WorldWideScience

Sample records for water molecule orientations

  1. Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations

    International Nuclear Information System (INIS)

    Markovic, M.I.

    1974-01-01

    Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy

  2. Influence of orientation averaging on the anisotropy of thermal neutrons scattering on water molecules

    International Nuclear Information System (INIS)

    Markovic, M. I.; Radunovic, J. B.

    1976-01-01

    Determination of spatial distribution of neutron flux in water, most frequently used moderator in thermal reactors, demands microscopic scattering kernels dependence on cosine of thermal neutrons scattering angle when solving the Boltzmann equation. Since spatial orientation of water molecules influences this dependence it is necessary to perform orientation averaging or rotation-vibrational intermediate scattering function for water molecules. The calculations described in this paper and the obtained results showed that methods of orientation averaging do not influence the anisotropy of thermal neutrons scattering on water molecules, but do influence the inelastic scattering

  3. Density, distribution, and orientation of water molecules inside and outside carbon nanotubes.

    Science.gov (United States)

    Thomas, J A; McGaughey, A J H

    2008-02-28

    The behavior of water molecules inside and outside 1.1, 2.8, 6.9, and 10.4 nm diameter armchair carbon nanotubes (CNTs) is predicted using molecular dynamics simulations. The effects of CNT diameter on mass density, molecular distribution, and molecular orientation are identified for both the confined and unconfined fluids. Within 1 nm of the CNT surface, unconfined water molecules assume a spatially varying density profile. The molecules distribute nonuniformly around the carbon surface and have preferred orientations. The behavior of the unconfined water molecules is invariant with CNT diameter. The behavior of the confined water, however, can be correlated to tube diameter. Inside the 10.4 nm CNT, the molecular behavior is indistinguishable from that of the unconfined fluid. Within the smaller CNTs, surface curvature effects reduce the equilibrium water density and force water molecules away from the surface. This effect changes both the molecular distribution and preferred molecular orientations.

  4. Hydroxyl and water molecule orientations in trypsin: Comparison to molecular dynamics structures

    Energy Technology Data Exchange (ETDEWEB)

    McDowell, R.S.; Kossiakoff, A.A. [Genentech, Inc., South San Francisco, CA (United States)

    1994-12-31

    A comparison is presented of experimentally observed hydroxyl and water hydrogens in trypsin determined from neutron density maps with the results of a 140ps molecular dynamics (MD) simulation. Experimental determination of hydrogen and deuterium atom positions in molecules as large as proteins is a unique capability of neutron diffraction. The comparison addresses the degree to which a standard force-field approach can adequately describe the local electrostatic and van der Waals forces that determine the orientations of these hydrogens. Neutron densities, derived from 2.1{Angstrom} D{sub 2}O-H{sub 2}O difference Fourier maps, provide a database of 27 well-ordered hydroxyl hydrogens. Most of the simulated hydroxyl orientations are within a standard deviation of the experimentally-observed positions, including several examples in which both the simulation and the neutron density indicate that a hydroxyl group is shifted from a {open_quote}standard{close_quote} rotamer. For the most highly ordered water molecules, the hydrogen distributions calculated from the trajectory were in good agreement with neutron density; simulated water molecules that displayed multiple hydrogen bonding networks had correspondingly broadened neutron density profiles. This comparison was facilitated by development of a method to construct a pseudo 2{Angstrom} density map based on the hydrogen atom distributions from the simulation. The degree of disorder of internal water molecules is shown to result primarily from the electrostatic environment surrounding that water molecule as opposed to the cavity size available to the molecule. A method is presented for comparing the discrete observations sampled in a dynamics trajectory with the time- averaged data obtained from X-ray or neutron diffraction studies. This method is particularly useful for statically-disordered water molecules, in which the average location assigned from a trajectory may represent a site of relatively low occupancy.

  5. Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations; Aproksimativno Krieger-Nelkinovo orijentacijsko usrednjenje i anozotropija vibracija molekula lake vode

    Energy Technology Data Exchange (ETDEWEB)

    Markovic, M I [Elektrothenicki fakultet, Belgrade (Yugoslavia)

    1974-07-01

    Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy.

  6. Molecule-oriented programming in Java

    NARCIS (Netherlands)

    Bergstra, J.A.

    2002-01-01

    Molecule-oriented programming is introduced as a programming style carrying some perspective for Java. A sequence of examples is provided. Supporting the development of the molecule-oriented programming style several matters are introduced and developed: profile classes allowing the representation

  7. NMR of dielectrically oriented molecules

    International Nuclear Information System (INIS)

    Ruessink, B.H.

    1986-01-01

    General information on experimental aspects of EFNMR is given. It is shown that the complete 14 N quadrupole tensor (qct) of pyridine and pyrimidine in the liquid state is accessible to EFNMR. Information obtained about 17 O qct in liquid nitromethane, is compared with results from other techniques. The 33 S qct in liquid sulfolane is investigated. The EFNMR results, combined with those from spin-lattice relaxation time measurements and from Hartree-Fock-Slater MO calculations, allowed the complete assignment of the 33 S qct. The quadrupole coupling of both 10 B and 11 B in a carborane compound is investigated and, together with the results of spin-lattice relaxation time measurements, detailed information about the assignment of the boron qct's could be derived. EFNMR studies of apolar molecules are described. A limitation in EFNMR is the inhomogeneity (delta B) of the magnetic field, which is introduced by the use of non-spinning sample cells. A way out is the detection of zero quantum transitions, their widths being independent of delta B. The results and prospectives of this approach are shown for the simple three spin 1/2 system of acrylonitrile in which the small dipolar proton-proton couplings could be revealed via zero quantum transitions. (Auth.)

  8. Electroluminescence from completely horizontally oriented dye molecules

    Energy Technology Data Exchange (ETDEWEB)

    Komino, Takeshi [Education Center for Global Leaders in Molecular System for Devices, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Sagara, Yuta [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Tanaka, Hiroyuki [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Chemistry, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Oki, Yuji [Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Electronics, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Nakamura, Nozomi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); International Institute for Carbon Neutral Energy Research (WPI-I2CNER), Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fujimoto, Hiroshi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fukuoka i" 3-Center for Organic Photonics and Electronics Research (i3-OPERA), Fukuoka 819-0388 (Japan); and others

    2016-06-13

    A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimate orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.

  9. Photochemical dynamics of surface oriented molecules

    International Nuclear Information System (INIS)

    Ho, W.

    1992-01-01

    The period 8/01/91-7/31/92 is the first year of a new project titled ''Photochemical Dynamics of Surface Oriented Molecules'', initiated with DOE Support. The main objective of this project is to understand the dynamics of elementary chemical reactions by studying photochemical dynamics of surface-oriented molecules. In addition, the mechanisms of photon-surface interactions need to be elucidated. The strategy is to carry out experiments to measure the translational energy distribution, as a function of the angle from the surface normal, of the photoproducts by time-of-flight (TOF) technique by varying the photon wavelength, intensity, polarization, and pulse duration. By choosing adsorbates with different bonding configuration, the effects of adsorbate orientation on surface photochemical dynamics can be studied

  10. Field-free orientation of molecules

    DEFF Research Database (Denmark)

    Machholm, Mette; Henriksen, Niels Engholm

    2001-01-01

    The excitation of angular motion, in particular, the creation of a wave packet in the angular degrees of freedom via short-pulse, off-resonant excitation with respect to rotational transitions, was examined. The key result was that field-free time-dependent orientation for a molecule like LiH can...... be generated after the turn-off of a state-of-the-art electromagnetic half-cycle pulse.......The excitation of angular motion, in particular, the creation of a wave packet in the angular degrees of freedom via short-pulse, off-resonant excitation with respect to rotational transitions, was examined. The key result was that field-free time-dependent orientation for a molecule like LiH can...

  11. Hydrophobic fluorine mediated switching of the hydrogen bonding site as well as orientation of water molecules in the aqueous mixture of monofluoroethanol: IR, molecular dynamics and quantum chemical studies.

    Science.gov (United States)

    Mondal, Saptarsi; Biswas, Biswajit; Nandy, Tonima; Singh, Prashant Chandra

    2017-09-20

    The local structures between water-water, alcohol-water and alcohol-alcohol have been investigated for aqueous mixtures of ethanol (ETH) and monofluoroethanol (MFE) by the deconvolution of IR bands in the OH stretching region, molecular dynamics simulation and quantum chemical calculations. It has been found that the addition of a small amount of ETH into the aqueous medium increases the strength of the hydrogen bonds between water molecules. In an aqueous mixture of MFE, the substitution of a single fluorine induces a change in the orientation as well as the hydrogen bonding site of water molecules from the oxygen to the fluorine terminal of MFE. The switching of the hydrogen bonding site of water in the aqueous mixture of MFE results in comparatively strong hydrogen bonds between MFE and water molecules as well as less clustering of water molecules, unlike the case of the aqueous mixture of ETH. These findings about the modification of a hydrogen bond network by the hydrophobic fluorine group probably make fluorinated molecules useful for pharmaceutical as well as biological applications.

  12. Orientation of KRb molecules in a switched electrostatic field

    International Nuclear Information System (INIS)

    Huang Yun-Xia; Xu Shu-Wu; Yang Xiao-Hua

    2013-01-01

    We theoretically investigate the orientation of the cold KRb molecules induced in a switched electrostatic field by numerically solving the full time-dependent Schrödinger equation. The results show that the periodic field-free molecular orientation can be realized for the KRb molecules by rapidly switching off the electrostatic field. Meanwhile, by varying the switching times of the electrostatic field, the adiabatic and nonadiabatic interactions of the molecules with the applied field can be realized. Moreover, the influences of the electrostatic field strength and the rotational temperature to the degree of the molecular orientation are studied. The investigations show that increasing the electrostatic field will increase the degree of the molecular orientation, both in the constant-field regime and in the field-free regime, while the increasing of the rotational temperature of the cold molecules will greatly decrease the degree of the molecular orientation. (atomic and molecular physics)

  13. Orientation of the pigment molecules in the chloroplast

    NARCIS (Netherlands)

    Goedheer, J.C.

    1955-01-01

    Dichroism, absorption anisotropy, and anomal dispersion of birefringence were measured in the big lamellate chloroplasts of Mougeotia. The results of these measurements indicate a certain orientation of the chlorophyll molecules, and to a smaller extent, of the carotenoids in the chloroplast. In

  14. Effects of molecular orientation in the laser ionization of molecules

    International Nuclear Information System (INIS)

    Xinhua Xie; Gerald Jordan; Christopher Ede; Armin Scrinzi

    2006-01-01

    Complete test of publication follows. Time-dependent electron momentum distributions are calculated during ionization of linear molecules by a strong laser pulse and upon recollision. For typical experimental laser parameters, we find a strong influence of molecular orientation and initial state symmetry on the total ionization rates and also on momentum distributions, compared to which the effect of electron correlation is less important for simple molecules. The dynamics of electron release and subsequent recollision with the parent ion largely determines the time-frequency structure of harmonic radiation, which underlies the generation of attosecond XUV pulses and the time-resolved imaging techniques for the electronic structure of molecules. In the present work, the effects of orientation and initial orbital symmetry are investigated by solving the time-dependent Schroedinger equation for a two-dimensional diatomic molecule in the single-active electron approximation. As in the presence of strong external fields recolliding electrons cannot be easily separated from bound electrons, the electron wave packet is probed at some distance from where all electrons can be safety considered as detached. We find that momentum distributions strongly depend on molecular size, orientation of the molecular axis, and node structure of the initial state. In order to determine the momentum spectra at the time of electron release and upon recollision, we classically propagate the Wigner distributions of probed wavepackets backward and forward in time, respectively. We find that the times of peak recollision current can vary strongly with the orientation of the molecule. Moreover, correlation effects on the electron spectra are included using the multi-configuration time-dependent Hartree-Fock method. The calculations are performed in three spatial dimensions with the restriction to cylindrical symmetry, where the molecule is aligned with the laser field. Correlation is studied

  15. Dynamics of molecular stereochemistry via oriented molecule scattering

    International Nuclear Information System (INIS)

    Parker, D.H.; Jalink, H.; Stolte, S.

    1987-01-01

    Crossed-beam reactive scattering experiments employing electrostatic hexapole fields to control the initial collision geometry of chemical reactions are described. New results are presented on the reactions of oriented NO with ozone and oriented N 2 O with Ba. Preliminary results are also given for the oriented CH 3 F + Ca* → CaF* + CH 3 reaction. Recent technical advances in state selection and product detection are detailed. They discuss the effects of rotational coupling and nonzero impact parameters in changing the molecular precollisions orientation selected by the hexapole fields to a different in-collision orientation at the moment of impact with the reaction partner. Uncoupling of l doubling in N 2 O at strong orientation fields is demonstrated via the observed reactive anisotropy. Steric effects are found to govern many aspects of the reactions investigated thus far. Strong correlations are observed of the reactivity, product recoil, and rotational angular momentum distributions with the collisional orientation. These correlations ultimately provide information on the anisotropic part of the reaction potential energy surface. They conclude with a brief outline of possible future directions in oriented molecule scattering

  16. Concerted orientation induced unidirectional water transport through nanochannels.

    Science.gov (United States)

    Wan, Rongzheng; Lu, Hangjun; Li, Jinyuan; Bao, Jingdong; Hu, Jun; Fang, Haiping

    2009-11-14

    The dynamics of water inside nanochannels is of great importance for biological activities as well as for the design of molecular sensors, devices, and machines, particularly for sea water desalination. When confined in specially sized nanochannels, water molecules form a single-file structure with concerted dipole orientations, which collectively flip between the directions along and against the nanotube axis. In this paper, by using molecular dynamics simulations, we observed a net flux along the dipole-orientation without any application of an external electric field or external pressure difference during the time period of the particular concerted dipole orientations of the molecules along or against the nanotube axis. We found that this unique special-directional water transportation resulted from the asymmetric potential of water-water interaction along the nanochannel, which originated from the concerted dipole orientation of the water molecules that breaks the symmetry of water orientation distribution along the channel within a finite time period. This finding suggests a new mechanism for achieving high-flux water transportation, which may be useful for nanotechnology and biological applications.

