted a different portrait of caring, demonstrating a differing emphasis on philosophical, cultural and empirical concerns. For Leininger, caring must be placed in a cultural context since caring patterns can differ transculturally. Watson has focused on the philosophic (existential--phenomenological) and spiritual basis of caring and sees caring as the ethical and moral ideal of nursing. Both Leininger and Watson have demonstrated their artistry in their individual portraits of caring and in their contributions to the development of nursing knowledge.

  14. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  15. John Knox and education

    Directory of Open Access Journals (Sweden)

    Graham A. Duncan

    2017-02-01

    Full Text Available John Knox the 16th century Scottish reformer made a lasting impact on the Scottish nation in the fields of society, politics, church and education. He is remembered mainly for his reform of the church but he also made a significant contribution to the reform of education, which has lasted until the present day and has impacted on other contexts. Although much of his vision was not realised during his lifetime, his mission continued nonetheless. He was a product of the late Medieval age and his transformation was completed by his experience alongside John Calvin in Geneva. This was then contextualised in his own Scottish situation. Here we examine his work in the field of education with particular reference to the First Book of Discipline. The outcome of his labours was a compulsory, universal system of free education, which involved character formation and enabled all to achieve the limit of their potential.

  16. Following John Wilkinson

    Directory of Open Access Journals (Sweden)

    Joe Luna

    2015-09-01

    Full Text Available This article reads closely John Wilkinson’s essay ‘Following the Poem’ (2007 alongside some of Wilkinson’s poetry from the 1980s and 1990s. Using the work of Donald Winnicott as a touchstone, the article critically evaluates the claims made in Wilkinson’s essay about fullness and intersubjectivity against some of his poetry’s expressions of fragmentation and dismemberment. The article concludes with some reflections on Wilkinson’s quotation of Shelley’s 'Prometheus Unbound in Proud Flesh' (1986, and on the later collection 'Hid Lip' (1992. It argues that an illuminating disparity or contradiction exists between the avowed aim of the reading practices described and advocated in ‘Following the Poem,’ and the state of the subjects repeatedly presented in Wilkinson’s poetry. The article finally suggests that this contradiction itself speaks volumes about the kind of world in which both poetry and poetics exist.

  17. John Adams Lecture

    CERN Multimedia

    PH Department

    2010-01-01

    13 December 2010 14:30 - Council Chamber, Bldg.503-1-001 Accelerator Breakthroughs, Achievements and Lessons from the Tevatron Collider V. Shiltsev / Fermilab’s Accelerator Physics Centre This year we celebrate the 25th anniversary of the first proton-antiproton collisions in the Tevatron. For two and a half decades the Tevatron at Fermilab (Batavia, IL, USA) was a centerpiece of the US and world’s High Energy Physics as the world’s highest energy particle collider at 1.8 TeV center of mass energy. While funding agencies are deciding on a 3-year extension of the Collider Run II operation through 2014, we – in this 2010 John Adams Lecture - will take a look in exciting story of the Tevatron: the story of long preparations, great expectations, numerous difficulties, years of “blood and sweat”, continuous upgrades, exceeding original goals (by a factor of 400) and high emotions. An accelerator scientist prospective will be given on a wide spectrum o...

  18. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  19. Applying Watson's nursing theory to assess patient perceptions of being cared for in a multicultural environment.

    Science.gov (United States)

    Suliman, Wafika A; Welmann, Elizabeth; Omer, Tagwa; Thomas, Laisamma

    2009-12-01

    J. Watson's (2002) caring theory addresses caring relationships among humans and the deep experiences of life itself. M. Leininger (1988) noted that caring is a universal phenomenon, which is likely to be perceived differently by patients and nurses if they come from different cultural backgrounds. Little is known about the patients' perception of "being cared for" in the Kingdom of Saudi Arabia, where most nurses in the workforce come from cultural backgrounds different from their patients. This study was designed to explore Saudi patient perceptions of important caring behaviors and those most frequently attended to by staff nurses in a multicultural environment. A questionnaire survey was used to explore discrepancies between the perceived importance of caring behaviors and how frequently those caring behaviors were attended to by staff nurses. A probability sample of 393 patients was drawn from three hospitals in three different regions of Saudi Arabia. The Caring Behaviors Assessment instrument of S. N. Cronin and B. Harrison (1988) was used in data collection. Patients rated overall caring behaviors as important (97.2%) and frequently experienced (73.7%). The discrepancy between the importance of and frequency of attendance to caring behaviors by nurses was statistically significant (t = -4.689, p = .001). The caring behaviors based upon Jean Watson's theory were valued by Saudi patients irrespective of their cultural differences with the caregiver. However, the frequency of caring attended to by nurses in teaching/learning and helping/trust behavior subcategories were rated lower. Such is most likely the result of culture differences and language barriers existing between patients and nurses in Saudi Arabia. Results showed that the carative factors in Jean Watson's theory were also applicable to patients in Saudi Arabia and that nursing professionals should base their care on such theory to meet patient needs.

  20. Finite sample of the Durbin-Watson test against fractionally integrated disturbances

    OpenAIRE

    Kleiber, Christian; Krämer, Walter

    2004-01-01

    We consider the finite sample power of various tests against serial correlation in the disturbances of a linear regression when these disturbances follow a stationary long memory process. It emerges that the power depends on the form of the regressor matrix and that, for the Durbin-Watson test and many other tests that can be written as ratios of quadratic forms in the disturbances, the power can drop to zero for certain regressors. We also provide a means to detect this zero-power trap. Our ...

  1. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  2. Strong enhancement of vibrational relaxation by Watson-Crick base pairing.

    Science.gov (United States)

    Woutersen, Sander; Cristalli, Gloria

    2004-09-15

    We have studied the ultrafast dynamics of NH-stretch vibrational excitations in Watson-Crick base pairs consisting of adenine and uracil derivatives. To estimate the influence of the A:U hydrogen bonding on the vibrational dynamics, we have also studied the uracil derivative in monomeric form. The vibrational relaxation of the NH-stretching mode is found to occur much faster in the Watson-Crick base pair than in monomeric uracil. From the delay dependence of the transient vibrational spectra, it can be concluded that both in base-paired and monomeric uracil, the energy relaxation takes place in two steps, the first step being a rapid transfer of energy from the NH-stretching mode to an accepting mode, the second step the relaxation of this accepting mode. The transient spectra show evidence that in the base pair the hydrogen bond between the nucleobases acts as the accepting mode, and that the hydrogen bonding between the bases is responsible for the extremely fast vibrational relaxation in this system.

  3. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  4. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  5. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  6. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  7. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  8. Eckert, Wallace John (1902-71)

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    Computer scientist and astronomer. Born in Pittsburgh, PA, Eckert was a pioneer of the use of IBM punched card equipment for astronomical calculations. As director of the US Nautical Almanac Office he introduced computer methods to calculate and print tables instead of relying on human `computers'. When, later, he became director of the Watson Scientific Computing Laboratory at Columbia Universit...

  9. ALGUNOS ASPECTOS ESENCIALES DEL PENSAMIENTO DE JEAN WATSON Y SU TEORÍA DE CUIDADOS TRANSPERSONALES

    OpenAIRE

    Urra M,Eugenia; Jana A,Alejandra; García V,Marcela

    2011-01-01

    En este trabajo se realiza una síntesis del pensamiento de Jean Watson a partir de dos perspectivas fundamentales a saber: su filosofía de cuidados y su teoría de cuidados transpersonales. El análisis se centra, por una parte, en los fundamentos filosóficos del cuidado que derivan del existencialismo y de la teoría de la alteridad levin-asiana y, por otra, en los 10 factores de cuidado que caracterizan su teoría. El artículo además rescata aspectos de la utilización de su teoría de cuidados e...

  10. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  11. Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories.

    Science.gov (United States)

    Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein

    2017-01-01

    In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. In this study, we use concept analyses of Walker-Avants and compare research methods. Material used is all Islamic documents. According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence.

  12. Morpholino oligonucleotides do not participate perfectly in standard Watson-Crick complexes with RNA.

    Science.gov (United States)

    Xiao, Gaoping; Wesolowski, Donna; Izadjoo, Mina; Altman, Sidney

    2010-11-01

    RNase P from E. coli will cleave a RNA at a site designated in a complex with an external guide sequence (EGS). The location of the site is determined by the Watson-Crick complementary sequence that can be formed between the RNA and the EGS. Morpholino oligonucleotides (PMOs) that have the same base sequences as any particular EGS will not direct cleavage by RNase P of the target RNA at the expected site in three mRNAs. Instead, cleavage occurs at a secondary site that does not correspond exactly to the expected Watson-Crick sequence in the PMO. This cleavage in the mRNA for a drug resistance gene, CAT mRNA, is at least second order in the concentration of the PMOs, but the mechanism is not understood yet and might be more complicated than a simple second-order reaction. EGSs and PMOs inhibit the reactions of each other effectively in a competitive fashion. A basic peptide attached to the PMO (PPMO) is more effective because of its binding properties to the mRNA as a substrate. However, a PMO is just as efficient as a PPMO on a mRNA that is mutated so that the canonical W-C site has been altered. The altered mRNA is not recognizable by effective extensive W-C pairing to an EGS or PMO. The complex of a PMO on a mutated mRNA as a substrate shows that the dimensions of the modified oligonucleotide cannot be the same as a naked piece of single-stranded RNA.

  13. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  14. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  15. Comparison of bioimpedance spectroscopy and the Watson formula for measuring body volume in patients on peritoneal dialysis

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusions: There are significant differences in the V of PD Unit patients when obtained by Watson formula or by BIS. A difference between the measurements is associated with the presence of DM, HTN, hypoalbuminaemia, obesity, malnutrition, inflammation, E/I ratio ≥1 and the absence of residual diuresis.

  16. John locke on personal identity.

    Science.gov (United States)

    Nimbalkar, Namita

    2011-01-01

    John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self) to be founded on consciousness (viz. memory), and not on the substance of either the soul or the body.

  17. Is John Locke a democrat?

    DEFF Research Database (Denmark)

    Svensson, Palle

      Over recent years there has been a tendency to present John Locke as an equalitarian democrat (Ashcraft) and being close to the political views of the levellers (Waldron). This is not a completely new interpretation (Kendall, 1941), but contrasts with the prevalent view presented in textbooks...... (Holden, Held, Ball and Dagger) and monographs on Locke (Dunn, Parry, Marshall). In this paper a new approach to the democratic character of John Locke's political theory is suggested, as his Second Treatise is analysed with Robert A. Dahl's conceptual framework on assumptions for a democratic order...

  18. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  19. Uncle Sam vs. John Bull.

    Science.gov (United States)

    Mellini, Peter

    1990-01-01

    Compares John Bull and Uncle Sam as iconographic symbols, respectively personifying male images of the British and United States national characters. Recounts their origins, evolutions, and representative values, and includes cartoons depicting the evolution. Describes female counterparts: Britannia and Columbia/Liberty. (CH)

  20. John Milton Oskison and Assimilation

    Science.gov (United States)

    Larre, Lionel

    2013-01-01

    John Milton Oskison (1874-1947) was a Cherokee writer, journalist, and activist and the author of novels and biographies as well as numerous short stories, essays, and articles about a great variety of subjects. Oskison thought of himself as "an interpreter to the world, of the modern, progressive Indian." The kind of representation Oskison gave…

  1. Thomas, Prof. Sir John Meurig

    Indian Academy of Sciences (India)

    Thomas, Prof. Sir John Meurig FRS. Date of birth: 15 December 1932. Address: Department of Materials Science and, Metallurgy, New Museums Site, 27, Babbage Road, Cambridge CB3 0FS, U.K.. Contact: Office: (+44-1223) 33 4300. Fax: (+44-1223) 33 4567. Email: jmt2@cam.ac.uk. YouTube; Twitter; Facebook; Blog ...

  2. Dr. John Marburger visits DESY

    CERN Multimedia

    2003-01-01

    Dr. John Marburger, Director of the United States Office of Science and Technology Policy, visited the research center DESY in Hamburg. The American physicist wanted to inform himself about the status of the TESLA X-ray laser and the TESLA linear collider as well as the international collaboration at DESY (1/2 page).

  3. John Dewey, Gothic and Modern

    Science.gov (United States)

    Kaminsky, James S.

    2010-01-01

    It is argued here that understanding John Dewey's thought as that of a prodigal liberal or a fellow traveller does not capture the complexity of his work. It is also important to recognise the portion of his work that is "historie morale." In the very best sense it is epic, encapsulating the hopes and dreams of a history of the American people in…

  4. The Poetry of John Dewey

    Science.gov (United States)

    Williams, Jerry L.

    2016-01-01

    This essay examines the poetry of John Dewey, 101 poems in total. Characteristic of the rhymed and metered poetry of the period, they show a very human side of Dewey. This analysis argues that many of his poems deal with existential themes--love, finitude, and God, for example. On a deeper level these poems are also show connections to Dewey's…

  5. An Interview with John Liontas

    Science.gov (United States)

    Sadeghi, Karim

    2017-01-01

    John I. Liontas, Ph.D. is an associate professor of foreign languages, English for speakers of other languages (ESOL), and technology in education and second language acquisition (TESLA), and director and faculty of the TESLA doctoral program at the University of South Florida. Dr. Liontas is a distinguished thought leader, author, and…

  6. John Knox Stuart, accoucheur extraordinaire.

    Science.gov (United States)

    Dow, D A

    1990-06-01

    John Knox Stuart of Glasgow epitomises the kind of 19th-century medical entrepreneur whose activities were intended to be curbed by the 1858 Medical Act. Druggist, obstetrician, builder, lecturer, poet and philanderer, his career was a chequered and eventful one.

  7. The Art of John Biggers

    Science.gov (United States)

    Coy, Mary

    2010-01-01

    In their 2005 exhibit of John Biggers' work, the New Orleans Museum of Art described it as being inspired by "African art and culture, the injustices of a segregated United States, the stoic women in his own family, and the heroes of everyday survival." In this article, the author describes how her students reinterpreted Biggers' work.…

  8. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  9. Laparoscopic Watson Fundoplication Is Effective and Durable in Children with Gastrooesophageal Reflux

    Directory of Open Access Journals (Sweden)

    Matthew G. Dunckley

    2014-01-01

    Full Text Available Gastroesophageal reflux (GOR affects 2–8% of children over 3 years of age and is associated with significant morbidity. The disorder is particularly critical in neurologically impaired children, who have a high risk of aspiration. Traditionally, the surgical antireflux procedure of choice has been Nissen’s operation. However, this technique has a significant incidence of mechanical complications and has a reoperation rate of approximately 7%, leading to the development of alternative approaches. Watson’s technique of partial anterior fundoplication has been shown to achieve long-lasting reflux control in adults with few mechanical complications, but there is limited data in the paediatric population. We present here short- and long-term outcomes of laparoscopic Watson fundoplication in a series of 76 children and infants, 34% of whom had a degree of neurological impairment including severe cerebral palsy and hypoxic brain injury. The overall complication rate was 27.6%, of which only 1 was classified as major. To date, we have not recorded any incidences of perforation and no revisions. In our experience, Watson’s laparoscopic partial fundoplication can be performed with minimal complications and with durable results, not least in neurologically compromised children, making it a viable alternative to the Nissen procedure in paediatric surgery.

  10. The complex gastrointestinal patient and Jean Watson's Theory of Caring in nutrition support.

    Science.gov (United States)

    Childs, Anne

    2006-01-01

    The care of the patient with gastrointestinal disease is complex and challenging. The reasons for the complexity are varied and different for each patient. Any of these variables can affect the nutritional health of the patient, an essential element of care that supports healing, recovery, and improved quality of life. A nutritional assessment, an evaluation of the patient's nutritional status, can be used to establish the patient's weight history, dietary habits, tolerances, and likes and dislikes. Intake and output values from this assessment provide information relating to the patient's ability to meet his or her nutritional requirements orally or whether alternate methods for nutrition support need be considered, such as a feeding tube or a central intravenous catheter. Parenteral nutrition is the intravenous nutrition supplementation required when the oral or enteral route for nutrition support is unavailable or impossible. In this article, a clinical case scenario for a 34-year-old man with a history of cancer and an extensive bowel resection will be presented to better explore the decision-making process for determining appropriate nutrition support. In addition, various issues the health practitioner needs to consider when managing the nutritional health of the complex gastrointestinal patient will be explored, relative to Jean Watson's Theory of Caring.

  11. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  12. Illustrating microorganisms: Sir William Watson Cheyne (1852-1932) and bacteriology.

    Science.gov (United States)

    Coutts, Jane

    2016-11-01

    Sir William Watson Cheyne is largely known to medical history as Lord Lister's 'trusted assistant'.1 He spent a lifetime defending Joseph Lister's (1827-1912) antiseptic principle in the wake of scepticism and misunderstanding. However, his main contribution to Lister's work was in the embryonic field of bacteriology in the 1870s-1890s, which brought him into contact with continental researchers, particularly Robert Koch (1843-1910). In this field, Cheyne built an independent reputation as an assessor, chronicler and promoter of continental laboratory methodology. He pioneered bacteriological training in British teaching hospitals and incorporated laboratory testing into case notes as standard procedure. This paper reconsiders Cheyne's contribution to the development of bacteriology in British medicine at the end of the 19th century. It examines his motives in promoting new laboratory techniques and the methods he used to embed them in hospital procedure. It also considers how he continued to use bacteriological arguments to keep the Listerian antiseptic principle on the medical agenda well after Lister withdrew from active involvement in the field. © The Author(s) 2015.

  13. Foreword: Sir John Pendry FRS Sir John Pendry FRS

    Science.gov (United States)

    Inglesfield, John; Echenique, Pedro

    2008-07-01

    John Pendry John Inglesfield and Pedro Echenique write: John Pendry's 65th birthday is on 4 July 2008, and this issue of the Journal of Physics: Condensed Matter is dedicated to him, with articles by friends, colleagues, and former students. By any standards, John Pendry is a great scientist, who has made—and continues to make—an enormous contribution to physics; the wide range of his interests is reflected in the scope of these articles. Not many scientists can establish a completely new and unexpected area of research, but this has been John's achievement in the last few years in the field of metamaterials, materials whose electromagnetic properties depend on their structure rather than the materials of which the structure is built. In this way, structures with effectively negative electrical permittivity and negative magnetic permeability can be constructed, demonstrating negative refraction; through metamaterials scientists now have access to properties not found in nature, and never previously explored experimentally. Never a week goes by without a potential new application of metamaterials, whether it is perfect lensing, or the cloak of invisibility. This has certainly led to tremendous visibility for John himself, with guest lectures all over the world, and radio and television appearances. John Pendry's first paper was published exactly 40 years ago, 'Analytic properties of pseudopotentials' [1], and since then he has published 310 articles at the latest count. But this first paper already reflected something of the way John works. His PhD project, with Volker Heine at the Cavendish Laboratory, was to interpret the scattering of low energy electrons from surfaces, the technique of LEED which was to become the method of choice for determining surface structure. Although the energy of the electrons in LEED is relatively low—say 50 eV—it is much higher than the energy of the conduction electrons, for which pseudopotentials had been devised, and John

  14. A sharp analysis on the asymptotic behavior of the Durbin-Watson statistic for the first-order autoregressive process

    OpenAIRE

    Bercu, Bernard; Proia, Frédéric

    2013-01-01

    International audience; The purpose of this paper is to provide a sharp analysis on the asymptotic behavior of the Durbin-Watson statistic. We focus our attention on the first-order autoregressive process where the driven noise is also given by a first-order autoregressive process. We establish the almost sure convergence and the asymptotic normality for both the least squares estimator of the unknown parameter of the autoregressive process as well as for the serial correlation estimator asso...

  15. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  16. Overview of Johne's disease immunology

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2013-10-01

    Full Text Available Johne's disease or paratuberculosis is one of the most economically important diseases of the livestock. Most of the economiclosses associated with paratuberculosis are related to decreased milk production, reduced fertility and higher rates of culling.Understanding the immunology of the disease is very important for better understanding of the interplay between the host andthe causative agent, Mycobacterium avium subsp. paratuberculosis (MAP. After uptake of MAPby macrophages residing inhost's intestinal tissue, two possible scenarios may emerge; MAP may be destroyed or may establish persistent infectionwithin the macrophages. If MAPpersists in the infected macrophage, it continuously modulates adaptive immune responsesof the animal. In this short review we describe the host-pathogen interactions in Johne's disease and highlights potentialprotective mechanisms in order for future design of more effective diagnostic method and vaccine.

  17. Titular Tilting in John Ashbery

    DEFF Research Database (Denmark)

    Balle, Søren Hattesen

    2008-01-01

    Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production. Their occurre......Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production...... discuss two ways in which this double marginalizing of Ashbery’s entitlement poems may lead to considerations of their potentially ‘untitled’ status....

  18. John von Neumann selected letters

    CERN Document Server

    2005-01-01

    John von Neuman was perhaps the most influential mathematician of the twentieth century, especially if his broad influence outside mathematics is included. Not only did he contribute to almost all branches of mathematics and created new fields, but he also changed post-World War II history with his work on the design of computers and with being a sought-after technical advisor to many figures in the U.S. military-political establishment in the 1940s and 1950s. The present volume is the first substantial collection of (previously mainly unpublished) letters written by von Neumann to colleagues, friends, government officials, and others. The letters give us a glimpse of the thinking of John von Neumann about mathematics, physics, computer science, science management, education, consulting, politics, and war. Readers of quite diverse backgrounds will find much of interest in this fascinating first-hand look at one of the towering figures of twentieth century science.

  19. Charles Darwin and John Herschel

    Science.gov (United States)

    Warner, B.

    2009-11-01

    The influence of John Herschel on the philosophical thoughts of Charles Darwin, both through the former's book, Natural Philosophy, and through their meeting in 1836 at the Cape of Good Hope, is discussed. With Herschel having himself speculated on evolution just a few months before he met Darwin, it is probable that he stimulated at least the beginnings of the latter's lifelong work on the subject.

  20. John Strong - 1941-2006

    CERN Document Server

    2006-01-01

    Our friend and colleague John Strong was cruelly taken from us by a brain tumour on 31 July, a few days before his 65th birthday. John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers. He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such h...

  1. The concept of Watson's carative factors in nursing and their (dis)harmony with patient satisfaction.

    Science.gov (United States)

    Pajnkihar, Majda; Štiglic, Gregor; Vrbnjak, Dominika

    2017-01-01

    Constant reviews of the caring behavior of nurses and patient satisfaction help to improve the quality of nursing. The aim of our research was to explore relationships between the level of nursing education, the perception of nurses and nursing assistants of Watson's carative factors, and patient satisfaction. A questionnaire survey using a convenience sample of 1,098 members of nursing teams and a purposive sample of 1,123 patients in four health care institutions in Slovenia was conducted in August 2012. A demographic questionnaire and the Caring Nurse-Patient Interactions Scale (nurse version) were delivered to the nurses. A Hospital Consumer Assessment of Health Plans Survey was delivered to discharged patients. Data were analyzed using descriptive and inferential statistics. Carative factor sensibility was related to the level of nursing education. Patients were satisfied with the care received from nurses, nursing assistants and hospitals, although we found differences between the perceptions of nurses and nursing assistants of carative factors and patient satisfaction. By comparing only the perceptions of nurses and nursing assistants of carative factors in health care institutions, differences were found for seven out of ten carative factors. We did not find major significant differences between carative factors and level of nurse education, except in one carative factor. Differences in perceptions of carative factors between health care institutions are probably the result of different institutional factors. The results can be of great benefit to nurse administrators and educators, indicating the factors that must be taken into account for enhancing patient satisfaction. Emphasis on caring theories should be placed in nursing education and their application in nursing practice.

  2. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  3. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  4. John von Neumann Birthday Centennial

    Energy Technology Data Exchange (ETDEWEB)

    Grcar, Joseph F.

    2004-11-12

    In celebration of John von Neumann's 100th birthday, a series of four lectures were presented on the evening of February 10, 2003 during the SIAM Conference on Computational Science and Engineering in San Diego. The venue was appropriate because von Neumann spent much of the later part of his life, in the 1950's, as an unofficial ambassador for computational science. He was then the only senior American scientist who had experience with the new computers (digital, electronic, and programmable) and a vision of their future importance. No doubt he would have relished the chance to attend a meeting such as this. The first speaker, William Aspray, described the ''interesting times'' during which computers were invented. His remarks were based on his history [1] of this period in von Neumann's life. We were honored to have John von Neumann's daughter, Marina von Neumann-Whitman, as our second speaker. Other accounts of von Neumann's life can be found in books by two of his colleagues [2] and [3]. Our third speaker, Peter Lax, provided both mathematical and international perspectives on John von Neumann's career. Finally, Pete Stewart spoke about von Neumann's numerical error analysis [4] in the context of later work; this talk did not lend itself to transcription, but readers may consult the historical notes in [5]. Our thanks to all the speakers for a remarkable evening. We are grateful to the DOE Applied Mathematical Sciences (AMS) program for partially supporting these lectures. Thanks are also due to SIAM and William Kolata, to our emcee, Gene Golub, to Paul Saylor for recording and editing, and to Barbara Lytle for the transcriptions. More about von Neumann's work can be learned from the recent American Mathematical Society proceedings [6].

  5. John Dewey: implications for schooling.

    Science.gov (United States)

    Silva, D

    1977-01-01

    Propositions, whether great and lasting or insignificant and passing, reside in the "guts of the living." Each age rediscovers its Plato, Dickens, Newton, or Dewey. Each age rewrites history, redefines science, develops its own theoretical perspectives. Propositions are tentative, conditional, or relative. They depend on contemporary priorities, and on a personal space and time context. At any future moment propositions may change, perspectives alter, new choices emerge. John Dewey provided for constructive innovation in schooling and the battles about his suggested criteria continue unabated. The purpose here, however, is only to examine some of Dewey's theoretical propositions and their probable implications (1).

  6. Los cuidados enfermeros en los centros geriátricos según el modelo de Watson Nursing care adopted for use in Homes for the Elderly based on Watson model

    Directory of Open Access Journals (Sweden)

    Mercedes Abades Porcel

    2007-12-01

    Full Text Available El objetivo de este estudio pretende describir y analizar los cuidados enfermeros adoptados en las instituciones geriátricas, basándose para ello en los "factores del cuidado" de la teoría de Jean Watson. El estudio se aborda desde la perspectiva teórica fenomenológica, paradigma interpretativista. Como método de generación de información se utilizará el análisis del discurso de la "Entrevista en profundidad" realizadas a las enfermeras sobre el concepto de cuidar en los centros geriátricos. Una vez finalizado el estudio podrá ser de gran utilidad para los profesionales del ámbito geriátrico, dado que permitirá conocer los problemas que surgen a la hora de adoptar el modelo de Watson en la atención geriátrica.The aim of this study is to describe and analyse the nursing care adopted for use in Homes for the Elderly, which is based on the "carative factors" as described in the Theory of Jean Watson. In order to do this, a phenomenological perspective, interpretative paradigm will be carried out. As a method for generating information, discourse analysis of in-depth interviews carried out on the nurses concerning the concept of caring in homes for the elderly will be used. Once the study has been finalised it could be extremely useful for those healthcare professionals working with the elderly, given that it will highlight problems arising when adopting Watson’s model when caring for the elderly.

  7. John Strong 1941-2006

    CERN Multimedia

    2006-01-01

    John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon Cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers.  He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such has been the lasting impact of these measurements that the paper on the pion form-factor had been cited 323 times up to the time of J...

  8. John Greenleaf's life of science.

    Science.gov (United States)

    Watenpaugh, Donald E

    2012-12-01

    This article summarizes the life and career of John E. Greenleaf, PhD. It complements an interview of Dr. Greenleaf sponsored by the American Physiological Society Living History Project found on the American Physiological Society website. Dr. Greenleaf is a "thought leader" and internationally renowned physiologist, with extensive contributions in human systems-level environmental physiology. He avoided self-aggrandizement and believed that deeds rather than words define one's legacy. Viewed another way, however, Greenleaf's words define his deeds: 48% of his 185 articles are first author works, which is an unusually high proportion for a scientist of his stature. He found that writing a thorough and thoughtful discussion section often led to novel ideas that drove future research. Beyond Greenleaf's words are the many students, postdocs, and collaborators lucky enough to have worked with him and thus learn and carry on his ways of science. His core principles included the following: avoid research "fads," embrace diversity, be the first subject in your own research, adhere to rules of fiscal responsibility, and respect administrative forces-but never back down from them when you know you are right. Greenleaf's integrity ensured he was usually right. He thrived on the axiom of many successful scientists: avoid falling in love with hypotheses, so that when unexpected findings appear, they arouse curiosity instead of fear. Dr. Greenleaf's legacy will include the John and Carol Greenleaf Award for prolific environmental and exercise-related publication in the Journal of Applied Physiology.

  9. Investigation of the H7 ordinary chondrite, Watson 012: Implications for recognition and classification of Type 7 meteorites

    Science.gov (United States)

    Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina

    2014-06-01

    Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were

  10. Porfiria aguda intermitente: valor do teste de Watson e Schwartz para o diagnóstico

    Directory of Open Access Journals (Sweden)

    José Lamartine de Assis

    1957-03-01

    (técnica de Watson e Schwartz.

  11. Comparison of bioimpedance spectroscopy and the Watson formula for measuring body volume in patients on peritoneal dialysis.

    Science.gov (United States)

    Martínez Fernández, Gonzalo; Ortega Cerrato, Agustín; de la Vara Iniesta, Lourdes; Oliver Galera, Eva; Gómez Roldán, Carmen; Pérez Martínez, Juan

    2016-01-01

    Knowing total body volume (V) is crucial in patients on peritoneal dialysis (PD). It is usually calculated by the Watson anthropometric formula, although the use of bioimpedance spectroscopy (BIS) is becoming increasingly widespread. Measuring V with both methods can at times produce quite different results. We aimed to identify differences between the 2 forms of measuring volume in a PD unit and determine which clinical factors are associated with these differences. Ours is an observational study of 74 patients on PD. We measured V using BIS (Vbis) and the Watson formula (Vw); 271 measurements were made with each method. We calculated the difference between Vbis and Vw in each patient and classified them into 2 groups: Difference between volumes ≥10% or diabetes mellitus (DM) (p=0,03), hypertension (HTN) (p=0,036), hypoalbuminemia (p<0,01), hypoprealbuminemia (p<0,01), low phase angle at 50 Hz (p<0,01), high C reactive protein (p<0,01), obesity (p=0,027), E/I ratio (ratio between extracellular and intracellular water) ≥1 (p<0.01) and residual diuresis (p=0.029). There are significant differences in the V of PD Unit patients when obtained by Watson formula or by BIS. A difference between the measurements is associated with the presence of DM, HTN, hypoalbuminaemia, obesity, malnutrition, inflammation, E/I ratio ≥1 and the absence of residual diuresis. Copyright © 2015 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  12. John Tyndall's religion: a fragment

    Science.gov (United States)

    Cantor, Geoffrey

    2015-01-01

    Both contemporaries and historians have focused on the high-profile 1874 Belfast Address in which John Tyndall was widely perceived as promulgating atheism. Although some historians have instead interpreted him as a pantheist or an agnostic, it is clear that any such labels do not accurately capture Tyndall's religious position throughout his life. By contrast, this paper seeks to chart Tyndall's religious journey from 1840 (when he was in his late teens) to the autumn of 1848 when he commenced his scientific studies at Marburg. Although he had been imbued with his father's stern conservative Irish Protestantism and opposition to Catholicism, as a youth he seems for a time to have been attracted to Methodism. Later, however, he questioned and rejected his father's religious views and was increasingly drawn to the more spiritual outlook of Ralph Waldo Emerson and Thomas Carlyle, along with a more radical attitude to politics.

  13. 75 FR 49497 - John Bonnes: Debarment Order

    Science.gov (United States)

    2010-08-13

    ... HUMAN SERVICES Food and Drug Administration John Bonnes: Debarment Order AGENCY: Food and Drug... the Federal Food, Drug, and Cosmetic Act (the act) debarring John Bonnes for a period of 5 years from... the act, under authority delegated to the Director (Staff Manual Guide 1410.35), finds that Mr. John...

  14. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Durbin-Watson partial least-squares regression applied to MIR data on adulteration with edible oils of different origins.

    Science.gov (United States)

    Jović, Ozren

    2016-12-15

    A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Medicine in John Locke's philosophy.

    Science.gov (United States)

    Sanchez-Gonzalez, M A

    1990-12-01

    John Locke's philosophy was deeply affected by medicine of his times. It was specially influenced by the medical thought and practice of Thomas Sydenham. Locke was a personal friend of Sydenham, expressed an avid interest in his work and shared his views and methods. The influence of Sydenham's medicine can be seen in the following areas of Locke's philosophy: his "plain historical method"; the emphasis on observation and sensory experience instead of seeking the essence of things; the rejection of hypotheses and principles; the refusal of research into final causes and inner mechanisms; the ideal of irrefutable evidence and skepticism on the possibilities of certainty in science. The science which for Locke held the highest paradigmatic value in his theory of knowledge was precisely medicine. To a great extent, Locke's Essay on Human Understanding can be understood as an attempt to justify, substantiate, and promote Sydenham's medical method. This method, generalized, was then proposed as an instrument for the elaboration of all natural sciences.

  17. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2017-09-18

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  18. WIT Diversity Talk with John Ellis

    CERN Multimedia

    CERN. Geneva; Ellis, Jonathan R.

    2017-01-01

    Sudeshna Datta Cockerill, CERN Ombudsperson, will interview John Ellis, a renown British theoretical physicist with a long career both at CERN and externally. John Ellis has also been awarded several prizes for his work in physics. Among many other outstanding roles and positions, he was Division Leader of the Theory Division at CERN from 1988-1994. John Ellis is currently Clerk Maxwell Professor of Theoretical Physics at King's College London.

  19. Exact Derivation of a Finite-Size Scaling Law and Corrections to Scaling in the Geometric Galton-Watson Process

    Science.gov (United States)

    Corral, Álvaro; Garcia-Millan, Rosalba; Font-Clos, Francesc

    2016-01-01

    The theory of finite-size scaling explains how the singular behavior of thermodynamic quantities in the critical point of a phase transition emerges when the size of the system becomes infinite. Usually, this theory is presented in a phenomenological way. Here, we exactly demonstrate the existence of a finite-size scaling law for the Galton-Watson branching processes when the number of offsprings of each individual follows either a geometric distribution or a generalized geometric distribution. We also derive the corrections to scaling and the limits of validity of the finite-size scaling law away the critical point. A mapping between branching processes and random walks allows us to establish that these results also hold for the latter case, for which the order parameter turns out to be the probability of hitting a distant boundary. PMID:27584596

  20. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  1. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  2. El derecho de propiedad en John Locke

    OpenAIRE

    Jorge Luis Toyama Miyagusuku

    1998-01-01

    El tema que abordaremos en esta monografía se contrae en determinar los principales aspectos de la teoría sobre el derecho de propiedad del inglés John Locke (Wrington, 1632-1704), en su obra«Segundo Ensayo sobre el GobiernoCivil».John

  3. John Smithi kaks palet / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-

    2003-01-01

    Näitus "John Smith. Marko ja Kaido" Tallinna Kunstihoones. Kaido Ole ja Marko Mäetamm esindavad rühmitusena "John Smith" Eestit 2003. a. Veneetsia biennaalil. Ilmunud ka kogumikus "Päevast päeva", lk. 90-96

  4. John of Salisbury on Aristotelian Science

    DEFF Research Database (Denmark)

    Bloch, David

    The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science.......The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science....

  5. Kajian Analisis Terhadap Konsep Pemikiran John Dewey

    OpenAIRE

    Maiaweng, Peniel C.D

    2009-01-01

    John Dewey dikenal oleh karena konsep pemikirannya tentang pragmatisme, relativisme, dan active learner. Untuk itu, dalam makalah ini akan dibahas tentang riwayat hidup John Dewey sebagai dasar pemunculan konsep pemikirannya (yang tertuang dalam konsep filsafat, agama, dan pendidikan), sumbangsihnya dalam dunia pendidikan, dan kritik terhadap konsep pemikirannya berdasarkan perspektif Krisren.

  6. John Kotter on Leadership, Management and Change.

    Science.gov (United States)

    Bencivenga, Jim

    2002-01-01

    Excerpts from interview with John Kotter, Konosuke Matsushita Professor of Leadership at the Harvard Business School, about his thoughts on the role of the superintendent as leader and manager. Describes his recent book "John P. Kotter on What Leaders Really Do," 1999. Lists eight-step change process from his book "Leading Change," 1996. (PKP)

  7. JBS Haldane: the John Innes years

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 5. J. B. S. Haldane: the John Innes years. SARAH WILMOT. HALDANE AT 125 Volume 96 Issue 5 November ... Keywords. J. B. S. Haldane; John Innes Horticultural Institution; history of genetics; William Bateson; Primula sinensis; plant genetics; biochemical genetics.

  8. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  9. La mirada de Watson, Parse y Benner para el análisis complejo y la buena práctica The glance of Watson, Pair and Benner for the complex analysis and the good practice

    Directory of Open Access Journals (Sweden)

    Sagrario Acebedo-Urdiales

    2007-06-01

    Full Text Available La necesidad de encontrar el significado y orden del quehacer enfermero por encima de especialidades, culturas, tareas, funciones o competencias, hace necesario llevar a la práctica teorías y conceptos de análisis que se puedan insertar en cada situación, como fundamento que guía la buena práctica enfermera. Los modelos y filosofías enfermeras nos dan elementos de reflexión, nos siembran la duda respecto a la práctica, nos dan elementos de investigación y cuando los integramos o nos reconocemos en ellos, además de flexibilizar la interpretación y el cuidado persona-situación, colocan a la enfermería dentro de su marco más maduro consistente con el modelo de Nithingale actualizado. Este trabajo tiene como objetivo plantear lo que para nosotras son los elementos básicos de las filosofías y teorías de Watson, Parse y Benner, que nos permiten el análisis complejo de las situaciones de cuidados y la comprensión del juicio clínico, que emerge de la práctica como acontecimiento real. El paradigma de la complejidad nos lleva a prácticas responsables, a estar no en objetivos, sino en procesos, no en partes o en todos sino en individuos que son a la vez sujeto-objeto.The need to find the meaning of nursing activity independently of specialties, cultures, tasks, functions or competences, leads us to the usage of theories and concepts of analysis than can be applied in each situation, as a guide for the right nursing activity. Nursing philosophies and models provide us elements of reflection, creating doubts in relation to the practice, and once they are assumed, we recognize ourselves on them, helping us to the interpretation of the person-situation caring, carrying nursing to its matures side, validating Nigthingale's model. This work has the aim of implanting the basic elements of Watson, Parse and Benner's theories in order to analyze situations of caring and understand the clinical judgment emerging from the practice. The

  10. John Bell and the Identical Twins

    CERN Multimedia

    1984-01-01

    A biographical profile of John S.Bell is presented based on extensive interviews the author had with Bell. Bell’s vierws on the quantum theory are presented along with a simple explanation of his idenity.

  11. John Dewey--Philosopher and Educational Reformer

    Science.gov (United States)

    Talebi, Kandan

    2015-01-01

    John Dewey was an American philosopher and educator, founder of the philosophical movement known as pragmatism, a pioneer in functional psychology, and a leader of the progressive movement in education in the United States.

  12. 2008 St. Johns County, FL Countywide Lidar

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Airborne terrestrial LiDAR was collected for St. Johns County, FL. System Parameters/Flight Plan. The LiDAR system acquisition parameters were developed based on a...

  13. Johns Hopkins Particulate Matter Research Center

    Data.gov (United States)

    Federal Laboratory Consortium — The Johns Hopkins Particulate Matter Research Center will map health risks of PM across the US based on analyses of national databases on air pollution, mortality,...

  14. 2004 St. Johns County, Florida Lidar

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset is the bare earth lidar data for St. Johns County, Florida, acquired in early January and February of 2004. This data was collected to develop...

  15. John af Salisbury. Forsker, formidler og inspirator

    DEFF Research Database (Denmark)

    Bloch, David

    2011-01-01

    Artikel om John of Salisbury (12. årh.) og hans syn på forskning og formidling. Der fokuseres først og fremmest på hans forhold til Aristoteles.......Artikel om John of Salisbury (12. årh.) og hans syn på forskning og formidling. Der fokuseres først og fremmest på hans forhold til Aristoteles....

  16. Would John Stuart Mill have regulated pornography?

    OpenAIRE

    McGlynn, C.; Ward, I.

    2014-01-01

    John Stuart Mill dominates contemporary pornography debates where he is routinely invoked as an authoritative defence against regulation. This article, by contrast, argues that a broader understanding of Mill's ethical liberalism, his utilitarianism, and his feminism casts doubt over such an assumption. New insights into Mill's approach to sex, sexual activity, and the regulation of prostitution reveal an altogether more nuanced and activist approach. We conclude that John Stuart Mill would a...

  17. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  18. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  19. Obituary: John W. Firor (1927-2007)

    Science.gov (United States)

    Gilman, Peter A.

    2009-12-01

    John W. Firor, a former Director of the High Altitude Observatory and the National Center for Atmospheric Research, and a founder of the Solar Physics Division of the American Astronomical Society, died of Alzheimer's disease in Pullman, Washington on November 5, 2007, he was 80. He was born in Athens Georgia on October 18, 1927, where his father was a professor of agricultural economics. John had an unusually diverse scientific career. His interest in physics and astrophysics began while serving in the army, during which time he was assigned to the Los Alamos National Laboratory, where he guarded highly radioactive materials (many have heard him describe how informal the protections were compared to later times). After his service he returned to college and graduated in physics from Georgia Tech in 1949. He received his Ph.D. from the University of Chicago in 1954, writing his thesis on cosmic rays under John Simpson. John Firor would later remark that: "If you needed cosmic rays to actually do anything, you are sunk." That thought, partly in jest, may help explain his motivation for moving to so many new scientific and management pursuits. John moved from cosmic ray physics to radio astronomy (particularly of the Sun) when he began work at the Carnegie Institution of Washington's Department of Terrestrial Magnetism, where he remained until 1961. During this time, he met Walter Orr Roberts, then the Director of the High Altitude Observatory (HAO) in Boulder, Colorado. HAO was then affiliated with the University of Colorado. In 1959, a movement began to upgrade the atmospheric sciences in the United States by establishing a National Center, where the largest, most important atmospheric research problems could be addressed. Roberts became the first Director of NCAR, as well as the first president of the University Corporation for Atmospheric Research (UCAR), the consortium of universities that was commissioned to manage and staff the new Center. HAO became a

  20. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  1. John Twysden and John Palmer: 17th-century Northamptonshire astronomers

    Science.gov (United States)

    Frost, M. A.

    2008-01-01

    John Twysden (1607-1688) and John Palmer (1612-1679) were two astronomers in the circle of Samuel Foster (circa 1600-1652), the subject of a recent paper in this journal. John Twysden qualified in law and medicine and led a peripatetic life around England and Europe. John Palmer was Rector of Ecton, Northamptonshire and later Archdeacon of Northampton. The two astronomers catalogued observations made from Northamptonshire from the 1640s to the 1670s. In their later years Twysden and Palmer published works on a variety of topics, often astronomical. Palmer engaged in correspondence with Henry Oldenburg, the first secretary of the Royal Society, on topics in astronomy and mathematics.

  2. Reformasie: John Knox, Die Skotse Calvinis*

    Directory of Open Access Journals (Sweden)

    V. E. d'Assonville

    1958-03-01

    Full Text Available As ons aan John Knox, die Skotse Hervormer, dink, dan sien ons voor ons oprys die beeld van die Ou-Testamentiese profeet wat sy stem in die woestyn verhef en gekleed gaan met ’n harige mantel en ’n leergord om sy heupe. John Knox het die byl aan die wortel van elke afgodsboom gelê. Soos ’n Luther het hy in die taal van die volk gespreek en daar was by hom geen vrees om selfs in paleise die oordeel van God oor konings aan te kondig nie.

  3. Obituary: John Louis Perdrix, 1926-2005

    Science.gov (United States)

    Orchiston, D. Wayne

    2006-12-01

    John Perdrix, astronomical historian and co-founder of the Journal of Astronomical History and Heritage, died on 27 June 2005. John Louis Perdrix was born in Adelaide, Australia, on 30 June 1926. After studying chemistry at Melbourne Technical College and working in industry, he joined the Commonwealth Scientific and Industrial Research Organisation's Division of Minerals and Geochemistry. In 1974 the Division relocated to the Western Australian capital, Perth, and John spent the rest of his working life there involved in geochemical research. From his teenage years John had a passion for astronomy, which he fine-tuned through the Astronomical Society of Victoria and the Victorian Branch of the British Astronomical Association. He was very active in both groups, serving as President of the former and Secretary/Treasurer of the latter. He was also an FRAS, and a member of the AAS, the BAA parent body, and the IAU (Commission 41)?no mean feat for an Australian amateur astronomer. Throughout his life, he was a strong advocate of close amateur-professional relations. John's main research interest was history of astronomy, and over the years he wrote a succession of research papers, mainly about aspects of Australian astronomy. His well-researched and neatly-illustrated papers on the Melbourne Observatory and the Great Melbourne Telescope are classics, and when the Observatory's future was in the balance they played a key role in the State Government's decision to convert this unique facility into a museum precinct. To support his research activities, John built up an amazing library that developed its own distinctive personality and quickly took over his house and garage before invading commercial storage facilities! Apart from writing papers, John had an even greater passion for editing and publishing. From 1985 to 1997 he produced the Australian Journal of Astronomy, and in 1998 this was replaced by the Journal of Astronomical History and Heritage (JAH2). Both

  4. Conceptions of Childhood in the Educational Philosophies of John Locke and John Dewey

    Science.gov (United States)

    Bynum, Gregory Lewis

    2015-01-01

    This article compares progressive conceptions of childhood in the educational philosophies of John Locke and John Dewey. Although the lives of the two philosophers were separated by an ocean and two centuries of history, they had in common the following things: (1) a relatively high level of experience working with, and observing, children that is…

  5. John Furlong and the "University Project"

    Science.gov (United States)

    Watson, David

    2014-01-01

    Like many senior teacher-educators and educational researchers, John Furlong has faced in several directions throughout his career, sometimes simultaneously. He has clearly not lost his enthusiasm for what happens in the classroom: he strongly appreciates those magical moments which can happen at any time, and which keep teachers going. He loves…

  6. John Hull and the Money Culture

    Science.gov (United States)

    Attfield, David

    2008-01-01

    John Hull's recent educational writings have included several on what he calls the "money culture". This is analysed and criticised in this article. Hull offers a Marxist and a neo-Marxist account of the role of money in western societies utilising the labour theory of value, false consciousness and the materialist interpretation of history. It is…

  7. Astronaut John Glenn Enters Friendship 7

    Science.gov (United States)

    1962-01-01

    Astronaut John Glenn enters the Mercury spacecraft, Friendship 7, prior to the launch of MA-6 on February 20, 1961 and became the first American who orbited the Earth. The MA-6 mission was the first manned orbital flight boosted by the Mercury-Atlas vehicle, a modified Atlas ICBM (Intercontinental Ballistic Missile), lasted for five hours, and orbited the Earth three times.

  8. John Forbes (ca. 1568-1634)

    NARCIS (Netherlands)

    Jong, Christiaan George Frederik de

    1987-01-01

    This book deals sith the life and work of the Scotsman John Forbes (c.1568-1634), who studied at the University of Saint Andrews and then served as a minister of the Church of Scotland (1593-1605). During his ministy he witnessed and later became a victim of the fierce battle between the Calvinistic

  9. Bathymetry (2011) for Coral Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Coral Bay, St. John in the U.S. Virgin Islands (USVI). The...

  10. John Smith - eesti kunstnik / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2006-01-01

    Marko Mäetamme ja Kaido Ole kollektiivsest loomingust, mida esitatakse John Smithi autorinime all, mõnda ka salapärase J. Smithi nn. biograafiast. Illustratsiooniks J. Smith'i "Jumalate maailm I (fragment). Õli, lõuend, 2002. Erakogu

  11. John Maynard Smith (1920-2004)

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 11. John Maynard Smith (1920-2004). Featured Scientist Volume 10 Issue 11 November 2005 pp 110-110. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/010/11/0110-0110. Resonance – Journal ...

  12. John Dewey in the 21st Century

    Science.gov (United States)

    Williams, Morgan K.

    2017-01-01

    John Dewey was a pragmatist, progressivist, educator, philosopher, and social reformer (Gutek, 2014). Dewey's various roles greatly impacted education, and he was perhaps one of the most influential educational philosophers known to date (Theobald, 2009). Dewey's influence on education was evident in his theory about social learning; he believed…

  13. John Deweys kritik af liberal education

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    2017-01-01

    The paper deals with John Dewey's aversion against liberal education and his concern about a 'dual track' educational system separating liberal education and vocational education. It investigates the reason why Dewey maintains that the philosophical 'dualisms' culminate in the question on vocation....

  14. John Dewey on Philosophy and Childhood

    Science.gov (United States)

    Gregory, Maughn; Granger, David

    2012-01-01

    John Dewey was not a philosopher of education in the now-traditional sense of a doctor of philosophy who examines educational ends, means, and controversies through the disciplinary lenses of epistemology, ethics, and political theory, or of agenda-driven schools such as existentialism, feminism, and critical theory. Rather, Dewey was both an…

  15. John Dewey and Adult Learning in Museums

    Science.gov (United States)

    Monk, David F.

    2013-01-01

    The objective of this article is to investigate learning in museums through the lens of John Dewey's philosophy of education and experiential learning. The influence of Dewey's philosophy of education is widespread and resounding. In this article, I examine the experiential qualities of Dewey's philosophy and compare it with the objectives of the…

  16. Preparing for Citizenship: Bring Back John Dewey

    Science.gov (United States)

    Pring, Richard

    2016-01-01

    The paper traces the development of citizenship in the curriculum in England since the 1960s, emerging particularly from the Crick report. It argues for lessons to be learnt from John Dewey's "Democracy and education", the centenary of which is being celebrated this year.

  17. Jean Piaget's Debt to John Dewey

    Science.gov (United States)

    Tanner, Daniel

    2016-01-01

    Jean Piaget became a veritable institution unto himself in education and psychology, largely as the result of his developmental-stage theory advanced over the second quarter of the twentieth century. Not until Piaget was 73 did he make mention of John Dewey's work at Dewey's laboratory school, founded in 1894 at the University of Chicago. But here…

  18. We, John Dewey's Audience of Today

    Science.gov (United States)

    da Cunha, Marcus Vinicius

    2016-01-01

    This article suggests that John Dewey's "Democracy and Education" does not describe education in an existing society, but it conveys a utopia, in the sense coined by Mannheim: utopian thought aims at instigating actions towards the transformation of reality, intending to attain a better world in the future. Today's readers of Dewey (his…

  19. John Wilkes Booth and the Lincoln Conspiracy.

    Science.gov (United States)

    Nufrio, Ronald M.

    The 1865 conspiracy to assassinate Abraham Lincoln also included plans to assassinate other government officials on that same April evening. The actor, John Wilkes Booth, succeeded in killing Lincoln, but his fellow conspirators bungled their attempts to kill William Seward, Andrew Johnson, Ulysses S. Grant, and possibly Edwin Stanton. In…

  20. Bathymetry (2011) for Fish Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Fish Bay, St. John in the U.S. Virgin Islands (USVI). The...

  1. John Rohr honored with emeritus status

    OpenAIRE

    Chadwick, Heather Riley

    2008-01-01

    John A. Rohr, of Blacksburg, professor of public administration and policy in the College of Architecture and Urban Studies at Virginia Tech, was conferred the "professor emeritus" title by the Virginia Tech Board of Visitors during the board's quarterly meeting on June 20.

  2. John Newbery, "Friend of All Mankind."

    Science.gov (United States)

    Hearn, Michael Patrick

    1997-01-01

    Recounts the life of John Newbery, the 18th-century London bookseller who did more than anyone to establish the children's book trade, and for whom the prestigious Newbery Award is named. States that Newbery published many books, including a line of books called the Juvenile Library, entertaining but also didactic, in the manner of the times. (PA)

  3. The Life and Work of John Snow

    Science.gov (United States)

    Melville, Wayne; Fazio, Xavier

    2007-01-01

    Due to his work to determine how cholera was spread in the 18th century, John Snow (1813-1858) has been hailed as the father of modern epidemiology. This article presents an inquiry model based on his life and work, which teachers can use to develop a series of biology lessons involving the history and nature of science. The lessons presented use…

  4. Speaking Personally--With John "Pathfinder" Lester

    Science.gov (United States)

    Beaubois, Terry

    2013-01-01

    John Lester is currently the chief learning officer at ReactionGrid, a software company developing 3-D simulations and multiuser virtual world platforms. Lester's background includes working with Linden Lab on Second Life's education activities and neuroscience research. His primary focus is on collaborative learning and instructional…

  5. The Bildungsroman in Cameroon Anglophone Literature: John ...

    African Journals Online (AJOL)

    This paper investigates the bildungsroman genre in postcolonial Cameroon Anglophone fiction through a textual analysis of John Nkemngong Nkengasong's Across the Mongolo and Margaret Afuh's Born before Her Time. It seeks to show that these two writers have borrowed a foreign genre and successfully manipulated ...

  6. John Locke‟s Epistemology and Teachings

    African Journals Online (AJOL)

    First Lady

    2013-01-28

    Jan 28, 2013 ... John Locke belongs to the epistemological school of thought called. Empiricism. Empiricism is a reaction ..... training at Westminster were not favourable to public school education. He sees very clearly the ... Locke is also opposed to multiplication of rules and again would rather trust the formation of habits' ...

  7. The Academic Freedom of John Dewey

    Science.gov (United States)

    Fischer, Louis

    1977-01-01

    Academic freedom is a perennial issue in the public schools of America. As with most significant social issues, disagreements regarding the nature and extent of freedom appropriate in our society is reflected in our schools in various ways. Examines some of those conflicts with comments on John Dewey's convictions on academic freedom. (Author/RK)

  8. Obituary: John Leroy Climenhaga, 1916-2008

    Science.gov (United States)

    Scarfe, Colin

    2009-01-01

    John Leroy Climenhaga was born on 7 November 1916 on a farm some 10 km from Delisle, a small town on the Canadian prairies, located about 50 km south-west of Saskatoon, Saskatchewan, and died at his home in Victoria, British Columbia, on 27 May 2008. His parents, Reuben and Elizabeth (nee Bert) Climenhaga, were farming folk, and he carried their honest and open attitude to the world throughout his life. John was the seventh born, and last to die, of their ten children. His father also served as an ordained minister of the Brethren in Christ. In early adulthood, John worked on his father's farm, but then attended the University of Saskatchewan, obtaining a B.A. with Honors in Mathematics and Physics and an M.A. in Physics, in 1945 and 1949 respectively. Between these events he worked as a Physics Instructor at Regina College from 1946 to 1948. In 1949 Climenhaga joined the faculty of Victoria College, as one of only two physicists in a small institution that was then part of the University of British Columbia. He remained in Victoria for the rest of his career, playing a major role in the College's growth into a full-fledged university, complete with thriving graduate programs in physics and astronomy as well as in many other fields. He served as Head of the Physics Department during the 1960s, a period which saw the College become the University of Victoria, with a full undergraduate program in Physics, and campaigned successfully for the establishment of a program in Astronomy, which began in 1965. From 1969 until 1972 he held the position of Dean of Arts and Science, and championed the university's participation in the Tri-University Meson Facility, whose high-current medium-energy beam was ideal for the production and study of mesons and their physics. That period was a turbulent one in the university's history, but John's integrity and his balanced and fair-minded approach to conflicts were of immeasurable importance in steering the young institution through it

  9. John Maynard Smith (1920-2004)

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 11. John Maynard Smith (1920-2004) - “One of the last Grand Evolutionary Theorists of the 20th Century”. Vidyanand Nanjundiah. General Article Volume 10 Issue 11 November 2005 pp 70-78 ...

  10. Capitalism in Six Westerns by John Ford

    Science.gov (United States)

    Braun, Carlos Rodriguez

    2011-01-01

    The economic and institutional analysis of capitalism can be illustrated through John Ford's Westerns. This article focuses on six classics by Ford that show the move toward modern order, the creation of a new society, and the rule of law. Economic features are pervading, from property rights and contracts to markets, money, and trade. Ford has…

  11. John W. Thoburn: International Humanitarian Award

    Science.gov (United States)

    American Psychologist, 2012

    2012-01-01

    Presents a short biography of the winner of the American Psychological Association's International Humanitarian Award. The 2012 winner, John W. Thoburn, is an extraordinary psychologist who devotes himself consistently to service to underserved populations, especially in the aftermath of natural or human-induced disasters. He exemplifies a genuine…

  12. John Dinsdale on Intellectual Self-knowledge

    DEFF Research Database (Denmark)

    Christensen, Michael Stenskjær

    2017-01-01

    This is an edition of the prologue and two questions concerning intellectual self-knowledge from John Dinsdale's Quaestiones in De anima. The edition is supplied with a translation, and in an appendix the prologue is compared with Giles of Rome's prologue to his Expositio De anima, on which...

  13. A simulation of Johne's disease control.

    Science.gov (United States)

    Groenendaal, Huybert; Nielen, Mirjam; Jalvingh, Alien W; Horst, Suzan H; Galligan, David T; Hesselink, Jan Willem

    2002-07-25

    A dynamic and stochastic simulation model (the "JohneSSim model") was developed to evaluate the economic and epidemiological effects of different strategies for control of paratuberculosis in dairy herds. Animals occupy one of the six defined infection states; the spread of Johne's disease is modeled with five infection routes. Many different dairy farm situations can be simulated. Control strategies that can be simulated are: (1) test-and-cull; (2) calf hygiene management; (3) vaccination and (4) grouping of animals. Losses are caused by: (1) reduced milk production; (2) diagnosis and treatment costs; (3) lower slaughter value of cows and (4) sub-optimal culling. The benefits were calculated as reduction in the losses caused by Johne's disease; the costs of each strategy were calculated on the basis of actual costs of each item; and net present value (NPV) was calculated as benefits minus costs. Herd and prevalence data from The Netherlands and Pennsylvania, USA were used. In both situations, a low true mean prevalence within 20 years could be reached only when all calf management tools were applied. The Dutch control program (PPN) was on average economically attractive (with or without labor costs, the average NPV was Euro 1183 and 12,397, respectively). In Pennsylvania, contract heifer rearing and improved calf hygiene reduced the prevalence effectively and had large economic benefits (US$ 43,917 for 20-year period) if the calves were sent to the heifer facility while very young. Validation with data from 21 infected Dutch dairy farms (as well as face-validation: comparison of the results of the JohneSSim model with experiences of Johne's experts) supported the basic assumptions in the model.

  14. Obituary: John J. Hillman, 1938-2006

    Science.gov (United States)

    Chanover, Nancy

    2007-12-01

    John J. Hillman, a dedicated NASA civil servant, spectroscopist, astrophysicist, planetary scientist, and mentor, died on February 12, 2006 of ocular melanoma at his home in Columbia, Maryland. His professional and personal interests were wide-reaching and varied, and he devoted his career to the advancement of our understanding of the beauty and wonder in the world around us. His love of nature, art, and science made him a true Renaissance man. John was born in Fort Jay, New York, on November 22, 1938, and was raised in Washington, D.C. He received his B.S., M.S., and Ph.D. degrees in Physics from American University in 1967, 1970, and 1975, respectively. He began working at NASA's Goddard Space Flight Center, then in its infancy, in 1969, juggling a full-time position as a Research Physicist, the completion of his M.S. and Ph.D. degrees, and a young family. His background in molecular spectroscopy enabled him to apply his skills to numerous disciplines within NASA: infrared and radio astronomy; electronic, vibrational, and rotational structure of interstellar molecules; solar and stellar atmospheres; and planetary atmospheres. He published more than 70 journal papers in these disciplines. He was a frequent contributor to the Ohio State University International Symposium on Molecular Spectroscopy, and possessed a rare ability to bridge the gap between laboratory and remote sensing spectroscopy, bringing scientists from different disciplines together to understand our Universe. The last fifteen years of John's career were devoted to the development of acousto-optic tunable filter (AOTF) cameras. He championed this technology as a low-cost, low-power alternative to traditional imaging cameras for in situ or remotely sensed planetary exploration. It was within this context that I got to know John, and eventually worked closely with him on the demonstration and application of this technology for planetary science using ground-based telescopes in New Mexico, California

  15. A New Reading of Shakespeare's King John.

    Science.gov (United States)

    Usher, Peter D.

    1995-12-01

    Shakespeare wrote King John c.1594, six years after the defeat of the Spanish Armada, and ~ 50 years after publication of the Copernican heliocentric hypothesis. It is said to be the most unhistorical of the History Plays, ``anomalous'', ``puzzling'', and ``odd'', and as such it has engendered far more than the customary range of interpretive opinion. I suggest that the play alerts Elizabethans not just to military and political threats, but to a changing cosmic world view, all especially threatening as they arise in Catholic countries. (a) Personification characterizes the play. John personifies the old order, while Arthur and the Dauphin's armies personify the new. I suggest that Shakespeare decenters King John just as Copernicus decentered the world. (b) Hubert menaces Arthur's eyes for a whole scene (4.1), but the need for such cruelty is not explained and is especially odd as Arthur is already under sentence of death (3.3.65-66). This hitherto unexplained anomaly suggests that the old order fears what the new might see. (c) Eleanor's confession is made only to Heaven and to her son the King (1.1.42-43), yet by echoing and word play the Messenger from France later reveals to John that he is privy to it (4.2.119-124). This circumstance has not been questioned heretofore. I suggest that the Messenger is like the wily Hermes (Mercury), chief communicator of the gods and patron of the sciences; by revealing that he moves in the highest circles, he tells John that he speaks with an authority that transcends even that of a king. The message from on high presages more than political change; it warns of a new cosmic and religious world order (d) Most agree that John is a weak king, so Shakespeare must have suspected flaws in the old ways. He would have known that Tycho Brahe's new star of 1572, the comet of 1577, and the 1576 model of his compatriot Thomas Digges, were shattering old ideas. (e) The tensions of the play are not resolved because in 1594 the new order was

  16. John Aitken (d. 1790)--grinder or scholar?

    Science.gov (United States)

    Kaufman, Matthew H

    2003-11-01

    John Aitken attended the University of Edinburgh between 1763 and 1769 but did not graduate MD. He gained the membership (i.e. fellowship) of the Royal College of Surgeons of Edinburgh in 1770, and was for two sessions Senior President of the Royal Medical Society. Between 1771 and 1790 he published numerous books and pamphlets on surgery, medicine, midwifery, anatomy and physiology. As a surgeon at the Royal Infirmary, from 1779, he lectured on most subjects in the medical curriculum. John Struthers was particularly scathing of Aitken's scholarship, and this article attempts to restore Aitken's reputation as a scholar and probably one of the first of the extra-academical lecturers, who taught both anatomy and surgery in Edinburgh from 1779 until his death in 1790.

  17. In Memoriam: Dr. Frank John Fenner

    Centers for Disease Control (CDC) Podcasts

    2011-04-22

    This podcast reflects on one of the greatest pioneers in virology, Dr. Frank John Fenner. Dr. Frederick Murphy, a member of EID's editorial board and the Institute of Medicine, and professor of Pathology at the University of Texas Medical Branch in Galveston, shares professional and personal stories of Dr. Frank Fenner.  Created: 4/22/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/26/2011.

  18. John Stuart Mill’s Utilitarianism

    OpenAIRE

    Aydın, Metin

    2013-01-01

    Utilitarianism, systematised by Jeremy Bentham (1748–1832) in 18th century, is a theory having strong effects in many different areas from economy and ethics to politic and law especially in England and geopraphies in which anglo-saxon culture reigns. John Stuart Mill (1806 – 1873) reinterpreted Utilitrianism which was inherited from Bentham, in the context of critics of utilitarianism and his own thoughts. In this essay, Mill’s utilitarianism will be examined. In this context, I will discuss...