  17. Photostop of iodine atoms from electrically oriented ICl molecules

    International Nuclear Information System (INIS)

    Bao Da-Xiao; Lian-Zhong Deng; Xu Liang; Yin Jian-Ping

    2015-01-01

    The dynamics of photostopping iodine atoms from electrically oriented ICl molecules was numerically studied based on their orientational probability distribution functions. Velocity distributions of the iodine atoms and their production rates were investigated for orienting electrical fields of various intensities. For the ICl precursor beams with an initial rotational temperature of ∼ 1 K, the production of the iodine atoms near zero speed will be improved by about ∼ 5 times when an orienting electrical field of ∼ 200 kV/cm is present. A production rate of ∼ 0.5‰ is obtained for photostopped iodine atoms with speeds less than 10 m/s, which are suitable for magnetic trapping. The electrical orientation of ICl precursors and magnetic trapping of photostopped iodine atoms in situ can be conveniently realized with a pair of charged ring magnets. With the maximal value of the trapping field being ∼ 0.28 T, the largest trapping speed is ∼ 7.0 m/s for the iodine atom. (paper)

  18. Conserved water molecules in bacterial serine hydroxymethyltransferases.

    Science.gov (United States)

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

    2015-10-01

    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Picosecond orientational dynamics of water in living cells.

    Science.gov (United States)

    Tros, Martijn; Zheng, Linli; Hunger, Johannes; Bonn, Mischa; Bonn, Daniel; Smits, Gertien J; Woutersen, Sander

    2017-10-12

    Cells are extremely crowded, and a central question in biology is how this affects the intracellular water. Here, we use ultrafast vibrational spectroscopy and dielectric-relaxation spectroscopy to observe the random orientational motion of water molecules inside living cells of three prototypical organisms: Escherichia coli, Saccharomyces cerevisiae (yeast), and spores of Bacillus subtilis. In all three organisms, most of the intracellular water exhibits the same random orientational motion as neat water (characteristic time constants ~9 and ~2 ps for the first-order and second-order orientational correlation functions), whereas a smaller fraction exhibits slower orientational dynamics. The fraction of slow intracellular water varies between organisms, ranging from ~20% in E. coli to ~45% in B. subtilis spores. Comparison with the water dynamics observed in solutions mimicking the chemical composition of (parts of) the cytosol shows that the slow water is bound mostly to proteins, and to a lesser extent to other biomolecules and ions.The cytoplasm's crowdedness leads one to expect that cell water is different from bulk water. By measuring the rotational motion of water molecules in living cells, Tros et al. find that apart from a small fraction of water solvating biomolecules, cell water has the same dynamics as bulk water.

  20. Orientational order and dynamics of water in bulk and in aqueous solutions of uranyl ions

    International Nuclear Information System (INIS)

    Chopra, Manish; Choudhury, Niharendu

    2014-01-01

    Molecular dynamics simulations in canonical ensemble of aqueous solutions of uranyl nitrate and bulk water at ambient condition have been carried out to investigate orientational order and dynamics of water. The orientational distributions of water around a central water molecule in bulk water and around a uranyl ion in an aqueous uranyl solution have been calculated. Orientational dynamics of water in bulk and in aqueous uranyl nitrate solution have also been analysed. (author)

  1. Nano-sensing of the orientation of fluorescing molecules with active coated nano-particles

    DEFF Research Database (Denmark)

    Arslanagic, Samel; Ziolkowski, Richard W.

    2015-01-01

    The potential of using active coated nano-particles to determine the orientation of fluorescing molecules is reported. By treating each fluorescing molecule as an electric Hertzian dipole, single and multiple fluorescing molecules emitting coherently and incoherently in various orientations...... are considered in the presence of active coated nano-particles. It is demonstrated that in addition to offering a means to determine the orientation of a single molecule or the over-all orientation of the molecules surrounding it, the nature of the far-field response from the active coated nano...

  2. The effect of uniform capture molecule orientation on biosensor sensitivity : dependence on analyte properties

    NARCIS (Netherlands)

    Trilling, A.K.; Harmsen, M.M.; Ruigrok, V.J.; Zuilhof, H.; Beekwilder, J.

    2013-01-01

    Uniform orientation of capture molecules on biosensors has been reported to increase sensitivity. Here it is investigated which analyte properties contribute to sensitivity by orientation. Orientation of capture molecules on biosensors was investigated using variable domains of llama heavy-chain

  3. Orientation of pentacene molecules on SiO2: From a monolayer to the bulk

    International Nuclear Information System (INIS)

    Zheng, Fan; Park, Byoung-Nam; Seo, Soonjoo; Evans, Paul G.; Himpsel, F. J.

    2007-01-01

    Near edge x-ray absorption fine structure (NEXAFS) spectroscopy is used to study the orientation of pentacene molecules within thin films on SiO 2 for thicknesses ranging from monolayers to the bulk (150 nm). The spectra exhibit a strong polarization dependence of the π * orbitals for all films, which indicates that the pentacene molecules are highly oriented. At all film thicknesses the orientation varies with the rate at which pentacene molecules are deposited, with faster rates favoring a thin film phase with different tilt angles and slower rates leading to a more bulklike orientation. Our NEXAFS results extend previous structural observations to the monolayer regime and to lower deposition rates. The NEXAFS results match crystallographic data if a finite distribution of the molecular orientations is included. Damage to the molecules by hot electrons from soft x-ray irradiation eliminates the splitting between nonequivalent π * orbitals, indicating a breakup of the pentacene molecule

  4. Femtosecond spectroscopic study of the solvation of amphiphilic molecules by water

    NARCIS (Netherlands)

    Rezus, Y.L.A.; Bakker, H.J.

    2008-01-01

    We use polarization-resolved mid-infrared pump-probe spectroscopy to study the aqueous solvation of proline and N-methylacetamide. These molecules serve as models to study the solvation of proteins. We monitor the orientational dynamics of partly deuterated water molecules (HDO) that are present at

  5. Vibrational and orientational dynamics of water in aqueous hydroxide solutions.

    Science.gov (United States)

    Hunger, Johannes; Liu, Liyuan; Tielrooij, Klaas-Jan; Bonn, Mischa; Bakker, Huib

    2011-09-28

    We report the vibrational and orientational dynamics of water molecules in isotopically diluted NaOH and NaOD solutions using polarization-resolved femtosecond vibrational spectroscopy and terahertz time-domain dielectric relaxation measurements. We observe a speed-up of the vibrational relaxation of the O-D stretching vibration of HDO molecules outside the first hydration shell of OH(-) from 1.7 ± 0.2 ps for neat water to 1.0 ± 0.2 ps for a solution of 5 M NaOH in HDO:H(2)O. For the O-H vibration of HDO molecules outside the first hydration shell of OD(-), we observe a similar speed-up from 750 ± 50 fs to 600 ± 50 fs for a solution of 6 M NaOD in HDO:D(2)O. The acceleration of the decay is assigned to fluctuations in the energy levels of the HDO molecules due to charge transfer events and charge fluctuations. The reorientation dynamics of water molecules outside the first hydration shell are observed to show the same time constant of 2.5 ± 0.2 ps as in bulk liquid water, indicating that there is no long range effect of the hydroxide ion on the hydrogen-bond structure of liquid water. The terahertz dielectric relaxation experiments show that the transfer of the hydroxide ion through liquid water involves the simultaneous motion of ~7 surrounding water molecules, considerably less than previously reported for the proton. © 2011 American Institute of Physics

  6. Ionization of oriented carbonyl sulfide molecules by intense circularly polarized laser pulses

    DEFF Research Database (Denmark)

    Dimitrovski, Darko; Abu-Samha, Mahmoud; Madsen, Lars Bojer

    2011-01-01

    We present combined experimental and theoretical results on strong-field ionization of oriented carbonyl sulfide molecules by circularly polarized laser pulses. The obtained molecular frame photoelectron angular distributions show pronounced asymmetries perpendicular to the direction of the molec......We present combined experimental and theoretical results on strong-field ionization of oriented carbonyl sulfide molecules by circularly polarized laser pulses. The obtained molecular frame photoelectron angular distributions show pronounced asymmetries perpendicular to the direction......-dimensionally-oriented polar molecules, in particular asymmetries in the emission direction of the photoelectrons. In the following article [Phys. Rev. A 83, 023406 (2011)] the focus is to understand strong-field ionization from three-dimensionally-oriented asymmetric top molecules, in particular the suppression of electron...

  7. The spontaneous synchronized dance of pairs of water molecules

    International Nuclear Information System (INIS)

    Roncaratti, Luiz F.; Cappelletti, David; Pirani, Fernando

    2014-01-01

    Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions

  8. The spontaneous synchronized dance of pairs of water molecules

    Energy Technology Data Exchange (ETDEWEB)

    Roncaratti, Luiz F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade de Brasília, 70910-900 Brasília (Brazil); Cappelletti, David, E-mail: david.cappelletti@unipg.it; Pirani, Fernando [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy)

    2014-03-28

    Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions.

  9. Oriented xenon hydride molecules in the gas phase

    Czech Academy of Sciences Publication Activity Database

    Buck, U.; Fárník, Michal

    2006-01-01

    Roč. 25, č. 4 (2006), s. 583-612 ISSN 0144-235X Grant - others:Deutsche Forschungsgemeinschaft(DE) SFB 357 Institutional research plan: CEZ:AV0Z40400503 Keywords : photofragment translational spectroscopy * charge transfer molecules * low temperature matrices * neutral rare-gas Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.036, year: 2006

  10. Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures

    Science.gov (United States)

    Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.

    2018-05-01

    Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.

  11. Single molecule optical measurements of orientation and rotations of biological macromolecules.

    Science.gov (United States)

    Shroder, Deborah Y; Lippert, Lisa G; Goldman, Yale E

    2016-11-22

    Subdomains of macromolecules often undergo large orientation changes during their catalytic cycles that are essential for their activity. Tracking these rearrangements in real time opens a powerful window into the link between protein structure and functional output. Site-specific labeling of individual molecules with polarized optical probes and measurement of their spatial orientation can give insight into the crucial conformational changes, dynamics, and fluctuations of macromolecules. Here we describe the range of single molecule optical technologies that can extract orientation information from these probes, review the relevant types of probes and labeling techniques, and highlight the advantages and disadvantages of these technologies for addressing specific inquiries.

  12. X-ray diffraction studies of the structure and orientations of thiophene and fluorenone based molecule

    International Nuclear Information System (INIS)

    Porzio, William; Pasini, Mariacecilia; Destri, Silvia; Giovanella, Umberto; Fontaine, Philippe

    2006-01-01

    The crystal structure of a conjugated molecule containing thiophene and fluorenone residues has been determined from powder X-ray diffraction (XRD). Thin films ( -5 Pa) onto oxidized silicon substrates, are oriented along with different crystallographic directions. A comparison of XRD in both Grazing Incidence and Bragg-Brentano geometries allowed to perform a quantitative analysis of the various orientations. This approach is generally applicable in the case of multi-oriented films. The results fully account for the poor performance of this molecule in p-type field effect transistor devices

  13. Autodissociation of a water molecule in liquid water

    Energy Technology Data Exchange (ETDEWEB)

    Geissler, Phillip L.; Dellago, Christoph; Chandler, David; Hutter, Jurg; Parrinello, Michele

    2000-04-01

    The dissociation of a water molecule in liquid water is the fundamental event in acid-base chemistry, determining the pH of water.Because the microscopic dynamics of this autodissociation are difficult to probe, both by experiment and by computer simulation, its mechanism has been unknown. Here we report several autodissociation trajectories generated by ab initio molecular dynamics [1]. These trajectories, which were harvested using transition path sampling [2-4], reveal the mechanism for the first time. Rare fluctuations in solvation energies destabilize an oxygen-hydrogen bond. Through the transfer of one or more protons along a hydrogen bond.

  14. Orientation of rod molecules in selective slits: a density functional theory

    International Nuclear Information System (INIS)

    Xu Xiaofei; Cao Dapeng; Wang Wenchuan

    2008-01-01

    A density functional theory (DFT) is used to investigate molecular orientation of rod fluids in selective slits. The DFT approach combines a modified fundamental measure theory (MFMT) for excluded-volume effect, the first-order thermodynamics perturbation theory for chain connectivity and the mean-field approximation for van der Waals (vdW) attraction. To study the molecular orientation, the intramolecular bonding orientation function is introduced into the DFT. First, we investigate the orientation of the surfactant-like rod molecule of AB 6 (i.e. ABBBBBB) in a nanoslit of H 20σ, where the walls selectively adsorb segment 'A'. It is observed that, with the increase of the surface energy of the wall to head segment (i.e. 'A' segment) of the rod molecule, the rod molecules adsorbed on the wall present the perpendicular orientation gradually, and assemble into a smectic-A-like monolayer finally. In addition, we also explore the molecular orientation of the rods with both end segments preferring to the wall, i.e. AB 8 A and AB 7 A, in a nanoslit of H = 10σ. Interestingly, the AB 8 A rod monolayer is compatible with either a smectic-A-like or a smectic-C-like organization, but AB 7 A rod molecules exhibit the smectic-A-like organization. The orientation factor of the AB 7 A rod molecule reaches 1, suggesting that AB 7 A rod molecules self-assemble into an ordered structure with perfectly perpendicular orientation to the wall.