  19. John Dewey's Visits to Hawai'i

    Science.gov (United States)

    McEwan, Hunter

    2015-01-01

    John Dewey visited Hawai'i on three separate occasions. Of all three trips, by far the most important, as far as Dewey's influence on education in Hawai'i is concerned, was in 1899 when he came with his wife, Alice Chipman Dewey, to help launch the University Extension program in Honolulu. The Deweys' second trip was a very brief one--twenty years…

  20. The mystery of John Wilkes Booth's dentist.

    Science.gov (United States)

    Hyson, J M; Kauffman, M W

    1999-11-01

    For many years there has been much speculation over the identity of the dentist of President Abraham Lincoln's assassin, John Wilkes Booth. Some have considered Dr. William Merrill (1833-1918), a rather prominent Washington, D.C. dentist, as the man who restored two of Booth's teeth with gold a few days before the assassination. Who was the mysterious Dr. Merrill and what evidence do we have that he ever treated Booth?

  1. 65 Year Birthday Celebration's Prof. John Ellis.

    CERN Multimedia

    Benoit Jeannet

    2011-01-01

    On 13 September, physicists from around the world joined John Ellis at a colloquium to celebrate his 65th birthday, and as he ended his long career as a distinguished CERN staff member and joins King’s College London. Here he is in the audience with fellow theorists, Nobel laureate Gerard ’t Hooft and Chris Llewellyn Smith, former director-general of CERN.

  2. Reformasie: John Knox, Die Skotse Calvinis* 2

    Directory of Open Access Journals (Sweden)

    V. E. d'Assonville

    1959-03-01

    Full Text Available Na negentien maande van onophoudelike stryd en nood, word John Knox gedurende Februarie 1549 van die wrede Franse galeiskip losgelaat. Hierop begeef die liggaamlik gebroke hervormer hom na Engeland, omdat Skotland nog te onveilig was, Die Rooms-Katolieke party het sake aldaar so onder die kiel gehad, dat ’n deurbraak van die Hervorming menslik gesproke op hierdie tydstip onmoontlikwas.

  3. Perugino's 'Virgin and Child with Saint John'

    National Research Council Canada - National Science Library

    Bamford, David

    1977-01-01

    .... Details of the cleaning tests are given, which show, amongst other things, that the drapery of Saint John was not original and that part of the parapet was false. Following a section on the restoration and framing, the author suggests possible explanations for the alterations that were found. There are illustrations of the panel before, during, and following cleaning and restoration, as well as an x-ray mosaic.

  4. John J. Bergan, 1927-2014

    Directory of Open Access Journals (Sweden)

    Paolo Zamboni

    2014-07-01

    Full Text Available John Bergan was born on August 4, 1927 and graduated in Medicine at the University of Indiana in 1954. He spent the residency in surgery at the Chicago Wesley Memorial Hospital and in 1960 was certified in the American Board of Surgery. The body of his academic career took place at the North Western University in Chicago, where he devoted himself to vascular surgery and also to its applications in transplantation surgery. Scrolling through the records of the North-Western Registry, it turns out that John performed his first kidney transplant as the first operator in 1964, and was Director of the program till 1976. However, for the European phlebologist John was the ambassador of Phlébologie in the United States of America. Two were his key meetings in the field. The first was with Geza de Takats, a forerunner of the modern Phlebology, who operated for long time in Chicago. John was in strong contact with this Mentor, to the point that he wrote the obituary on Surgery in 1986, when he died. The second was the stellar conjunction with James S. T. Yao at the NorthWestern University. Together they released the first complete text-book of Phlebology in the United States, Venous Problems, at the end of the 70’s. In the 80’s, he was one of the Founding Fathers of the American Venus forum, at the famous first meeting at the hotel of Coronado, and, subsequently, President. But he also served as President the American College of Phlebology. This because was an eclectic and multi-core phlebologist, equally interested and curious about the new features in outpatient practice, as well as in cutting-edge research applied to the venous system. The last years of his academic career were actively spent in a climate much more favourable compared to Illinois, at the University of California San Diego, in La Jolla, where he continued to work and publish on veins. Few years ago Claude Franceschi and me taught venous haemodynamics, at a course organised in

  5. Book in three volumes of dr. John Puricha: Theology and pedagogy of St. John Chrysostom

    Directory of Open Access Journals (Sweden)

    Parlić-Božović Jasna Lj.

    2011-01-01

    Full Text Available Before the is latest work of Bishop Dr John Puric, by its importance, analytically decorated works, an impressive and voluminous number of facts happy including pedagogical Serbian public. Specifically, our pedagogical public is missing in this way displayed the Orthodox point of view of observation pedagogical crown and top categories. Episkom John was the there / volume work attempted to provide the interested reader the personality profile of any precise data from the conception of St. John Crisostom by looking at the same time as its pedagogy, and theology. Moreover these two concepts and bringing them to their assence, John episcope them actually connects into one inseparable unity. Therefore, this work has a multiple value and importance esportance especially for educators, who have not tried or had the oppotunality to see and understand the pedagogy of Orthodox theology in general, decorated with the ideas of Saint John Chrysostom special. Mindfullpeace as heir and successor creative Cappadocia 'novonikejske' trijadologije, St. John Chrystom recognizes the statut of Divine pedagogy educational philanthropy and philanthropic saving of pedagogy in each of the three Divine Persons. God the Father is this part, written by Bishop John, and from the perspective of John Chrysostom, is uncreated and unborn educationak philanthropy source of grace of the Holy Trinity. God the Son, and of the Father, uncreated etrinilly born, only begotten Son of God, newborn Logos, Jesus Christ the God/ man, BewAdam is alive and saving, hypostatic Ikonomija God, great mystery of the faith- God is reported in the body, the Divine Krishna- resurrect pedagogy, in which the comic-eschatologiocal Body, Church of Heaven and Earth, The Secret New Substances contain - the salvation of all creation, all creatures animate and inanimate. The salvation of man and the world, in the Divine dispensation and the pedagogy of salvation invation involve all there persons of the Holy

  6. Inaugural Lecture in the John Adams Memorial Lecture Series John Adams and his times

    CERN Document Server

    Amaldi, Edoardo; CERN. Geneva

    1985-01-01

    The John Adams' Memorial Lecture will be an annual event which in futur years will provide young and promising accelerator engineers and physicists with an opportunity to expose their work in the accelerator field. The inaugural lecture will put the many very important contribution of John Adams into perspective, not only with respect to CERN, but also with respect to the development of high energy physics in the world.

  7. Obituary: John Daniel Kraus, 1910-2004

    Science.gov (United States)

    Kraus, John D., Jr.; Marhefka, Ronald J.

    2005-12-01

    John Daniel Kraus, 94, of Delaware, Ohio, director of the Ohio State University "Big Ear" Radio Observatory, physicist, inventor, and environmentalist died 18 July 2004 at his home in Delaware, Ohio. He was born on 28 June 1910 in Ann Arbor, Michigan. He received a Bachelor of Science in 1930, a Master of Science in 1931, and a PhD in physics in 1933 (at 23 years of age), all from the University of Michigan, Ann Arbor. During the 1930s at Michigan, he was involved in physics projects, antenna consulting, and in atomic-particle-accelerator research using the University of Michigan's premier cyclotron. Throughout the late 1920s and the 1930s, John was an avid radio amateur with call sign W8JK. He was back on the air in the 1970s. In 2001 the amateur radio magazine CQ named him to the inaugural class of its Amateur Radio Hall of Fame. He developed many widely used innovative antennas. The "8JK closely spaced array" and the "corner reflector" were among his early designs. Edwin H. Armstrong wrote John in July 1941 indicating in part, "I have read with interest your article in the Proceedings of the Institute on the corner reflector...Please let me congratulate you on a very fine piece of work." Perhaps John's most famous invention, and a product of his intuitive reasoning process, is the helical antenna, widely used in space communications, on global positioning satellites, and for other applications. During World War II, John was in Washington, DC as a civilian scientist with the U.S. Navy responsible for "degaussing" the electromagnetic fields of steel ships to make them safe from magnetic mines. He also worked on radar countermeasures at Harvard University's Radio Research Laboratory. He received the U.S. Navy Meritorious Civilian Service Award for his war work. In 1946 he took a faculty position at Ohio State University, becoming professor in 1949, and retiring in 1980 as McDougal Professor Emeritus of Electrical Engineering and Astronomy. Even so, he never retired

  8. O processo Clinical Caritas de Jean Watson na assistência de enfermagem brasileira: uma revisão sistemática

    OpenAIRE

    Carvalho, Nirvania V.; Neta, Dinah Sá Rezende; Silva, Grazielle Roberta Freitas da; Araújo, Telma M. Evangelista de

    2011-01-01

    Esta revisión sistemática tiene por objetivo revisar la aplicación del proceso Clinical Caritas, la reformulación de la teoría del cuidado humano: Jean Watson, a través de trabajos científico. Sólo cinco se encontraron productos en la bases de datos LILACS, SciELO, MEDLINE y BDENF después de la aplicación de rigurosos criterios de inclusión. Los resultados mostraron que el 80% de las publicaciones son de 2006 y el 60% realizados en el Sur. Los autores son enfermeros de postgrado, que trabajan...

  9. Cuidador domiciliar do idoso e o cuidado de si : uma análise através da teoria do cuidado humano de Jean Watson

    OpenAIRE

    Schossler,Thaís; Crossetti,Maria da Graça Oliveira

    2008-01-01

    Este estudo objetivou conhecer a percepção do cuidador domiciliar do idoso sobre o cuidado de si, através da Teoria do Cuidado Humano de Jean Watson. Trata-se de uma pesquisa qualitativa, do tipo exploratório-descritiva, desenvolvida na Unidade de Saúde da Vila Floresta, com nove cuidadores domiciliares de idosos integrantes do Programa de Assistência Domiciliar. As informações foram coletadas no período de agosto a outubro de 2006, através da entrevista semi-estruturada, cuja análise e inter...

  10. John Paul College: The Professional Renewal Journey

    Directory of Open Access Journals (Sweden)

    Pauline Mundie

    2014-09-01

    Full Text Available John Paul College, a K-12 School in Queensland, Australia, recognises the centrality of classroom teachers to the ongoing improvement of student outcomes. The college has implemented a multi-tiered professional renewal and assessment process. These changes of emphasis are the result of significant research and subsequent/associated professional discussion and were supported during the EBA decision-making in 2012. The professional renewal process at John Paul College guides teachers through a cycle of goal setting (related to any aspect of teacher practice which aims to improve student learning and achievement; ongoing discussion between the teacher and a mentor which determines actions; directed classroom observations (3 per term and associated pre and post reflection/discussion; leading to application of changed practice toward achieving the criteria of the goals. The principles of the professional renewal program are to:  enhance development along accepted school-wide, team and department goals;  encourage professional pedagogical reflections and conversations with a colleague/mentor;  motivate improved performance and highlight the next steps in a teacher’s development. Through the introduction of professional renewal, attestation and exemplary teacher processes, the leadership and teachers of John Paul College have achieved an appropriate and innovative balance between self-directed, peer supported/directed and college-wide, strategic initiatives. Each member of the teaching team, from graduate to senior leaders are actively engaged in personalised programs of professional growth which is specifically aimed at improved learning and outcomes of the college’s students.

  11. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  12. Gifts from Mary Ainsworth and John Bowlby.

    Science.gov (United States)

    Crittenden, Patricia M

    2017-07-01

    Attachment theory has developed over many decades - and continues to develop. Its roots lie in several seminal publications of John Bowlby (the basis of attachment theory) and Mary D. S. Ainsworth (the notion of individual differences in attachment). This paper identifies the prescient contributions of these early publications and two processes (a long-term dialogue and reflection on discrepancy) that underlay emergent theory. Because I was a student of Ainsworth when both attachment theory and individual differences in attachment organization were becoming better known, I offer some of my recollections of that period, suggesting how that period may have affected current work in attachment.

  13. Review of Due south, by John Kelly

    OpenAIRE

    Headland, Robert K.

    2007-01-01

    This small volume is basically the diary of John Kelly, who visited the British Antarctic Survey station on Signy Island in the South Orkney Islands. It includes about 60 monochrome plates (mainly half-page ones), a few sketches and a map of the island. The text is essentially a diary of the author’s time, from beginning in the Falkland Islands, sailing aboard RRS Ernest Shackleton , staying on the island from 25 January to 8 March 2003 to the return journey. As well as the illustrations, the...

  14. Decomposition and removability properties of John domains

    Indian Academy of Sciences (India)

    A quasidisk is the image of a disk or a half-plane under a quasiconformal mapping of the ... also a John domain, where P = {p1,p2,...,pm} and pi ∈ D (i = 1, 2,...,m). .... (2.5). Proof. Let S = ∂Bn(w1,r1)∩∂Bn(w2,r2). If S contains at most one point, then the proof is obvious. On the other hand, if S contains at least two points, ...

  15. The John Zink Hamworthy combustion handbook

    CERN Document Server

    Baukal, Charles E

    2013-01-01

    Despite the length of time it has been around, its importance, and vast amounts of research, combustion is still far from being completely understood. Issues regarding the environment, cost, and fuel consumption add further complexity, particularly in the process and power generation industries. Dedicated to advancing the art and science of industrial combustion, The John Zink Hamworthy Combustion Handbook, Second Edition: Volume 3 - Applications offers comprehensive, up-to-date coverage of equipment used in the process and power generation industries. Under the leadership of Charles E. Baukal

  16. El constitucionalismo según John Rawls

    OpenAIRE

    Gargarella, Roberto

    2005-01-01

    El término democracia se encuentra completamente ausente del famoso libro de John Rawls, Teoría de la justicia. En Liberalismo político, en cambio, Rawls discute varios de los muchos temas sobre los que el concepto de democracia nos invita a reflexionar. En este escrito concentro mi atención en una de esas discusiones: la tensión entre constitucionalismo y democracia. Más específicamente, procuro examinar de qué modo Rawls trata de afirmar el doble compromiso que toda constitución quiere honr...

  17. The chemistry of John Dalton's color blindness.

    Science.gov (United States)

    Hunt, D M; Dulai, K S; Bowmaker, J K; Mollon, J D

    1995-02-17

    John Dalton described his own color blindness in 1794. In common with his brother, he confused scarlet with green and pink with blue. Dalton supposed that his vitreous humor was tinted blue, selectively absorbing longer wavelengths. He instructed that his eyes should be examined after his death, but the examination revealed that the humors were perfectly clear. In experiments presented here, DNA extracted from his preserved eye tissue showed that Dalton was a deuteranope, lacking the middlewave photopigment of the retina. This diagnosis is shown to be compatible with the historical record of his phenotype, although it contradicts Thomas Young's belief that Dalton was a protanope.

  18. Dedication: John W. Wright, 1929-1978

    Science.gov (United States)

    Wright, John W.

    1980-09-01

    The death of John W. Wright in an automobile accident on November 20, 1978, came as a great shock to all who knew him. His family and friends lost a stimulating, compassionate human being whose many-faceted personality they greatly admired. The scientific community working on remote sensing of the air-water interface lost one of its pioneers and leaders. To dedicate this issue of the Journal of Geophysical Research to Dr. Wright seems a fitting tribute to his many scientific achievements.

  19. The healing philosopher: John Locke's medical ethics.

    Science.gov (United States)

    Short, Bradford William

    2004-01-01

    This article examines a heretofore unexplored facet of John Locke's philosophy. Locke was a medical doctor and he also wrote about medical issues that are controversial today. Despite this, Locke's medical ethics has yet to be studied. An analysis of Locke's education and his teachers and colleagues in the medical profession, of the 17th century Hippocratic Oath, and of the reaction to the last recorded outbreak of the bubonic plague in London, shines some light on the subject of Locke's medical ethics. The study of Locke's medical ethics confirms that he was a deontologist who opposed all suicide and abortion through much of pregnancy.

  20. Reformasie: John Knox, die Skotse Calvinis 3

    Directory of Open Access Journals (Sweden)

    V. E. d'Assonville

    1959-03-01

    Full Text Available Knox land in Skotland op 2 Mei 1559 in die hitte van die stryd, of soos hy dit self noem „in the brunt of the battle”. Maria die regentes het nou openlik haar ware kleure gewys en sydag vaar die Protestantse predikers Harlow, Douglas en Willock om op 10 Mei in die kasteel van Stirling te verskyn (Fleming, p. 42. John Knox neem hom voor om self daar teenwoordig te wees om, soos hy skryf, deur sy lewe of deur sy dood God se Naam teverheerlik (Laing, p. 21.

  1. The Trieste Lecture of John Stewart Bell

    Science.gov (United States)

    Bassi, Angelo; Carlo Ghirardi, Gian

    2007-03-01

    Delivered at Trieste on the occasion of the 25th Anniversary of the International Centre for Theoretical Physics, 2 November 1989 The video of this lecture is available here. Please see the PDF for the transcript of the lecture. General remarks by Angelo Bassi and GianCarlo Ghirardi During the autumn of 1989 the International Centre for Theoretical Physics, Trieste, celebrated the 25th anniversary of its creation. Among the many prestigious speakers, who delivered extremely interesting lectures on that occasion, was the late John Stewart Bell. All lectures have been recorded on tape. We succeeded in getting a copy of John's lecture. In the lecture, many of the arguments that John had lucidly stressed in his writings appear once more, but there are also extremely interesting new remarks which, to our knowledge, have not been presented elsewhere. In particular he decided, as pointed out by the very choice of the title of his lecture, to call attention to the fact that the theory presents two types of difficulties, which Dirac classified as first and second class. The former are those connected with the so-called macro-objectification problem, the latter with the divergences characterizing relativistic quantum field theories. Bell describes the precise position of Dirac on these problems and he stresses appropriately how, contrary to Dirac's hopes, the steps which have led to a partial overcoming of the second class difficulties have not helped in any way whatsoever to overcome those of the first class. He then proceeds to analyse the origin and development of the Dynamical Reduction Program and draws attention to the problems that still affect it, in particular that of a consistent relativistic generalization. When the two meetings Are there quantum jumps? and On the present status of Quantum Mechanics were organized in Trieste and Losinj (Croatia), on 5 10 September 2005, it occurred to us that this lecture, which has never been published, might represent an

  2. John Napier life, logarithms, and legacy

    CERN Document Server

    Havil, Julian

    2014-01-01

    John Napier (1550–1617) is celebrated today as the man who invented logarithms—an enormous intellectual achievement that would soon lead to the development of their mechanical equivalent in the slide rule: the two would serve humanity as the principal means of calculation until the mid-1970s. Yet, despite Napier’s pioneering efforts, his life and work have not attracted detailed modern scrutiny. John Napier is the first contemporary biography to take an in-depth look at the multiple facets of Napier’s story: his privileged position as the eighth Laird of Merchiston and the son of influential Scottish landowners; his reputation as a magician who dabbled in alchemy; his interest in agriculture; his involvement with a notorious outlaw; his staunch anti-Catholic beliefs; his interactions with such peers as Henry Briggs, Johannes Kepler, and Tycho Brahe; and, most notably, his estimable mathematical legacy. Julian Havil explores Napier’s original development of logarithms, the motivations for his approa...

  3. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  4. Translating The Infinities by John Banville

    Directory of Open Access Journals (Sweden)

    Irene Abigail Piccinini

    2015-12-01

    Full Text Available Abstract - John Banville’s talent as a prose stylist is widely recognized. The polished elegance of his phrases constitutes a continuing and fascinating challenge for his translator, due to the intricacies of the source text, its manifold registers and lexical choices. In his novel The Infinities, in Italian Teoria degli Infiniti, John Banville takes cue from Kleist’s Amphytrion to devise a novel where classicality interweaves with science and science fiction through the invention of a world where the ancient gods intermingle with the humans while waiting for the death of Adam Godley, a famous mathematician who explained how an infinity of worlds exist and interact with each other. To translate this book I had not only to work extensively on lexis and style, but also to do considerable research to render the many literary and non literary references. Some examples of these struggles with the source text during the translation process are given in the present paper. Riassunto - John Banville, autore irlandese noto per la sua prosa raffinata, scrive in una lingua che rappresenta una sfida continua e affascinante per chi lo traduce. La sua complessità stilistica, che sfrutta molteplici registri linguistici e si avvale di scelte lessicali cui spesso è arduo trovare un traducente italiano soddisfacente, costringe il traduttore a fare ricorso a tutte le sottigliezze del proprio mestiere per restituire quanto più possibile l’eleganza dell’originale nella propria lingua. Nel romanzo The Infinities, tradotto in italiano come Teoria degli infiniti (Guanda, Parma 2011, Banville prende spunto dall’Anfitrione di Kleist per costruire un romanzo che guarda alla classicità sconfinando in un misto di scienza e fantascienza con la concezione di un’infinità di mondi paralleli teorizzata dal matematico Adam Godley, il protagonista morente al cui capezzale si radunano uomini e antichi dei in attesa che il cerchio della vita e della morte si compia

  5. URobotics—Urology Robotics at Johns Hopkins

    Science.gov (United States)

    Stoianovici, D

    2011-01-01

    URobotics (Urology Robotics) is a program of the Urology Department at the Johns Hopkins Medical Institutions dedicated to the development of new technology for urologic surgery (http://urology.jhu.edu/urobotics). The program is unique in that it is the only academic engineering program exclusively applied to urology. The program combines efforts and expertise from the medical and engineering fields through a close partnership of clinical and technical personnel. Since its creation in 1996, the URobotics lab has created several devices, instruments, and robotic systems, several of which have been successfully used in the operating room. This article reviews the technology developed in our laboratory and its surgical applications, and highlights our future directions. PMID:11954067

  6. CONHECIMENTO SIMBÓLICO EM JOHN VENN

    OpenAIRE

    Bruno Ramos Mendonça

    2013-01-01

    Esta dissertação apresenta uma reconstrução da teoria lógica de John Venn (1834- 1923) em Symbolic Logic (1881; 1894). Em sua obra, Venn apresenta uma álgebra da lógica, e enfrenta uma série de problemas filosóficos subjacentes a essa lógica simbólica. Em primeiro lugar, Venn precisa considerar a relação entre a lógica simbólica e a lógica tradicional, i.e., a silogística. Em segundo lugar, Venn precisa considerar a relação entre a lógica simbólica e a matemática. No tratamento...

  7. John Ruskin and the Savage Gothic

    Directory of Open Access Journals (Sweden)

    Frances S. Connelly

    2015-06-01

    Full Text Available John Ruskin’s provocative theories concerning Gothic art and architecture bear serious consideration in light of the formative debates concerning “primitive” art and its relation to modern European society. Like many primitivists, Ruskin’s advocacy for the medieval was motivated by a reformist zeal concerning the state of modern industrial Europe. He differs markedly in his ideas concerning the value and uses of the "savage” Gothic for modern audiences. Ruskin rejected the random borrowing of stylistic elements, stressing instead the artisanal process and the communal role of Gothic monuments. It is also significant that Ruskin problematises the relationship between “primitive” and modern by repeatedly acknowledging his position as a modern viewer and emphasising the process through which he makes (artisan-like his interpretive history of the Gothic. Rejecting the mastering gaze, Ruskin constantly reminds readers that their view of this pre-modern work is fragmentary and disjunctive.

  8. John Adams and CERN: Personal Recollections

    Science.gov (United States)

    Brianti, G.; Plane, D. E.

    2014-02-01

    By any standards, John Adams had a most remarkable career. He was involved in three important, emerging technologies, radar, particle accelerators and controlled fusion, and had an outstanding impact on the last two. Without a university education, he attained hierarchical positions of the highest level in prestigious national and international organizations. This article covers the CERN part of his career, by offering some personal insights into the different facets of his contributions to major accelerator projects, from the first strong-focusing synchrotron, the PS, to the SPS and its conversion to a proton--antiproton collider. In particular, it outlines his abilities as a leader of an international collaboration, which has served as an example for international initiatives in other disciplines.

  9. John Dewey and His Philosophy of Education

    Directory of Open Access Journals (Sweden)

    Aliya Sikandar

    2015-12-01

    Full Text Available This review paper on John Dewey, the pioneering educationist of the 20th century, discusses his educational thoughts, and writings, which gave a new direction to education at the turn of the century. Dewey’s contributions are immense and overwhelming in the fields of education, politics, humanism, logic, and aesthetics. This discussion will focus on Dewey and his philosophy related to educational approaches, pedagogical issues, and the linkages that he made between education, democracy, experience, and society. At the heart of his educational thought is the child. Dewey’s idea on humanism springs from his democratic bent and his quest for freedom, equity, and the value of child’s experiences.

  10. John Dewey and early Chicago functionalism.

    Science.gov (United States)

    Backe, A

    2001-11-01

    John Dewey and James Angell are regarded respectively as the founder and systematizer of the Chicago school of functional psychology. The early Chicago school traditionally has been portrayed as a unified theoretical approach based primarily on William James's naturalist theory of mental processes. It is argued in this article that although the psychology systematized by Angell bore a close affinity to James's naturalism, Dewey's own psychology was based primarily on the neo-Hegelian philosophy of Thomas Hill Green. Through a review of a number of Dewey's major writings, Green's neo-Hegelian philosophy is shown to have influenced Dewey's views on psychological concepts such as reaction, emotion, and perception during the formative period of the Chicago school. The interpretation of Dewey's psychology developed in this article leads to the conclusion that early Chicago functionalism should not be regarded as a unified theoretical approach.

  11. John F. Dewey—Tectonics Editor

    Science.gov (United States)

    Richman, Barbara T.

    ‘I want the journal to acquire a reputation for very rapid, fair, and accurate reviewing,’ asserted John F. Dewey, editor-in-chief of AGU's newest journal, Tectonics. Dewey said that he will rule the bimonthly, which will begin publication in February, ‘with a bit of a rod of iron’ to ensure that Tectonics is ‘where only original and important papers are published.’‘I'm going to be very strict with reviewers,’ Dewey explained in his quick British clip. ‘If the review does not come back to me within 10 days to 2 weeks, I'll review the paper myself. I'm also going to have a system whereby, if a paper needs major surgery after being refereed, it will be rejected. Papers will have to be in virtually publishable condition before they are first submitted,’ he said.

  12. El constitucionalismo según John Rawls

    Directory of Open Access Journals (Sweden)

    Roberto Gargarella

    2005-01-01

    Full Text Available El término “democracia” se encuentra completamente ausente del famoso libro de John Rawls, Teoría de la justicia. En Liberalismo político, en cambio, Rawls discute varios de los muchos temas sobre los que el concepto de democracia nos invita a reflexionar. En este escrito concentro mi atención en una de esas discusiones: la tensión entre constitucionalismo y democracia. Más específicamente, procuro examinar de qué modo Rawls trata de afirmar el doble compromiso que toda constitución quiere honrar, esto es, el compromiso con el ideal de la autonomía individual, y el compromiso con el ideal del auto-gobierno colectivo.

  13. General Relativity and John Archibald Wheeler

    CERN Document Server

    Ciufolini, Ignazio

    2010-01-01

    Observational and experimental data pertaining to gravity and cosmology are changing our view of the Universe. General relativity is a fundamental key for the understanding of these observations and its theory is undergoing a continuing enhancement of its intersection with observational and experimental data. These data include direct observations and experiments carried out in our solar system, among which there are direct gravitational wave astronomy, frame dragging and tests of gravitational theories from solar system and spacecraft observations. This book explores John Archibald Wheeler's seminal and enduring contributions in relativistic astrophysics and includes: the General Theory of Relativity and Wheeler's influence; recent developments in the confrontation of relativity with experiments; the theory describing gravitational radiation, and its detection in Earth-based and space-based interferometer detectors as well as in Earth-based bar detectors; the mathematical description of the initial value pro...

  14. John Locke and the right to resistance

    Directory of Open Access Journals (Sweden)

    Jovanov Ilija D.

    2015-01-01

    Full Text Available John Locke was a great thinker and many works have been devoted to clear up his theories. One of the most significant, stated in his principal work, Two Treatises of Government, is the theory of the right to resistance. It was a bit revolutionary then, and to a large extent it is today. Domination of legal positivism is negation of that, by Locke, natural right. However, the fact is that in recent times the resistance to the established power occurs in a number of countries and in different forms, so that the idea of the right to resistance becomes live question again. In this regard it is interesting to consider Locke's viewpoint on this important issue and to determine whether his theory on the resistance is applicable in modern societies.

  15. John Adams and CERN: Personal Recollections

    CERN Document Server

    Brianti, Giorgio

    2013-01-01

    By any standards, John Adams had a most remarkable career. He was involved in three important, emerging technologies, radar, particle accelerators and controlled fusion, and had an outstanding impact on the last two. Without a university education, he attained hierarchical positions of the highest level in prestigious national and international organizations. This article covers the CERN part of his career, by offering some personal insights into the different facets of his contributions to major accelerator projects, from the first strong-focusing synchrotron, the PS, to the SPS and its conversion to a proton–antiproton collider. In particular, it outlines his abilities as a leader of an international collaboration, which has served as an example for international initiatives in other disciplines.

  16. John Ruskin e o desenho no Brasil

    OpenAIRE

    Claudio Silveira Amaral

    2005-01-01

    O assunto principal do critico de arte inglês do século XIX John Ruskin foi uma teoria da percepção cujo objetivo era o ensino do desenho para a sociedade industrial. No século XIX o ensino do desenho era considerado uma politica industrial, e no Brasil não foi diferente. A vinda da família real ao país deflagrou o nosso primeiro projeto de industrialização com base no ensino do desenho. A Missão Francesa veio fundar aqui duas escolas, uma para as artes liberais e outra para as artes Mecânica...

  17. Caruso St John y Robert Smithson: Interferencias

    Directory of Open Access Journals (Sweden)

    Emilia Hernández Pezzi

    2016-05-01

    Full Text Available Resumen Los discursos cruzados son el soporte común del presente número de Cuadernos. El cruce que planteamos tiene como protagonistas al artista Robert Smithson y a los arquitectos Adam Caruso y Peter St John. Estos últimos hacen mención del trabajo del artista norteamericano para explicar su proyecto de remodelación de Stortorget, la plaza de la catedral en el centro de Kalmar, Suecia. A partir de aquí, comenzamos una exploración del trabajo y las preocupaciones de ambos que nos permite dibujar convergencias y sintonías procesuales por encima de las diferencias temáticas, ideológicas y estilísticas. Al disponer en paralelo la obra de Smithson y Caruso St John descubrimos vibraciones y resonancias que muestran una interacción productiva de sus preocupaciones. La materia se convierte en sus propuestas en un objeto activo y sensible, un depósito energético con el que operar. El traslado de piedras en Stortorget convoca la memoria de la ciudad del mismo modo que el basalto y la sal del Spiral Jetty, erosionados por el tiempo, nos hablan de procesos abiertos. El tiempo y la memoria pasan a ser soportes estratégicos con los que construyen sus miradas. Los objetos se disuelven en las relaciones que establecen con su entorno produciendo equilibrios frágiles e instantáneos. De esta manera el artículo pretende generar un vórtice de reflexión, una espiral en cuyo recorrido se manifiesten las tensiones parciales del cruce propuesto, sus fijezas momentáneas.

  18. Factor personal e institucional en el desarrollo del “cuidado humano de ayuda confianza”, de la teoria de Jean Watson en los enfermeros del servicio de medicina 3B del Hospital Nacional Guillermo Almenara Irigoyen, 2013

    OpenAIRE

    Sebastián Llancari, Carolina; Velásquez Carranza, Doris

    2016-01-01

    La teoría del cuidado humano de Watson sostiene que ante el riesgo de deshumanización en el cuidado del paciente, se hace necesario el rescate del aspecto humano por parte de los profesionales de enfermería. Objetivos: determinar el factor personal e institucional en el desarrollo del “cuidado humano de ayuda-confianza”, de la teoría de Jean Watson en los enfermeros en el Servicio de Medicina 3B del HNGAI. Material y métodos:estudio descriptivo de corte transversal. Población conformada por e...

  19. Obituary: John Norris Bahcall, 1934-2005

    Science.gov (United States)

    Striker, Jeremiah P.; Bahcall, Neta A.

    2007-12-01

    John Norris Bahcall, one of the most creative and influential astrophysicists of his generation — a scientist who helped prove what makes the Sun shine and helped make the Hubble Space Telescope a reality — passed away in Pasadena, California, on 17 August 2005. Bahcall died peacefully in his sleep from a rare blood disorder. For the past 35 years, Bahcall was the Richard Black Professor of Natural Sciences at the Institute for Advanced Study in Princeton, New Jersey, where he created one of the leading astrophysics programs in the world. Active and working to the end, Bahcall said that he was always grateful for a full and happy life that exceeded his wildest expectations. Bahcall died as he lived, surrounded by the family he loved, embracing life to its fullest, happy, working and joking to the end. Bahcall's stellar career encompassed seminal contributions in numerous fields of astrophysics as well as extraordinary leadership on behalf of the scientific community, including the American Astronomical Society, the American Physical Society, the National Academy of Sciences, NASA, and Congress. Bahcall's contributions made him one of the scientific leaders of his time. He had been recognized by numerous awards including the 1998 National Medal of Science from President Clinton, the Gold Medal of the Royal Astronomical Society, the Medal of the Swedish Royal Academy, the Dan David Award, the Fermi Award, the first Hans Bethe Prize, the Franklin Medal, the Comstock Prize in physics, NASA's Exceptional Scientific Achievement Medal, NASA's Distinguished Public Service Medal, and the top awards of the American Astronomical Society — including the Russell Award, the Heineman Prize, and the Warner Prize. Bahcall was elected to the National Academy of Sciences in 1976 and to the American Philosophical Society in 2001. He was the recipient of Honorary Degrees from numerous universities around the world. Bahcall's scientific interests and expertise ranged from neutrino

  20. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  1. A Conversation with John McKetta.

    Science.gov (United States)

    McKetta, John J; Truskett, Thomas M

    2017-06-07

    John J. McKetta, Jr. is a foundational figure in chemical engineering education and energy policy in the United States. An authority on the thermodynamic properties of hydrocarbons and an energy adviser to several US presidents, McKetta helped to educate and mentor thousands of students at the University of Texas at Austin for over 40 years, many of whom became leading figures in the energy and petrochemical industries, as well as in academia. As dean of the College of Engineering, McKetta helped to establish a bioengineering program, which later became the Biomedical Engineering Department, at the University of Texas at Austin, and was a tireless advocate for excellence and a focus on the student. At age 100, McKetta recalls the challenges and opportunities he faced in childhood, his memories of the emergence of petrochemical engineering, and his views on chemical engineering education and the people it has impacted in the United States over the past 100 years.

  2. The life and works of John Napier

    CERN Document Server

    Rice, Brian; Corrigan, Alexander

    2017-01-01

    For the first time, all five of John Napier’s works have been brought together in English in a single volume, making them more accessible than ever before. His four mathematical works were originally published in Latin: two in his lifetime (1550–1617), one shortly after he died, and one over 200 years later. The authors have prepared three introductory chapters, one covering Napier himself, one his mathematical works, and one his religious work. The former has been prepared by one of Napier’s descendants and contains many new findings about Napier’s life to provide the most complete biography of this enigmatic character, whose reputation has previously been overshadowed by rumour and speculation. The latter has been written by an academic who was awarded a PhD for his thesis on Napier at the University of Edinburgh, and it provides the most lucid and coherent coverage available of this abstruse and little understood work. The chapter on Napier’s mathematical texts has been authored by an experienced...

  3. Disorientations: John Singer Sargent and Queer Phenomenology

    Directory of Open Access Journals (Sweden)

    Anne Pasek

    2013-12-01

    Full Text Available Art history has long struggled to find a method to account for the diverse expressions of queer desire across the heterogeneous landscape of history. While there has been a surge of research on the lives, artworks, and audiences of artists that trouble the heterosexual norm, the wider impact of this scholarship is often limited to singular biographies. Following the call for greater self-reflexivity and acknowledgement of difference in queer theory and phenomenological approaches to art history, the additive goals of gay and lesbian scholarship with its political investment in strategies of representation can be brought into scrutiny. To this end, a critical historiographical review of gay and lesbian art history is undertaken and a queer phenomenological method is presented as a new means forward. Applied to the work of John Singer Sargent, it is argued that a focus on the spatial orientation of bodies in his album of male nudes provides a more nuanced and ethical account of the queer than a focus on identity and identifications.

  4. John Stuart Mill on socialism and accountability

    Directory of Open Access Journals (Sweden)

    Francisco José Sales Rocha

    2010-01-01

    Full Text Available http://dx.doi.org/10.5007/1677-2954.2010v9n1p17Este artigo mostra que o tipo de socialismo proposto por John Stuart Mill é marcado por uma forte preocupação com a controlabilidade do poder econômico e político. Ele rejeitou enfaticamente os modelos centralistas de socialismo por entender que eles levam a uma grande concentração de poder que compromete a liberdade. Para J. S. Mill, o socialismo deve ser implantado lentamente a partir de reformas amplamente discutidas que favoreçam a cidadania econômica dos trabalhadores, promovam a participação deles nas decisões referentes ao processo produtivo e em associações voluntárias. J. S. Mill acreditava que a competição econômica é essencial para o adequado funcionamento de uma economia socialista. Ele não esperava que tal economia se tornasse uma realidade em um futuro próximo.

  5. John Beebe in conversation with Beverley Zabriskie.

    Science.gov (United States)

    Beebe, John; Zabriskie, Beverley

    2011-06-01

    John Beebe speaks with Beverley Zabriskie about the central motifs of his life and depth psychological experience, and how these informed his choice of vocation as psychiatrist, Jungian analyst, educator and author. Dr. Beebe narrates how he moved beyond the fate assigned the son of a needy mother and abandoning father. He illustrates how the role his family expected him to fill constellated archetypal motifs--the magical or divine curative child, the whiz kid--from which he had then to disidentify for the sake of becoming an individual with a personal voice and capacity to express his own true values. He tells of his differentiation and search for completion through the perspective of Jung's psychological types theory. He also reflects on the evolution of Jungian analytic theory and practice generally, his editorship of the JAP and the San Francisco Jung Institute Library Journal, his confrontation with analytic homophobia, and the emerging quality of professional and personal relationships in relation to ethics and to love. He assesses Jung's courage and integrity as displayed through the release of Jung's Red Book, and his own quest for an organic and psychological moral stance expressed in his benchmark book, Integrity in Depth. © 2011, The Society of Analytical Psychology.

  6. PREFACE: John Desmond Bernal: Science and Society

    Science.gov (United States)

    Casey, Vincent

    2007-02-01

    This meeting, held in the Limerick Institute of Technology, on Thursday 1 June 2006, was organised by the Munster Group of the Institute of Physics in Ireland to commemorate the life and work of John Desmond Bernal. Bernal, was born in Nenagh in 1901. Alan Mackay, who worked with Bernal at Birkbeck College coins the word 'Polytropic' to describe Bernal. He was active and hugely influential in a wide range of areas such as science, politics and society, and was instrumental in the creation of whole new areas of intellectual endeavour such as the 'science of science', molecular biology, and operations research. Andrew Brown's analogy for Bernal's mind is that 'it was like a diamond—beautifully structured, multifaceted and dazzling to behold'. In relation to Bernal, Helena Sheehan states that: 'His legacy is complex. All the more so because he was marxist in philosophy, communist in politics, polyamorous in sexuality.'. Like religion, these are areas that conventional scientists tend to shy away from or at the very least consign to very separate and often neglected 'compartments'. According to Sheehan, 'Bernal came to marxism seriously and intelligently. He found in its philosophical framework a structure in which he could live, think, create, pursue science, act politically and develop further. It opened him radically to the world, rather than closing him down or constricting him, as critics imply.'. And his contributions to science and to society are significant and enduring. Just two areas of 'his science' were addressed in some detail at this meeting. Martin Caffrey treats the area of structural biology in the context of modern developments but focusing on Bernal's role in its evolution. John Finney gives an account of Bernal's 'two bouts of activity' on the structure of water and as Bernal's last PhD student he gives unique insights on how Bernal worked and why he 'did science'. Bernal writes in response to a well wisher on his 70th birthday: 'I am sure that

  7. John Wheeler, 1933 - 1959: Particles and Weapons

    Science.gov (United States)

    Ford, Kenneth

    2009-05-01

    During the early part of his career, John Archibald Wheeler made an astonishing number of contributions to nuclear and particle physics, as well as to classical electrodynamics, often in collaboration with another physicist. He was also a major contributor to the Manhattan Project (in Chicago and Hanford rather than Los Alamos), and, following World War II, became an influential scientific cold warrior. His early achievements in physics include the calculated scattering of light by light (with Gregory Breit), the prediction of nuclear rotational states (with Edward Teller), the theory of fission (with Niels Bohr), action-at-a-distance electrodynamics (with Richard Feynman), the theory of positronium, the universal weak interaction (with Jayme Tiomno), and the proposed use of the muon as a nuclear probe particle. He gained modest fame as the person who identified xenon 135 as a reactor poison. His Project Matterhorn contributed significantly to the design of the H bomb, and his Project 137, which he had hoped would flower into a major defense lab, served as the precursor to the Jason group.

  8. The romantic sexology of John Addington Symonds.

    Science.gov (United States)

    Binkley, S

    2000-01-01

    This paper examines a radical text by the English Classicist and homosexual, John Addington Symonds (1840-1893). Through a close study of an unpublished and long concealed manuscript, "A Problem in Modern Ethics" (1891), Symonds's political vision and the odd form of writing it takes is revealed as romantic in character. Symonds polemicizes against the pathologization of homosexuals in the legal-medical discourses of the time and advocates on behalf of a latent homosexual ethics, shunned from modern Western society, but continuing to hold forth a promise for the civic and moral renewal of Western countries. Against the positions of Krafft-Ebing and others, Symonds argues for the acceptance of "manly love," in the spirit of the ancients, as a source of moral inspiration for a declining Europe. Where Symonds is often read by historians of homosexual radicalism as a precursor to the radical tradition of the 20th century, romantic acceptance of the untimeliness of his moral vision, indicates less a politically progressive than a romantically fatalistic enterprise.

  9. Breathing Silence. An interview with John Palmer

    Directory of Open Access Journals (Sweden)

    Cristina Scuderi

    2011-07-01

    Full Text Available The interview focuses on some aspects of the composer’s work with electronics. Palmer, described by the critics as «undoubtedly the most visionary composer of his generation» speaks about the composers and musical works that have had a major impact on him. He also mentions the friendship with John Cage, his numerous travels – with particular emphasis on Japan – and the influence of Eastern culture on his musical mind. The composer discusses the notion of causality explored in Renge-Kyo, the meditative nature of Transient and Inwards, and spirituality as the central theme of both acousmatic works In the Temple and I Am. The electronic medium is also por- trayed as a mirror of an intense and vivid preoccupation for intimacy and perpetual search for timbral qualities that by now characterize most of his music. Another important aspect of Palmer’s work mentioned in the interview is the collaboration with some established performers and its importance for the realization of a musical work.

  10. From John Lee to John Gottman: Recognizing Intra- and Interpersonal Differences to Promote Marital Satisfaction

    Directory of Open Access Journals (Sweden)

    Claire Kimberly

    2013-10-01

    Full Text Available Since Extension agents work with a variety of families, there is a desperate need to further our understanding of how to educate diverse communities on a family-related topic. Focused on assisting those teaching marital education to a diverse population, this study attempts to understand how individual differences impact relationship satisfaction and marital communication. Based on John Gottman’s research on marital communication and John Lee’s six loves styles, 653 participants completed a survey to further understanding of the relationship between inter- and intrapersonal variables. Results revealed that marital communication and love styles accounted for 54.6% of the variance in marital satisfaction regardless of difference in demographics. Results of this study provide a resource for educators and practitioners to use with diverse clientele, while also emphasizing the need to understand both intra- and interpersonal variables when working with families.

  11. How serendipity shaped a life; an interview with John W. Saunders, Jr. by John F. Fallon.

    Science.gov (United States)

    Saunders, John W

    2002-01-01

    John W. Saunders Jr. is an outstanding contributor to the field of Developmental Biology. His analyses of the apical ectodermal ridge, discovery and study of the zone of polarizing activity, insights into cell death in development, and analytical studies of feather patterns are part of a legacy to developmental biology. The body of his published work remains central to the understanding of limb development and is a major reason for the premiere place that the developmental biology of limbs holds in our research and teaching today. Beyond these things known to nearly everyone, there is John's role as teacher that is equally impressive. His one-on-one style, in small groups or from the podium is engaging, encompassing, and above all else, enthusiastic about the study of the development of living things. His love of developmental biology comes through to students of all ages and is inspirational. And, of course, inimitable charm accompanies the substance of any interaction with John. He still teaches in the Embryology Course at MBL Woods Hole. Recent students say that hearing his lectures and his involvement in the laboratory are highlights of the course. His continued knowledge of science and delight in new advances is a model for students to follow and they recognize it. John Saunders is a scientist and educator par excellence. His contributions have stood the test of time. His personal interactions with colleagues and students have enriched their lives in innumerable ways, large and small. His is a lifetime of outstanding achievements. In this interview, he reflects on his six--going on seven--decades in science and his personal enjoyment of recent advances in Developmental Biology.

  12. John Stuart Mill, John Rawls y Amartya Sen, los tres nombres de la equidad

    Directory of Open Access Journals (Sweden)

    María Teresa Lopera

    1997-07-01

    Full Text Available Tres autores como John Stuart Mill, John Rawls y Amartia Sen son objeto de análisis en este artículo que estudia el tema de la equidad en un contexto que se caracteriza por el abandono casi generalizado del estudio de los valores en relación a los grandes problemas económicos; el artículo defiende como necesaria la recuperación de las preocupaciones éticas en la ciencia económica. La segunda parte, presenta una bibliografía reciente presentada como respuesta a la obra de John Rawls a partir de 1985, cuando este autor da el llamado giro desde su teoría de la justicia como equidad hacia un reciente liberalismo político, período de gran interés para comprender las discusiones actuales de la filosofía política y el futuro de la discusión interdisciplinaria con la economía.

  13. La herencia igualitarista de John Rawls

    Directory of Open Access Journals (Sweden)

    Puyol González, Ángel

    2004-12-01

    Full Text Available One of the indisputable achievements of John Rawls work has been the revitalisation of the concept of equality in the ethics and political philosophy of the last few years. He has removed it from the monopoly of the ideologies that have had better or worse luck throughout the entire twentieth century and returned it to the analytical and conceptual rigor of philosophy. Moreover, he has done so with the added virtue of harmonising the value of equality with the values of freedom and efficiency, which is an effort that is not always valued with sufficient understanding. There is no doubt about the influence of Rawls theory of justice on current egalitarian thinking that, in some way, has been, and is still being, built -following -or diverging from the wake opened by the philosopher from Harvard. In this article, I analyse the main debates that are going on about Rawlsian egalitarianism and I point out some possible future orientation. In the first place, I set out the two great egalitarian arguments in Rawls work stemming, respectively, from a person's moral conception and the moral arbitrariness of the individual' s social and natural contingencies. Afterwards, I explore the problems of both arguments insisting, on one hand, on the inadequacy of the Kantian moral personality as a foundation for an egalitarian theory and, on the other hand, on the inconsistency of luck egalitarianism as an egalitarian extension of Rawls theory. In third place, I demonstrate that the main egalitarian problem in Rawls work comes from the concept of equality and equity void of solidarity. I conclude, finally, that justice as fairness should be contrasted with justice as fraternity.

    Uno de los logros indiscutibles de la obra de John Rawls ha sido la revitalización del concepto de igualdad en la ética y la filosofía política de los últimos años, desmonopolizándolo de las ideologías que han recorrido con mejor o peor fortuna todo el siglo xx y devolvi

  14. Case definition terminology for paratuberculosis (Johne's disease).

    Science.gov (United States)

    Whittington, R J; Begg, D J; de Silva, K; Purdie, A C; Dhand, N K; Plain, K M

    2017-11-09

    Paratuberculosis (Johne's disease) is an economically significant condition caused by Mycobacterium avium subsp. paratuberculosis. However, difficulties in diagnosis and classification of individual animals with the condition have hampered research and impeded efforts to halt its progressive spread in the global livestock industry. Descriptive terms applied to individual animals and herds such as exposed, infected, diseased, clinical, sub-clinical, infectious and resistant need to be defined so that they can be incorporated consistently into well-understood and reproducible case definitions. These allow for consistent classification of individuals in a population for the purposes of analysis based on accurate counts. The outputs might include the incidence of cases, frequency distributions of the number of cases by age class or more sophisticated analyses involving statistical comparisons of immune responses in vaccine development studies, or gene frequencies or expression data from cases and controls in genomic investigations. It is necessary to have agreed definitions in order to be able to make valid comparisons and meta-analyses of experiments conducted over time by a given researcher, in different laboratories, by different researchers, and in different countries. In this paper, terms are applied systematically in an hierarchical flow chart to enable classification of individual animals. We propose descriptive terms for different stages in the pathogenesis of paratuberculosis to enable their use in different types of studies and to enable an independent assessment of the extent to which accepted definitions for stages of disease have been applied consistently in any given study. This will assist in the general interpretation of data between studies, and will facilitate future meta-analyses.

  15. John Frassanito &Associates: Designer for Space Travel

    Science.gov (United States)

    Zukowsky, John

    2002-01-01

    When most people think of design for space travel they think immediately of engineers and scientists, not architects or industrial designers. Yet, one of those arts professionals has been at the center of creating "space" in space for almost four decades. John Frassanito (born 1941) is an industrial designer who trained at the Art Center (now the famous Art Center College of Design in Pasadena) in the mid 1960s. After graduation in 1968, he began his design career by working with Raymond Loewy and William Snaith at the same time that Loewy's office was designing the interiors of Skylab, America's first space station (launched 1973). Frassanito worked on Skylab while at the Loewy firm until the early 1970s, when he was hired as a designer within the Computer Terminal Corporation where, in 1972, he designed the Datapoint 2000 -- the computer that the journal Invention and Technology (Fall 1994) called the "direct ancestor of today's PC." Frassanito started his own firm in 1983, where he continued to design computers as well as products for companies such as Sani-Fresh and Scott Paper. But he has made his mark on design for space travel since the mid-1980s, where he has been an outside contractor who has worked on a variety of NASA projects through today. These include 1980s works such as interior configuration and design for Space Station Freedom, as well as concepts for inflatable TransHab structures, through 1990s computer- generated animations for NASA missions, real and conceptual. In fact, Frassanito's high quality of design and animated imaging has been consistently utilized by NASA over the past decade to present mission realities and future concepts to scientists, engineers, lawmakers, and the general public alike. A survey of his work will be the subject of this paper in an effort to document the essential role that visual arts professionals play in designing "space" for space.

  16. Media perceptions of Tommy John surgery.

    Science.gov (United States)

    Conte, Stan A; Hodgins, Justin L; ElAttrache, Neal S; Patterson-Flynn, Nancy; Ahmad, Christopher S

    2015-11-01

    misconceptions exist regarding UCL reconstruction within the professional baseball media. Efforts for physicians to educate the media on the risks of overuse throwing injuries with emphasis on accurate indications, outcomes, and recovery of Tommy John Surgery are encouraged.

  17. Obituary: John P. Davidson (1924-2010)

    Science.gov (United States)

    Twarog, Bruce; Anthony-Twarog, Barbara

    2011-12-01

    Nuclear physicist and astrophysicist John P. Davidson died at his home on January 10, 2010. He was born on July 22, 1924 in Los Angeles, California. Jack followed his high school interests in rocketry and physical science to the University of California, Berkeley, where he earned a Bachelor of Science degree in physics in June 1948 after serving a stint from 1943 to 1946 in the Army Signal Corps in the European Theater of Operations. Following the war and graduation, Jack embarked on a graduate career in nuclear physics at Washington University, St. Louis. While there, he also initiated what became a life-long partnership with Mary Reiser dedicated to issues of social justice by co-founding an organization to lobby for university admission of African-American students, a policy change opposed by physicist and Chancellor, Arthur Holly Compton. Mary and Jack married in 1949. Jack Davidson's academic career began shortly after completion of his PhD in 1952 under Eugene Feenberg. He taught in Brazil and in Norway before becoming an assistant professor at Rensselaer Polytechnic Institute in 1957. He stayed at RPI until 1966, at which time he joined the faculty of the University of Kansas where he served faculty and students until his retirement in 1996. His teaching, research and administrative career at KU was distinguished by a growing commitment to the astronomy and astrophysics program. Not only did he foster its growth during his tenure as department chair (1977-1989), he directed a residential summer science program in astronomy for high school students at KU for nearly 10 years in the 1970's. He combined his background in nuclear physics and his fascination with astrophysics into a research program to study elemental abundance anomalies in stellar spectra, authoring with Don Bord several pioneering applications of wavelength coincidence statistics to the ultraviolet spectra of peculiar A stars. At KU, Jack assumed leadership roles in the local chapter of Phi Beta

  18. Obituary: Michael John Klein, 1940-2005

    Science.gov (United States)

    Gulkis, Samuel

    2006-12-01

    Michael John Klein died on 14 May 2005 at home in South Pasadena, California. The cause of death was tongue cancer that metastasized to the lungs. He was a non-smoker. Mike was a passionate radio astronomer, a trusted astronomical observer, an educator and a family man. Mike was born on 19 January 1940 in Ames, Iowa, the son of Florence Marie (Graf) and Fred Michael Klein. His mother was a homemaker, and his father was a banker. Mike had two older sisters, Lois Jean (Klein) Flauher and Marilyn June (Klein) Griffin. In 1962, Mike married his high school sweetheart Barbara Dahlberg, who survives him along with their three children, Kristin Marie (Klein) Shields, Michael John Klein Jr., Timothy Joel Klein, and six grandchildren. Mike developed a love for astronomy early in his life, and credited an early morning, newspaper-delivery route that he had at age twelve, which took him outside well before sunrise. He told family members that as he walked along his route, he stared into the sky and wondered what everything was. He studied sky charts, located stars, and began to understand how the planets shifted their positions relative to the stars each day. Another big influence in Mike's life was his brother in-law, Jim Griffin. Jim helped Mike understand that his passion for science did not have to remain a hobby, but could and should become a career. Jim's encouragement led Mike to attend Iowa State University in Ames, where he earned a BS in electrical engineering in 1962. Mike then started graduate school in electrical engineering at Michigan State, but after one semester transferred to the University of Michigan, Ann Arbor, where he earned an MS (1966) and PhD (1968) in astronomy. His doctoral dissertation, under the direction of Professor Fred Haddock, was based on extensive observations of the planets and examined the physical and thermal properties of planetary atmospheres and surfaces. Mike was awarded a Resident Research Associate position at JPL by the National

  19. Obituary: Michael John Seaton, 1923-2007

    Science.gov (United States)

    Pradhan, Anil; Nahar, Sultana

    2007-12-01

    Professor Michael John Seaton, hailed as the "Father of Atomic Astrophysics," passed away on May 29, 2007. He was one of the few Honorary Fellows of both the American Astronomical Society and the American Physical Society, so honored for his monumental contributions to both physics and astronomy. Mike Seaton was born on January 16, 1923 in Bristol, England. He attended Wallington County High School. But his leftist political activities, even at that stage, led to his expulsion, though he was eventually allowed to matriculate. He enlisted in the Royal Air Force as a navigator during the Second World War, and flew many dangerous missions. His legendary concentration and precision are reflected in the following anecdote. Once after a bombing mission his aircraft was lost in fog over the Alps. Seaton calculated the position and coordinates in flight to guide the aircraft. When the fog lifted, the crew found themselves flying perilously close to the mountains, but made it safely back. His associates often said, "A Seaton calculation is carried out as if his life depended on it." After the War he was admitted to University College London (UCL) as an undergraduate. Thereafter, he spent all of his professional career at UCL. Seaton received his Batchelor's degree in 1948, and his Ph.D. in 1951. His tenure at UCL coincided with the golden age of atomic astrophysics, for he was largely responsible for it. Seaton was elected Fellow of the Royal Society in 1967, and as President of the Royal Astronomical Society (RAS) in 1978. He was the recipient of an Honorary Doctorate from the Observatoire de Paris, an Honorary D.Sc. from the Queen's University of Belfast, the Gold Medal for Astronomy by the RAS, the Guthrie Medal by the Institute of Physics, the Royal Society Hughes award for lifetime work by the RAS, and several other prestigious awards. Nevertheless, as Alex Dalgarno recently remarked, Seaton was not part of the establishment because he chose not to be. Though rooted in

  20. Dr. John Frederick May and the identification of John Wilkes Booth's body.

    Science.gov (United States)

    Spiegel, A D

    1998-10-01

    Shortly after President Abraham Lincoln's assassin was killed on April 26, 1865, a formal inquest was held to positively identify the body. Dr. John Frederick May, a leading surgeon in the District of Columbia, was summoned to examine the remains. Two years earlier, Dr. May had removed a fibroid tumor from the back of the assassin's neck and an identifiable large ugly scar resulted when the wound inadvertently opened and healed by granulation. Based upon the recognition of the scar made by his scalpel, Dr. May made a positive identification.

  1. Narratological perspectives on John 13:1-38

    Directory of Open Access Journals (Sweden)

    J. A. du Rand

    1990-01-01

    Full Text Available The text of John 13 as a literary phenomenon is taken as narrative communication. Emphasis is laid on the pragmatic dimension, in which the relation between the sign and the recipient is highlighted. This article describes John 13 as a structured narrative in which a specific ideological perspective is reflected. Retrospectively viewed, John 13 provides an interpretative framework for meaningful discipleship. The modem reader is challenged to seek for deeper significance in the narration of the footwashing.

  2. John Considine: Dictionaries in Early Modern Europe: Lexicography ...

    African Journals Online (AJOL)

    Abstract. John Considine. Dictionaries in Early Modern Europe: Lexicography and the Making of Heritage. 2008, xiv + 393 pp. ISBN: 9780521886741. Cambridge: Cambridge University Press. Price: £55 / $99.

  3. John Calvin and John Locke on the Sensus Divinitatis and Innatism

    Directory of Open Access Journals (Sweden)

    J. Caleb Clanton

    2017-02-01

    Full Text Available Inheritors of the Calvinist Reformed tradition have long disagreed about whether knowledge of God’s nature and existence can be or need be acquired inferentially by means of the standard arguments of natural theology. Nonetheless, they have traditionally coalesced around the thought that some sense or awareness of God is naturally implanted or innate in human beings. A root of this orientation can be found in John Calvin’s discussion of the sensus divinitatis in the first book of The Institutes of the Christian Religion. This paper outlines a pedagogical strategy for organizing and evaluating Calvin’s treatment of the sensus divinitatis, chiefly by putting it in tension with John Locke’s polemic against innatism in Book I of An Essay concerning Human Understanding. I begin by reconstructing Calvin’s depiction of the sensus divinitatis, as well as his case for thinking that it is innate. I then explain how Locke’s critique of innatism offers a fairly direct response to Calvin and, hence, a useful framework for exploring the limits of Calvin’s treatment of the sensus divinitatis.

  4. John dos Passos in the 1930s John dos Passos in the 1930s

    Directory of Open Access Journals (Sweden)

    Townsend Ludington

    2008-04-01

    Full Text Available In 1930 John dos Passos was nearing the pinnacle of his impressive career. The Forty Second Parallel, the first volume of his trilogy USA, would be published that year to critical acclaim; he was respected as a writer by political factions both left and right; he was actively involved in causes in which he believed such as Emergency Committee for the Southern Political Prisoners (the Scottsboro Boys; and he was newly and happily married to Katy Smith and enjoying his friendships with other literary lights such as Ernest Hemingway. In 1930 John dos Passos was nearing the pinnacle of his impressive career. The Forty Second Parallel, the first volume of his trilogy USA, would be published that year to critical acclaim; he was respected as a writer by political factions both left and right; he was actively involved in causes in which he believed such as Emergency Committee for the Southern Political Prisoners (the Scottsboro Boys; and he was newly and happily married to Katy Smith and enjoying his friendships with other literary lights such as Ernest Hemingway.

  5. NEWS: John Goronwy Jones (1920-1999)

    Science.gov (United States)

    Jennison, Brenda M.

    2000-05-01

    John Goronwy Jones Gron Jones, as he was known to all, was a champion of Physics Education and his death, shortly before his eightieth birthday, robbed physics teachers of a colleague who fought many battles on their behalf. He was not shy of taking issue with anyone in authority who might be putting forward policies which would harm his great love: Physics Education and Physics Teaching. His photograph shows a man with an impish grin, looking friend and foe alike straight in the eye, before delivering the death blow to an argument which was founded on less than common sense. At other times he would listen patiently to the woes of colleagues before offering them fatherly/grandfatherly advice so that whoever was on the receiving end would go away feeling better for the encounter. Gron was born in Swansea and educated at Lewis Boys Grammar School in Glamorgan before entering University College Cardiff first of all as a mathematician before graduating in Physics in 1941. After his war service in the RAF, working on signals and radar development, he returned to do an MSc in X-ray crystallography before completing a PGCE in Bristol. What then passed for teacher training in all institutions left him wary of returning to train teachers himself but after 14 years spent teaching physics in three schools he returned to Cardiff and began a 25 year career in teacher training. He and his two colleagues, Clifford Othen (chemistry) and Douglas Hillier (biology) built up the Cardiff Science Centre as a focus for initial and in-service science teacher training in South Wales. The triumvirate was well known and a power to be reckoned with. They created links between the University Science Departments and the Schools. Gron knew the local schools and their physics teachers intimately. Cardiff became a focus for science education both nationally and internationally. He was a frequent attender at both ICPE (International Commission for Physics Education) and GIREP (International Physics

  6. 77 FR 27766 - Jamar, John P.; Notice of Filing

    Science.gov (United States)

    2012-05-11

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Jamar, John P.; Notice of Filing Take notice that on May 3, 2012, John P. Jamar submitted for filing, an application for authority to hold interlocking positions, pursuant to...

  7. 33 CFR 117.881 - John Day River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false John Day River. 117.881 Section 117.881 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Oregon § 117.881 John Day River. The draw of the...

  8. Familiar-Strange: Teaching the Scripture as John Would Teach

    Science.gov (United States)

    Ha, Tung-Chiew

    2014-01-01

    The Gospel of John teaches through telling the story of Jesus in light of the familiar Hebrew faith stories. It is an interpretive task that presents Jesus to his audience and teaches them adequate faith. John the Teacher skillfully uses narrative skills to create the familiar-strange effect in his storytelling. Each story is followed by a…

  9. Celebrating the Life and Legacy of Dr. John Hope Franklin

    Science.gov (United States)

    Harris, Robert L., Jr.; Levering-Lewis, David; French, John D.; Wharton, Clifton R., Jr.

    2009-01-01

    Dr. John Hope Franklin chronicled the experiences of African-Americans like no one before him, forcing America to recognize Black history as American history. His contributions were innumerable and his impact was abiding. In celebration of his life and legacy, the authors profile the celebrated scholar and activist, Dr. John Hope Franklin.

  10. 76 FR 39867 - Russell, John G.; Notice of Filing

    Science.gov (United States)

    2011-07-07

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Russell, John G.; Notice of Filing Take notice that on June 29, 2011, John G. Russell submitted for filing, an application for authority to hold interlocking positions, pursuant to...

  11. John Dewey's Experiential Theories and Leadership Preparation in Higher Education

    Science.gov (United States)

    Berman, Larry A.

    2013-01-01

    The purpose of this study was to investigate the degree to which John Dewey's experiential theories were embedded in leadership preparation curricula in departments of leadership and college student personnel administration at universities in the Midwestern United States. John Dewey, who is considered to be America's greatest philosopher, defined…

  12. 33 CFR 110.73 - St. Johns River, Fla.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false St. Johns River, Fla. 110.73 Section 110.73 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.73 St. Johns River, Fla. (a) Area A. The waters lying...