  15. Slow neutron scattering by water molecules

    Energy Technology Data Exchange (ETDEWEB)

    Stancic, V [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

    1970-07-01

    In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

  16. Slow neutron scattering by water molecules

    International Nuclear Information System (INIS)

    Stancic, V.

    1970-01-01

    In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

  17. Photoelectron diffraction from single oriented molecules: Towards ultrafast structure determination of molecules using x-ray free-electron lasers

    Science.gov (United States)

    Kazama, Misato; Fujikawa, Takashi; Kishimoto, Naoki; Mizuno, Tomoya; Adachi, Jun-ichi; Yagishita, Akira

    2013-06-01

    We provide a molecular structure determination method, based on multiple-scattering x-ray photoelectron diffraction (XPD) calculations. This method is applied to our XPD data on several molecules having different equilibrium geometries. Then it is confirmed that, by our method, bond lengths and bond angles can be determined with a resolution of less than 0.1 Å and 10∘, respectively. Differently from any other scenario of ultrafast structure determination, we measure the two- or three-dimensional XPD of aligned or oriented molecules in the energy range from 100 to 200 eV with a 4π detection velocity map imaging spectrometer. Thanks to the intense and ultrashort pulse properties of x-ray free-electron lasers, our approach exhibits the most probable method for obtaining ultrafast real-time structural information on small to medium-sized molecules consisting of light elements, i.e., a “molecular movie.”

  18. Two dimensional NMR of liquids and oriented molecules

    International Nuclear Information System (INIS)

    Gochin, M.

    1987-02-01

    Chapter 1 discusses the quantum mechanical formalism used for describing the interaction between magnetic dipoles that dictates the appearance of a spectrum. The NMR characteristics of liquids and liquid crystals are stressed. Chapter 2 reviews the theory of multiple quantum and two dimensional NMR. Properties of typical spectra and phase cycling procedures are discussed. Chapter 3 describes a specific application of heteronuclear double quantum coherence to the removal of inhomogeneous broadening in liquids. Pulse sequences have been devised which cancel out any contribution from this inhomogeneity to the final spectrum. An interpretation of various pulse sequences for the case of 13 C and 1 H is given, together with methods of spectral editing by removal or retention of the homo- or heteronuclear J coupling. The technique is applied to a demonstration of high resolution in both frequency and spatial dimensions with a surface coil. In Chapter 4, multiple quantum filtered 2-D spectroscopy is demonstrated as an effective means of studying randomly deuterated molecules dissolved in a nematic liquid crystal. Magnitudes of dipole coupling constants have been determined for benzene and hexane, and their signs and assignments found from high order multiple quantum spectra. For the first time, a realistic impression of the conformation of hexane can be estimated from these results. Chapter 5 is a technical description of the MDB DCHIB-DR11W parallel interface which has been set up to transfer data between the Data General Nova 820 minicomputer, interfaced to the 360 MHz spectrometer, and the Vax 11/730. It covers operation of the boards, physical specifications and installation, and programs for testing and running the interface

  19. Two dimensional NMR of liquids and oriented molecules

    Energy Technology Data Exchange (ETDEWEB)

    Gochin, M.

    1987-02-01

    Chapter 1 discusses the quantum mechanical formalism used for describing the interaction between magnetic dipoles that dictates the appearance of a spectrum. The NMR characteristics of liquids and liquid crystals are stressed. Chapter 2 reviews the theory of multiple quantum and two dimensional NMR. Properties of typical spectra and phase cycling procedures are discussed. Chapter 3 describes a specific application of heteronuclear double quantum coherence to the removal of inhomogeneous broadening in liquids. Pulse sequences have been devised which cancel out any contribution from this inhomogeneity to the final spectrum. An interpretation of various pulse sequences for the case of /sup 13/C and /sup 1/H is given, together with methods of spectral editing by removal or retention of the homo- or heteronuclear J coupling. The technique is applied to a demonstration of high resolution in both frequency and spatial dimensions with a surface coil. In Chapter 4, multiple quantum filtered 2-D spectroscopy is demonstrated as an effective means of studying randomly deuterated molecules dissolved in a nematic liquid crystal. Magnitudes of dipole coupling constants have been determined for benzene and hexane, and their signs and assignments found from high order multiple quantum spectra. For the first time, a realistic impression of the conformation of hexane can be estimated from these results. Chapter 5 is a technical description of the MDB DCHIB-DR11W parallel interface which has been set up to transfer data between the Data General Nova 820 minicomputer, interfaced to the 360 MHz spectrometer, and the Vax 11/730. It covers operation of the boards, physical specifications and installation, and programs for testing and running the interface.

  20. Photoelectron angular distributions from strong-field ionization of oriented molecules

    DEFF Research Database (Denmark)

    Holmegaard, Lotte; Hansen, Jonas Lerche; Kalhøj, Line

    2010-01-01

    The combination of ultrafast light sources with detection of molecular-frame photoelectron angular distributions (MFPADs) is setting new standards for detailed interrogation of molecular dynamics. However, until recently measurement of MFPADs relied on determining the molecular orientation after...... ionization, which is limited to species and processes where ionization leads to fragmentation. An alternative is to fix the molecular frame before ionization. The only demonstrations of such spatial orientation involved aligned small linear nonpolar molecules. Here we extend these techniques to the general...... class of polar molecules. Carbonylsulphide and benzonitrile molecules, fixed in space by combined laser and electrostatic fields, are ionized with intense, circularly polarized 30-fs laser pulses. For carbonylsulphide and benzonitrile oriented in one dimension, the MFPADs exhibit pronounced anisotropies...

  1. High-harmonic spectroscopy of oriented OCS molecules: emission of even and odd harmonics.

    Science.gov (United States)

    Kraus, P M; Rupenyan, A; Wörner, H J

    2012-12-07

    We study the emission of even and odd high-harmonic orders from oriented OCS molecules. We use an intense, nonresonant femtosecond laser pulse superimposed with its phase-controlled second harmonic field to impulsively align and orient a dense sample of molecules from which we subsequently generate high-order harmonics. The even harmonics appear around the full revivals of the rotational dynamics. We demonstrate perfect coherent control over their intensity through the subcycle delay of the two-color fields. The odd harmonics are insensitive to the degree of orientation, but modulate with the degree of axis alignment, in agreement with calculated photorecombination dipole moments. We further compare the shape of the even and odd harmonic spectra with our calculations and determine the degree of orientation.

  2. Single molecule optical measurements of orientation and rotations of biological macromolecules

    OpenAIRE

    Shroder, Deborah Y; Lippert, Lisa G; Goldman, Yale E

    2016-01-01

    The subdomains of macromolecules often undergo large orientation changes during their catalytic cycles that are essential for their activity. Tracking these rearrangements in real time opens a powerful window into the link between protein structure and functional output. Site-specific labeling of individual molecules with polarized optical probes and measuring their spatial orientation can give insight into the crucial conformational changes, dynamics, and fluctuations of macromolecules. Here...

  3. Cross sections and spin polarizations of electrons elastically scattered from oriented molecules (CH3I)

    International Nuclear Information System (INIS)

    Fink, M.; Ross, A.W.; Fink, R.J.

    1989-01-01

    Elastic differential cross sections and spin polarizations for electrons elastically scattered from CH 3 I are calculated using the independent atom model. Three molecular orientations with respect to the incident electron wavevector are considered - first, the molecule is oriented randomly, second, the electron wave front and molecular bond are parallel, and third, the wavefront and the bond axis are perpendicular. It will be seen to what extent orientational averaging weakens features of the cross section and spin polarization. The calculations show that cross section and spin polarization measurements are a possible tool for determining the degree of molecular orientation. There is no degeneracy between I-C and C-I in cross section and spin polarization measurements. The results presented here for 200 eV and 600 eV electrons scattered by CH 3 I should be considered as a case study and it should be possible to find molecules and electron energies for which even more dramatic differences between the various orientations between the molecules and the electrons can be expected. (orig.)

  4. Oriented epitaxial TiO2 nanowires for water splitting

    Science.gov (United States)

    Hou, Wenting; Cortez, Pablo; Wuhrer, Richard; Macartney, Sam; Bozhilov, Krassimir N.; Liu, Rong; Sheppard, Leigh R.; Kisailus, David

    2017-06-01

    Highly oriented epitaxial rutile titanium dioxide (TiO2) nanowire arrays have been hydrothermally grown on polycrystalline TiO2 templates with their orientation dependent on the underlying TiO2 grain. Both the diameter and areal density of the nanowires were tuned by controlling the precursor concentration, and the template surface energy and roughness. Nanowire tip sharpness was influenced by precursor solubility and diffusivity. A new secondary ion mass spectrometer technique has been developed to install additional nucleation sites in single crystal TiO2 templates and the effect on nanowire growth was probed. Using the acquired TiO2 nanowire synthesis knowhow, an assortment of nanowire arrays were installed upon the surface of undoped TiO2 photo-electrodes and assessed for their photo-electrochemical water splitting performance. The key result obtained was that the presence of short and dispersed nanowire arrays significantly improved the photocurrent when the illumination intensity was increased from 100 to 200 mW cm-2. This is attributed to the alignment of the homoepitaxially grown nanowires to the [001] direction, which provides the fastest charge transport in TiO2 and an improved pathway for photo-holes to find water molecules and undertake oxidation. This result lays a foundation for achieving efficient water splitting under conditions of concentrated solar illumination.

  5. Electron-impact ionization of oriented molecules using the time-dependent close-coupling approach

    Energy Technology Data Exchange (ETDEWEB)

    Colgan, J [Theoretical Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Pindzola, M S, E-mail: jcolgan@lanl.gov [Department of Physics, Auburn University, Auburn, AL 36849 (United States)

    2011-04-01

    An overview is given on recent progress on computing triple differential cross sections for electron-impact ionization of the hydrogen molecule using a time-dependent close-coupling approach. Our calculations, when averaged over all molecular orientations, are generally in very good agreement with (e,2e) measurements made on H{sub 2}, where the molecular orientation is unknown, for a range of incident energies and outgoing electron angles and energies. In this paper, we present TDCS for ionization of H{sub 2} at specific molecular orientations. It is hoped that this study will help stimulate future measurements of TDCS from oriented H{sub 2} at medium impact energies.

  6. Effect of substrate temperature on orientation of subphthalocyanine molecule in organic photovoltaic cells

    International Nuclear Information System (INIS)

    Chou, Chi-Ta; Tang, Wei-Li; Tai, Yian; Lin, Chien-Hung; Liu, Chin-Hsin J.; Chen, Li-Chyong; Chen, Kuei-Hsien

    2012-01-01

    This study investigates the effect of substrate temperature (T s ) on the boron subphthalocyanine chloride (SubPc) thin film and its power conversion efficiency in SubPc/C 60 heterojunction photovoltaic cells. The orientations of SubPc molecules in thin films determined by X-ray diffraction is strongly correlated with the electronic properties of the organic thin films, and can be controlled by the substrate temperature during the vapor deposition. An optimal substrate temperature of 120 °C has been concluded to induced (221) molecular orientation over the (122) orientation and significantly improve the carrier transport of the SubPc thin film. A SubPc/C 60 heterojunction photovoltaic cells thus fabricated shows higher open-circuit voltage and up to 1.55% conversion efficiency has been achieved, which is attributed to preferential (221) orientation of the SubPc deposited at the elevated temperature.

  7. Transport of water molecules through noncylindrical pores in multilayer nanoporous graphene.

    Science.gov (United States)

    Shahbabaei, Majid; Kim, Daejoong

    2017-08-09

    In this study, molecular dynamics (MD) simulations are used to examine the water transport properties through asymmetric hourglass-shaped pores in multilayer nanoporous graphene with a constant interlayer separation of 6 Å. The properties of the tested asymmetric hourglass-shaped pores [with the models having long cone (l 1 , -P) and short cone (l 2 , +P) entrances] are compared to a symmetric pore model. The study findings indicate that the water occupancy increases across the asymmetric pore (l 1 , -P) compared to (l 2 , +P), because of the length effect. The asymmetric pore, (l 1 , -P), yields higher flux compared to (l 2 , +P) and even the symmetric model, which can be attributed to the increase in the hydrogen bonds. In addition, the single-file water molecules across the narrowest pore diameter inside the (l 2 , +P) pore exhibit higher viscosity compared to those in the (l 1 , -P) pore because of the increase in the water layering effect. Moreover, it is found that the permeability inside the multilayer hourglass-shaped pore depends on the length of the flow path of the water molecules before approaching the layer with the smallest pore diameter. The probability of dipole orientation exhibits wider distribution inside the (l 1 , -P) system compared to (l 2 , +P), implying an enhanced formation of hydrogen bonding of water molecules. This results in the fast flow of water molecules. The MD trajectory shows that the dipole orientation across the single-layer graphene has frequently flipped compared to the dipole orientation across the pores in multilayer graphene, which is maintained during the whole simulation time (although the dipole orientation has flipped for a few picoseconds at the beginning of the simulation). This can be attributed to the energy barrier induced by the individual layer. The diffusion coefficient of water molecules inside the (l 2 , +P) system increases with pressure difference, however, it decreases inside the (l 1 , -P) system because

  8. Control of the selectivity of the aquaporin water channel family by global orientational tuning

    DEFF Research Database (Denmark)

    Jensen, Morten Østergaard; Tajkhorshid, E.; Nollert, P.