  13. A Personal Perspective: My Four Encounters with John Kendrew.

    Science.gov (United States)

    Wassarman, Paul M

    2017-08-18

    By celebrating the 100th anniversary of John Kendrew's birth in 1917, the Journal of Molecular Biology recognizes his seminal contributions to science in general and structural biology in particular. John was first to use X-ray diffraction to solve the 3-dimensional structure of a protein, sperm-whale myoglobin, worthy of a Nobel Prize in Chemistry in 1962. John was the Founder and first Editor-in-Chief of the Journal of Molecular Biology, Deputy Chairman of the Laboratory of Molecular Biology and Head of its Division of Structural Studies, a Founder of the European Molecular Biology Organization, first Director-General of the European Molecular Biology Laboratory, and 33rd President of St. John's College, Oxford. In this personal perspective I relate how I came to know John as his postdoctoral fellow at the Laboratory of Molecular Biology in 1967 and as his biographer 45 years later. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Anamnesis and the Silent Narrator in Plato and John

    Directory of Open Access Journals (Sweden)

    George L. Parsenios

    2017-03-01

    Full Text Available The Gospel of John is often compared to the dialogues of Plato by those who connect Johannine theology and Platonic philosophy. The comparison operates on the level of ideas. The present paper does not ignore issues of theology and philosophy but grounds a comparison of John and Plato first and foremost on the literary level. In several key places in John 1, 3, and 14, the Johannine narrator recedes from view and is unexpectedly silent where one would expect a narrator’s comment to organize the conversations and interactions between characters in John. Plato also renders the voice of the narrator silent in a dialogue like the Theaetetus. This paper argues that John and Plato both suppress the narrator’s voice in order to further their anamnetic efforts and to make later generations not only readers but participants in their original conversations.

  15. John Stuart Mill: utilitarismo e liberalismo = John Stuart Mill: utilitarianism and liberalism

    Directory of Open Access Journals (Sweden)

    Simões, Mauro Cardoso

    2013-01-01

    Full Text Available Meu objetivo, neste trabalho, é investigar a compatibilidade das teses utilitaristas e liberais de John Stuart Mill. Apresentarei, inicialmente, os principais críticos da filosofia moral e política de Mill, para os quais o discípulo de Bentham teria abandonado o utilitarismo ou, ainda, não esclarecido suficientemente seu princípio da liberdade, o que o tornaria um pensador assistemático e inconsistente. Minha tese é contrária a tais interpretações, uma vez que sustenta ser Mill consistente. Em seguida, defenderei uma interpretação do princípio da liberdade e da individualidade, procurando demonstrar que seu utilitarismo é compatível com seu liberalismo

  16. Obituary: John P. Oliver (1939-2011)

    Science.gov (United States)

    Cohen, Howard

    2011-12-01

    John P. Oliver, an emeritus professor of astronomy at the University of Florida in Gainesville, passed away Thursday, February 10, 2011, after a courageous and long battle with renal cancer. He left behind memories of a life and career to envy. During his forty years of service to his profession and department, this unique astronomer distinguished himself as a research scientist and instrumentalist, creative software designer, gifted teacher and speaker, a vocal advocate of public outreach, and friend to all who knew him. Oliver was born in New Rochelle, New York, during late fall 1939 on November 24. His father, James P. Oliver, was a naval officer and his mother was the former Dorothy Armstrong Cambell. Oliver's early days were spent in various cities due to his father's military life but he eventually received a high school diploma from Princess Ann High School in Virginia. Oliver subsequently graduated with a bachelor of science degree in physics in 1963 from the prestigious Rensselaer Polytechnic Institute in Troy. Lick Observatory awarded him a graduate assistantship so he moved west to California where he met and, on November 2, 1963, married Barbara Kay McKenna, who became his lifelong love and partner. In California Oliver had the good fortune to work with several eminent astronomers. This included Albert E. Whifford, director of Lick Observatory and known for his work on interstellar reddening, and Merle F. Walker, an expert in photometry, who also helped establish Pluto's rotation period. His close relation with Lawrence H. Aller, one of the 20th century's memorable astronomers, known for his ability to combine observation, theory and education, and for his care and kindness, helped bind Oliver and astronomy together for life. Oliver would also join the technical staff of the Aerospace Corporation, become an acting director of the Pine Mountain Observatory (University of Oregon), and a research assistant at the University of California in Los Angeles

  17. Obituary: John Allen Eddy (1931-2009)

    Science.gov (United States)

    Gingerich, Owen

    2011-12-01

    and eventual impacts of environmental changes of all kinds. In 2004 they moved to Tucson, where Eddy worked for NASA at the National Solar Observatory until the time of his death. Author's Note: A principal source of information is the interview with John A. Eddy by Spencer Weart on 21 April 1999, Niels Bohr Library & Archives, American Institute of Physics, College Park, MD USA, www.aip.org/history/ohilist/22910.html. See also the obituary by Peter Foukal in Physics Today, January 2010, pp. 60-61.

  18. Obituary: John Beverley Oke, 1928-2004

    Science.gov (United States)

    Hesser, James Edward

    2004-12-01

    John Beverley (Bev) Oke passed away of heart failure early on 2 March 2004 at his Victoria, B.C. home. Bev's insatiable scientific curiosity led to fundamental contributions in many areas of stellar and extragalactic astronomy, including the development of advanced instrumentation for the largest optical telescopes and the mentoring of scores of grateful students and colleagues. Bev Oke was born in Sault Ste. Marie, ON, Canada on 23 March 1928, the son of Lyla Parteshuk and the Rev. C. Clare Oke. He entered the University of Toronto in 1945 to study physics with a steadily increasing fraction of astronomy, receiving his BA in 1949. Summer employment at the David Dunlap Observatory (DDO, 1948) and at the Dominion Observatory (Ottawa, 1949, 1950) sealed his interest in astronomy as a career. For his MA thesis (1950, Toronto), performed under theoretician Ralph Williamson, he made interior models of the Sun, and was proud to have proved that the proton-proton cycle was indeed the source of solar energy. Upon entering Princeton University he worked with Martin Schwarzschild on stellar interiors models and Lyman Spitzer on interstellar lines. A lifelong friendship with Alan Sandage began during Bev's second year while Alan was a post-doc at Princeton. During Bev's third year he spent three months in Pasadena with Lyman obtaining data for his thesis on Of stars. While in Pasadena he began a second life-long collaboration with Jesse Greenstein, an astronomer whose approach to science Bev deeply respected. In the small field of astronomy in that era, Bev wrote to DDO Director Jack Heard indicating the nearing completion of his PhD studies and his interest in a position. This led to a lectureship at the University of Toronto (1953-1956), followed by an Assistant Professorship (1956-1958). Bev's interest in instruments began at this time, when he built a device to convert photographic density to intensity, and worked with DDO engineer-machinist Jerry Longworth to implement

  19. John Dewey: Su filosofia y filosofia de la educacion (John Dewey: His Philosophy and Philosophy of Education). Working Paper.

    Science.gov (United States)

    Zoreda, Margaret Lee

    This paper forms part of an investigation about how the philosophy of John Dewey (1859-1952) can illuminate the practice of the teaching of English as a foreign language. The paper seeks to interpret and synthesize John Dewey's philosophical works to construct a "Deweyian lens" with which to analyze and evaluate the field of the teaching…

  20. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  1. Health specific traits beyond the Five Factor Model, cognitive processes and trait expression: replies to Watson (2012), Matthews (2012) and Haslam, Jetten, Reynolds, and Reicher (2012).

    Science.gov (United States)

    Ferguson, Eamonn; Ward, Jane W; Skatova, Anya; Cassaday, Helen J; Bibby, Peter A; Lawrence, Claire

    2013-05-01

    In this article we reply to the issues raised by the three commentaries on Ferguson's (2012) article. Watson argues that the four traits identified by Ferguson (2012) - health anxiety, alexithymia, empathy and Type D - do not lie outside the Five Factor Model (FFM). We present factor analytic data showing that health anxiety forms a separate factor from positive and negative affectivity, alexithymia forms a factor outside the FFM and while emotional empathy loads with agreeableness, cognitive empathy forms a separate factor outside the FFM. Across these analyses there was no evidence for a general factor of personality. We also show that health anxiety, empathic facets and alexithymia show incremental validity over FFM traits. However, the evidence that Type D lies outside the FFM is less clear. Matthews (2012) argues that traits have a more distributed influence on cognitions and that attention is not part of Ferguson's framework. We agree; but Ferguson's original statement concerned where traits have their maximal effect. Finally, Haslam et al. suggest that traits should be viewed from a dynamic interactionist perspective. This is in fact what Ferguson (2012) suggested and we go on to highlight that traits can also influence group processes.

  2. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  3. BNL director John Marburger addresses the 'state of the lab'

    CERN Multimedia

    2000-01-01

    John Marburger presented a 'State of the Laboratory' address focusing on three main themes: BNL's improved interactions with the local community; the development of management systems and laboratory successes (1 page).

  4. Reflections on Cambridge: John Maynard Keynes at King's College Cambridge

    OpenAIRE

    Macfarlane, Alan

    2012-01-01

    .mp4 video file The economist John Maynard Keynes spent much of his life in Cambridge, connected to King's College. Alan Macfarlane reflects on a few aspects of his life and work. Filmed by Xu Bei in 2010

  5. Chapter 3: Contextual survey of John 9 | Ito | Acta Theologica

    African Journals Online (AJOL)

    Abstract. Book Title: The story of Jesus and the blind man: A speech act reading of John 9. Book Author: Hisayasu Ito. Ritsumeikan University, Kyoto City, Japan. Acta Theologica, Supplementum 21 2015.

  6. John White on Philosophy of Education and Philosophy

    Science.gov (United States)

    Siegel, Harvey

    2014-01-01

    John White offers a provocative characterization of philosophy of education. In this brief reaction, I evaluate the characterization and urge the maintenance of a strong connection between philosophy of education and philosophy.

  7. John McCain : muutuste aeg tulgu! / Tõnis Erilaid

    Index Scriptorium Estoniae

    Erilaid, Tõnis, 1943-

    2008-01-01

    John McCain kuulutati vabariiklaste ametlikuks presidendikandidaadiks ning parteikongressil peetud kõnes lubas ta muutusi, mida eelnevalt oli lubanud ka tema demokraadist konkurent Barack Obama. Vt. samas: Rünnakud Sarah Palinile ei lõpe

  8. John Heinz National Wildlife Refuge at Tinicum: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on John Heinz National Wildlife Refuge for the next 15 years. This plan outlines the...

  9. John Malkovich ikka oskab / Kätlin Kaldmaa

    Index Scriptorium Estoniae

    Kaldmaa, Kätlin, 1970-

    2006-01-01

    Edinburghi filmifestivalil esilinastus "Colour Me Kubrick" (stsenarist Anthony Frewin, režissöör Brian Cook, peaosas John Malkovich) mehest, kes režissööri eluajal 1996.a. esines Stanley Kubrick'una

  10. Darwin and Genomics: Regenia Gagnier interviews John Dupré

    Directory of Open Access Journals (Sweden)

    John Dupré

    2010-10-01

    Full Text Available In an interview with Regenia Gagnier, the philosopher of science John Dupré discusses some of the fundamental concepts of genomics and their implications for human nature and freedom.

  11. John Hay National Wildlife Refuge: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on John Hay NWR for the next 15 years. This plan outlines the Refuge vision and purpose...

  12. "Thoughts Concerning Education": John Locke On Teaching Speech

    Science.gov (United States)

    Baird, John E.

    1971-01-01

    Locke's suggestions for more effective speech instruction have gone largely unnoticed. Consequently, it is the purpose of this article to consider John Locke's criticisms, theory and specific methods of speech education. (Author)

  13. NPP Tropical Forest: John Crow Ridge, Jamaica, 1974-1978

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: Biomass and productivity for four subtypes of an upper montane tropical forest along John Crow Ridge in the Blue Ridge Mountains of Jamaica from 1974 to 1978

  14. Biographical Sketch: John Royal Moore, MD 1899–1988

    OpenAIRE

    Brand, Richard A.

    2011-01-01

    This biographical sketch on John R. Moore corresponds to the historic text, The Classic: Cartilaginous-cup Arthroplasty in Ununited Fractures of the Neck of the Femur (1948), available at DOI 10.1007/s11999-011-1974-z.

  15. Conceptualising holiness in the Gospel of John: The mode and ...

    African Journals Online (AJOL)

    2017-02-24

    ). The fourth and the ultimate objective is the glorification of God (17:4). Conceptualising holiness in the Gospel of John: The mode and objectives of holiness (part 1). Read online: Scan this QR code with your smart phone or.

  16. Exploring the Universe with John Milton and Mary Shelley.

    Science.gov (United States)

    Poston, David

    1989-01-01

    Presents an approach to teaching John Milton's "Paradise Lost" in conjunction with Mary Shelley's "Frankenstein." Notes that a study of these works stimulates vigorous discussions on theological and moral issues, human nature, and the cultural past and future. (MM)

  17. Biographical sketch: John Albert Key, 1890-1955.

    Science.gov (United States)

    Brand, Richard A

    2013-07-01

    This biographical sketch on John Albert Key corresponds to the historic text, The Classic: Epiphyseal coxa vara or displacement of the capital epiphysis of the femur in adolescence, available at DOI 10.1007/s11999-013-2913-y.

  18. Biographical sketch: John Royal Moore, MD 1899-1988.

    Science.gov (United States)

    Brand, Richard A

    2011-10-01

    This biographical sketch on John R. Moore corresponds to the historic text, The Classic: Cartilaginous-cup Arthroplasty in Ununited Fractures of the Neck of the Femur (1948), available at DOI 10.1007/s11999-011-1974-z.

  19. John of Salisbury, Adam of Balsham and The Cornifician Problem

    DEFF Research Database (Denmark)

    Bloch, David

    2010-01-01

    En undersøgelse af den Cornificius, som John of Salisbury angriber i sit værk Metalogicon. Der argumenteres for, at Cornificius er åbenlyst inspireret af den berømte Adam of Balsham......En undersøgelse af den Cornificius, som John of Salisbury angriber i sit værk Metalogicon. Der argumenteres for, at Cornificius er åbenlyst inspireret af den berømte Adam of Balsham...

  20. John of Salisbury, The Quadrivium and Demonstrative Science

    DEFF Research Database (Denmark)

    Bloch, David

    2009-01-01

    Artiklen undersøger John of Salisburys viden om, og forståelse af, quadrivium med særlig henblik på betydningen for hans syn på demonstrativ videnskab......Artiklen undersøger John of Salisburys viden om, og forståelse af, quadrivium med særlig henblik på betydningen for hans syn på demonstrativ videnskab...

  1. Lifelong Liberal John Maynard Keynes: Some Highlights from His Life

    OpenAIRE

    Gumus, Erdal

    2003-01-01

    History has witnessed many great individuals who have had unforgettable impact and great influences on societies that they may not last for centuries. Among these, doubtless to say, John Maynard Keynes was one of the most influenced social scientists. It is therefore the subject of this study to briefly examine his personal life from his birth and school years. This study shows that John Maynard Keynes life carries so many distinguished features that are to be invaluable examples for young ec...

  2. First John structure resolved: Exegetical analysis, Part 2

    Directory of Open Access Journals (Sweden)

    Ron J. Bigalke

    2013-11-01

    Full Text Available Numerous attempts have been suggested regarding the structure of First John. The only nearly unanimous agreement amongst commentators is concerning the prologue (1:1–4 and the conclusion (5:13–21. The lack of unanimity can be frustrating for the majority of those who seek to understand the macrostructure of the First Epistle of John. Consequentially, some commentators have opined that it is impossible to determine a notable structure of First John, and the epistle is thus regarded as a relatively imprecise series of various thoughts that were composed on the basis of mere association. Many exegetes have therefore proposed suggested outlines to aid the understanding of First John as opposed to providing genuine efforts to articulate a discernable structure of the epistle. The final part of this exegetical analysis seeks to demonstrate that exegetes need not succumb to such pessimism because there does appear to be a discernable structure to First John. Providing and stating resolve concerning the First John structure is fundamental for understanding the revealed contents of the epistle.

  3. First John structure resolved: Exegetical analysis, Part 2

    Directory of Open Access Journals (Sweden)

    Ron J. Bigalke

    2013-01-01

    Full Text Available Numerous attempts have been suggested regarding the structure of First John. The only nearly unanimous agreement amongst commentators is concerning the prologue (1:1–4 and the conclusion (5:13–21. The lack of unanimity can be frustrating for the majority of those who seek to understand the macrostructure of the First Epistle of John. Consequentially, some commentators have opined that it is impossible to determine a notable structure of First John, and the epistle is thus regarded as a relatively imprecise series of various thoughts that were composed on the basis of mere association. Many exegetes have therefore proposed suggested outlines to aid the understanding of First John as opposed to providing genuine efforts to articulate a discernable structure of the epistle. The final part of this exegetical analysis seeks to demonstrate that exegetes need not succumb to such pessimism because there does appear to be a discernable structure to First John. Providing and stating resolve concerning the First John structure is fundamental for understanding the revealed contents of the epistle.

  4. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  5. John Hejduk ja tema Wall House 2 = John Hejduk and his Wall House 2 / Vilen Künnapu

    Index Scriptorium Estoniae

    Künnapu, Vilen, 1948-

    2010-01-01

    Ameerika arhitekt John Hejdukist ja tema mõjust 20. sajandi lõpukümnendite arhitektuurimõttele. Ka 1973. aastal projekteeritud eramust Wall House 2, mis valmis alles 2001. aastal Groningenis. Kommentaar Soome arhitektuuriprofessor Juhani Pallasmaalt

  6. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  7. Old Testament spirituality in the gospel of John

    Directory of Open Access Journals (Sweden)

    Dirk G. van der Merwe

    2014-01-01

    Full Text Available The majority of early Christian documents are saturated with Jewish thought. Although Second-Temple Judaism did include a certain amount of diversity, when the Gospel of John was written in different phases during the latter half of the 1st century, the written Torah was a fixed part of Jewish Scripture. In this research, I endeavour to point out how Torah themes saturate the Prologue of the Gospel of John and also how these themes create a certain spirituality amongst its readers. A positive feature of Old Testament imagery and themes is that they are polysemantic, which made it easy for the writers of New Testament documents to reinterpret the Old Testament in the light of Jesus Christ. The author of the Gospel of John also made use of significant characters, themes and imagery, all taken from the Torah. In doing so, he created new spiritualities amongst the readers of the Gospel of John to endorse the identity, reality and a certain image and experience of the unseen God (1:18 of the Old Testament through Jesus Christ. The spirituality in the Gospel of John is bound up with a real God interacting with real people in real situations.

  8. Logos Announced the Light of Salvation: Interpreting How John Presented His Message in John 1:1-18, According to Functional Grammar

    Science.gov (United States)

    Pollinger, Seth

    2014-01-01

    This study of John 1:1-18 describes how John (the speaker) presented his message to his audience within their activity of verbal communication. By focusing on verbal meaning, this interpretation analyzes how John presented and expressed his meanings through language by interpreting this text based on the seamless interrelation between John's…

  9. John Bell (1763-1820): brother artist and anatomist.

    Science.gov (United States)

    Gardner-Thorpe, Christopher

    2013-01-01

    John Bell, brother-surgeon of Charles Bell, was, like Charles, an outstanding surgeon and a good artist. John was one of the few who illustrated his work with their own drawings in the days before audiovisual aids were available and without the benefit of reliable drawing aids, photography and computer-aided design. Charles, on the other hand, was the better artist and illustrated much of the normal anatomy of the nervous system. Each brother undertook extensive surgery of men who had been wounded in war; John Bell left us his engravings from the textbooks, more numerous perhaps than Charles, but Charles left us a series of oil paintings and watercolours in addition to the illustrations in his textbooks. © 2013 Elsevier B.V. All rights reserved.

  10. Geology of St. John, U.S. Virgin Islands

    Science.gov (United States)

    Rankin, Douglas W.

    2002-01-01

    The rocks of St. John, which is located near the eastern end of the Greater Antilles and near the northeastern corner of the Caribbean plate, consist of Cretaceous basalt, andesite, keratophyre, their volcaniclastic and hypabyssal intrusive equivalents, and minor calcareous rocks and chert. These rocks were intruded by Tertiary mafic dikes and tonalitic plutons. The oldest rocks formed in an extensional oceanic environment characterized by abundant keratophyre and sheeted dikes. Subduction-related volcanism of the east-west-trending marine Greater Antilles volcanic arc began on St. John near the transition between the Early and Late Cretaceous. South-directed compression, probably caused by the initial collision between the Greater Antilles arc of the Caribbean plate and the Bahama platform of the North American plate, deformed the Cretaceous strata into east-west-trending folds with axial-plane cleavage. Late Eocene tonalitic intrusions, part of the Greater Antilles arc magmatism, produced a contact aureole that is as much as two kilometers wide and that partly annealed the axial-plane cleavage. East-west compression, possibly related to the relative eastward transport of the Caribbean plate in response to the beginning of spreading at the Cayman Trough, produced long-wavelength, low-amplitude folds whose axes plunge gently north and warp the earlier folds. A broad north-plunging syncline-anticline pair occupies most of St. John. The last tectonic event affecting St. John is recorded by a series of post-late Eocene sinistral strike-slip faults related to the early stages of spreading at the Cayman Trough spreading center and sinistral strike-slip accommodation near the northern border of the Caribbean plate. Central St. John is occupied by a rhomb horst bounded by two of these sinistral faults. Unlike other parts of the Greater Antilles, evidence for recent tectonic movement has not been observed on St. John.

  11. Process and progress: John Hughlings Jackson's philosophy of science.

    Science.gov (United States)

    Jacyna, L Stephen

    2011-10-01

    Some scepticism has been voiced over whether the work of John Hughlings Jackson possesses any significant philosophical orientation. This article argues that Hughlings Jackson was acquainted with the work of a wide range of philosophers. In particular, certain aspects of the writings of John Stuart Mill are reflected in Hughlings Jackson's own work. From early in his career, Hughlings Jackson adopted a critical stance in his neurological papers, seeking to expose shortcomings in the conventional practices of his peers and urging greater methodological rigour and sophistication in order to advance their science. This critical and 'procedurist' bias endows Hughlings Jackson's writings with a characteristically modern character.

  12. Was John Paul II an Apologist of Christianity?

    Directory of Open Access Journals (Sweden)

    Andrzej Michalik

    2012-09-01

    Full Text Available The paper tries to answer the question whether John Paul II was an apologist of Christianity. Moving along scholastic methodology, the paper progress along three stages, exploring a negative statement ( videtur quod non , justifying a positive assertion ( sed contra , to formulate a conclusion ( ergo . Through this methodology the paper argues that Pope John Paul II was the defender of Christianity. This methodology allows thorough study of the highlights of the pontificate of this Great Pope and on the basis of counter-points to bring out a more clear answer to the research question.

  13. “HAVING FELLOWSHIP WITH GOD” ACCORDING TO 1 JOHN ...

    African Journals Online (AJOL)

    For believers to have fellowship (koinwniva) with one another and corporately with. God, is one of the main objectives stated for the proclamation of the gospel by the author of 1 John. This article investigates the intermediation and environment through which and in which fellowship is constituted between God and his ...

  14. Haunting Masculinity and Frightening Femininity: The Novels of John Bellairs

    Science.gov (United States)

    Heinecken, Dawn

    2011-01-01

    While developing scholarship around children's horror fiction has focused on the works of contemporary writers, this essay provides a close reading of the novels of John Bellairs, a leading and early practitioner of the genre. It argues that the first three novels in his Lewis Barnevelt series may be understood as addressing some of the same…

  15. Interview with Antony John Kunnan on Language Assessment

    Science.gov (United States)

    Nimehchisalem, Vahid

    2015-01-01

    Antony John Kunnan is a language assessment specialist. His research interests are fairness of tests and testing practice, assessment literacy, research methods and statistics, ethics and standards, and language assessment policy. His most recent publications include a four-volume edited collection of 140 chapters titled "The Companion to…

  16. Collected works of John Tate part II (1976--2006)

    CERN Document Server

    Tate, John; Serre, Jean-Pierre

    2016-01-01

    In these volumes, a reader will find all of John Tate's published mathematical papers-spanning more than six decades-enriched by new comments made by the author. Included also is a selection of his letters. His letters give us a close view of how he works and of his ideas in process of formation.

  17. John Ellis considers cosmology, colloquiums and new collaborations

    CERN Multimedia

    Katarina Anthony

    2011-01-01

    On 13 September, physicists from around the world joined John Ellis in a colloquium to celebrate his 65th birthday. In our last issue, we talked to John about the Higgs, the lack of the Higgs and extra dimensions. In this second part of the interview, John speaks about the colloquium and the wide range of topics it covered, all inspired by his career.   John Ellis in his office (July 2011). How did your birthday colloquium come about? When physicists here at CERN reach a “certain age” – or reach a transition point in their careers – it is traditional to hold some kind of colloquium. I had previously resisted pressure to hold one of these events. But this year, my official duties for the Organization have come to an end.  While it is unlikely you will see any difference in my working habits, it was a milestone that proved too important to not give into requests for an event. Rather than a very long sequence of people talking about what they d...

  18. John McArthur | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    John serves as a Senior Fellow at The Brookings Institution and as a Senior Advisor on Sustainable Development to the United Nations Foundation. He previously served as CEO of Millennium Promise Alliance; as faculty member at Columbia University, School of International and Public Affairs; and as Manager and ...

  19. Scholarship in Teaching and Learning: An Interview with John Mitterer

    Science.gov (United States)

    Daniel, David B.

    2009-01-01

    John Mitterer earned his PhD in cognitive psychology from McMaster University. Like many teaching professors, his career took an unexpected turn early on when he was hired to teach introductory psychology at Brock University, near Niagara Falls, in Ontario, Canada. It was love at first lecture. He never left the course and now, as a full professor…

  20. Conceptualising holiness in the Gospel of John: The mode and ...

    African Journals Online (AJOL)

    In the Gospel of John, the holiness of the trinity constitutes the theological environment for the code of holiness and forms the basis for the exhortation to holiness. The code of holiness is described in the light of the interaction of three levels of relationships: the unity between Father and the Son as the example of holiness, ...

  1. 'Epistemology models ontology'− In gesprek met John Polkinghorne

    African Journals Online (AJOL)

    Test

    7 Jun 2011 ... The famous premise of John Polkinghorne, 'epistemology models ontology', has been assessed in this article. It is interpreted that its logic is based on a linear trajectory of knowledge → being. Polkinghorne places much emphasis on the fact that he pursues a 'bottom-up' approach, that is, an inductive way ...

  2. The John Henry wars | Berman | Marang: Journal of Language and ...

    African Journals Online (AJOL)

    academics, the former accusing the latter of ruining the legend through endless analysis. As the title suggests, these 'wars' over this national icon unearth the subtleties of the political economy of labor, the ironies of racial identity, and the intricate relationship between folklore and fiction. Keywords:folklore, John Henry

  3. John Hick's Philosophy of Religious Pluralism in the Context of ...

    African Journals Online (AJOL)

    This article is an interpretation of John Hick's philosophy of religious pluralism in the context of traditional Yoruba religion. The ultimate goal of the article is pragmatic, viz. to provide a theoretical basis for peaceful coexistence among different religions in Nigeria. The methods adopted to achieve this objective are ...

  4. Toward a Contextual Theological Reading of John Amos Comenius

    Science.gov (United States)

    Glenn, Justin

    2016-01-01

    John Amos Comenius developed a revolutionary philosophy of education in seventeenth-century Europe. He argued for ideas such as universal education, which was virtually unheard of in his time but has become standard in modern western society. In the middle of the twentieth century, Comenius's ideas were heralded in the secular educational…

  5. Automation of library system: A study of John Harris library ...

    African Journals Online (AJOL)

    This study cover ed the automation of Circulation and OPAC operation of John Harris library, University of Benin. System analysis of the existing system was carried out; the elicited information was employed in building a web - based application programme, designed, developed a nd implemented in PHP and MySQL ...

  6. John Stuart Mill on Freedom, Education, and Social Reform.

    Science.gov (United States)

    Carbone, Peter F.

    1983-01-01

    Examines the social philosophy of John Stuart Mill, emphasizing his views on freedom, education, and social reform. Considers Mill's individualism and reformism, the conflict between freedom and control that characterizes his work, and the importance of freedom and education. Suggests caution in drawing educational implications from his work. (DAB)

  7. John Stuart Mill's Concepts of Quality and Pedagogical Norms.

    Science.gov (United States)

    Kim, Ki Su

    1986-01-01

    Considers the paradoxical relationship between two pervasive educational goals--quality and equality. Sees this paradox embedded in John Stuart Mill's writings on education, which attempted to reconcile the utilitarian pleasure principle (which emphasizes quantitative measures), with a traditional differentiation among levels and kinds of desires…

  8. How to Write About a Bumblebee--John Burroughs.

    Science.gov (United States)

    Stock, Tom

    1981-01-01

    The personal comments of literary naturalist, John Burroughs, whose 60-year writing career began in the 1860s, can guide writing teachers today. Recommended techniques include literary walks, a fermentation process between contact with nature and writing about it, emphasis on clarity and truth, and keeping a journal. (NEC)

  9. Principal Component Surface (2011) for Fish Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Fish Bay, St. John in the U.S. Virgin Islands (USVI). It was...

  10. Principal Component Surface (2011) for Coral Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.3x0.3 meter principal component analysis (PCA) surface for areas inside Coral Bay, St. John in the U.S. Virgin Islands (USVI). It was...

  11. Paratuberculosis (Johne’s Disease) in the Monkey (Macaca Mulatta),

    Science.gov (United States)

    Johne’s disease or paratuberculosis is caused by the acid-fast organism Mycobacterium paratuberculosis and is known to affect cattle, sheep and goats...IT HAS A PROLONGED COURSE CHARACTERIZED BY DIARRHEA, EMACIATION, AND EVENTUALLY DEATH. The recognition of paratuberculosis in the monkey provides

  12. Inquiry, Agency, and Art: John Dewey's Contribution to Pragmatic Cosmopolitanism

    Science.gov (United States)

    Waks, Leonard

    2009-01-01

    Cosmopolitanism in 2009 is arguably the philosophical and social counterpart of the progressivism of 1909. In this article, the author argues that John Dewey's pragmatism has (at least) two valuable lessons for the theory and practice of cosmopolitanism. After situating Dewey in the current discussion of cosmopolitanism and locating this…

  13. William Morris and John Dewey: Imagining Utopian Education

    Science.gov (United States)

    Freeman-Moir, John

    2012-01-01

    With strikingly resonance William Morris and John Dewey independently imagined what utopian education might plausibly be. Neither remotely thought of utopia as a perfectly ordered society, but rather as a process. Each understood education functionally in terms of how it fits with art, work, and democracy within a holistic conception of utopia.…

  14. John Dewey on Listening and Friendship in School and Society

    Science.gov (United States)

    Waks, Leonard J.

    2011-01-01

    In this essay, Leonard Waks examines John Dewey's account of listening, drawing on Dewey's writings to establish a direct connection in his work between listening and democracy. Waks devotes the first part of the essay to explaining Dewey's distinction between one-way or straight-line listening and transactional listening-in-conversation, and to…

  15. Russian Philosophers and Educators on the Pragmatism of John Dewey

    Science.gov (United States)

    Gorshkova, V. V.

    2015-01-01

    The article demonstrates how the views of Russian academics have evolved over time. These views cover topics from the falsification and ideological rejection of the ideas of John Dewey to the objective contextual readings and interpretations of his major works. [This article was translated by Kenneth Cargill.

  16. Scapegoat: John Dewey and the Character Education Crisis

    Science.gov (United States)

    White, Brian

    2015-01-01

    Many conservatives, including some conservative scholars, blame the ideas and influence of John Dewey for what has frequently been called a crisis of character, a catastrophic decline in moral behavior in the schools and society of North America. Dewey's critics claim that he is responsible for the undermining of the kinds of instruction that…

  17. PROGRESIVISME JOHN DEWEY DAN PENDIDIKAN PARTISIPATIF PERSPEKTIF PENDIDIKAN ISLAM

    Directory of Open Access Journals (Sweden)

    Ilun Mualifah

    2013-05-01

    Full Text Available This article discusses about participative education related to education progressivism concept by John Dewey, and then it is examined on Islamic studies perception. Participative education concept on John Dewey’s education progressivism is education concept that refers to John Dewey’s theories that bring up progressive principles. The progressive principles base on optimistic attitude on viewing the progress of learners’ learning process. The education progressivism concept by John Dewey contains participative education principles; it can be strengthened on Islamic education view that there are some compatibility aspects (especially in worldly usefulness, and there are many differences based on principles (especially in metaphysic-spiritual thing. Therefore, when Muslims will implement participative principles on Dewey’s educational concept in their life, they need to filter it based on Islamic views. If it does not contradict to Islamic views, it should be implemented on their life. Nevertheless, if it opposes Islamic views, it should not be implemented on their life (it is enough for them to know it as knowledge.