    2002-01-01

    and orientation of a single file of seven to nine water molecules inside the channel. Two conserved asparagines force a central water molecule to serve strictly as a hydrogen bond donor to its neighboring water molecules. Assisted by the electrostatic potential generated by two half-membrane spanning loops......Aquaporins are transmembrane channels found in cell membranes of all life forms. We examine their apparently paradoxical property, facilitation of efficient permeation of water while excluding protons, which is of critical importance to preserving the electrochemical potential across the cell...... membrane. We have determined the structure of the Escherichia coli aquaglyceroporin GlpF with bound water, in native (2.7 angstroms) and in W48F/F200T mutant (2.1 angstroms) forms, and carried out 12-nanosecond molecular dynamics simulations that define the spatial and temporal probability distribution...

  9. On the Several Molecules and Nanostructures of Water

    Directory of Open Access Journals (Sweden)

    Cynthia Kolb Whitney

    2012-01-01

    Full Text Available This paper investigates the water molecule from a variety of viewpoints. Water can involve different isotopes of Hydrogen and Oxygen, it can form differently shaped isomer molecules, and, when frozen, it occupies space differently than most other substances do. The tool for conducting the investigation of all this is called ‘Algebraic Chemistry’. This tool is a quantitative model for predicting the energy budget for all sorts of changes between different ionization states of atoms that are involved in chemical reactions and in changes of physical state. The model is based on consistent patterns seen in empirical data about ionization potentials, together with rational scaling laws that can interpolate and extrapolate for situations where no data are available. The results of the investigation of the water molecule include comments, both positive and negative, about technologies involving heavy water, poly water, Brown’s gas, and cold fusion.

  10. Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.

    Science.gov (United States)

    Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin

    2013-06-20

    When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.

  11. Orientational order and rotational relaxation in the plastic crystal phase of tetrahedral molecules.

    Science.gov (United States)

    Rey, Rossend

    2008-01-17

    A methodology recently introduced to describe orientational order in liquid carbon tetrachloride is extended to the plastic crystal phase of XY4 molecules. The notion that liquid and plastic crystal phases are germane regarding orientational order is confirmed for short intermolecular distances but is seen to fail beyond, as long range orientational correlations are found for the simulated solid phase. It is argued that, if real, such a phenomenon may not to be accessible with direct (diffraction) methods due to the high molecular symmetry. This behavior is linked to the existence of preferential orientation with respect to the fcc crystalline network defined by the centers of mass. It is found that the dominant class accounts, at most, for one-third of all configurations, with a feeble dependence on temperature. Finally, the issue of rotational relaxation is also addressed, with an excellent agreement with experimental measures. It is shown that relaxation is nonhomogeneous in the picosecond range, with a slight dispersion of decay times depending on the initial orientational class. The results reported mainly correspond to neopentane over a wide temperature range, although results for carbon tetrachloride are included, as well.

  12. Integration or segregation: how do molecules behave at oil/water interfaces?

    Science.gov (United States)

    Moore, F G; Richmond, G L

    2008-06-01

    It has been over 250 years since Benjamin Franklin, fascinated with the wave-stilling effect of oil on water, performed his famous oil-drop experiments; nevertheless, the behavior of water molecules adjacent to hydrophobic surfaces continues to fascinate today. In the 18th century, the calming of the seas seemed the most pertinent application of such knowledge; today, we understand that oil-on-water phenomena underlie a range of important chemical, physical, and biological processes, including micelle and membrane formation, protein folding, chemical separation, oil extraction, nanoparticle formation, and interfacial polymerization. Beyond classical experiments of the oil-water interface, recent interest has focused on deriving a molecular-level picture of this interface or, more generally, of water molecules positioned next to any hydrophobic surface. This Account summarizes more than a decade's work from our laboratories aimed at understanding the nature of the hydrogen bonding occurring between water and a series of organic liquids in contact. Although the common perception is that water molecules and oil molecules positioned at the interface between the immiscible liquids want nothing to do with one another, we have found that weak interactions between these hydrophilic and hydrophobic molecules lead to interesting interfacial behavior, including highly oriented water molecules and layering of the organic medium that extends several molecular layers deep into the bulk organic liquid. For some organic liquids, penetration of oriented water into the organic layer is also apparent, facilitated by molecular interactions established at the molecularly thin region of first contact between the two liquids. The studies involve a combined experimental and computational approach. The primary experimental tool that we have used is vibrational sum frequency spectroscopy (VSFS), a powerful surface-specific vibrational spectroscopic method for measuring the molecular

  13. Towards ligand docking including explicit interface water molecules.

    Directory of Open Access Journals (Sweden)

    Gordon Lemmon

    Full Text Available Small molecule docking predicts the interaction of a small molecule ligand with a protein at atomic-detail accuracy including position and conformation the ligand but also conformational changes of the protein upon ligand binding. While successful in the majority of cases, docking algorithms including RosettaLigand fail in some cases to predict the correct protein/ligand complex structure. In this study we show that simultaneous docking of explicit interface water molecules greatly improves Rosetta's ability to distinguish correct from incorrect ligand poses. This result holds true for both protein-centric water docking wherein waters are located relative to the protein binding site and ligand-centric water docking wherein waters move with the ligand during docking. Protein-centric docking is used to model 99 HIV-1 protease/protease inhibitor structures. We find protease inhibitor placement improving at a ratio of 9:1 when one critical interface water molecule is included in the docking simulation. Ligand-centric docking is applied to 341 structures from the CSAR benchmark of diverse protein/ligand complexes [1]. Across this diverse dataset we see up to 56% recovery of failed docking studies, when waters are included in the docking simulation.

  14. Current-Induced Switching of a Single-Molecule Magnet with Arbitrary Oriented Easy Axis

    OpenAIRE

    Misiorny, Maciej; Barnas, Józef

    2007-01-01

    The main objective of this work is to investigate theoretically how tilting of an easy axis of a single-molecule magnet (SMM) from the orientation collinear with magnetic moments of the leads affects the switching process induced by current flowing through the system. To do this we consider a model system that consists of a SMM embedded in the nonmagnetic barrier of a magnetic tunnel junction. The anisotropy axis of the SMM forms an arbitrary angle with magnetic moments of the leads (the latt...

  15. Transport behavior of water molecules through two-dimensional nanopores

    International Nuclear Information System (INIS)

    Zhu, Chongqin; Li, Hui; Meng, Sheng

    2014-01-01

    Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules

  16. Structures of water molecules in carbon nanotubes under electric fields

    International Nuclear Information System (INIS)

    Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji

    2015-01-01

    Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate

  17. The role of water molecules in computational drug design.

    Science.gov (United States)

    de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

    2010-01-01

    Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

  18. Precise Orientation of a Single C60 Molecule on the Tip of a Scanning Probe Microscope

    Science.gov (United States)

    Chiutu, C.; Sweetman, A. M.; Lakin, A. J.; Stannard, A.; Jarvis, S.; Kantorovich, L.; Dunn, J. L.; Moriarty, P.

    2012-06-01

    We show that the precise orientation of a C60 molecule which terminates the tip of a scanning probe microscope can be determined with atomic precision from submolecular contrast images of the fullerene cage. A comparison of experimental scanning tunneling microscopy data with images simulated using computationally inexpensive Hückel theory provides a robust method of identifying molecular rotation and tilt at the end of the probe microscope tip. Noncontact atomic force microscopy resolves the atoms of the C60 cage closest to the surface for a range of molecular orientations at tip-sample separations where the molecule-substrate interaction potential is weakly attractive. Measurements of the C60C60 pair potential acquired using a fullerene-terminated tip are in excellent agreement with theoretical predictions based on a pairwise summation of the van der Waals interactions between C atoms in each cage, i.e., the Girifalco potential [L. Girifalco, J. Phys. Chem. 95, 5370 (1991)JPCHAX0022-365410.1021/j100167a002].

  19. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DEFF Research Database (Denmark)

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  20. Single Molecule 3D Orientation in Time and Space: A 6D Dynamic Study on Fluorescently Labeled Lipid Membranes

    DEFF Research Database (Denmark)

    Börner, Richard; Ehrlich, Nicky; Hohlbein, Johannes

    2016-01-01

    Interactions between single molecules profoundly depend on their mutual three-dimensional orientation. Recently, we demonstrated a technique that allows for orientation determination of single dipole emitters using a polarization-resolved distribution of fluorescence into several detection channels...... interesting in non-isotropic environments such as lipid membranes, which are of great importance in biology. We used giant unilamellar vesicles (GUVs) labeled with fluorescent dyes down to a single molecule concentration as a model system for both, assessing the robustness of the orientation determination...

  1. Control of unidirectional transport of single-file water molecules through carbon nanotubes in an electric field.

    Science.gov (United States)

    Su, Jiaye; Guo, Hongxia

    2011-01-25

    The transport of water molecules through nanopores is not only crucial to biological activities but also useful for designing novel nanofluidic devices. Despite considerable effort and progress that has been made, a controllable and unidirectional water flow is still difficult to achieve and the underlying mechanism is far from being understood. In this paper, using molecular dynamics simulations, we systematically investigate the effects of an external electric field on the transport of single-file water molecules through a carbon nanotube (CNT). We find that the orientation of water molecules inside the CNT can be well-tuned by the electric field and is strongly coupled to the water flux. This orientation-induced water flux is energetically due to the asymmetrical water-water interaction along the CNT axis. The wavelike water density profiles are disturbed under strong field strengths. The frequency of flipping for the water dipoles will decrease as the field strength is increased, and the flipping events vanish completely for the relatively large field strengths. Most importantly, a critical field strength E(c) related to the water flux is found. The water flux is increased as E is increased for E ≤ E(c), while it is almost unchanged for E > E(c). Thus, the electric field offers a level of governing for unidirectional water flow, which may have some biological applications and provides a route for designing efficient nanopumps.

  2. Relative orientation of collagen molecules within a fibril: a homology model for homo sapiens type I collagen.

    Science.gov (United States)

    Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

    2018-02-15

    Type I collagen is an essential extracellular protein that plays an important structural role in tissues that require high tensile strength. However, owing to the molecule's size, to date no experimental structural data are available for the Homo sapiens species. Therefore, there is a real need to develop a reliable homology model and a method to study the packing of the collagen molecules within the fibril. Through the use of the homology model and implementation of a novel simulation technique, we have ascertained the orientations of the collagen molecules within a fibril, which is currently below the resolution limit of experimental techniques. The longitudinal orientation of collagen molecules within a fibril has a significant effect on the mechanical and biological properties of the fibril, owing to the different amino acid side chains available at the interface between the molecules.

  3. Water-assisted dehalogenation of thionyl chloride in the presence of water molecules.

    Science.gov (United States)

    Yeung, Chi Shun; Ng, Ping Leung; Guan, Xiangguo; Phillips, David Lee

    2010-04-01

    A second-order Møller-Plesset perturbation theory (MP2) and density functional theory (DFT) investigation of the dehalogenation reactions of thionyl chloride is reported, in which water molecules (up to seven) were explicitly involved in the reaction complex. The dehalogenation processes of thionyl chloride were found to be dramatically catalyzed by water molecules. The reaction rate became significantly faster as more water molecules became involved in the reaction complex. The dehalogenation processes can be reasonably simulated by the gas-phase water cluster models, which reveals that water molecules can help to solvate the thionyl chloride molecules and activate the release of the Cl(-) leaving group. The computed activation energies were used to compare the calculations to available experimental data.

  4. Vibrational properties of water molecules adsorbed in different zeolitic frameworks

    International Nuclear Information System (INIS)

    Crupi, V; Longo, F; Majolino, D; Venuti, V

    2006-01-01

    The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different

  5. Photoionization of water molecules by high energy photons

    Directory of Open Access Journals (Sweden)

    Lara Martini

    2017-07-01

    Full Text Available We theoretically study the photoionization of water molecules by high energy photon impact. We develop a model in which the final state wavefunction is given by a Coulomb continuum wavefunction with effective charges and the water molecule bound states are represented using the Moccia's monocentric wavefunctions. We obtain analytical expressions for the transition matrix element that enable the computation of cross sections by numerical quadratures. We compare our predictions for photon energies between 20 and 300 eV with more elaborated theoretical results and experiments. We obtain a very good agreement with experiments, in particular, at enough high energies where there is a lack of elaborated results due to their high computational cost. Received: 15 March 2017, Accepted: 25 June 2017; Edited by: S. Kais; DOI: http://dx.doi.org/10.4279/PIP.090006 Cite as: L Martini, D I R Boll, O A Fojón, Papers in Physics 9, 090006 (2017

  6. Scattering of thermal neutron by the water molecule

    International Nuclear Information System (INIS)

    Rosa, L.P.

    The calculation of the differenctial cross section for scattering of thermal neutrons by water, taking into account the translational, rotational and vibrational motions of the water molecule, is presented according to Nelkin' model. Some modifications are presented which have been introduced in the original method to improve the results and an application has been made to reactor physics, by calculating the thermal neutron flux in a homogenous medium containing water and absorver. Thirty thermal energy groups have been used to compute the spectra. Within the limits of error, better agreement has been obtained between theory and experiments by using a modified Nelkin kernel consisting of substituting the asymptotic formulae for the rotational and vibrational motions by more exact expressions, similar to the Buttler model for heavy water

  7. Langevin equation method for the rotational Brownian motion and orientational relaxation in liquids: II. Symmetrical top molecules

    CERN Document Server

    Coffey, W T; Titov, S V

    2003-01-01

    A theory of orientational relaxation for the inertial rotational Brownian motion of a symmetric top molecule is developed using the Langevin equation rather than the Fokker-Planck equation. The infinite hierarchy of differential-recurrence relations for the orientational correlation functions for the relaxation behaviour is derived by averaging the corresponding Euler-Langevin equations. The solution of this hierarchy is obtained using matrix continued fractions allowing the calculation of the correlation times and the spectra of the orientational correlation functions for typical values of the model parameters.

  8. STICKING OF MOLECULES ON NONPOROUS AMORPHOUS WATER ICE

    Energy Technology Data Exchange (ETDEWEB)

    He, Jiao; Vidali, Gianfranco [Physics Department, Syracuse University, Syracuse, NY 13244 (United States); Acharyya, Kinsuk, E-mail: gvidali@syr.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-05-20

    Accurate modeling of physical and chemical processes in the interstellar medium (ISM) requires detailed knowledge of how atoms and molecules adsorb on dust grains. However, the sticking coefficient, a number between 0 and 1 that measures the first step in the interaction of a particle with a surface, is usually assumed in simulations of ISM environments to be either 0.5 or 1. Here we report on the determination of the sticking coefficient of H{sub 2}, D{sub 2}, N{sub 2}, O{sub 2}, CO, CH{sub 4}, and CO{sub 2} on nonporous amorphous solid water. The sticking coefficient was measured over a wide range of surface temperatures using a highly collimated molecular beam. We showed that the standard way of measuring the sticking coefficient—the King–Wells method—leads to the underestimation of trapping events in which there is incomplete energy accommodation of the molecule on the surface. Surface scattering experiments with the use of a pulsed molecular beam are used instead to measure the sticking coefficient. Based on the values of the measured sticking coefficient, we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy. We use this formula in a simulation of ISM gas–grain chemistry to find the effect of sticking on the abundance of key molecules both on grains and in the gas phase.

  9. Electric dipole moments of nanosolvated acid molecules in water clusters.

    Science.gov (United States)

    Guggemos, Nicholas; Slavíček, Petr; Kresin, Vitaly V

    2015-01-30

    The electric dipole moments of (H2O)nDCl (n=3-9) clusters have been measured by the beam-deflection method. Reflecting the (dynamical) charge distribution within the system, the dipole moment contributes information about the microscopic structure of nanoscale solvation. The addition of a DCl molecule to a water cluster results in a strongly enhanced susceptibility. There is evidence for a noticeable rise in the dipole moment occurring at n≈5-6. This size is consistent with predictions for the onset of ionic dissociation. Additionally, a molecular-dynamics model suggests that even with a nominally bound impurity an enhanced dipole moment can arise due to the thermal and zero-point motion of the proton and the water molecules. The experimental measurements and the calculations draw attention to the importance of fluctuations in defining the polarity of water-based nanoclusters and generally to the essential role played by motional effects in determining the response of fluxional nanoscale systems under realistic conditions.

  10. Hydrogen bonding characterization in water and small molecules

    Science.gov (United States)

    Silvestrelli, Pier Luigi

    2017-06-01

    The prototypical hydrogen bond in water dimer and hydrogen bonds in the protonated water dimer, in other small molecules, in water cyclic clusters, and in ice, covering a wide range of bond strengths, are theoretically investigated by first-principles calculations based on density functional theory, considering not only a standard generalized gradient approximation functional but also, for the water dimer, hybrid and van der Waals corrected functionals. We compute structural, energetic, and electrostatic (induced molecular dipole moments) properties. In particular, hydrogen bonds are characterized in terms of differential electron density distributions and profiles, and of the shifts of the centres of maximally localized Wannier functions. The information from the latter quantities can be conveyed to a single geometric bonding parameter that appears to be correlated with the Mayer bond order parameter and can be taken as an estimate of the covalent contribution to the hydrogen bond. By considering the water trimer, the cyclic water hexamer, and the hexagonal phase of ice, we also elucidate the importance of cooperative/anticooperative effects in hydrogen-bonding formation.

  11. Continuum simulations of water flow past fullerene molecules

    DEFF Research Database (Denmark)

    Popadic, A.; Praprotnik, M.; Koumoutsakos, P.

    2015-01-01

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently by continuum flow...

  12. Selective control of photodissociation in deutereted water molecule HOD

    International Nuclear Information System (INIS)

    Adhikari, S.; Deshpande, Sarin; Sarma, Manabendra; Kurkal, Vandana; Mishra, M.K.

    2006-01-01

    Bond dissociation in the deutereted water molecule HOD has been investigated to explore the possibility of selective control of dissociation of O-H and O-D bonds using simple field profiles and initial states that do not require high overtone excitations. Preliminary results indicate that considerable selectivity in dissociation of O-H and O-D bonds can be achieved using fundamental and first overtone excitations only and use of field optimized initial state (FOIST) based scheme with appropriate choice of field parameters and initial states may enhance both selectivity and yield

  13. Heterogeneous Ice Nucleation: Interplay of Surface Properties and Their Impact on Water Orientations.

    Science.gov (United States)

    Glatz, Brittany; Sarupria, Sapna

    2018-01-23

    Ice is ubiquitous in nature, and heterogeneous ice nucleation is the most common pathway of ice formation. How surface properties affect the propensity to observe ice nucleation on that surface remains an open question. We present results of molecular dynamics studies of heterogeneous ice nucleation on model surfaces. The models surfaces considered emulate the chemistry of kaolinite, an abundant component of mineral dust. We investigate the interplay of surface lattice and hydrogen bonding properties in affecting ice nucleation. We find that lattice matching and hydrogen bonding are necessary but not sufficient conditions for observing ice nucleation at these surfaces. We correlate this behavior to the orientations sampled by the metastable supercooled water in contact with the surfaces. We find that ice is observed in cases where water molecules not only sample orientations favorable for bilayer formation but also do not sample unfavorable orientations. This distribution depends on both surface-water and water-water interactions and can change with subtle modifications to the surface properties. Our results provide insights into the diverse behavior of ice nucleation observed at different surfaces and highlight the complexity in elucidating heterogeneous ice nucleation.

  14. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    International Nuclear Information System (INIS)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  15. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  16. Spectral manifestations of orientational motion dynamics of CO molecules in liquid Ar in wings of the CO fundamental band

    International Nuclear Information System (INIS)

    Kondaurov, V.A.; Filippov, N.N.

    1995-01-01

    The shape of the CO fundamental band in the 2000 to 2300 cm -1 range was studied in the IR absorption spectrum of dilute solutions of CO in liquid Ar. The memory function of the orientational motion of the CO molecules was shown to have two maxima indicative of the librational nature of motion of the CO molecules in liquid Ar. The value of the libration frequency v 1 = 34 ± 8 cm -1 allows us to calculate the torque acting on a molecule in the orientating field of the surrounding particles of a liquid. The torque appears to be one-half the value found from the spectral moment analysis of the band. This discrepancy is most likely due to contributions from random torques caused by strong fluctuations of the orientating field. Analysis of the exponential behavior of the band wings permits us to determine the relaxation rate of rotational perturbations, v d = 17 ± 1 cm -1 , in the liquid system CO + Ar. It follows from comparison with an appreciably smaller value of v d in the CO 2 + Ar system that the character of reorientations of CO molecules in liquid Ar is intermediate between those of crystallike and gaslike motions. 16 refs., 2 figs., 3 tabs

  17. Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

    International Nuclear Information System (INIS)

    Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan

    2011-01-01

    Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

  18. Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

    Energy Technology Data Exchange (ETDEWEB)

    Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)

    2011-03-01

    Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

  19. Molecular multipole moments of water molecules in ice Ih

    International Nuclear Information System (INIS)

    Batista, E.R.; Xantheas, S.S.; Jonsson, H.

    1998-01-01

    We have used an induction model including dipole, dipole endash quadrupole, quadrupole endash quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments to study the electric field in ice. The self-consistent induction calculations gave an average total dipole moment of 3.09 D, a 67% increase over the dipole moment of an isolated water molecule. A previous, more approximate induction model study by Coulson and Eisenberg [Proc. R. Soc. Lond. A 291, 445 (1966)] suggested a significantly smaller average value of 2.6 D. This value has been used extensively in recent years as a reference point in the development of various polarizable interaction potentials for water as well as for assessment of the convergence of water cluster properties to those of bulk. The reason for this difference is not due to approximations made in the computational scheme of Coulson and Eisenberg but rather due to the use of less accurate values for the molecular multipoles in these earlier calculations. copyright 1998 American Institute of Physics

  20. Distribution of binding energies of a water molecule in the water liquid-vapor interface

    Energy Technology Data Exchange (ETDEWEB)

    Chempath, Shaji [Los Alamos National Laboratory; Pratt, Lawrence R [TULANE UNIV

    2008-01-01

    Distributions of binding energies of a water molecule in the water liquid-vapor interface are obtained on the basis of molecular simulation with the SPC/E model of water. These binding energies together with the observed interfacial density profile are used to test a minimally conditioned Gaussian quasi-chemical statistical thermodynamic theory. Binding energy distributions for water molecules in that interfacial region clearly exhibit a composite structure. A minimally conditioned Gaussian quasi-chemical model that is accurate for the free energy of bulk liquid water breaks down for water molecules in the liquid-vapor interfacial region. This breakdown is associated with the fact that this minimally conditioned Gaussian model would be inaccurate for the statistical thermodynamics of a dilute gas. Aggressive conditioning greatly improves the performance of that Gaussian quasi-chemical model. The analogy between the Gaussian quasi-chemical model and dielectric models of hydration free energies suggests that naive dielectric models without the conditioning features of quasi-chemical theory will be unreliable for these interfacial problems. Multi-Gaussian models that address the composite nature of the binding energy distributions observed in the interfacial region might provide a mechanism for correcting dielectric models for practical applications.

  1. Rapid and accurate prediction and scoring of water molecules in protein binding sites.

    Directory of Open Access Journals (Sweden)

    Gregory A Ross

    Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

  2. Double ionization of the hydrogen sulfide molecule by electron impact: Influence of the target orientation on multiple differential cross sections

    Energy Technology Data Exchange (ETDEWEB)

    Imadouchene, N. [Laboratoire de Mécanique, Structures et Energétique Université Mouloud Mammeri de Tizi-Ouzou, B.P. 17, Tizi-Ouzou 15000 (Algeria); Aouchiche, H., E-mail: h_aouchiche@yahoo.fr [Laboratoire de Mécanique, Structures et Energétique Université Mouloud Mammeri de Tizi-Ouzou, B.P. 17, Tizi-Ouzou 15000 (Algeria); Champion, C. [Centre d’Etudes Nucléaires de Bordeaux Gradignan, Université Bordeaux, CNRS/IN2P3, Boîte Postale 120, Gradignan 33175 (France)

    2016-07-15

    Highlights: • The double ionization of the H{sub 2}S molecule is here theoretically studied. • The orientation dependence of the differential cross sections is scrutinized. • The specific double ionizing mechanisms are clearly identified. - Abstract: Multiple differential cross sections of double ionization of hydrogen sulfide molecule impacted by electrons are here investigated within the first Born approximation. In the initial state, the incident electron is represented by a plane wave function whereas the target is described by means of a single-center molecular wave function. In the final state, the two ejected electrons are described by Coulomb wave functions coupled by the Gamow factor, whereas the scattered electron is described by a plane wave. In this work, we analyze the role played by the molecular target orientation in the double ionization of the four outermost orbitals, namely 2b{sub 1}, 5a{sub 1}, 2b{sub 2} and 4a{sub 1} in considering the particular case of two electrons ejected from the same orbital. The contribution of each final state to the double ionization process is studied in terms of shape and magnitude for specific molecular orientations and for each molecular orbital we identified the mechanisms involved in the double ionization process, namely, the Shake-Off and the Two-Step 1.

  3. Imaging Molecular Structure through Femtosecond Photoelectron Diffraction on Aligned and Oriented Gas-Phase Molecules

    DEFF Research Database (Denmark)

    Boll, Rebecca; Rouzee, Arnaud; Adolph, Marcus

    2014-01-01

    This paper gives an account of our progress towards performing femtosecond time-resolved photoelectron diffraction on gas-phase molecules in a pump-probe setup combining optical lasers and an X-ray Free-Electron Laser. We present results of two experiments aimed at measuring photoelectron angular...

  4. Structure of the first- and second-neighbor shells of simulated water: Quantitative relation to translational and orientational order

    Science.gov (United States)

    Yan, Zhenyu; Buldyrev, Sergey V.; Kumar, Pradeep; Giovambattista, Nicolas; Debenedetti, Pablo G.; Stanley, H. Eugene

    2007-11-01

    We perform molecular dynamics simulations of water using the five-site transferable interaction potential (TIP5P) model to quantify structural order in both the first shell (defined by four nearest neighbors) and second shell (defined by twelve next-nearest neighbors) of a central water molecule. We find that the anomalous decrease of orientational order upon compression occurs in both shells, but the anomalous decrease of translational order upon compression occurs mainly in the second shell. The decreases of translational order and orientational order upon compression (called the “structural anomaly”) are thus correlated only in the second shell. Our findings quantitatively confirm the qualitative idea that the thermodynamic, structural, and hence dynamic anomalies of water are related to changes upon compression in the second shell.