  18. John Dewey and the Challenge of Progressive Education

    Science.gov (United States)

    Waks, Leonard J.

    2013-01-01

    In "The School and Society" John Dewey noted new tendencies in education, e.g., manual training and nature study. He raised two related questions: (1) how are we to "understand the" new educational trends as reflections of the "social context"--as an "inevitable" effort to bring education into line with the broader pattern of change in industrial…

  19. Why Should Scholars Keep Coming Back to John Dewey?

    Science.gov (United States)

    Gordon, Mordechai

    2016-01-01

    This essay attempts to explain why philosophers, philosophers of education, and scholars of democracy should keep coming back to John Dewey for insights and inspiration on issues related to democracy and education. Mordechai Gordon argues that there are four major reasons that contribute to scholars' need to keep returning to Dewey for inspiration…

  20. John Knopfmacher, [Abstract] Analytic Number Theory, and the ...

    African Journals Online (AJOL)

    In this paper some important contributions of John Knopfmacher to ' Analytic Number Theory' are described. This theory investigates semigroups with countably many generators (generalized 'primes'), with a norm map (or a 'degree map'), and satisfying certain conditions on the number of elements with norm less

  1. SuchThatCast Episode 9: John Dupré

    NARCIS (Netherlands)

    Soraker, Johnny

    2013-01-01

    John Dupré is the director of the ESRC Centre for Genomics in Society and professor of philosophy at the University of Exeter. Dupré was educated at the University of Oxford and the University of Cambridge and taught at Oxford, Stanford University and Birkbeck College of the University of London

  2. John Paynter, Music Education and the Creativity of Coincidence

    Science.gov (United States)

    Finney, John

    2011-01-01

    My purpose is to develop better understanding of John Paynter's professional life and work, and by examining his pedagogic principles, discern something of the system of beliefs that underlay his commitment to finding a place for music within a system of general education. A number of significant influences are identified that bear upon his…

  3. Discursive investigation into John's internalised spirit identity and its ...

    African Journals Online (AJOL)

    2016-05-31

    May 31, 2016 ... (John 8:44–46). In the verses, Jesus castigated the Jews and naturalised their identity. For the Johannine Jesus, the. Jews – the outsiders, are ..... kingdom. Clinging to her mundane identity of being a. Samaritan, she exuded ignorance by asking invalid questions. The Johannine Jesus perceived her ...

  4. Two Cheers for Worldview: A Response to Elmer John Thiessen

    Science.gov (United States)

    Smith, James K. A.

    2010-01-01

    This article presents Smith's response to Elmer John Thiessen's review of his book "Desiring the Kingdom." Before attending to specific concerns, the author first begins with an affirmation that he shares with Thiessen: He, too, found "worldview thinking" to be revolutionary. He said he is a whole-hearted worldview convert, as it were. Smith…

  5. Discursive investigation into John's internalised spirit identity and its ...

    African Journals Online (AJOL)

    In reading the gospel of John, one gets the impression that faithful disciples, the Holy Spirit and morality are exclusively located within the Johannine community and can only permeate to the outside through the good work of the insiders – the disciples. Everything is asymmetric – morality, ideal disciples and good virtues ...

  6. The Solar Physics Observatory at Kodaikanal and John Evershed

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 11. The Solar Physics Observatory at Kodaikanal and John Evershed. D C V Mallik. General Article Volume 14 Issue 11 November 2009 pp 1032-1039. Fulltext. Click here to view fulltext PDF. Permanent link:

  7. Editorial: In defense of science—What would John do?

    Science.gov (United States)

    Gad-el-Hak, Mohamed

    2017-02-01

    Recent onslaughts on the importance of pure research to our collective well-being are trending. In this essay, I discuss the issues involved and offer a rebuttal. The thoughts are inspired by my mentor, academic sibling, and idol John Leask Lumley.

  8. John Locke: A Philosopher of Liberty or Slavery? | Hassan ...

    African Journals Online (AJOL)

    John Locke: A Philosopher of Liberty or Slavery? M Hassan. Abstract. No Abstract. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  9. Huang Zongxi's and John Locke's Rhetoric toward Modernity

    Science.gov (United States)

    Wang, Xiaobo

    2012-01-01

    Huang Zongxi was an influential seventeenth century Chinese political and social theorist who is considered by many to be the inspiration and founding father of democracy and human rights in China. This article examines the many similarities in thought and social influence between Huang and his contemporary, the English philosopher John Locke.…

  10. An Unidentified Source of John Locke's "Some Thoughts Concerning Education."

    Science.gov (United States)

    Rang, Brita

    2001-01-01

    Discusses an example of cultural exchange in the late 17th century, highlighting John Locke's ideas on education, which were formulated during his 5-year sojourn in Holland, and suggesting that Locke's ideas on education were far more influenced and stimulated by his encounters with Dutch educational literature and Dutch educational practice than…

  11. John Locke, the Individual, and the Origin of Communication.

    Science.gov (United States)

    Peters, John Durham

    1989-01-01

    Views "communication" as a product of a particular historical epoch and set of social conditions. Illustrates the birth of communication and the accompanying modern conditions and commitments by examining John Locke's linguistic and political theories. Traces Locke's commitment to the individual as master of meaning. (SR)

  12. Het slavernijverleden van John Locke : Naar een minder wit curriculum?

    NARCIS (Netherlands)

    Veraart, W.J.; Van Beers, Britta; Van Domselaar, Iris

    2017-01-01

    In this contribution I critically address the practical and theoretical attitude of the philosopher John Locke towards the trans-Atlantic slave trade and the colonial system of chattel slavery of people of African descent, in connection with the question how we should deal with the colonial context

  13. John Locke‟s Epistemology and Teachings | Jaja | African ...

    African Journals Online (AJOL)

    This paper examines the contributions of John Locke to philosophy especially his epistemology and his idea of the primacy of experience as the basis of all knowledge. For Locke, there is a clear distinction between simple and complex ideas. The paper also examines the concept of primary and secondary qualities, his ...

  14. Ovine paratuberculosis: A confirmed case of Johne's disease in Libya

    African Journals Online (AJOL)

    Paratuberculosis (Johne's disease) was suspected in a herd of approximately 033 sheep after weight loss and scouring had increased in adult animals despite repeated treatment with anthelmintics, antibiotics, multivitamins and minerals. The herd is located near Tarhouna city. Herd history revealed that a total of 60 ewes ...

  15. Linking Past and Present: John Dewey and Assessment for Learning

    Science.gov (United States)

    Kucey, Sharen; Parsons, Jim

    2017-01-01

    This collection of extracts is drawn from an article originally published in the "Journal of Teaching and Learning" (2012). It provides an important reminder to understand Assessment for Learning in depth, by relating some of its key features to aspects of John Dewey's educational and political philosophy of democratic participation.

  16. A Science of Social Work? Response to John Brekke

    Science.gov (United States)

    Shaw, Ian

    2014-01-01

    I take the opportunity provided by John Brekke's (2012) article to respond to the general assumptions and approaches that may be brought when considering the question of a science of social work. I consider first, what should be our frames of reference, our communities of interest, or our boundaries of inclusion, for such a discussion?…

  17. John Thomson: Photojournalist in Asia, 1862-1872.

    Science.gov (United States)

    Parker, Elliott S.

    John Thomson was a nineteenth-century British photojournalist who used the wet-plate process to illustrate his explorations of eastern and Southeast Asia. His travels from 1862 to 1872 took him to the following places, among others: Ceylon, Cambodia, Singapore, Thailand, Saigon, Siam, mainland China, and Taiwan. Thomson chose to use the wet-plate…

  18. In memoriam: John Warren Aldrich, 1906-1995

    Science.gov (United States)

    Banks, Richard C.

    1997-01-01

    John Aldrich was born in Providence, Rhode Island, on 23 February 1906, and went to the Providence public schools. He developed a broad interest in natural history at an early age, being stimulated by his mother, a kindergarten teacher, who introduced him to nature books. His interest was strengthened by Harold L. Madison, Director of the Park Museum in Providence, an Associate ( = member) of the AOU. As a high school student, John taught nature study at the Rhode Island Boy Scout Camp in summers. John was President of his class at Classical High School, and manager of the school's football team in his senior year. Also in that year, 1923, John published his first paper, a note in Bird-Lore on the occurrence of the Mockingbird in Rhode Island. That paper is a literary gem, showing that his skill in writing developed as early as his knowledge of birds. His early interest in football continued as well; he was a devoted fan of the Washington Redskins in his later years.

  19. Building the Engaged Campus: An Interview with John Brooks Slaughter.

    Science.gov (United States)

    Maeda, Donna

    1999-01-01

    Interview with John Brooks Slaughter, recent president of Occidental College, focuses on his leadership during a period when the college dramatically increased its minority enrollment, recruited an impressively diverse faculty, and launched various community outreach programs. Explores Slaughter's views concerning diversity as part of a college's…

  20. John McGahern's stylistic and narratological art

    DEFF Research Database (Denmark)

    Nørgaard, Nina; Busse, Beatrix; McIntyre, Dan

    2010-01-01

    The Irish writer John McGahern is acknowledged as a master stylist in both his novels and his short stories. In this article we discuss the stylistic and narratological factors that contribute to the artistry in McGahern’s short story writing. We analyse three stories: “A Slip-up”, “All Sorts...

  1. SuchThatCast Episode 8: John Sutton

    NARCIS (Netherlands)

    Soraker, Johnny

    2013-01-01

    John Sutton is Professor of Cognitive Science at Macquarie University in Sydney, Australia. He is currently head of the same department, having previously also been head of the Macquarie Philosophy department. He is author of Philosophy and Memory Traces:Descartes to Connectionism (Cambridge

  2. 10. O Olawoyin John Hick Pluralism in the Traditional Yoruba ...

    African Journals Online (AJOL)

    REGINALDS

    Introduction. The role of religions in many of today's conflicts has galvanized scholars of religion to find a way of interpreting the apparent conflicting truth claims of various religions that lead to mistrust. Many hypotheses have been suggested to reconcile these conflicting truth claims. John Harwood Hick's philosophy of ...

  3. John Dewey's Democracy and Education: A British Tribute

    Science.gov (United States)

    Higgins, Steve, Ed.; Coffield, Frank, Ed.

    2016-01-01

    In 1916 John Dewey published "Democracy and Education: An introduction to the philosophy of education". In this book some of today's foremost historians, philosophers, psychologists, and sociologists of education mark the anniversary of Dewey's work by reviewing and reflecting, from a British perspective, on Dewey's contribution to our…

  4. Faith of a novelist : religion in John Galsworthy's work

    NARCIS (Netherlands)

    Knoester, Maarten Willem

    2006-01-01

    Most readers are familiar with the British author John Galsworthy (1867-1933) through his The Forsyte Saga (1922), A Modern Comedy (1929) and The End of the Chapter (1934). He wrote many other novels as well, and in his own times he was also known as a leading dramatist. Literary criticism and

  5. 'Epistemology models ontology'− In gesprek met John Polkinghorne ...

    African Journals Online (AJOL)

    The famous premise of John Polkinghorne, 'epistemology models ontology', has been assessed in this article. It is interpreted that its logic is based on a linear trajectory of knowledge → being. Polkinghorne places much emphasis on the fact that he pursues a 'bottom-up' approach, that is, an inductive way of going about ...

  6. John Osborne's Theatre in the Teaching and Learningof the English ...

    African Journals Online (AJOL)

    John Osborne's Theatre in the Teaching and Learningof the English Working Class Culture. ... compares and contrasts the language of the working-class protagonist, Jimmy Porter, with that of his middle-class wife and mother in-law, and concludes with the examination of the functional aspect of Jimmy Porter's grammar.

  7. John McCarthy–Father of Artificial Intelligence

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 3. John McCarthy – Father of Artificial Intelligence. V Rajaraman. General Article Volume 19 Issue 3 March 2014 pp 198-207. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/019/03/0198-0207 ...

  8. Collected works of John Tate part I (1951--1975)

    CERN Document Server

    Tate, John; Serre, Jean-Pierre

    2016-01-01

    In these volumes, a reader will find all of John Tate's published mathematical papers-spanning more than six decades-enriched by new comments made by the author. Included also is a selection of his letters. His letters give us a close view of how he works and of his ideas in process of formation.

  9. ON THE TRAIL OF JOHN CALVIN'S PHILOSO- PHY OF LANGUAGE ...

    African Journals Online (AJOL)

    best suit the structure of a Festschrift for this gifted, soft-spoken scholar, an ana- logy struck my mind. Some years ago I had the opportunity of suggesting a few building blocks of John Calvin's philosophy of language at the 6th. South African Congress for Calvin Research (August 2000, Potchefstroom). 1. Prof. N.T. van der ...

  10. Siim Nestor soovitab : Orelipoiss. John Maus / Siim Nestor

    Index Scriptorium Estoniae

    Nestor, Siim, 1974-

    2007-01-01

    Orelipoisi ehk Jaan Pehki debüütalbumi "99" esitlusest 20. dets. Tallinna klubis Juuksur ja 21. dets. Tartus Genialistide klubis (plaadimuusikat valib Vaiko Eplik). 21. dets. Tallinnas Kultuurikatlas (Madara 22) sündmusel Mutionu "krill" pidu esineb artist John Maus, harfimängija Liis Jürgens, Wannabe Swen ja DJdena Aivar Tõnso ning Estrada

  11. Calvyn se institusie as handboek vir John Knox

    Directory of Open Access Journals (Sweden)

    V. E. D'Assonville

    1969-06-01

    Full Text Available Hoewel John Knox, die Skotse Hervormer oor die algemeen beskou word as 'n calvinis, is daar tot op die huidige datum nog baie onsekerheid en selfs verwarring oor die omvang en die nadere bepaling hiervan. Veral oor die eerste jare van sy optrede, vanaf 1547 tot 1554 toe hy vir die eerste keer Calvyn in Genéve ontmoet het.

  12. Memories of John N. Brady: scientist, mentor and friend

    Directory of Open Access Journals (Sweden)

    Marriott Susan J

    2009-05-01

    Full Text Available Abstract Friends and colleagues remember John N. Brady, Ph.D., Chief of the Virus Tumor Biology Section of the Laboratory of Cellular Oncology, who died much too young at the age of 57 on April 27, 2009 of colon cancer. John grew up in Illinois and received his Ph.D. with Dr. Richard Consigli at Kansas State University studying the molecular structure of polyomavirus. In 1984 John came to the National Institutes of Health as a Staff Fellow in the laboratory of Dr. Norman Salzman, Laboratory of Biology of Viruses NIAID, where he was among the first to analyze SV40 transcription using in vitro transcription systems and to analyze regulatory sequences for SV40 late transcription. He then trained with Dr. George Khoury in the Laboratory of Molecular Virology NCI, where he identified SV40 T-antigen as a transcriptional activator protein. His research interests grew to focus on the human retroviruses: human T-cell lymphotropic virus type I (HTLV-I and human immunodeficiency virus (HIV, analyzing how interactions between these viruses and the host cell influence viral gene regulation, viral pathogenesis and viral transformation. His research also impacted the fields of eukaryotic gene regulation and tumor suppressor proteins. John is survived by his wife, Laraine, and two sons, Matt and Kevin.

  13. Thoughts on Teaching: John L. Lewis, Jesus, and President Bush.

    Science.gov (United States)

    Starnes, Bobby Ann

    2004-01-01

    Bobby Ann Starnes, the author of this article, grew up with portraits of two important people displayed prominently in her home, Jesus, and John L. Lewis. Lewis, a giant among American leaders in the first half of the twentieth century, sent hundreds of organizers to help create some of the nation's leading labor unions, including the United…

  14. Chirp Seismic-Reflection data from the John Day Reservoir

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — A two-week field operation was conducted in the John Day Reservoir on the Columbia River to image the floor of the pool, to measure the distribution and thickness of...

  15. Orthophoto Mosaic (2012) for Coral Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This 0.3x0.3 meter imagery mosaic of Coral Bay, St. John in the U.S. Virgin Islands was created by the National Oceanic and Atmospheric Administration (NOAA) using a...

  16. Orthophoto Mosaic (2012) for Fish Bay, St. John

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This 0.3x0.3 meter imagery mosaic of Fish Bay, St. John in the U.S. Virgin Islands was created by the National Oceanic and Atmospheric Administration (NOAA) using a...

  17. Cuidado humanizado de enfermería según la teoría de Jean Watson, servicio de medicina del Hospital Daniel Alcides Carrión. Lima- Callao, 2015.

    OpenAIRE

    Guerrero-Ramírez, Rosa; Meneses-La Riva, Mónica Elisa; De La Cruz-Ruiz, María

    2017-01-01

    El Cuidado Humanizado es una necesidad que urge en la práctica profesional y esto se evidencia en las políticas, disposiciones normativas establecidas por las entidades de salud que velan por el derecho de los pacientes y garantizan la calidad del servicio que se brinda. Objetivo: determinar el Cuidado Humanizado que brinda el profesional deEnfermería según la Teoría de Jean Watson, Servicio de Medicina del Hospital Daniel Alcides Carrión. Material y métodos: la población total estuvo conform...

  18. The manifesto as genre in Ibsen's John Gabriel Borkman

    Directory of Open Access Journals (Sweden)

    Christine Korte

    2015-02-01

    Full Text Available This article examines John Gabriel Borkman’s neo-aristocratic performance of power and authority in Ibsen’s eponymously titled play (1896. After his downfall, John Gabriel has retreated into his once grand reception hall wherein he has become like a petrified relic from a preceding era. His performance within the “fading glory” of the upstairs hall– a veritable theatre for his delusions of grandeur – is one of an outmoded type of bourgeois “hero” whose flagrantly illicit dealings are no longer tenable as capitalism becomes ever-more “rational” and bureaucratic in its façade. The article focuses on John Gabriel’s performance of a “sovereign” or charismatic authority and examines his future visions as “manifestos”. The manifesto is a form belonging to a feudal era of rule by divine right – one that is necessarily “theatrical” in its performance of a legitimate authority. Assuming the voice of the sovereign, John Gabriel attempts to address the needs of the iron-ore miners – a desiring, albeit latent force in Ibsen’s text. The desires of the workers, however, are continually effaced by the bewitching powers of capitalist abstraction, which account for the alienation of family and individuals in Ibsen’s play.   Comparing John Gabriel’s manifesto with Marx and Engels’ Communist Manifesto not only accounts for the end of an age of neo-aristocratic bourgeois decadence, but also marks labour as the definitive socio-political issue of the late 19th century. Where John Gabriel uses a dramaturgy rooted in past models of rule to address the workers in his vision of a benevolent “kingdom”, the Communist Manifesto heralds the death of his class and replaces the voice of the “sovereign authority” with the self-authorising voice of the workers themselves. Borkman’s fatal flaw then is failing to sufficiently address the plight of the iron-ore miners with whom he claims intimate acquaintance but with whom

  19. Distribution and Quantity of Sites of John Cunningham Virus Persistence in Immunologically Healthy Patients: Correlation With John Cunningham Virus Antibody and Urine John Cunningham Virus DNA.

    Science.gov (United States)

    Berger, Joseph R; Miller, Craig S; Danaher, Robert J; Doyle, Kathryn; Simon, Kenneth J; Norton, Elizabeth; Gorelik, Leonid; Cahir-McFarland, Ellen; Singhal, Divya; Hack, Nawaz; Owens, Joseph Ryan; Nelson, Peter T; Neltner, Janna H

    2017-04-01

    Although seroepidemiological studies indicate that greater than 50% of the population has been infected with John Cunningham virus (JCV), the sites of JCV persistence remain incompletely characterized. To determine sites of JCV persistence in immunologically healthy individuals. Tissue specimens from multiple sites including brain, renal, and nonrenal tissues were obtained at autopsy performed in the Department of Pathology at the University of Kentucky from 12 immunologically healthy patients between February 9, 2011, and November 27, 2012. Quantitative polymerase chain reaction was performed on the tissue specimens and urine. Serum JCV antibody status was determined by enzyme-linked immunosorbent assay. The detection and quantification of JCV from the tissues by quantitative polymerase chain reaction illuminated sites of viral persistence. These results were correlated with JCV antibody levels. Autopsies were performed on 12 individuals, 10 men and 2 women, ranging in age from 25 to 75 years (mean, 55.3 years). Seven of 12 individuals were JCV antibody seropositive based on absorbance units. Serostatus was associated with amounts of JCV DNA in urine and its tissue distribution. John Cunningham virus DNA was found in 75% of genitourinary tissue samples from donors (18 of 24) with high JCV antibody levels, 13.3% of donors with low levels i(4 of 30), and 0% of seronegative persons (0 of 32). In nongenitourinary tissues, JCV DNA was detected in 45.1% of tissue samples of donors (32 of 71) with high JCV, 2.2% of donors with low JCV serostatus (2 of 93), and 0% of seronegative persons (0 of 43). Genitourinary tissues had higher copy numbers than other sites. John Cunningham virus DNA was detected in urine of seronegative individuals in a research-grade assay. Persistent (latent or actively replicating) JCV infection mostly predominates in genitourinary tissues but distributes in other tissues at low copy number. The distribution and copy numbers of the virus appear to

  20. A brief history of Mt John and a tribute to Frank Bateson's involvement in Mt John's development

    Science.gov (United States)

    Hearnshaw, John

    2005-03-01

    In this article I will summarize the contribution that Frank Bateson made to establishing the observatory at Mt John in the 1960s. I will go on to note the main developments at the observatory between its foundation and the present time.

  1. John Kjaer : Nõukogude Liitu ja euroliitu seob vaid sõna "liit" / John Kjaer ; interv. Tuuli Koch

    Index Scriptorium Estoniae

    Kjaer, John

    2003-01-01

    Euroopa Komisjoni delegatsiooni juht Eestis John Kjaer vastab küsimustele, mis puudutavad Edgar Savisaare kõnet Keskerakonna kongressil, kus ta võrdles NSV Liitu Euroopa Liiduga; peamisi erinevusi EL-i ja totalitaarriigi vahel, otsuste langetamise põhimõtteid EL-is

  2. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Nietzsche, autobiography, history: mourning and Martin and John.

    Science.gov (United States)

    Champagne, J

    1998-01-01

    How might gay and lesbian literature be read not as a mimetic representation of homosexuality, but as an activity linked to problems of subjectivity and historiography? Reading Dale Peck's novel Martin and John alongside passages from Friedrich Nietzsche's "On the Uses and Disadvantages of History for Life" and Sigmund Freud's "Mourning and Melancholia," this essay argues for an understanding of Peck's text as an attempt to link two apparently different processes of import to contemporary gay male subjects in particular: the writing of what Nietzsche terms "critical history," and the mourning of those lost to HIV disease. It concludes by linking Martin and John to feminist critiques of identity and traditional historiography, as well as noting the connection between these two critiques.

  4. John Bowlby and ethology: an annotated interview with Robert Hinde.

    Science.gov (United States)

    Bowlby, John

    2007-12-01

    From the 1950s, John Bowlby, one of the founders of attachment theory, was in personal and scientific contact with leading European scientists in the field of ethology (e.g., Niko Tinbergen, Konrad Lorenz, and especially Robert Hinde). In constructing his new theory on the nature of the bond between children and their caregivers, Bowlby profited highly from their new approach to (animal) behavior. Hinde and Tinbergen in their turn were influenced and inspired by Bowlby's new thinking. On the basis of extensive interviews with bowlby's colleague and lifelong friend Robert Hinde and on the basis of archival materials, both the relationship between John Bowlby and Robert Hinde and the cross-fertilization of ethology and attachment theory are described.

  5. Caruso St.John and Robert Smithson: Interferences

    Directory of Open Access Journals (Sweden)

    Emilia Hernández Pezzi

    2016-05-01

    Full Text Available Intersecting points of view are the common theme of this issue of Cuadernos. The protagonists of our proposed point of intersection are the artist Robert  Smithson and the architects Adam Caruso and Peter St. John. Caruso and St. John refer to the North American artist’s work in order to explain their  remodeling project of Stortorget, the town square around the baroque  cathedral in the center of Kalmar, Sweden. With this idea as a starting point, we explore the work and the concerns of both the artist and the architects which allows us to describe convergences and harmonies of processes despite their thematic, ideological, and stylistic differences.

  6. John Scott Haldane: The father of oxygen therapy

    OpenAIRE

    K. C. Sekhar; SSC Chakra Rao

    2014-01-01

    John Scott Haldane was a versatile genius who solved several problems of great practical significance. His ability to look beyond the laboratory and investigate theory added crucial findings in the field of respiratory physiology. His work on high altitude physiology, diving physiology, oxygen therapy, and carbon monoxide poisoning led to a sea change in clinical medicine and improved safety and reduced mortality and morbidity in many high risk situations.

  7. John Freeman: entrepreneurship and innovation defined--a personal remembrance

    OpenAIRE

    Jerome S. Engel; David J. Teece

    2012-01-01

    This article is a personal remembrance by the authors, of John Freeman's transition from being a scholar on organization theory to an active contributor to entrepreneurship research, teaching and mentoring. The article reflects on Freeman's work on organizational ecology and entrepreneurship, as faculty director of the Lester Center for Entrepreneurship and Innovation at the University of California, Berkeley, as he turned the focus of the Center to new venture formation. The article narrates...

  8. John Wesley se Aldersgate-ervaring: 'n Herwaardering

    African Journals Online (AJOL)

    I felt I did trust in Christ, Christ alone for salvation; and an assurance was given me that he had taken away my sins, even mine, and saved me from the law of sin and death'. 948 ..... As hy in 1765 hieroor aan John Newton skryf, voeg hy daar by: 'And I am still persuaded, this is what the Lord Jesus hath bought for me with his ...

  9. Sir John Herschel and the Stability of Saturn's Ring

    CERN Document Server

    Whiting, Alan B

    2011-01-01

    In a pioneering exposition of mathematical astronomy for the public, Sir John Herschel attributed the stability of the ring of Saturn to its being eccentric with respect to the planet and lopsided (asymmetric in mass) by a minute amount. Tracing the sources and effects of this error reveals several lessons of general relevance to science: on the formulation and interpretation of calculations, the use of cutting-edge observations and the combining of observations with theory. I emphasise the phenomenon of reinforcing errors.

  10. Sustaining Reliability on Accountability Measures at The Johns Hopkins Hospital.

    Science.gov (United States)

    Pronovost, Peter J; Holzmueller, Christine G; Callender, Tiffany; Demski, Renee; Winner, Laura; Day, Richard; Austin, J Matthew; Berenholtz, Sean M; Miller, Marlene R

    2016-02-01

    In 2012 Johns Hopkins Medicine leaders challenged their health system to reliably deliver best practice care linked to nationally vetted core measures and achieve The Joint Commission Top Performer on Key Quality Measures ®program recognition and the Delmarva Foundation award. Thus, the Armstrong Institute for Patient Safety and Quality implemented an initiative to ensure that ≥96% of patients received care linked to measures. Nine low-performing process measures were targeted for improvement-eight Joint Commission accountability measures and one Delmarva Foundation core measure. In the initial evaluation at The Johns Hopkins Hospital, all accountability measures for the Top Performer program reached the required ≥95% performance, gaining them recognition by The Joint Commission in 2013. Efforts were made to sustain performance of accountability measures at The Johns Hopkins Hospital. Improvements were sustained through 2014 using the following conceptual framework: declare and communicate goals, create an enabling infrastructure, engage clinicians and connect them in peer learning communities, report transparently, and create accountability systems. One part of the accountability system was for teams to create a sustainability plan, which they presented to senior leaders. To support sustained improvements, Armstrong Institute leaders added a project management office for all externally reported quality measures and concurrent reviewers to audit performance on care processes for certain measure sets. The Johns Hopkins Hospital sustained performance on all accountability measures, and now more than 96% of patients receive recommended care consistent with nationally vetted quality measures. The initiative methods enabled the transition of quality improvement from an isolated project to a way of leading an organization.

  11. John Tyndall and the Royal Medal that was never struck

    Science.gov (United States)

    Jackson, Roland

    2014-01-01

    Just once in its long history has a Royal Medal been awarded but not presented. John Tyndall FRS (1820–93) was the chosen recipient in 1853 for his early work on diamagnetism but declined to accept it. The story of why Tyndall felt compelled to turn down this considerable honour sheds light on the scientific politics and personal relationships of the time, on the importance given to the study of magnetism, and on Tyndall's own character and career. PMID:24921107

  12. JOHN STUART MILL'İN FAYDACI AHLKI

    OpenAIRE

    Aydın, Metin

    2014-01-01

    Utilitarianism, systematised by Jeremy Bentham (1748–1832) in 18th century, is a theory having strong effects in many different areas from economy and ethics to politic and law especially in England and geopraphies in which anglo-saxon culture reigns. John Stuart Mill (1806 – 1873) reinterpreted Utilitrianism which was inherited from Bentham, in the context of critics of utilitarianism and his own thoughts. In this essay, Mill’s utilitarianism will be examined. In this context, I will discuss...

  13. John Scott Haldane: The father of oxygen therapy

    Directory of Open Access Journals (Sweden)

    K C Sekhar

    2014-01-01

    Full Text Available John Scott Haldane was a versatile genius who solved several problems of great practical significance. His ability to look beyond the laboratory and investigate theory added crucial findings in the field of respiratory physiology. His work on high altitude physiology, diving physiology, oxygen therapy, and carbon monoxide poisoning led to a sea change in clinical medicine and improved safety and reduced mortality and morbidity in many high risk situations.

  14. Interview with Antony John Kunnan on Language Assessment

    OpenAIRE

    Vahid Nimehchisalem

    2015-01-01

    Antony John Kunnan is a language assessment specialist. His research interests are fairness of tests and testing practice, assessment literacy, research methods and statistics, ethics and standards, and language assessment policy. His most recent publications include a four-volume edited collection of 140 chapters titled The Companion to Language Assessment (Wiley, 2014), a four-volume set of 75 previously published papers titled Language Testing and Assessment (Routledge, 2014) and Talking a...

  15. Musica come divenire. Il paesaggio sonoro secondo John cage

    Directory of Open Access Journals (Sweden)

    Francesca Aste

    2008-12-01

    Full Text Available John Cage ha dedicato tutta la sua vita all’indagine delle possibilità di relazione dell’uomo con i suoni che lo circondano, allargando il campo dell’arte musicale a quello dell’etica e dell’ecologia. Cage non si è occupato di soundscape come un genere compositivo specifico, come forse oggi potremmo identificarlo, tuttavia l’ambiente occupa un ruolo centrale in relazione al suo modo di comporre.

  16. John Herschel and the Cape flora, 1834 - 1839.

    Science.gov (United States)

    Rourke, J. P.

    John Herschel's interest in botany was stimulated by his contact with the species-rich Cape flora while resident in Cape Town, 1834 - 1838. The comparative study of his extensive living collection of bulbous plants, mainly of the Iridaceae, Liliaceae, Amarayllidaceae and Orchidaceae led him to consider some basic aspects of the origin of species and of taxonomic theory, in letters to colleagues in Europe.

  17. Nineteenth-century America through the Eyes of John Gennadius

    OpenAIRE

    Marianna D. Christopoulos

    2015-01-01

    The aim of this article is to unfold and analyze the view of America held by John Gennadius [Ioannis Gennadios], one of the most important diplomats of nineteenthcentury Greece. Having spent most of his life in England as a member of the Greek legation, which he served for more than 20 years, Gennadius was influenced by the ongoing British discussion of the “American miracle”. His perception was, however, fostered during two visits to America, a professional one (1888) and a pr...

  18. Patterning Your Department After Great Leaders: John D. Rockefeller

    OpenAIRE

    Loborec, Steven M.; Weber, Robert J.