  5. Simulations of the flipping images and microparameters of molecular orientations in liquids according to the molecule string model

    International Nuclear Information System (INIS)

    Wang Li-Na; Zhao Xing-Yu; Zhang Li-Li; Huang Yi-Neng

    2012-01-01

    The relaxation dynamics of liquids is one of the fundamental problems in liquid physics, and it is also one of the key issues to understand the glass transition mechanism. It will undoubtedly provide enlightenment on understanding and calculating the relaxation dynamics if the molecular orientation flipping images and relevant microparameters of liquids are studied. In this paper, we first give five microparameters to describe the individual molecular string (MS) relaxation based on the dynamical Hamiltonian of the MS model, and then simulate the images of individual MS ensemble, and at the same time calculate the parameters of the equilibrium state. The results show that the main molecular orientation flipping image in liquids (including supercooled liquid) is similar to the random walk. In addition, two pairs of the parameters are equal, and one can be ignored compared with the other. This conclusion will effectively reduce the difficulties in calculating the individual MS relaxation based on the single-molecule orientation flipping rate of the general Glauber type, and the computer simulation time of interaction MS relaxation. Moreover, the conclusion is of reference significance for solving and simulating the multi-state MS model. (condensed matter: structural, mechanical, and thermal properties)

  6. Chemical reactions of water molecules on Ru(0001) induced by selective excitation of vibrational modes

    Energy Technology Data Exchange (ETDEWEB)

    Mugarza, Aitor; Shimizu, Tomoko K.; Ogletree, D. Frank; Salmeron, Miquel

    2009-05-07

    Tunneling electrons in a scanning tunneling microscope were used to excite specific vibrational quantum states of adsorbed water and hydroxyl molecules on a Ru(0 0 0 1) surface. The excited molecules relaxed by transfer of energy to lower energy modes, resulting in diffusion, dissociation, desorption, and surface-tip transfer processes. Diffusion of H{sub 2}O molecules could be induced by excitation of the O-H stretch vibration mode at 445 meV. Isolated molecules required excitation of one single quantum while molecules bonded to a C atom required at least two quanta. Dissociation of single H{sub 2}O molecules into H and OH required electron energies of 1 eV or higher while dissociation of OH required at least 2 eV electrons. In contrast, water molecules forming part of a cluster could be dissociated with electron energies of 0.5 eV.

  7. Study on orientation mechanisms of poly(vinylidenefluoride-trifluoroethylene) molecules aligned by atomic force microscopy

    International Nuclear Information System (INIS)

    Kimura, Kuniko; Kobayashi, Kei; Yamada, Hirofumi; Horiuchi, Toshihisa; Ishida, Kenji; Matsushige, Kazumi

    2006-01-01

    We have developed a molecular orientation control technique for polymers utilizing contact-mode atomic force microscopy (AFM). In this paper, we studied the molecular alignment mechanism of this technique by applying it to poly(vinylidenefluoride-trifluoroethylene) (P(VDF-TrFE)). The resultant alignment and formed crystal size were strongly dependent on the temperature during the modification. They also depended on the scan line spacing of the modification. These results made the alignment mechanism clear. The obtained molecular alignment was stable against the heat treatment even at the temperatures just below T m

  8. Communication: Salt-induced water orientation at a surface of non-ionic surfactant in relation to a mechanism of Hofmeister effect

    Energy Technology Data Exchange (ETDEWEB)

    Hishida, Mafumi; Kaneko, Yohei; Okuno, Masanari; Yamamura, Yasuhisa; Ishibashi, Taka-aki; Saito, Kazuya, E-mail: kazuya@chem.tsukuba.ac.jp [Department of Chemistry, Faculty of Pure and Applied Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8571 (Japan)

    2015-05-07

    The behavior of water molecules at the surface of nonionic surfactant (monomyristolein) and effects of monovalent ions on the behavior are investigated using the heterodyne-detected vibrational sum frequency generation spectroscopy. It is found that water molecules at the surface are oriented with their hydrogen atoms pointing to the bulk, and that the degree of orientation depends on the anion strongly but weakly on the cation. With measured surface potentials in those saline solutions, it is concluded that the heterogeneous distribution of anions and cations in combination with the nonionic surfactant causes the water orientation. This heterogeneous distribution well explains the contrasting order of anions and cations with respect to the ion size in the Hofmeister series.

  9. Communication: Salt-induced water orientation at a surface of non-ionic surfactant in relation to a mechanism of Hofmeister effect

    International Nuclear Information System (INIS)

    Hishida, Mafumi; Kaneko, Yohei; Okuno, Masanari; Yamamura, Yasuhisa; Ishibashi, Taka-aki; Saito, Kazuya

    2015-01-01

    The behavior of water molecules at the surface of nonionic surfactant (monomyristolein) and effects of monovalent ions on the behavior are investigated using the heterodyne-detected vibrational sum frequency generation spectroscopy. It is found that water molecules at the surface are oriented with their hydrogen atoms pointing to the bulk, and that the degree of orientation depends on the anion strongly but weakly on the cation. With measured surface potentials in those saline solutions, it is concluded that the heterogeneous distribution of anions and cations in combination with the nonionic surfactant causes the water orientation. This heterogeneous distribution well explains the contrasting order of anions and cations with respect to the ion size in the Hofmeister series

  10. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  11. Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site

    Directory of Open Access Journals (Sweden)

    Hymavati

    2012-01-01

    Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.

  12. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  13. A Services-Oriented Architecture for Water Observations Data

    Science.gov (United States)

    Maidment, D. R.; Zaslavsky, I.; Valentine, D.; Tarboton, D. G.; Whitenack, T.; Whiteaker, T.; Hooper, R.; Kirschtel, D.

    2009-04-01

    Water observations data are time series of measurements made at point locations of water level, flow, and quality and corresponding data for climatic observations at point locations such as gaged precipitation and weather variables. A services-oriented architecture has been built for such information for the United States that has three components: hydrologic information servers, hydrologic information clients, and a centralized metadata cataloging system. These are connected using web services for observations data and metadata defined by an XML-based language called WaterML. A Hydrologic Information Server can be built by storing observations data in a relational database schema in the CUAHSI Observations Data Model, in which case, web services access to the data and metadata is automatically provided by query functions for WaterML that are wrapped around the relational database within a web server. A Hydrologic Information Server can also be constructed by custom-programming an interface to an existing water agency web site so that responds to the same queries by producing data in WaterML as do the CUAHSI Observations Data Model based servers. A Hydrologic Information Client is one which can interpret and ingest WaterML metadata and data. We have two client applications for Excel and ArcGIS and have shown how WaterML web services can be ingested into programming environments such as Matlab and Visual Basic. HIS Central, maintained at the San Diego Supercomputer Center is a repository of observational metadata for WaterML web services which presently indexes 342 million data measured at 1.75 million locations. This is the largest catalog water observational data for the United States presently in existence. As more observation networks join what we term "CUAHSI Water Data Federation", and the system accommodates a growing number of sites, measured parameters, applications, and users, rapid and reliable access to large heterogeneous hydrologic data repositories

  14. Theoretical investigation of the ultrafast dissociation of core-ionized water and uracil molecules immersed in liquid water

    Energy Technology Data Exchange (ETDEWEB)

    Stia, C.R.; Fojon, O.A. [Instituto de Fisica Rosario - CONICET-Universidad Nacional de Rosario, Rosario (Argentina); Gaigeot, M.P. [Laboratoire Analyse et Modelisation pour la Biologie et l' Environnement, LAMBE, UMR-CNRS 8587, Universite d' Evry-Val-d' Essonne, 91 - Evry (France); Institut Universitaire de France, 75 - Paris (France); Vuilleumier, R. [Departement de chimie, Ecole Normale Superieure, 75 - Paris (France); Herve du Penhoat, M.A.; Politis, M.F. [Institut de Mineralogie et de Physique des Milieux Condenses, IMPMC, UMR-CNRS 7590, Universite Pierre et Marie Curie, 75 - Paris (France)

    2010-10-15

    We present a series of ab initio density functional based calculations of the fragmentation dynamics of core-ionized biomolecules. The computations are performed for pure liquid water, aqueous and isolated Uracil. Core ionization is described by replacing the 1s{sup 2} pseudopotential of one atom of the target molecule (C, N or O) with a pseudopotential for a 1s{sup 1} core-hole state. Our results predict that the dissociation of core-ionized water molecules may be reached during the lifetime of inner-shell vacancy (less than 10 fs), leading to OH bond breakage as a primary outcome. We also observe a second fragmentation channel in which total Coulomb explosion of the ionized water molecule occurs. Fragmentation pathways are found similar for pure water or when the water molecule is in the primary hydration shell of the uracil molecule. In the latter case, the proton may be transferred towards the uracil oxygen atoms. When the core hole is located on the uracil molecule, ultrafast dissociation is only observed in the aqueous environment and for nitrogen-K vacancies, resulting in proton transfers towards the hydrogen-bonded water molecule. (authors)

  15. Quick synthesis of highly aligned or randomly oriented nanofibrous structures composed of C60 molecules via self-assembly

    International Nuclear Information System (INIS)

    Kurosu, Shunji; Fukuda, Takahiro; Maekawa, Toru

    2013-01-01

    Assemblies, which are composed of nanoparticles such as nanofibres, have been intensively studied in recent years. This has particularly been the case in the field of biomedicine, where the aim is to develop efficient methodologies for capturing and separating target biomolecules and cells and/or encouraging bio-chemical reactions, utilizing the extremely high surface area to volume ratio of assemblies. There is an urgent need for the development of a quick synthesis method of forming nanofibrous structures on the surface of biomedical microchips and devices for the investigation of the interactions between biomolecules/cells and the nanostructures. Here, we produce nanofibrous structures composed of C 60 molecules, which are aligned in one direction or randomly oriented, by dissolving C 60 molecules and sulphur in benzene and evaporating a droplet of the solution on a glass substrate under appropriate conditions. The synthesis time is as short as 30 s. Sulphur is extracted and nanofibres are crystallized by leaving them in supercritical carbon dioxide. (paper)

  16. Dynamics of water molecules in the active-site cavity of human cytochromes P450

    DEFF Research Database (Denmark)

    Rydberg, Patrik; Rod, Thomas Holm; Olsen, Lars

    2007-01-01

    We have studied the dynamics of water molecules in six crystal structures of four human cytochromes P450, 2A6, 2C8, 2C9, and 3A4, with molecular dynamics simulations. In the crystal structures, only a few water molecules are seen and the reported sizes of the active-site cavity vary a lot....... In the simulations, the cavities are completely filled with water molecules, although with approximately 20% lower density than in bulk water. The 2A6 protein differs from the other three in that it has a very small cavity with only two water molecules and no exchange with the surroundings. The other three proteins...... channels, through which there is a quite frequent exchange of water molecules (one molecule is exchanged every 30-200 ps), except in 2A6. Most of the channels are observed also in the crystal structures, but two to three channels in each protein open only during the simulations. There are no water...

  17. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    International Nuclear Information System (INIS)

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  18. Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl

    Science.gov (United States)

    Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.

    2018-02-01

    Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.

  19. Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

    KAUST Repository

    Shinagawa, Tatsuya; Takanabe, Kazuhiro

    2015-01-01

    Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed

  20. Adsorptionof polar organic molecules at oil/water interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Aveyard, R; Chapman, J

    1975-03-15

    A study has been made of the adsorption of several esters of dicarboxylic acids at the alkane/water and the air/water interface. The adsorption of n-butanol and n-heptanol at the air/water surface also has been investigated. The surface pressure (pi) -surface area (A) isotherms are compared for the various films, and standard free energies of adsorption have been determined. Attempts have been made to fit the pi, A isotherms using surface equations of state based on the models, of both a 2-dimensional gas and a 2-dimensional solution. The solution model has proved reasonably successful for fairly dilute films at the air/water surface. At higher coverages, an equation derived by Smith for liquid expanded monolayers gives a moderately good description of films of heptanol on water. A simple application of the solution model on adsorbed monolayers at the liquid; liquid interface met with little success. However, it is found that 2-dimensional gas equations describe such systems surprisingly well for fairly low surface concentrations. (20 refs.)

  1. Roles of water molecules in bacteria and viruses

    Science.gov (United States)

    Cox, C. S.

    1993-02-01

    In addition to water, microbes mainly comprise lipids, carbohydrates, proteins and nucleic acids. Their structure and function singularly and conjointly is affected by water activity. Desiccation leads to dramatic lipid phase changes whereas carbohydrates, proteins and nucleic acids initially suffer spontaneous, reversible low activation energy Maillard reactions forming products that more slowly re-arrange, cross-link etc. to give non-native states. While initial products spontaneously may reverse to native states by raising water activity, later products only do so through energy consumption and enzymatic activity eg. repair. Yet, native states of lipid membranes and associated enzymes are required to generate energy. Consequently, good reserves of high energy compounds (e.g. ATP) and of membrane stabilisers (e.g. trehalose) may be expected to enhance survival following drying and rehydration (e.g. anhydrobiotic organisms).

  2. Effect of water molecule distribution on the quantitative XRD analysis in the case of Na-montmorillonite exchanged Cu2+

    International Nuclear Information System (INIS)

    Oueslati, W.; Meftah, M.; Ben Rhaiem, H.; Ben Haj Amara, A.

    2010-01-01

    Document available in extended abstract form only. Several theoretical models are proposed to describe hydration process for Wyoming-montmorillonite clay exchanged Na + or Cu 2+ . They propose some theoretical distribution and disposition for water molecule in the inter-lamellar space in the case of homogeneous and inter-stratified hydration states. For example, Ben Brahim et al. (1983a) studied the interlayer structure (atomic positions of interlayer cations) and associated H 2 O molecules of Na-saturated montmorillonite and beidellite samples. Moore and Hower (1986) studied ordered structures composed of mono-hydrated and collapsed interlayers in montmorillonite, and Cuadros (1996) estimated the H 2 O content of smectite as a function of the interlayer cation. Using similar approach, Ferrage et al (2005b) proposed a discreet distribution of water molecule layer in the same z coordinate of the exchangeable cation with inhomogeneous distribution. This heterogeneity was attributed to the surface charge. The main objective of this study is to characterize the structural changes in the theoretical XRD profile, induced by different water molecule distribution, used to simulate experimental XRD patterns in the case of Na-montmorillonite exchanged Cu 2+ . This problem was achieved by quantitative XRD analysis using an indirect method based on the comparison of the experimental 001 reflections obtained from oriented films patterns with those calculated from structural models. The starting materials were Ca-montmorillonite originated from bentonites of Wyoming (USA). The XRD patterns were obtained by reflection setting with a D8 ADVANCE Bruker installation using Cu-Kα radiation and equipped with solid state detector. Intensities were measured at an interval of 2Θ 0.04 deg. and 40-50 s counting time per step. The diffracted intensity was calculated according to the matrix formalism detailed by Drits and Tchoubar, (1990). The fitting strategies was detailed by Ferrage et

  3. Contamination of boreholes water by 76 pesticides molecules in the ...

    African Journals Online (AJOL)

    user2

    to be the cause of the degradation of the quality of sur- face and ground waters ... network and the nature of the soil generally clay lateritic with high permeability. .... 0.006 0.008 0.004 0.004 0.004 0.007 0.008 0.004 0.004 0.004 Malathion.

  4. Oriented Polar Molecules in a Solid Inert-Gas Matrix: A Proposed Method for Measuring the Electric Dipole Moment of the Electron

    Directory of Open Access Journals (Sweden)

    A. C. Vutha

    2018-01-01

    Full Text Available We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the z ^ -direction by an applied electric field, as has recently been demonstrated by Park et al. The trapped molecules are prepared into a state that has its electron spin perpendicular to z ^ , and a magnetic field along z ^ causes precession of this spin. An electron electric dipole moment d e would affect this precession due to the up to 100 GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring d e to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.

  5. Oriented Polar Molecules in a Solid Inert-Gas Matrix: A Proposed Method for Measuring the Electric Dipole Moment of the Electron

    Science.gov (United States)

    Vutha, A.; Horbatsch, M.; Hessels, E.

    2018-01-01

    We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the $\\hat{\\rm{z}}$ direction by an applied electric field, as has recently been demonstrated by Park, et al. [Angewandte Chemie {\\bf 129}, 1066 (2017)]. The trapped molecules are prepared into a state which has its electron spin perpendicular to $\\hat{\\rm{z}}$, and a magnetic field along $\\hat{\\rm{z}}$ causes precession of this spin. An electron electric dipole moment $d_e$ would affect this precession due to the up to 100~GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring $d_e$ to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.

  6. Maintained expression of the planar cell polarity molecule Vangl2 and reformation of hair cell orientation in the regenerating inner ear.

    Science.gov (United States)

    Warchol, Mark E; Montcouquiol, Mireille

    2010-09-01

    The avian inner ear possesses a remarkable ability to regenerate sensory hair cells after ototoxic injury. Regenerated hair cells possess phenotypes and innervation that are similar to those found in the undamaged ear, but little is known about the signaling pathways that guide hair cell differentiation during the regenerative process. The aim of the present study was to examine the factors that specify the orientation of hair cell stereocilia bundles during regeneration. Using organ cultures of the chick utricle, we show that hair cells are properly oriented after having regenerated entirely in vitro and that orientation is not affected by surgical removal of the striolar reversal zone. These results suggest that the orientation of regenerating stereocilia is not guided by the release of a diffusible morphogen from the striolar reversal zone but is specified locally within the regenerating sensory organ. In order to determine the nature of the reorientation cues, we examined the expression patterns of the core planar cell polarity molecule Vangl2 in the normal and regenerating utricle. We found that Vangl2 is asymmetrically expressed on cells within the sensory epithelium and that this expression pattern is maintained after ototoxic injury and throughout regeneration. Notably, treatment with a small molecule inhibitor of c-Jun-N-terminal kinase disrupted the orientation of regenerated hair cells. Both of these results are consistent with the hypothesis that noncanonical Wnt signaling guides hair cell orientation during regeneration.

  7. Water-mediated influence of a crowded environment on internal vibrations of a protein molecule.

    Science.gov (United States)

    Kuffel, Anna; Zielkiewicz, Jan

    2016-02-14

    The influence of crowding on the protein inner dynamics is examined by putting a single protein molecule close to one or two neighboring protein molecules. The presence of additional molecules influences the amplitudes of protein fluctuations. Also, a weak dynamical coupling of collective velocities of surface atoms of proteins separated by a layer of water is detected. The possible mechanisms of these phenomena are described. The cross-correlation function of the collective velocities of surface atoms of two proteins was decomposed into the Fourier series. The amplitude spectrum displays a peak at low frequencies. Also, the results of principal component analysis suggest that the close presence of an additional protein molecule influences the high-amplitude, low-frequency modes in the most prominent way. This part of the spectrum covers biologically important protein motions. The neighbor-induced changes in the inner dynamics of the protein may be connected with the changes in the velocity power spectrum of interfacial water. The additional protein molecule changes the properties of solvation water and in this way it can influence the dynamics of the second protein. It is suggested that this phenomenon may be described, at first approximation, by a damped oscillator driven by an external random force. This model was successfully applied to conformationally rigid Choristoneura fumiferana antifreeze protein molecules.

  8. FORMATION OF ORGANIC MOLECULES AND WATER IN WARM DISK ATMOSPHERES

    Energy Technology Data Exchange (ETDEWEB)

    Najita, Joan R. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Adamkovics, Mate; Glassgold, Alfred E. [Astronomy Department, University of California, Berkeley, CA 94720 (United States)

    2011-12-20

    Observations from Spitzer and ground-based infrared spectroscopy reveal significant diversity in the molecular emission from the inner few AU of T Tauri disks. We explore theoretically the possible origin of this diversity by expanding on our earlier thermal-chemical model of disk atmospheres. We consider how variations in grain settling, X-ray irradiation, accretion-related mechanical heating, and the oxygen-to-carbon ratio can affect the thermal and chemical properties of the atmosphere at 0.25-40 AU. We find that these model parameters can account for many properties of the detected molecular emission. The column density of the warm (200-2000 K) molecular atmosphere is sensitive to grain settling and the efficiency of accretion-related heating, which may account, at least in part, for the large range in molecular emission fluxes that have been observed. The dependence of the atmospheric properties on the model parameters may also help to explain trends that have been reported in the literature between molecular emission strength and mid-infrared color, stellar accretion rate, and disk mass. We discuss whether some of the differences between our model results and the observations (e.g., for water) indicate a role for vertical transport and freezeout in the disk midplane. We also discuss how planetesimal formation in the outer disk (beyond the snowline) may imprint a chemical signature on the inner few AU of the disk and speculate on possible observational tracers of this process.

  9. FORMATION OF ORGANIC MOLECULES AND WATER IN WARM DISK ATMOSPHERES

    International Nuclear Information System (INIS)

    Najita, Joan R.; Ádámkovics, Máté; Glassgold, Alfred E.

    2011-01-01

    Observations from Spitzer and ground-based infrared spectroscopy reveal significant diversity in the molecular emission from the inner few AU of T Tauri disks. We explore theoretically the possible origin of this diversity by expanding on our earlier thermal-chemical model of disk atmospheres. We consider how variations in grain settling, X-ray irradiation, accretion-related mechanical heating, and the oxygen-to-carbon ratio can affect the thermal and chemical properties of the atmosphere at 0.25-40 AU. We find that these model parameters can account for many properties of the detected molecular emission. The column density of the warm (200-2000 K) molecular atmosphere is sensitive to grain settling and the efficiency of accretion-related heating, which may account, at least in part, for the large range in molecular emission fluxes that have been observed. The dependence of the atmospheric properties on the model parameters may also help to explain trends that have been reported in the literature between molecular emission strength and mid-infrared color, stellar accretion rate, and disk mass. We discuss whether some of the differences between our model results and the observations (e.g., for water) indicate a role for vertical transport and freezeout in the disk midplane. We also discuss how planetesimal formation in the outer disk (beyond the snowline) may imprint a chemical signature on the inner few AU of the disk and speculate on possible observational tracers of this process.

  10. Neglected Outcomes of Customer Orientation in Urban Public Water ...

    African Journals Online (AJOL)

    We found that there is a positive correlation between customer orientation and efficiency (0.58 [p0.01]); and an inverse correlation between customer satisfaction and efficiency (0.043% [p>0.01]). These results imply that increased ...

  11. Nanoscale charge localization induced by random orientations of organic molecules in hybrid perovskite CH3NH3PbI3

    Science.gov (United States)

    Ma, Jie; Wang, Lin-Wang

    2015-03-01

    Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.

  12. Influence of the effective mass of water molecule on thermal neutron scattering

    International Nuclear Information System (INIS)

    Markovic, M.

    1981-01-01

    The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E o = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

  13. Shear-stress-induced structural arrangement of water molecules in nanoscale Couette flow with slipping at wall boundary

    International Nuclear Information System (INIS)

    Lin, Jau-Wen

    2014-01-01

    This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied

  14. Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

    KAUST Repository

    Shinagawa, Tatsuya

    2015-01-01

    Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed constant current behaviors at near neutral pH reflect the intrinsic electrocatalytic reactivity of the metal electrodes for water reduction. This journal is © the Owner Societies.

  15. STABILIZATION OF THE NEUTRAL PROTEASE OF BACILLUS-STEAROTHERMOPHILUS BY REMOVAL OF A BURIED WATER MOLECULE

    NARCIS (Netherlands)

    VRIEND, G; BERENDSEN, HJC; VANDERZEE, [No Value; VANDENBURG, B; VENEMA, G; EIJSINK, VGH

    1991-01-01

    Using site-directed mutagenesis, Ala166 in the neutral protease of Bacillus stearothermophilus was changed into Ser. Model building and molecular dynamics simulations of the mutant enzyme indicated that the Ser hydroxyl group fits well in a cavity which contains a water molecule in the wild-type

  16. Effects of Water Molecule on CO Oxidation by OH: Reaction Pathways, Kinetic Barriers, and Rate Constants.

    Science.gov (United States)

    Zhang, Linyao; Yang, Li; Zhao, Yijun; Zhang, Jiaxu; Feng, Dongdong; Sun, Shaozeng

    2017-07-06

    The water dilute oxy-fuel combustion is a clean combustion technology for near-zero emission power; and the presence of water molecule could have both kinetic and dynamic effects on combustion reactions. The reaction OH + CO → CO 2 + H, one of the most important elementary reactions, has been investigated by extensive electronic structure calculations. And the effects of a single water molecule on CO oxidation have been studied by considering the preformed OH(H 2 O) complex reacts with CO. The results show little change in the reaction pathways, but the additional water molecule actually increases the vibrationally adiabatic energy barriers (V a G ). Further thermal rate constant calculations in the temperature range of 200 to 2000 K demonstrate that the total low-pressure limit rate constant for the water assisted OH(H 2 O) + CO → CO 2 + H 2 O + H reaction is 1-2 orders lower than that of the water unassisted one, which is consistent with the change of V a G . Therefore, the hydrated radical OH(H 2 O) would actually slow down the oxidation of CO. Meanwhile, comparisons show that the M06-2X/aug-cc-pVDZ method gives a much better estimation in energy and thus is recommended to be employed for direct dynamics simulations.

  17. Differential and total cross sections for the ionization of water molecule by electron impact

    International Nuclear Information System (INIS)

    Houamer, S.; Dal Cappello, C.; Mansouri, A.

    2007-01-01

    A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed

  18. Fractionation of hydrogen and oxygen isotopes between hydrated and free water molecules in aqueous urea solution

    International Nuclear Information System (INIS)

    Kakiuchi, M.; Matsuo, S.

    1985-01-01

    Ratios of D/H and 18 O/ 16 O in the vapor phase in equilibrium with aqueous urea solution with different urea molalities were measured at 15 and 25 0 C. Under the assumption that urea solutions consist of two species, i.e., the urea-water cluster and free water, the results are interpreted to give the average hydration number, i.e., the number of water molecules per urea molecule in the urea-water cluster. Good agreement was obtained for the hydration number estimated independently from hydrogen and oxygen isotopic fractions. On the basis of hydrogen isotopic data at 25 0 C, the average hydration number of urea in the cluster is 6.3 +/- 0.8 at 2.1 m and 2.75 +/- 0.08 at saturation (20.15 m). The corresponding average hydration numbers based on oxygen isotopic data were calculated to be 6.7 +/- 2.4 at 2.1 m and 2.75 +/- 0.25 at urea saturation. HD 16 O is enriched in the urea-water cluster and H 2 18 O is enriched in free water. Isotopic partitioning between the cluster and free water is markedly different from those between hydration spheres and free water in aqueous electrolyte solutions. 29 references, 6 figures, 5 tables

  19. Partition Coefficients of Organic Molecules in Squalane and Water/Ethanol Mixtures by Molecular Dynamics Simulations

    DEFF Research Database (Denmark)

    Lundsgaard, Rasmus; Kontogeorgis, Georgios; Economou, Ioannis G.

    2011-01-01

    coefficient can be estimated for both a small hydrophilic and a hydrophobic organic molecules between squalane (used here to mimic low density poly ethylene) and water/ethanol solutes using thermodynamic integration to calculate the free energy of solvation. Molecular dynamics simulations are performed, using...... the GROMACS software, by slowly decoupling of firstly the electrostatic and then the Lennard–Jones interactions between molecules in the simulation box. These calculations depend very much on the choice of force field. Two force fields have been tested in this work, the TraPPE-UA (united-atom) and the OPLS...

  20. Measurements of water molecule density by tunable diode laser absorption spectroscopy in dielectric barrier discharges with gas-water interface

    Science.gov (United States)

    Tachibana, Kunihide; Nakamura, Toshihiro; Kawasaki, Mitsuo; Morita, Tatsuo; Umekawa, Toyofumi; Kawasaki, Masahiro

    2018-01-01

    We measured water molecule (H2O) density by tunable diode-laser absorption spectroscopy (TDLAS) for applications in dielectric barrier discharges (DBDs) with a gas-water interface. First, the effects of water temperature and presence of gas flow were tested using a Petri dish filled with water and a gas injection nozzle. Second, the TDLAS system was applied to the measurements of H2O density in two types of DBDs; one was a normal (non-inverted) type with a dielectric-covered electrode above a water-filled counter electrode and the other was an inverted type with a water-suspending mesh electrode above a dielectric-covered counter electrode. The H2O density in the normal DBD was close to the density estimated from the saturated vapor pressure, whereas the density in the inverted DBD was about half of that in the former type. The difference is attributed to the upward gas flow in the latter type, that pushes the water molecules up towards the gas-water interface.