    2015-01-01

    Learning through the examples of great leaders can provide pharmacy directors with guidance on how to shape their leadership style. John D. Rockefeller was one of the most successful businessmen in the world, and he is highly regarded as having been a great leader. His example of having the courage of his convictions will be necessary as pharmacy faces drastic changes ahead in pharmacy provider status and practice model changes. His management of his staff serves as an excellent example of th...

  19. A memoir of Sir John Forbes (1787-1861).

    Science.gov (United States)

    Agnew, Robin

    2014-11-01

    The 150th anniversary of the death of Sir John Forbes passed on 13 November 2011 perhaps unnoticed except in his native land. This memoir is an attempt to remind the medical profession of some of his achievements and of the value of percussion and auscultation in the bedside diagnosis of diseases of the heart and lungs. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  20. MANUSIA DAN PENDIDIKAN MENURUT PEMIKIRAN IBN KHALDUN DAN JOHN DEWEY

    Directory of Open Access Journals (Sweden)

    T. Saiful Akbar

    2015-02-01

    Full Text Available This study aims to understand the concept of human and Ibn Khaldun's ideas of education; to understand the concept of human and educational thought of John Dewey; to know the similarities and differences between the ideas of Ibn Khaldun and John Dewey on the concept of human and education. Various problems have been addressed through the library research method. The study produced several findings: First, human beings according to Ibn Khaldun as a creation of God with all the potential fitted to the five senses and intellect become intellect. The purpose of education opens the mind and maturity of the individual to the advancement of religious, industrial and social system. Material teaching is as educational planning. The method is to advocate phasing method, repetition, widya-tours and training (practice. Secondly, according to John Dewey man is a subject that has the ability, strength, personality, and existence who are capable of changing realities. The goal of education is only to gain happiness in the world life. The method of education is including problem solving, learning by doing and discipline. Third, the thought of Ibn Khaldun is much more religious because it is influenced by its control logic in religious knowledge, so that emphazises more on human spirituality in building civilization. While John Dewey is more radical and extreme, He proposed progressive education which strives against traditional teaching authority. Both Ibn Khaldūn dan Dewey are arise from inhuman socio-cultural environment and recognize the existence of human existence with nature and humanity impulse.

  1. Topical application of St. John's wort (Hypericum perforatum).

    Science.gov (United States)

    Wölfle, Ute; Seelinger, Günter; Schempp, Christoph M

    2014-02-01

    St. John's wort (Hypericum perforatum) has been intensively investigated for its antidepressive activity, but dermatological applications also have a long tradition. Topical St. John's wort preparations such as oils or tinctures are used for the treatment of minor wounds and burns, sunburns, abrasions, bruises, contusions, ulcers, myalgia, and many others. Pharmacological research supports the use in these fields. Of the constituents, naphthodianthrones (e.g., hypericin) and phloroglucinols (e.g., hyperforin) have interesting pharmacological profiles, including antioxidant, anti-inflammatory, anticancer, and antimicrobial activities. In addition, hyperforin stimulates growth and differentiation of keratinocytes, and hypericin is a photosensitizer which can be used for selective treatment of nonmelanoma skin cancer. However, clinical research in this field is still scarce. Recently, sporadic trials have been conducted in wound healing, atopic dermatitis, psoriasis, and herpes simplex infections, partly with purified single constituents and modern dermatological formulations. St. John's wort also has a potential for use in medical skin care. Composition and stability of pharmaceutical formulations vary greatly depending on origin of the plant material, production method, lipophilicity of solvents, and storage conditions, and this must be regarded with respect to practical as well as scientific purposes. Georg Thieme Verlag KG Stuttgart · New York.

  2. The Urgency for Peace in Teachings of John Paul II

    Directory of Open Access Journals (Sweden)

    Jerzy Lewandowski

    2014-04-01

    Full Text Available Peace has always been a topic of great importance. Its presence is desired by all nations and societies. It brings the world together in unity. John Paul II considered peace to be an integral part in creation of an independent and healthy society. Papal encyclicals and messages, intended to present the response of the teaching Church to problems that arise from time to time, often dwell on the principles that advocate peace. Since freedom and peace are in many cases a privilege for many nations, the mentioned pope commits himself to speak about the cruelty and evilness of wars and national conflicts. Pope John Paul II denounces intolerance as denial of freedom for many people, and consequently a great threat to peace. The pope teaches that peace has its roots in the family. Yet, in many societies, the family is deprived of the utmost importance that it certainly deserves. Without the adequate means for a decent livelihood, families can experience hardship in committing themselves to promote solidarity and a proper social fabric worthy of human dignity. For John Paul II, a nation’s freedom and peace are safeguarded and promoted through particular attention and a much-devoted effort by strong and healthy families.

  3. Vanguard aspects in John Cage’s music

    Directory of Open Access Journals (Sweden)

    VINICIUS CRANEK GAGLIARDO

    2013-01-01

    Full Text Available This paper aims to establish some relations between the European artistic vanguards, such as Surrealism and Dadaism, and John Cage’s musical pieces. More specifically, I will try to present some of the characteristics of these vanguard movements that persisted in the work of the American composer. To do this, I will consider the ideals of Expressionism – height moment of aestheticism –, from the book Theory of Vanguard, by Peter Bürger, and the study of Jorge de Almeida, Crítica dialética em Theodor Adorno, reflecting on its relationship with subsequent vanguard manifestations in order to provide a better understanding of the common characteristics of the vanguard movements in the first half of the Twentieth Century. In this analysis, I will discuss the concepts of vanguard, art institution and work of art. Then, I will map some aspects of the John Cage’s work, relating it to the avant-garde ideas presented earlier. In short, I intend to demonstrate, at the end of these reflections, the avant-garde project for the art in the Twentieth Century and the manifestation of the elements of this project in the John Cage’s poetic.

  4. John M. T. Finney: distinguished surgeon and Oslerphile.

    Science.gov (United States)

    Stone, Marvin J

    2016-01-01

    John Finney (1863-1942) was born near Natchez, Mississippi. After receiving his medical degree from Harvard, he interned at Massachusetts General Hospital and then went to Baltimore to become one of the first interns at the new Johns Hopkins Hospital. He met William Osler the day the hospital opened and became a lifelong admirer of "the Chief." Finney specialized in gastrointestinal surgery and was recognized for his expertise in the field. Osler recommended Finney to a physician colleague, writing, "You could not be in better hands…. Finney has been most successful and his judgment is so good." Finney served for 33 years under William Halsted at Hopkins. After Halsted's death, Finney was offered the chair of surgery at Johns Hopkins but declined. He was a founder and first president of the American College of Surgeons. He also served as president of the American Surgical Association and the Society of Clinical Surgery. Finney became chief surgical consultant for the Allied Expeditionary Forces in World War I. He was decorated by the United States, France, and Belgium. Finney was a master surgeon and a role model for generations of students and physicians.

  5. The ethical implications of 2 John 10�11

    Directory of Open Access Journals (Sweden)

    Jan van der Watt

    2015-03-01

    Full Text Available The imperative in 2 John 10�11 not to receive a visitor with a false doctrine into one�s house is one of the most controversial prohibitions in the New Testament, especially in light of the commandment of love, ancient hospitality conventions, and modern-day expectations of open discussion. This raises the question what this prohibition is specifically about and whether hospitality is really asked for. This question is considered in some detail in this article. A widely held view is that the prohibition in 2 John 10 is not in line with generally accepted Christian ethics, since it militates against the attitude of love, care, and hospitality. This view is dominant in commentaries. This article aims at countering this view by proposing that the issue is not hospitality but endangering the identity and tradition of the group. This should be regarded as a positive Christian value.Intradisciplinary and/or interdisciplinary implications: I challenge theological readings of 2 John 10�11 that regard the text as unchristian in its exhortation. The results of the research show that hospitality is not the communicative centre of the text, but protection of the group, which was a common feature, not only in Christianity, but also in the ancient world in general. The future discourse should now move from focusing on moral issues related to hospitality to issues related to preserving tradition within a religion.

  6. 78 FR 42972 - Notice of Intent To Collect Fees on the John Day River, Oregon

    Science.gov (United States)

    2013-07-18

    ... Bureau of Land Management Notice of Intent To Collect Fees on the John Day River, Oregon AGENCY: Bureau... (River Mile 157) to Tumwater Falls (River Mile 10) stretch of the John Day River, between Service Creek, Oregon, and the confluence of the John Day River and the Columbia River, Oregon. The John Day River...

  7. 77 FR 59962 - John Heinz National Wildlife Refuge at Tinicum, DE and Philadelphia Counties, PA; Final...

    Science.gov (United States)

    2012-10-01

    ... Fish and Wildlife Service John Heinz National Wildlife Refuge at Tinicum, DE and Philadelphia Counties... significant impact (FONSI) for John Heinz National Wildlife Refuge at Tinicum (John Heinz NWR, refuge) in... requests to [email protected] . Include ``John Heinz NWR Final CCP'' in the subject line of your...

  8. Aspectos vanguardistas na música de John Cage * Vanguard aspects in John Cage’s music

    Directory of Open Access Journals (Sweden)

    VINICIUS CRANEK GAGLIARDO

    2013-08-01

    Full Text Available Resumo: Este artigo tem por objetivo estabelecer algumas relações entre as vanguardas artísticas europeias, como o surrealismo e o dadaísmo, e as peças musicais de John Cage. De modo mais específico, procurarei apresentar algumas das características destes movimentos de vanguarda que ainda persistiram na obra do compositor norte-americano. Para isso, a partir do livro Teoria da Vanguarda, de Peter Bürger, e do estudo de Jorge de Almeida, Crítica dialética em Theodor Adorno, retomarei os ideais do Expressionismo – momento auge do esteticismo –, refletindo sobre sua relação com as manifestações vanguardistas subsequentes, no intuito de proporcionar uma melhor compreensão das características comuns aos movimentos de vanguarda da primeira metade do século XX. Nesta análise, discutirei os conceitos de vanguarda, instituição arte e obra de arte. Em seguida, mapearei alguns aspectos da obra de John Cage, relacionando-a com os ideais vanguardistas apresentados anteriormente. Em suma, pretendo evidenciar, ao final dessas reflexões, o projeto vanguardista para a arte no século XX e a manifestação de elementos deste projeto na poética de John Cage.Palavras-chave: John Cage – Vanguarda – Arte. Abstract: This paper aims to establish some relations between the European artistic vanguards, such as Surrealism and Dadaism, and John Cage’s musical pieces. More specifically, I will try to present some of the characteristics of these vanguard movements that persisted in the work of the American composer. To do this, I will consider the ideals of Expressionism – height moment of aestheticism –, from the book Theory of Vanguard, by Peter Bürger, and the study of Jorge de Almeida, Crítica dialética em Theodor Adorno, reflecting on its relationship with subsequent vanguard manifestations in order to provide a better understanding of the common characteristics of the vanguard movements in the first half of the Twentieth Century

  9. John Banister: um cirurgião elisabetano no Brasil John Banister: an Elizabethan surgeon in Brazil

    Directory of Open Access Journals (Sweden)

    Amílcar D'Avila de Mello

    2011-03-01

    Full Text Available Na história quinhentista do Brasil, são muito raras as referências aos profissionais da saúde. Na expedição de Edward Fenton, despachada pela Coroa inglesa em 1582 para fundar um entreposto comercial na Ásia, vinha o famoso cirurgião-barbeiro e físico (médico John Banister. Desviada da sua rota original para repetir os feitos de Francis Drake, a esquadra fez escala na África, atravessou o Atlântico e ancorou no litoral catarinense. Nessas águas, a expedição degenerou em ações piráticas e retornou fracassada à Europa. John Banister é considerado aquele que libertou a anatomia inglesa da sua escravidão medieval, lançando sobre ela a luz do Renascimento. Foi a primeira vez que alguém dessa envergadura na área da saúde visitava estas latitudes.In Brazil's sixteenth-century history, very few references are made to health professionals. On the expedition of Edward Fenton, dispatched by the English Crown in 1582 to set up a trading post in Asia, was the famous barber-surgeon and physician John Banister. The naval squadron, diverted from its original route to repeat the feats of Sir Francis Drake, stopped over in Africa, crossed the Atlantic and anchored off the Santa Catarina coast in Brazil. In these waters, the expedition degenerated into piracy and returned unsuccessful to Europe. John Banister is considered the person who liberated English anatomy from mediaeval slavery, shedding upon it the light of the Renaissance. It was the first time that anyone of this importance in the area of health had visited these latitudes.

  10. UNIVERSAL MAN: The Seven Lives of John Maynard Keynes

    Directory of Open Access Journals (Sweden)

    Criatian Uta

    2016-12-01

    Full Text Available John Maynard Keynes was one of the most influential personalities of the twentieth century. It is considered one of the creators of what today we call Macroeconomics. He played an important role during the Bretton Woods Conference in 1944, after which were put up substantial postwar financial institutions such as the World Bank and International Monetary Fund. The economic policy measures he proposed prevailed in the first decades after World War II and saw a revival in recent years due to the financial crisis of 2008-2009. His works on economics have seen many editions and have been translated into most languages.

  11. Deconstruction as Interpretative Strategy. John Sallis’ Reading of Nietzsche

    Directory of Open Access Journals (Sweden)

    Bondor George

    2004-06-01

    Full Text Available In this paper I shall discuss deconstruction as interpretative strategy. In this respect, I shall start by analysing John Sallis’ reading of a section from Nietzsche’s Twighlight of the Idols. Sallis tries to reveal the spacings of reason, and their consequences on the distinction between „true world” and „apparent world”. Though I apply deconstructive strategy on some other sections of Nietzsche’s work, namely: „The Problem of Socrates” and „How the True World finally became a Fable”.

  12. A new demonology : John Keel and The Mothman Prophecies

    OpenAIRE

    Clarke, David

    2016-01-01

    An early interest in Fortean phenomena led John Keel (1930-2009) to investigate at first hand UFO experiences the US Midwest from 1966. His findings were reported in a series of books and articles that were published during the so-called ‘occult revival’ of the 1970s. Today many Fortean scholars regard him as being one of the most influential and controversial figures in the history of UFOlogy. Keel rejected the popular Extra-terrestrial Hypothesis (ETH) as an explanation for the UFO phenomen...

  13. John Dury, reformer of education against the radical challenge

    Directory of Open Access Journals (Sweden)

    Mario Caricchio

    2010-01-01

    Full Text Available I see not how Gods way to salvation can be said to be manyJohn Dury has regularly featured in the religious and intellectual histories of the British seventeenth century in the last sixty years. His figure has mainly been constructed around three overlapping images: the irenic champion, the educational forerunner, and the utopian type of a Puritan ‘Great Instauration’. Studies focussed at first on his irenic mission to reconcile the Protestant churches throughout Europe. Then, following the r...

  14. John Deweys pædagogik som filosofisk livskunst

    DEFF Research Database (Denmark)

    Dræby, Anders

    De senere år har der været forøget fokus på John Deweys slægtskab med antikkens filosofiske tradition. Oplægget stiller i den forbindelse skarpt på spørgsmålet om, hvorvidt og hvordan det giver mening at forstå Deweys pædagogiske filosofi i sammenhæng med Hellenismens og Romerrigets filosofiske...... livskunst. Er det med andre ord muligt at begribe Deweys pædagogik som en særlig form for filosofisk livskunst?...

  15. John Dewey's pragmatist alternative to the belief-acceptance dichotomy.

    Science.gov (United States)

    Brown, Matthew J

    2015-10-01

    Defenders of value-free science appeal to cognitive attitudes as part of a wedge strategy, to mark a distinction between science proper and the uses of science for decision-making, policy, etc. Distinctions between attitudes like belief and acceptance have played an important role in defending the value-free ideal. In this paper, I will explore John Dewey's pragmatist philosophy of science as an alternative to the philosophical framework the wedge strategy rests on. Dewey does draw significant and useful distinctions between different sorts of cognitive attitudes taken by inquirers, but none can be used to support the wedge strategy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. An annotated bibliography of works by John Beard.

    Science.gov (United States)

    Moss, Ralph W

    2008-12-01

    This article provides a bibliography of the scientific publications of John Beard, DSc (1858-1924). Beard was an English embryologist and cancer researcher of the late 19th and early 20th century, who devised the trophoblastic theory of cancer, a forerunner of today's theory of cancer stem cells. Beard was the author of more than 100 scientific articles and monographs, as well as the book The Enzyme Treatment of Cancer (1911). This is the first bibliography ever compiled of his scientific publications.

  17. John Walkenbach's Favorite Excel 2010 Tips and Tricks

    CERN Document Server

    Walkenbach, John

    2010-01-01

    Build robust Excel 2010 apps quickly and efficiently. Known as "Mr. Spreadsheet," John Walkenbach's name is synonymous with excellence in computer books that explain the complexities of various topics. With this collection of favorite Excel tips and tricks, you get a unique look at ways to make Excel 2010 more efficient than you ever imagined. Packed with easy-to-understand advice regarding all aspects of Excel, this book shares improved ways of speeding up application development with Excel and maximizing the power of Excel to create robust applications.: Addresses the extensive cha

  18. The John Zink Hamworthy combustion handbook, v.1 fundamentals

    CERN Document Server

    Baukal, Charles E

    2012-01-01

    Despite the length of time it has been around, its importance, and vast amounts of research, combustion is still far from being completely understood. Environmental, cost, and fuel consumption issues add further complexity, particularly in the process and power generation industries. Dedicated to advancing the art and science of industrial combustion, The John Zink Hamworthy Combustion Handbook, Second Edition: Volume One - Fundamentals gives you a strong understanding of the basic concepts and theory. Under the leadership of Charles E. Baukal, Jr., top combustion engineers and technologists f

  19. John S. Bell on the foundations of quantum mechanics

    CERN Document Server

    Bell, John S; Gottfried, Kurt; Veltman, Martinus J G

    2001-01-01

    This book is the most complete collection of John S Bell's research papers, review articles and lecture notes on the foundations of quantum mechanics. Some of this material has hitherto been difficult to access. The book also appears in a paperback edition, aimed at students and young researchers. This volume will be very useful to researchers in the foundations and applications of quantum mechanics. Contents: (1) On the Problem of Hidden Variables in Quantum Mechanics; (2) On the Einstein-Podolsky-Rosen Paradox; (3) The Moral Aspect of Quantum Mechanics; (4) Introduction to the Hidden-Variabl

  20. VIP interview: John D. (Jay) Rockefeller IV, United States Senator.

    Science.gov (United States)

    Rockefeller, J D

    1994-01-01

    John D. (Jay) Rockefeller IV has proudly served the people of West Virginia for nearly 30 years. After coming to the town of Emmons in 1964 as a VISTA worker, Jay Rockefeller made the Mountain State his home. In 1966, he was elected to a two-year term in the West Virginia House of Delegates. He then served four years as Secretary of State, three years as President of West Virginia Wesleyan College, and eight years as Governor of West Virginia. In 1984, he was elected to the United States Senate and was reelected in 1990.

  1. A conversation with John W. Tukey and Elizabeth Tukey

    OpenAIRE

    Fernholz, Luisa T.; Morgenthaler, Stephan

    2000-01-01

    John Wilder Tukey, Donner Professor of Science Emeritus at Princeton University, was born in New Bedford, Massachusetts, on June 16,1915. After earning bachelor’s and master’s degrees in chemistry at Brown University in 1936 and 1937, respectively, he started his career at Princeton University with a Ph.D.in mathematics in 1939 followed by an immediate appointment as Henry B.Fine Instructor in Mathematics. A decade later, at age 35, he was advanced to a full professorship. H...

  2. John Singleton Copley and the World of Prints

    Directory of Open Access Journals (Sweden)

    Jules David Prown

    2016-04-01

    Full Text Available John Singleton Copley (1738–1815 is known for his painted portraits of colonial Americans (oils, pastels, and miniatures and his English history pictures, but the relationship between Copley and prints is relatively obscure. Yet he was involved with prints throughout his career and beyond, from his earliest exposure to art in the Boston studio of his stepfather to the sale four years after his death of his collection of around 1,125 prints by and after old master and contemporary artists, and many engravings after his own paintings.

  3. Recognizing the Stranger: Recognition Scenes in the Gospel of John

    DEFF Research Database (Denmark)

    Larsen, Kasper Bro

    Recognizing the Stranger is the first monographic study of recognition scenes and motifs in the Gospel of John. The recognition type-scene (anagnōrisis) was a common feature in ancient drama and narrative, highly valued by Aristotle as a touching moment of truth, e.g., in Oedipus’ tragic self......-discovery and Odysseus’ happy homecoming. The book offers a reconstruction of the conventions of the genre and argues that it is one of the most recurrent and significant literary forms in the Gospel. When portraying Jesus as the divine stranger from heaven, the Gospel employs and transforms the formal and ideological...

  4. Frederic Andrews Gibbs and the assassination of John Fitzgerald Kennedy

    Directory of Open Access Journals (Sweden)

    Kalyan B Bhattacharyya

    2017-01-01

    Full Text Available Frederic Gibbs, the peerless expert on electroencephalogrphy was summoned to provide opinion on the EEG tracing of Jack Ruby, who murdered Lee Harvey Oswald, the assassin of John Fitzgerald Kennedy, the American President, in 1963. Gibbs pleaded that the tracing suggested features indicative of psychomotor epilepsy and Ruby killed Oswald in a state of fugue. His view was not agreed upon but Gibbs stood his ground unflinchingly. Subsequent appeals to the higher court spared Ruby from imminent execution and finally he died a natural death from metastatic complications of carcinoma of the lung in 1967.

  5. Tradition and reality in John Fowles’s poetry

    Directory of Open Access Journals (Sweden)

    Drozdova Maria Sergeevna

    2017-10-01

    Full Text Available The paper focuses on reception in John Fowles’s poetry of the 1950s and 60s. The paper deals with the form and stylistics of the poems and their intertextuality, i.e. allusions and reminiscences to his predecessors’ works. The basic methods are those of reception-aesthetics and literary hermeneutics. The present paper is based on E.V. Abramovskikh’s theory and typology of creative reception developed by the author of the paper. The author analyzes creative reception strategies in Fowles’s poetry and draws a conclusion on the interaction of tradition and reality in it.

  6. The English Crown and the election of Pope John XXII

    OpenAIRE

    Bombi, Barbara

    2017-01-01

    This article investigates the involvement of Edward II in the negotiations that led to John XXII's election on 7 August 1316 after a two-year papal vacancy between 1314 and 1316. The main source for this analysis is a dossier of sixteen diplomatic documents, found among the Chancery records in The National Archives in London. The article concludes that Edward II tried to exploit the papal vacancy as a means to re-establish his international profile and seek support abroad in order to face opp...

  7. Música y sensación sonora: John Tavener

    Directory of Open Access Journals (Sweden)

    Alvarado, Boris

    2014-12-01

    Full Text Available This article aims to examine the act of sound sensation in John Tavener Work (1944-2013 following the idea of logic of sensation created by Gilles Deleuze (1925-1995 and phenomenology of the body Xavie Zubiri (1898-1983. Through the concepts of from both philosophers it might be possible to draw the sound experience of vibration that proposes the sacred art of minimalism in the Anglo- Saxon composer.Lo que busca este artículo es investigar el bello y difícil acto de la sensación sonora de la obra de John Tavener (1944-2013 a la luz de una lógica de la sensación de Gilles Deleuze (1925-1995 y de la fenomenología del cuerpo de Xavie Zubiri (1898-1983. Creemos que con los conceptos acuñados por ambos filósofos pueden dar cuenta de un modo más acabado de ese estilo único de la experiencia sonora en la vibración que propone el arte sacro de la música minimal del compositor anglosajón.

  8. John Rawls: a economia moral da justiça

    Directory of Open Access Journals (Sweden)

    Hermano Roberto Thiry-Cherques

    2011-12-01

    Full Text Available Neste texto, descrevo como o filósofo norte-americano John Rawls reformulou o pensamento moral contemporâneo, ao propor a subordinação da ética à justiça. Resumo a defesa que apresentou para uma moral fundada em um pacto que compensasse, sem tentar anulá-las, as assimetrias econômico-sociais do mundo em que vivemos. Concluo com uma discussão sobre as dificuldades teóricas que encontrou para absorver o pluralismo cultural, filosófico, político e religioso do Ocidente.In this article I describe how the North-American philosopher John Rawls has reformulated contemporary moral thinking in proposing subordination of ethics to justice. I synthesize his defense of a morality based on an agreement that compensates, without attempting to nullify, current socio-economic asymmetries. I conclude with a discussion of the theoretical difficulties he encountered in absorbing cultural, philosophical, political and religious Western pluralism in his theory.

  9. Epidemiology in Ethiopia 200 years after John Snow's birth.

    Science.gov (United States)

    Enquselassie, Fikre

    2013-10-01

    The year 2013 marks exactly 200 years since John Snow, known as the father of modern epidemiology, was born. In 19th century, epidemiologists like John Snow, concentrated almost entirely upon infectious diseases of humans measuring the burden of disease, describing pattern and attempting to understand the transmission dynamics. During the second half of the 20th century; big changes occurred so that epidemiologists in the developed world started to use systematized approaches to investigate the etiologies, conditions and to evaluate interventions through different study designs. However, the situation in the developing world is not the same as the rest of the world. Even 200 years after Snow's birth, epidemiological capacity is lowest in Africa. This article attempts to describe that Ethiopia is not exceptional. In the past few decades, there have been some attempts to build capacity in the country by launching training programs in clinical epidemiology, general epidemiology and field epidemiology. However, not only few epidemiologists are trained, but, limited funding, high-teaching burdens, poor working conditions and low salaries are among important contributors for epidemiological brain drain in Ethiopia. Thus, strengthening learning opportunities and rewarding career paths are required to increase human resource capacity and retain skilled personnel in the field of epidemiology.

  10. John Rawls\\'s Constructivism & the Theory of Constructional Perceptions

    Directory of Open Access Journals (Sweden)

    M Zamani

    2010-03-01

    Full Text Available John Rawls, American contemporary philosopher, has chosen the title of constructivism for his views on philosophy of ethics and politics. The base of his veiws is the same as the theory of social contract which has been discussed before by John Locke and Imanuel Kant. Rawls completes this view by the condition of impartiality and fairness , which is distinguished by ignorance about the position of self (the veil of ignorance in primary situation. Rawls criticises intutionism and utilitarianism and holds an antirealistic approach towards ethics . The theory that has been delivered by Allame Tabatabee (the constructional perception caused agreements and disagreements, but his idea seems to be new and effective in Islamic philosophy. Based on this idea many conceptions are constructive including goodness , badness and justice. The aim of this paper is to analyse and give a comparison between these ideas and studies similarities and differences with regard to topics such as antirealism, objectivity, criteria of justification and separation of science and ethics.

  11. John Locke och familjens makt över uppfostran

    Directory of Open Access Journals (Sweden)

    Christer Hedin

    2007-01-01

    Full Text Available JOHN LOCKE AND THE POWER OF THE FAMILY OVER EDUCATION. Who deserves author-ity over education? Plato was convinced that it was the state. Locke insisted onthe family. Mill, from his own hard-won experience, was convinced that theindividual should have more influence than the family. Of course, childrenhad to be compelled to learn basics; otherwise their freedom would be re-duced. John Locke lived in a time of growing capital formation. He defendedthe right of ownership as a fundamental human right. According to him, itfollowed from the right to life. Property was created through work, and workwas a way of using life. Parents had to have the decisive influence on educa-tion. They needed to be convinced that their heirs would manage their inher-itance in a responsible way. Locke is regarded as a father of democracy. How-ever, it can hardly be claimed that he was a promoter of democracy in educa-tion. His defence of private property led him to ascribe so much power overeducation to parents that individual rights were substantially curtailed.

  12. John Rawls's Constructivism & the Theory of Constructional Perceptions

    Directory of Open Access Journals (Sweden)

    M. Zamani

    2010-01-01

    Full Text Available John Rawls, American contemporary philosopher, has chosen the title of constructivism for his views on philosophy of ethics and politics. The base of his veiws is the same as the theory of social contract which has been discussed before by John Locke and Imanuel Kant. Rawls completes this view by the condition of impartiality and fairness , which is distinguished by ignorance about the position of self (the veil of ignorance in primary situation. Rawls criticises intutionism and utilitarianism and holds an antirealistic approach towards ethics . The theory that has been delivered by Allame Tabatabee (the constructional perception caused agreements and disagreements, but his idea seems to be new and effective in Islamic philosophy. Based on this idea many conceptions are constructive including goodness , badness and justice. The aim of this paper is to analyse and give a comparison between these ideas and studies similarities and differences with regard to topics such as antirealism, objectivity, criteria of justification and separation of science and ethics.

  13. John Tweedie and Charles Darwin in Buenos Aires.

    Science.gov (United States)

    Ollerton, Jeff; Chancellor, Gordon; van Wyhe, John

    2012-06-20

    The journey of exploration undertaken by Charles Darwin FRS during the voyage of HMS Beagle has a central place within the historical development of evolutionary theory and has been intensively studied. Despite this, new facts continue to emerge about some of the details of Darwin's activities. Drawing on recently published Darwin material and unpublished letters in the archives of the Royal Botanic Gardens, Kew, we document a hitherto unexamined link between Darwin and John Tweedie (1775-1862), a relatively obscure Scottish gardener turned South American plant collector. All of the available evidence points to a meeting between the two men in Buenos Aires in 1832. Tweedie provided Darwin with information about the geography of the Rio Paraná, including the locality of fossilized wood eroding from the river bank. It also seems likely that Tweedie supplied Darwin with seeds that he later shipped back to John Stevens Henslow in Cambridge. Although this brief meeting was at the time relatively unimportant to either man, echoes of that encounter have resonated with Tweedie's descendants to the present day and have formed the basis for a family story about a written correspondence between Darwin and Tweedie. Local information supplied to Darwin by residents such as Tweedie was clearly important and deserves further attention.

  14. The art of science: interview with Professor John Archibald Wheeler

    CERN Document Server

    Bičák, Jiři

    2011-01-01

    During the conference on the methods of differential geometry in physics in Warsaw in June 1976, Professor Wheeler gave an interview for the Czechoslovak Journal of Physics A. After Professor Wheeler authorized the English version in January 1977, the Czech translation was published in \\v{C}eskoslovensk\\'y \\v{c}asopis pro fyziku A (1978) and soon afterwards the Polish translation appeared in Postepy fizyky. After John Wheeler's recent death it occurred to me that it would now be appropriate to publish the original interview from 1976 so that it would not be lost to English readers; and so, despite being more than 30 years old, the interview appeared in the special issue on quantum gravity of "General Relativity and Gravitation" dedicated to the memory of J. A. Wheeler. John Wheeler would now surely add more about black holes in nuclei of galaxies, not mentioning just Cygnus X-1, when discussing cosmology he would undoubtedly address the problem of dark energy etc. However, in the conversation about Einstein a...

  15. Chemical evaluations of John F. Baldwin Ship Channel sediment

    Energy Technology Data Exchange (ETDEWEB)

    Word, J.Q.; Kohn, N.P.

    1990-09-01

    In October 1989, the Battelle/Marine Sciences Laboratory (MSL) conducted sampling, geological characterization, and chemical evaluation studies on sediment from a proposed ship channel in San Francisco Bay, California. This channel extends from the San Francisco Bar, through San Pablo Bay, into Carquinez Strait, and on to Sacramento. The 1989 study area included a 28-mile-long portion of the John F. Baldwin Ship Channel that extended from West Richmond to and including Carquinez Strait. The objective of our study was to determine physical characteristics and chemical contaminant levels in sediment to the proposed project depth of {minus}45 ft mean lower low water (MLLW) (plus 2 ft of overdepth). Sediment core samples were collected at 47 locations throughout the John F. Baldwin Ship Channel using a vibratory hammer core sampler. Ten of these locations were from West Richmond, 29 from San Pablo Bay, and 8 from Carquinez Strait. The geological properties of sediment core samples were described, the sediment from the cores was composited into 72 separate samples based on those descriptions, and chemical analyses were conducted of 13 metals, 16 polynuclear aromatic hydrocarbons (PAH), 18 pesticides, 7 PCBs, 3 butyltins, and 4 conventional sediment chaacteristics. These data were then compared with sediment values from Oakland and Richmond harbors, reference values from Point Reyes fine- and coarse-grained sediments, and from typical shale sediment. 22 refs., 23 figs., 10 tabs.

  16. The contributions of John Money: a personal view.

    Science.gov (United States)

    Bullough, Vern L

    2003-08-01

    John Money has been a dominant voice in sexology in the last part of the 20th century, breaking new ground in a wide variety of areas. In the process, he has been cantankerous, outspoken, and ever willing to do battle, but also original and thought provoking. This paper begins with an examination of science in general, moves on to psychology and sexology, and then examines Money s contributions to sexology in some detail. The latter are many and varied, including the development of the concept of gender, his theory of gender identity based on his work with intersex individuals, the John-Joan case, and his importance in establishing transsexualism as a diagnostic category and an academic discipline. Also important are his contributions to the development of the nomenclature of sexology, his importance to the sexology movement as a teacher, his significant research on a large variety of sexual topics, his ability to convince government agencies that sex was deserving of funding, and his association with the Erickson Educational Foundation. He also was a significant figure in the development of the Society for the Scientific Study of Sexuality (SSSS) and in raising the standard of its journal (The Journal of Sex Research), and therefore it is only fitting that an award be named after him. Though Money remains controversial, he has contributed significantly to the development of sexology as a discipline.

  17. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  18. Computational Fluid Dynamics Modeling of the John Day Dam Tailrace

    Energy Technology Data Exchange (ETDEWEB)

    Rakowski, Cynthia L.; Perkins, William A.; Richmond, Marshall C.; Serkowski, John A.

    2010-07-08

    US Army Corps of Engineers - Portland District required that a two-dimensional (2D) depth-averaged and a three-dimensional (3D) free-surface numerical models to be developed and validated for the John Day tailrace. These models were used to assess potential impact of a select group of structural and operational alternatives to tailrace flows aimed at improving fish survival at John Day Dam. The 2D model was used for the initial assessment of the alternatives in conjunction with a reduced-scale physical model of the John Day Project. A finer resolution 3D model was used to more accurately model the details of flow in the stilling basin and near-project tailrace hydraulics. Three-dimensional model results were used as input to the Pacific Northwest National Laboratory particle tracking software, and particle paths and times to pass a downstream cross section were used to assess the relative differences in travel times resulting from project operations and structural scenarios for multiple total river flows. Streamlines and neutrally-buoyant particles were seeded in all turbine and spill bays with flows. For a Total River of 250 kcfs running with the Fish Passage Plan spill pattern and a spillwall, the mean residence times for all particles were little changed; however the tails of the distribution were truncated for both spillway and powerhouse release points, and, for the powerhouse releases, reduced the residence time for 75% of the particles to pass a downstream cross section from 45.5 minutes to 41.3 minutes. For a total river of 125 kcfs configured with the operations from the Fish Passage Plan for the temporary spillway weirs and for a proposed spillwall, the neutrally-buoyant particle tracking data showed that the river with a spillwall in place had the overall mean residence time increase; however, the residence time for 75% of the powerhouse-released particles to pass a downstream cross section was reduced from 102.4 min to 89 minutes.

  19. L’éthique à l’écran. Compte-rendu de What’s Good on TV? – Understanding Ethics Through Television, de Jamie Watson et Robert Arp, et de Seeing the Light – Exploring Ethics Through Movies, de Wanday Teays

    Directory of Open Access Journals (Sweden)

    Zaffran, Marc

    2012-11-01

    Full Text Available What’s Good on TV ? – Understanding Ethics Through Television by Jamie Watson and Robert Arp, and Seeing the Light – Exploring Ethics Through Movies by Wanday Teays, undertake each in their own way to show the interest of audiovisual fictions – film and television – for teaching ethics.

  20. The teacher taught? What Charles Darwin owed to John Lubbock

    Science.gov (United States)

    Pearn, Alison

    2014-01-01

    The period around the publication of John Lubbock's Origin of civilisation in 1870 and Charles Darwin's Descent of man and selection in relation to sex the following year is key to a re-evaluation of the relationship between the two men, usually characterized as that of pupil and master. It is in the making of Descent that Lubbock's role as a scientific collaborator is most easily discerned, a role best understood within the social and political context of the time. Lubbock made Darwin—both the man and his science—acceptable and respectable. Less obvious is Darwin's conscious cultivation of Lubbock's patronage in both his private and public life, and Lubbock's equally conscious bestowal, culminating in his role in Darwin's burial in Westminster Abbey.

  1. John Freind: physician, chemist, Jacobite, and friend of Voltaire's.

    Science.gov (United States)

    Rowlinson, J S

    2007-05-22

    John Freind (1675/76-1728) achieved distinction in several walks of life, first as a classical scholar, then as a physician and as a chemist who advocated Newtonian philosophy. His clinical practice was generally conservative and he was against the newly introduced practice of inoculating the smallpox. His principles were Tory and High Church; his loyalty to the house of Stuart involved him in the Jacobite plot of 1722, and a spell in the Tower of London. His money was part of the foundation of Dr Lee's benefaction to Christ Church, which still survives in name in scientific posts in Oxford. He was among the circle of friends that Voltaire formed during his two-year stay in England and, 50 years later, Voltaire took him and his son as the principal characters in a conte philosophique defending a deistic attitude against both atheism and revealed religion.

  2. John Browne (1642-1702): anatomist and plagiarist.

    Science.gov (United States)

    Loukas, Marios; Akiyama, Matthew; Shoja, Mohammadali M; Yalçin, Bulent; Tubbs, R Shane; Cohen-Gadol, Aaron A

    2010-01-01

    In contrast to many other physicians of his age, John Browne (1642-1702), an English anatomist and surgeon, managed to strike a balance in his career that spanned relative obscurity, prestige, and notoriety. Among his more prestigious credits, Browne was Surgeon in Ordinary to King Charles II and William III. He also had numerous publications to his name, some of which are credited as great innovations. His career, however, was tempered by his most important book, which has been critiqued by his contemporaries as well as modern historians as plagiarism. Although Browne undeniably copied the works of others and published them under his name, he was not alone in this practice. Various forms of intellectual thievery were common in Browne's day, and there were many perpetrators. The life of this overlooked figure in the history of anatomy and the stigma attached to him will be examined.

  3. An interview with John Dewey on science education

    Science.gov (United States)

    Ansbacher, Ted

    2000-04-01

    Sooner or later almost all physics teachers are forced by the evidence to conclude that students do not attain understanding of concepts by listening to lectures — no matter how lucid they may be. A more fruitful alternative, which many teachers have arrived at independently, actively involves the students, starting with their own experiences and guiding them from there, through observation and reasoning, towards knowledge with understanding. There is great value in tracing the history of this educational thread: it confirms that the ideas have deep roots and have stood the test of time; it provides clues to the troubling question of why,! ! if this approach is so good, it is still not widely practiced; and, more importantly, it allows new thinking to start from "the shoulders of giants" rather than at ground level. One of these giants is John Dewey.

  4. John Ambrose Fleming and the Beginning of Electronics

    Energy Technology Data Exchange (ETDEWEB)

    Fred Dylla; Steve Corneliussen

    2004-11-01

    2004 was the centenary of John Ambrose Fleming's momentous patent on the thermionic diode that can be called the birth of electronics. The ''Edison effect'' was discovered in 1882; this was later shown to be the result of thermionic emission of electrons from a heated filament into a vacuum. Edison did not make any significant devices based on this discovery, and the effect was ignored for more than 8 years. In 1890 Fleming explained the effect and showed that the thermionic diode could be used as a rectifier. Fourteen years later Fleming filed his 1904 patent on the thermionic diode. It was the first public announcement of the electron tube; this revolutionized the development of radio and led to the invention of the thermionic triode by Lee de Forest in 1906. The background to these events will be described.

  5. ¿Es posible matizar el individualismo de John Locke?

    Directory of Open Access Journals (Sweden)

    Diego A. Fernández Peychaux

    2012-04-01

    Full Text Available El interrogante del que este artículo pretende dar cuenta es si el individualismo de John Locke responde a la radicalidad con la que la corriente de interpretación más difundida intenta caracterizarlo. La conclusión que se alcanza luego de una amplia presentación de pruebas textuales, es que la necesaria matización del individualismo se deriva de la insistencia del autor en justificar el origen divino de los derechos y deberes. De este modo, en la medida en que se niegue que los hombres disponen de un derecho irrefrenable a seguir su deseo de autopreservación, es posible concluir que el Estado no existe para resguardar esos presuntos derechos individuales, sino para restaurar la ley de naturaleza que ya no sirve, como debería, para determinar los derechos y deberes de los hombres.

  6. Natural Law And Civil Law in John Locke

    Directory of Open Access Journals (Sweden)

    Gustavo Hessmann Dalaqua

    2015-01-01

    Full Text Available This paper deals with the relationship between natural law and civil law in John Locke’s philosophy. Although renowned scholars have claimed that such a relationship is deductive, this paper will try to show a different interpretation and argue that the relationship between civil law and natural law is one of determination. Far from being a mere deduction of an immutable natural law, civil law plays a determinative role in natural law. As we shall see, this interpretation highlights something that Locke held in high regard: the deliberative character of natural law. Citizens’ deliberation in the legislature to some extent creates natural law. Citizens are thus free to determine the law, and participating in such a determination is crucial to their political liberty. In this sense, as we shall explain, Locke’s political liberty is akin to republicanism.

  7. John Locke and the case of Anthony Ashley Cooper.

    Science.gov (United States)

    Anstey, Peter R; Principe, Lawrence M

    2011-01-01

    In June 1668 Anthony Ashley Cooper, later to become the 1st Earl of Shaftesbury, underwent abdominal surgery to drain a large abscess above his liver. The case is extraordinary, not simply on account of the eminence of the patient and the danger of the procedure, but also because of the many celebrated figures involved. A trove of manuscripts relating to this famous operation survives amongst the Shaftesbury Papers in the National Archives at Kew. These include case notes in the hand of the philosopher John Locke and advice from leading physicians of the day including Francis Glisson, Sir George Ent and Thomas Sydenham. The majority of this material has never been published before. This article provides complete transcriptions and translations of all of these manuscripts, thus providing for the first time a comprehensive case history. It is prefaced with an extended introduction.

  8. John Locke's seed lists: a case study in botanical exchange.

    Science.gov (United States)

    Harris, Stephen A; Anstey, Peter R

    2009-12-01

    This paper gives a detailed analysis of four seed lists in the journals of John Locke. These lists provide a window into a fascinating open network of botanical exchange in the early 1680s which included two of the leading botanists of the day, Pierre Magnol of Montpellier and Jacob Bobart the Younger of Oxford. The provenance and significance of the lists are assessed in relation to the relevant extant herbaria and plant catalogues from the period. The lists and associated correspondence provide the main evidence for Locke's own important, though modest contribution to early modern botany, a contribution which he would have regarded as a small part of the broader project of constructing a natural history of plants. They also provide a detailed case study of the sort of open and informal network of knowledge exchange in the early modern period that is widely recognised by historians of science, but all too rarely illustrated.

  9. St. Thomas Aquinas and John Locke on Natural Law

    Directory of Open Access Journals (Sweden)

    Ginna M. Pennance-Acevedo

    2017-06-01

    Full Text Available John Locke’s natural law theory has frequently been conceived as a continuation of the Thomistic tradition and as sound basis for human rights as universally binding. This paper concludes that this is not the case. Unlike Aquinas’ metaphysical realism, Locke’s empiricism and nominalism make it impossible for us to know our human nature, our exclusively human goods, and telos—thereby undermining the sound foundations of the exceptionless moral precepts of natural law. Whereas Aquinas defines the good as that which is perfective and fulfilling of human nature, Locke identifies the good with pleasure, which leads to subjectivism. While both Aquinas and Locke argue that God is the origin and foundation of the binding force of natural law, Locke’s voluntarism is incompatible with the ruling nature of law. Consequently, unlike Aquinas, Locke’s theory lacks the metaphysical foundations for universal human rights.

  10. ¿Es posible matizar el individualismo de John Locke?

    Directory of Open Access Journals (Sweden)

    Diego A. Fernández Peychaux

    2011-12-01

    Full Text Available El interrogante del que este artículo pretende dar cuenta es si el individualismo de John Locke responde a la radicalidad con la que la corriente de interpretación más difundida intenta caracterizarlo. La conclusión que se alcanza luego de una amplia presentación de pruebas textuales, es que la necesaria matización del individualismo se deriva de la insistencia del autor en justificar el origen divino de los derechos y deberes. De este modo, en la medida en que se niegue que los hombres disponen de un derecho irrefrenable a seguir su deseo de autopreservación, es posible concluir que el Estado no existe para resguardar esos presuntos derechos individuales, sino para restaurar la ley de naturaleza que ya no sirve, como debería, para determinar los derechos y deberes de los hombres.

  11. John Hewitt: Creating a Canon of Ulster Art’

    Directory of Open Access Journals (Sweden)

    Riann Coulter

    2013-12-01

    Full Text Available This article explores the role of John Hewitt (1907 – 87 in attempting to articulate a distinctive artistic and cultural identity for Ulster from the middle of the twentieth century. Focusing on Hewitt’s interpretation of the visual arts, this essay examines the ways in which he acted as a curator and advocate for particular artists who he felt embodied his sense of a regional style of art for Ulster. Hewitt’s work is contextualised by a broader discussion of ideas of national and regional identity following the Second World War, and also by the increasingly visible avant-garde centres of artistic development in places such as London and New York.

  12. John Milton: Puritan Tradition and Political Languages in XVIIth Century

    Directory of Open Access Journals (Sweden)

    Laura MITAROTONDO

    2015-06-01

    Full Text Available It is not simple to place John Milton in a specific political current of the English historical context of 17th century. In detail, we want to study Milton’s prose works to extract the topics of the English civic and political tradition in the First Revolution age. In these terms, we’ll analyze the Commonplace Book, a collection of commentaries about texts and authors, and about various subjects: the interpretations of Machiavelli in the Old English tradition of the Modern age, the idea of man’s freedom and his relationship with natural law and political authority, according to the general perspective of the Puritan religion, which characterizes Milton’s political language.

  13. Workshop held at Johns Hopkins University, March 2013

    CERN Document Server

    2013-01-01

    Cyber-physical systems (CPS) involve deeply integrated, tightly coupled computational and physical components. These systems, spanning multiple scientific and technological domains, are highly complex and pose several fundamental challenges. They are also critically important to society’s advancement and security. The design and deployment of the adaptable, reliable CPS of tomorrow requires the development of a basic science foundation, synergistically drawing on various branches of engineering, mathematics, computer science, and domain specific knowledge.   This book brings together 19 invited papers presented at the Workshop on Control of Cyber-Physical Systems, hosted by the Department of Electrical & Computer Engineering at The Johns Hopkins University in March 2013. It highlights the central role of control theory and systems thinking in developing the theory of CPS, in addressing the challenges of cyber-trust and cyber-security, and in advancing emerging cyber-physical applications ranging from s...

  14. O discurso psicológico de John Dewey

    Directory of Open Access Journals (Sweden)

    ERIKA NATACHA FERNANDES DE ANDRADE

    2013-01-01

    Full Text Available Este artículo analiza el discurso del filósofo y educador norteamericano John Dewey (1859- 1952 sobre el tema “naturaleza humana”, y adopta como referencia el libro Human nature and conduct: an introduction to Social Psychology. En ese libro, publicado en 1922, Dewey discute los conceptos fundamentales de la psicología - el instinto, el hábito, la inteligencia y otros - y propone una nueva ciencia psicológica; sus elaboraciones cubren los campos de la filosofía, la psicología y la educación. La metodología para el análisis del discurso sigue los estudios desarrollados por el Grupo de Investigación “Retórica y argumentación en la Pedagogía” que se basan en las teorías de Chaim Perelman y Stephen Toulmin.

  15. John Stewart Bell and twentieth century physics vision and integrity

    CERN Document Server

    Whitaker, Andrew

    2016-01-01

    John Stewart Bell (1928-1990) was one of the most important figures in twentieth-century physics, famous for his work on the fundamental aspects of the century's most important theory, quantum mechanics. While the debate over quantum theory between the supremely famous physicists, Albert Einstein and Niels Bohr, appeared to have become sterile in the 1930s, Bell was able to revive it and to make crucial advances - Bell's Theorem or Bell's Inequalities. He was able to demonstrate a contradiction between quantum theory and essential elements of pre-quantum theory - locality and causality. The book gives a non-mathematical account of Bell's relatively impoverished upbringing in Belfast and his education. It describes his major contributions to quantum theory, but also his important work in the physics of accelerators, and nuclear and elementary particle physics.

  16. Patterning Your Department After Great Leaders: John D. Rockefeller.

    Science.gov (United States)

    Loborec, Steven M; Weber, Robert J

    2015-03-01

    Learning through the examples of great leaders can provide pharmacy directors with guidance on how to shape their leadership style. John D. Rockefeller was one of the most successful businessmen in the world, and he is highly regarded as having been a great leader. His example of having the courage of his convictions will be necessary as pharmacy faces drastic changes ahead in pharmacy provider status and practice model changes. His management of his staff serves as an excellent example of the importance of staff retention programs. As health systems strive to do more with less, it is now more important than ever to scrutinize using resources and apply Rockefeller's attention to efficiency and effectiveness when growing patient-centered pharmacy services.

  17. Byzantine kalophonia, illustrated by St. John Koukouzeles’ piece

    Directory of Open Access Journals (Sweden)

    Maria Alexandru

    2012-01-01

    Full Text Available The present paper explores some aspects of the so-called kalophonic musical style which flourished during the last centuries of Byzantium. It focuses on a masterpiece by St. John Koukouzeles, namely the epibole Φρούρησον πανένδοξε (Ο Allglorious, keep watch over the city, in honor of St. Demetrios, the protector of Thessaloniki, and is complementary to some previous musicological analysis of this piece by Stephania Meralidou. After a brief presentation of the old sticheron Ἔχει μὲν ἡ θειοτάτη σου ψυχή, whereof St. John takes his departing point for the kalophonic composition, the paper concentrates on a multi-level analysis of the epibole, firstly on the ground of the late middle-Byzantine notation, according to the ms Vlatadon 46 (A.D. 1551, and secondly by comparing the old notation to its slow exegesis in new-Byzantine notation by Chourmouzios Chartophylax (score and recording issued by the Greek Byzantine Choir, dir. L. Angelopoulos.The analysis comprises several approaches like textual, music-architectural, modal, micro-syntactical, rhetorical, macro-syntactical, generative, comparative (cf. plates 7-12, 17-20. Since this material is also suitable for didactic purposes, the different plates are given again in the appendix, in form of exercises to be filled in by interested students.The different analytical approaches reveal the highly refined melodic fabric of kalophonia with its plethora of theseis-combinations, the extensive use of music-rhetorical devices, basic norms of the complex art of musical exegesis in this style, as well as the beauty of this kind of melodies, which have been acknowledged to represent the ‘zenith’ of Byzantine music (Wellesz.

  18. Decentred Centre in John Fowles’s The Magus

    Directory of Open Access Journals (Sweden)

    Aleks Matosoğlu

    2015-12-01

    Full Text Available Decentred Centre in John Fowles’sThe Magus Abstract John Fowles’ The Magus (1966 has been the focus of criticism for many years. This study regards the character of Conchis as a decentred “centre” in the structure of the novel and as in the experience of the contemporary humanity. Conchis becomes in the eyes of Nicholas an all-knowing figure, an accumulation of Western thought since the Greek civilization. He produces signs to be read as he himself becomes a body of various signs that construct him as the metaphysical centre that Western thinkers have relied upon. His narration becomes superior to Nicholas’ and he himself becomes only a narrative voice. The voice from the times of Plato has been considered as a direct expression of the thoughts in one’s mind and thus superior to writing that is permeated with the undecidability of meaning in the absence of the speaker and the addressee. In the novel, words as an endless play of metaphors take the place of voice. There is no knowable reality outside the play words or metaphors which is an endless chain of signifiers that lead to other signifiers. Every time Nicholas turns to Conchis to find the centre outside the play of the language, he finds other signifiers. Thus, Conchis as a meaning-making centre is dethroned. He is not the sole operator of the masks that divert from their presumed original target when they are read. Nicholas is just another production of the literary tradition who reads the signs only to produce other signs. Conchis in the beginning of the novel renounces fiction for science but along the course of the novel, we see that words are never reliable whether in fiction or in science.

  19. A Western apache writing system: the symbols of silas john.

    Science.gov (United States)

    Basso, K H; Anderson, N

    1973-06-08

    At the outset of this article, it was observed that the adequacy of an etic typology of written symbols could be judged by its ability to describe all the emic distinctions in all the writing systems of the world. In conclusion, we should like to return to this point and briefly examine the extent to which currently available etic concepts can be used to describe the distinctions made by Western Apaches in relation to the writing system of Silas John. Every symbol in the Silas John script may be classified as a phonetic-semantic sign. Symbols of this type denote linguistic expressions that consist of one or more words and contrast as a class with phonetic-nonsemantic signs, which denote phonemes (or phoneme clusters), syllables (or syllable clusters), and various prosodic phenomena (2, pp. 2, 248). Phonetic semantic signs are commonly partitioned into two subclasses: alogographs (which denote single words) and phraseographs (which denote on or more words). Although every symbol in the Silas John script can be assigned to one or the other of these categories, such an exercise is without justification (21). We have no evidence to suggest that Western Apaches classify symbols according to the length or complexity of their linguistic referents, and therefore the imposition of distinctions based on these criteria would be inappropriate and misleading. A far more useful contrast, and one we have already employed, is presented in most etic typologies as an opposition between compound (composite) and noncompound (noncomposite) symbols. Used to break down the category of phonetic-semantic signs, these two concepts enable us to describe more or less exactly the distinction Apaches draw between "symbol elements put together" (ke?escin ledidilgoh) and "symbol elements standing alone" (ke?- escin doledidildaahi). The former may now be defined as consisting of compound phonetic-semantic signs, while the latter is composed of noncompound phonetic-semantic signs. Up to this point

  20. 77 FR 6168 - Culturally Significant Objects Imported for Exhibition Determinations: “John Chamberlain: Choices”

    Science.gov (United States)

    2012-02-07

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF STATE Culturally Significant Objects Imported for Exhibition Determinations: ``John Chamberlain: Choices'' SUMMARY... objects to be included in the exhibition ``John Chamberlain: Choices,'' imported from abroad for temporary...

  1. A randomized controlled trial of the effects of nursing care based on Watson's Theory of Human Caring on distress, self-efficacy and adjustment in infertile women.

    Science.gov (United States)

    Arslan-Özkan, İlkay; Okumuş, Hülya; Buldukoğlu, Kadriye

    2014-08-01

    To investigate the effects of nursing care based on the Theory of Human Caring on distress caused by infertility, perceived self-efficacy and adjustment levels. Infertility leads to individual, familial and social problems. Nursing care standards for women affected by infertility have yet to emerge. A randomized controlled trial. This study was conducted from May 2010-February 2011, with 105 Turkish women with infertility (intervention group: 52, control group: 53). We collected data using the Infertility Distress Scale, the Turkish-Infertility Self Efficacy Scale Short Form and the Turkish-Fertility Adjustment Scale. The intervention group received nursing care based on the Theory of Human Caring. Data were analysed using t-tests, chi-square tests and intention-to-treat analyses. The intervention and control groups significantly differed with regard to infertility distress, self-efficacy and adjustment levels. The intervention group's mean self-efficacy score increased by seven points and adjustment score decreased by seven points (in a positive direction). In addition, there was a significant reduction in infertility distress scores in the intervention group, but there was no change in the control group. Nursing care based on the Theory of Human Caring decreased the negative impact of infertility in women receiving infertility treatment and increased self-efficacy and adjustment. © 2013 John Wiley & Sons Ltd.

  2. 76 FR 4940 - John G. Costino, D.O.; Dismissal of Proceeding

    Science.gov (United States)

    2011-01-27

    ... Enforcement Administration John G. Costino, D.O.; Dismissal of Proceeding On June 1, 2010, the Deputy Assistant Administrator, Office of Diversion Control, issued an Order to Show Cause to John G. Costino, D.O... Order to Show Cause issued to John G. Costino, D.O., be, and it hereby is, dismissed. Dated: January 18...

  3. 77 FR 12324 - Captain John Smith Chesapeake National Historic Trail Advisory Council

    Science.gov (United States)

    2012-02-29

    ... National Park Service Captain John Smith Chesapeake National Historic Trail Advisory Council AGENCY... Captain John Smith Chesapeake National Historic Trail will hold a meeting. Designated through an amendment..., Maryland, Delaware, and in the District of Columbia,'' tracing the 1607-1609 voyages of Captain John Smith...

  4. 77 FR 64352 - Notice of Meeting for Captain John Smith Chesapeake National Historic Trail Advisory Council

    Science.gov (United States)

    2012-10-19

    ... National Park Service Notice of Meeting for Captain John Smith Chesapeake National Historic Trail Advisory... Advisory Committee on the Captain John Smith Chesapeake National Historic Trail will hold a meeting...-1609 voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting...

  5. 77 FR 2317 - Captain John Smith Chesapeake National Historic Trail Advisory Council

    Science.gov (United States)

    2012-01-17

    ... National Park Service Captain John Smith Chesapeake National Historic Trail Advisory Council AGENCY... Captain John Smith Chesapeake National Historic Trail will hold a meeting via conference call. Designated... voyages of Captain John Smith to chart the land and waterways of the Chesapeake Bay. This meeting is...

  6. Reflection on the "New Dynamics" of Distance Education: An Interview with Sir John Daniel

    Science.gov (United States)

    Latchem, Colin

    2012-01-01

    This article presents an interview with Sir John Daniel outgoing President and CEO of the Commonwealth of Learning. Sir John Daniel's term as President and Chief Executive Officer of the Commonwealth of Learning (COL) ended on May 31, 2012. Readers of "Distance Education" will know of Sir John's work at the Tele-universite (Directeur des…

  7. 75 FR 8570 - Atlantic Ocean off John F. Kennedy Space Center, FL; Restricted Area

    Science.gov (United States)

    2010-02-25

    ... Department of the Army, Corps of Engineers 33 CFR Part 334 Atlantic Ocean off John F. Kennedy Space Center... the coast of the John F. Kennedy Space Center (KSC), Florida. The KSC is the main launch facility for...). 2. Add Sec. 334.525 to read as follows: Sec. 334.525 Atlantic Ocean off John F. Kennedy Space Center...

  8. 33 CFR 334.525 - Atlantic Ocean off John F. Kennedy Space Center, FL; restricted area.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Atlantic Ocean off John F... REGULATIONS § 334.525 Atlantic Ocean off John F. Kennedy Space Center, FL; restricted area. (a) The area. The..., contiguous to the area offshore of the John F. Kennedy Space Center (KSC), Florida. The area is bounded by a...

  9. 77 FR 8251 - John B. Crockett; Notice of Preliminary Permit Application Accepted for Filingand Soliciting...

    Science.gov (United States)

    2012-02-14

    ... Energy Regulatory Commission John B. Crockett; Notice of Preliminary Permit Application Accepted for Filingand Soliciting Comments, Motions to Intervene, and Competing Applications On January 20, 2012, John B.... Applicant Contact: John B. Crockett, 3296 Snowflake Way, Boise, ID 83706; phone: (208) 344-5319. FERC...

  10. 75 FR 34643 - Atlantic Ocean Off John F. Kennedy Space Center, FL; Restricted Area

    Science.gov (United States)

    2010-06-18

    ... Department of the Army, Corps of Engineers 33 CFR Part 334 Atlantic Ocean Off John F. Kennedy Space Center... the Atlantic Ocean off the coast of the John F. Kennedy Space Center (KSC), Florida. The KSC is the...: Sec. 334.525 Atlantic Ocean off John F. Kennedy Space Center, FL; Restricted Area. (a) The area. The...

  11. 76 FR 26767 - Captain John Smith Chesapeake National Historic Trail Advisory Council

    Science.gov (United States)

    2011-05-09

    ... National Park Service Captain John Smith Chesapeake National Historic Trail Advisory Council AGENCY... Captain John Smith Chesapeake National Historic Trail will hold a meeting. Designated through an amendment..., Maryland, Delaware, and in the District of Columbia,'' tracing the 1607-1609 voyages of Captain John Smith...

  12. 76 FR 52691 - Captain John Smith Chesapeake National Historic Trail Advisory Council

    Science.gov (United States)

    2011-08-23

    ... National Park Service Captain John Smith Chesapeake National Historic Trail Advisory Council AGENCY... Captain John Smith Chesapeake National Historic Trail will hold a meeting. Designated through an amendment..., Maryland, Delaware, and in the District of Columbia,'' tracing the 1607-1609 voyages of Captain John Smith...

  13. 78 FR 58515 - Supplemental Environmental Impact Statement for the Bird Hazard Reduction Program at John F...

    Science.gov (United States)

    2013-09-24

    ... Hazard Reduction Program at John F. Kennedy International Airport AGENCY: Animal and Plant Health... Inspection Service to analyze a proposed method for managing hazards to aircraft at John F. Kennedy... action is a supplement to the Gull Hazard Reduction Program at John F. Kennedy International Airport...

  14. 76 FR 56471 - Meeting of the John H. Chafee Blackstone River Valley National Heritage Corridor Commission

    Science.gov (United States)

    2011-09-13

    ... National Park Service Meeting of the John H. Chafee Blackstone River Valley National Heritage Corridor Commission AGENCY: National Heritage Corridor Commission, John H. Chafee Blackstone River Valley, National... with the Federal Advisory Committee Act, 5 U.S.C. Appendix, that the John H. Chafee Blackstone River...

  15. 78 FR 76175 - Notice of Public Meeting for the John Day-Snake Resource Advisory Council

    Science.gov (United States)

    2013-12-16

    ... Bureau of Land Management Notice of Public Meeting for the John Day-Snake Resource Advisory Council... U.S. Department of the Interior, Bureau of Land Management (BLM), the John Day-Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The John Day-Snake RAC will hold a public...

  16. 75 FR 5803 - John Day/Snake Resource Advisory Council; Meetings

    Science.gov (United States)

    2010-02-04

    ... Bureau of Land Management John Day/Snake Resource Advisory Council; Meetings AGENCY: Bureau of Land Management, Interior. ACTION: Meeting Notice for the John Day/Snake Resource Advisory Council. SUMMARY.... Department of the Interior, Bureau of Land Management (BLM) John Day/Snake Resource Advisory Council (JDSRAC...

  17. 78 FR 64236 - Notice of Public Meeting for the John Day; Snake Resource Advisory Council

    Science.gov (United States)

    2013-10-28

    ... Bureau of Land Management Notice of Public Meeting for the John Day; Snake Resource Advisory Council... U.S. Department of the Interior, Bureau of Land Management (BLM), the John Day--Snake Resource Advisory Council (RAC) will meet as indicated below: DATES: The John Day--Snake RAC will hold a public...

  18. John Dewey, William Wirt and the Gary Schools Plan: A Centennial Reappraisal

    Science.gov (United States)

    Thorburn, Malcolm

    2017-01-01

    A century on from the height of John Dewey's educational writings and the reputation of the Gary Schools Plan as a model of progressive education, the paper reappraises two key matters: the relationship between John Dewey and William Wirt, the first superintendent of the Gary Schools in Gary Indiana, and the coherence between John Dewey's…

  19. 75 FR 25285 - John Heinz National Wildlife Refuge at Tinicum, Philadelphia and Delaware Counties, PA

    Science.gov (United States)

    2010-05-07

    ... Fish and Wildlife Service John Heinz National Wildlife Refuge at Tinicum, Philadelphia and Delaware... environmental assessment (EA) for John Heinz National Wildlife Refuge (NWR) at Tinicum in Philadelphia...: Electronic Mail: fws.gov ">[email protected] fws.gov . Include ``John Heinz NWR CCP'' in the subject line of...

  20. Talking with John Trim (Part I): A Career in Phonetics, Applied Linguistics and the Public Service

    Science.gov (United States)

    Little, David; King, Lid

    2013-01-01

    As this issue was in preparation, the journal learned with great regret of the passing of John Trim. John was a long-serving member of the "Language Teaching" Board and his insight and advice proved invaluable for this and previous editors. An expert in the field of phonetics, linguistics, language didactics and policy, John worked…