  1. QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-10-01

    Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978 

  2. Single molecule fluorescence image patterns linked to dipole orientation and axial position: application to myosin cross-bridges in muscle fibers.

    Directory of Open Access Journals (Sweden)

    Thomas P Burghardt

    2011-02-01

    Full Text Available Photoactivatable fluorescent probes developed specifically for single molecule detection extend advantages of single molecule imaging to high probe density regions of cells and tissues. They perform in the native biomolecule environment and have been used to detect both probe position and orientation.Fluorescence emission from a single photoactivated probe captured in an oil immersion, high numerical aperture objective, produces a spatial pattern on the detector that is a linear combination of 6 independent and distinct spatial basis patterns with weighting coefficients specifying emission dipole orientation. Basis patterns are tabulated for single photoactivated probes labeling myosin cross-bridges in a permeabilized muscle fiber undergoing total internal reflection illumination. Emitter proximity to the glass/aqueous interface at the coverslip implies the dipole near-field and dipole power normalization are significant affecters of the basis patterns. Other characteristics of the basis patterns are contributed by field polarization rotation with transmission through the microscope optics and refraction by the filter set. Pattern recognition utilized the generalized linear model, maximum likelihood fitting, for Poisson distributed uncertainties. This fitting method is more appropriate for treating low signal level photon counting data than χ(2 minimization.Results indicate that emission dipole orientation is measurable from the intensity image except for the ambiguity under dipole inversion. The advantage over an alternative method comparing two measured polarized emission intensities using an analyzing polarizer is that information in the intensity spatial distribution provides more constraints on fitted parameters and a single image provides all the information needed. Axial distance dependence in the emission pattern is also exploited to measure relative probe position near focus. Single molecule images from axial scanning fitted

  3. Study Orientation Ply of Fiberglass on Blade Salt Water Pump Windmill using Abaqus

    Science.gov (United States)

    Badruzzaman, B.; Sifa, A.

    2018-02-01

    Windmill is one tool to generate energy from wind energy is converted into energy motion, salt production process still using traditional process by utilizing windmill to move sea water to salt field With a windmill driven water system, a horizontal axis type windmill with an average windmill height of 3-4 m, with a potential wind speed of 5-9 m / s, the amount of blade used for salt water pumps as much as 4 blades, one of the main factor of the windmill component is a blade, blade designed for the needs of a salt water pump by using fiberglass material. On layer orientation 0°,30°,45°,60° and 90° with layer number 10 and layer thickness 2 mm, the purpose of this study was to determine the strength of fiberglass that was influenced by the orientation of the layer, and to determine the orientation of fiberglass layer before making. This method used Finite Element Analysis method using ABAQUS, with homogenous and heterogeneous layer parameters. The simulation result shows the difference in von misses value at an angle of 0°, 30°, 45°,60° homogeneous value is greater than heterogeneous value, whereas in orientation 90 heterogeneous values have value 1,689e9 Pa, greater than homogenous 90 orientation value of 1,296e9 Pa.

  4. Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite

    KAUST Repository

    Yoon, Seyoon

    2013-01-01

    The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current knowledge of the refined structure. The MD simulations provide detailed information on the position and mobility of the hydrogen and oxygen of interlayer water, as well as its self-diffusion coefficient, through the interlayer of 14 Å tobermorite. Comparison of the MD simulation results at 100 and 300 K demonstrates that water molecules in the interlayer maintain their structure but change their mobility. The dominant configuration and self-diffusion coefficient of interlayer water are obtained in this study. Copyright © 2013 Japan Concrete Institute.

  5. Perturbation theory for nematic liquid crystals of axially symmetric molecules: Evaluation of fourth rank orientational order parameter

    International Nuclear Information System (INIS)

    Singh, K.

    1993-11-01

    Using a statistical mechanical perturbation theory for isotropic-nematic transition we report a calculation of second and fourth rank orientation order parameters and thermodynamic properties for a model system of prolate ellipsoids of revolution parameterized by its length-to-width ratio. The influence of attractive potential represented by dispersion interaction on a variety of thermodynamic properties is analysed. Inclusion of fourth rank orientational order parameter in calculation slightly changes the transition parameter. (author). 7 refs, 1 tab

  6. Water molecule-enhanced CO2 insertion in lanthanide coordination polymers

    International Nuclear Information System (INIS)

    Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang

    2009-01-01

    Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.

  7. Investigation of the Hydantoin Monomer and its Interaction with Water Molecules

    Science.gov (United States)

    Gruet, Sébastien; Perez, Cristobal; Schnell, Melanie

    2017-06-01

    Hydantoin (Imidazolidine-2,4-dione, C_3H_4N_2O_2) is a five-membered heterocyclic compound of astrobiological interest. This molecule has been detected in carbonaceous chondrites [1], and its formation can rise from the presence of glycolic acid and urea, two prebiotic molecules [2]. The hydrolysis of hydantoin under acidic conditions can also produce glycine [3], an amino acid actively searched for in the interstellar medium. Spectroscopic data of hydantoin is very limited and mostly dedicated to the solid phase. The high resolution study in gas phase is restricted to the work recently published by Ozeki et al. reporting the pure rotational spectra of the ground state and two vibrational states of the molecule in the millimeter-wave region (90-370 GHz)[4]. Using chirped-pulse Fourier-transform microwave (CP-FTMW) spectroscopy, we recorded the jet-cooled rotational spectra of hydantoin with water between 2 to 8 GHz. We observed the ground state of hydantoin monomer and several water complexes with one or two water molecules. All the observed species exhibit a hyperfine structure due to the two nitrogen atoms present in the molecule, which were fully resolved and analyzed. Additional experiments with a ^{18}O enriched water sample were realized to determine the oxygen-atom positions of the water monomers. These experiments yielded accurate structural information on the preferred water binding sites. The observed complexes and the interactions that hold them together, mainly strong directional hydrogen bonds, will be presented and discussed. [1] Shimoyama, A. and Ogasawara, R., Orig. Life Evol. Biosph., 32, 165-179, 2002. DOI:10.1023/A:1016015319112. [2] Menor-Salván, C. and Marín-Yaseli, M.R., Chem. Soc. Rev., 41(16), 5404-5415, 2012. DOI:10.1039/c2cs35060b. [3] De Marcellus P., Bertrand M., Nuevo M., Westall F. and Le Sergeant d'Hendecourt L., Astrobiology. 11(9), 847-854, 2011. DOI:10.1089/ast.2011.0677. [4] Ozeki, H., Miyahara R., Ihara H., Todaka S., Kobayashi

  8. Water Orientation at Ceramide/Water Interfaces Studied by Heterodyne-Detected Vibrational Sum Frequency Generation Spectroscopy and Molecular Dynamics Simulation

    KAUST Repository

    Adhikari, Aniruddha; Re, Suyong; Nishima, Wataru; Ahmed, Mohammed; Nihonyanagi, Satoshi; Klauda, Jeffery B.; Sugita, Yuji; Tahara, Tahei

    2016-01-01

    Lipid/water interaction is essential for many biological processes. The water structure at the nonionic lipid interface remains little known, and there is no scope of a priori prediction of water orientation at nonionic interfaces, either. Here, we

  9. A Raman spectroscopy study on the effects of intermolecular hydrogen bonding on water molecules absorbed by borosilicate glass surface

    Science.gov (United States)

    Li, Fabing; Li, Zhanlong; Wang, Ying; Wang, Shenghan; Wang, Xiaojun; Sun, Chenglin; Men, Zhiwei

    2018-05-01

    The structural forms of water/deuterated water molecules located on the surface of borosilicate capillaries have been first investigated in this study on the basis of the Raman spectral data obtained at different temperatures and under atmospheric pressure for molecules in bulk and also for molecules absorbed by borosilicate glass surface. The strongest two fundamental bands locating at 3063 cm-1 (2438 cm-1) in the recorded Raman spectra are assigned here to the Osbnd H (Osbnd D) bond stretching vibrations and they are compared with the corresponding bands observed at 3124 cm-1 (2325 cm-1) in the Raman spectrum of ice Ih. Our spectroscopic observations have indicated that the structure of water and deuterated water molecules on borosilicate surface is similar to that of ice Ih (hexagonal phase of ice). These observations have also indicated that water molecules locate on the borosilicate surface so as to construct a bilayer structure and that strong and weak intermolecular hydrogen bonds are formed between water/deuterated molecules and silanol groups on borosilicate surface. In accordance with these findings, water and deuterated water molecules at the interface of capillary have a higher melting temperature.

  10. Quantification of the Intracellular Life Time of Water Molecules to Measure Transport Rates of Human Aquaglyceroporins.

    Science.gov (United States)

    Palmgren, Madelene; Hernebring, Malin; Eriksson, Stefanie; Elbing, Karin; Geijer, Cecilia; Lasič, Samo; Dahl, Peter; Hansen, Jesper S; Topgaard, Daniel; Lindkvist-Petersson, Karin

    2017-12-01

    Orthodox aquaporins are transmembrane channel proteins that facilitate rapid diffusion of water, while aquaglyceroporins facilitate the diffusion of small uncharged molecules such as glycerol and arsenic trioxide. Aquaglyceroporins play important roles in human physiology, in particular for glycerol metabolism and arsenic detoxification. We have developed a unique system applying the strain of the yeast Pichia pastoris, where the endogenous aquaporins/aquaglyceroporins have been removed and human aquaglyceroporins AQP3, AQP7, and AQP9 are recombinantly expressed enabling comparative permeability measurements between the expressed proteins. Using a newly established Nuclear Magnetic Resonance approach based on measurement of the intracellular life time of water, we propose that human aquaglyceroporins are poor facilitators of water and that the water transport efficiency is similar to that of passive diffusion across native cell membranes. This is distinctly different from glycerol and arsenic trioxide, where high glycerol transport efficiency was recorded.

  11. Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

    Energy Technology Data Exchange (ETDEWEB)

    Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

  12. Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers

    Directory of Open Access Journals (Sweden)

    Stephan Loew

    2011-01-01

    Full Text Available Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1 high drug loading of donor liposomes, (2 attractive interactions between drug molecules within the liposomes, and (3 slow transfer of drugs between the inner and outer leaflets of the liposomes.

  13. Structural analysis on mutation residues and interfacial water molecules for human TIM disease understanding

    Science.gov (United States)

    2013-01-01

    Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study

  14. Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics

    International Nuclear Information System (INIS)

    Yoshida, Koji

    2001-01-01

    Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)

  15. Influence of the water molecules near surface of viral protein on virus activation process

    Energy Technology Data Exchange (ETDEWEB)

    O, Shepelenko S; S, Salnikov A; V, Rak S; P, Goncharova E; B, Ryzhikov A, E-mail: shep@vector.nsc.r, E-mail: shep@ngs.r [Federal State Research Institution State Research Center of Virology and Biotechnology VECTOR of the Federal Service for Surveillance in Consumer Rights Protection and Human Well-being (FSRI SRC VB VECTOR) Koltsovo, Novosibirsk Region (Russian Federation)

    2009-06-01

    The infection of a cell with influenza virus comprises the stages of receptor binding to the cell membrane, endocytosis of virus particle, and fusion of the virus envelope and cell endosome membrane, which is determined by the conformational changes in hemagglutinin, a virus envelope protein, caused by pH decrease within the endosome. The pH value that induces conformation rearrangements of hemagglutinin molecule considerably varies for different influenza virus strains, first and foremost, due to the differences in amino acid structure of the corresponding proteins. The main goal of this study was to construct a model making it possible to assess the critical pH value characterizing the fusogenic activity of influenza virus hemagglutinin from the data on hemagglutinin structure and experimental verification of this model. Under this model, we assume that when the electrostatic force between interacting hemagglutinin molecules in the virus envelop exceeds a certain value, the hemagglutinin HA1 subunits are arranged so that they form a cavity sufficient for penetration of water molecules. This event leads to an irreversible hydration of the inner fragments of hemagglutinin molecule in a trimer and to the completion of conformational changes. The geometry of electrostatic field in hemagglutinin trimer was calculated taking into account the polarization effects near the interface of two dielectrics, aqueous medium and protein macromolecule. The critical pH values for the conformational changes in hemagglutinin were measured by the erythrocyte hemolysis induced by influenza virus particles when decreasing pH. The critical pH value conditionally separating the pH range into the regions with and without the conformational changes was calculated for several influenza virus H1N1 and H3N2 strains based on the data on the amino acid structure of the corresponding hemagglutinin molecules. Comparison of the theoretical and experimental values of critical pH values for

  16. Ab Initio Density Functional Theory Investigation of the Interaction between Carbon Nanotubes and Water Molecules during Water Desalination Process

    Directory of Open Access Journals (Sweden)

    Loay A. Elalfy

    2013-01-01

    Full Text Available Density functional theory calculations using B3LYP/3-21G level of theory have been implemented on 6 carbon nanotubes (CNTs structures (3 zigzag and 3 armchair CNTs to study the energetics of the reverse osmosis during water desalination process. Calculations of the band gap, interaction energy, highest occupied molecular orbital, lowest unoccupied molecular orbital, electronegativity, hardness, and pressure of the system are discussed. The calculations showed that the water molecule that exists inside the CNT is about 2-3 Å away from its wall. The calculations have proven that the zigzag CNTs are more efficient for reverse osmosis water desalination process than armchair CNTs as the reverse osmosis process requires pressure of approximately 200 MPa for armchair CNTs, which is consistent with the values used in molecular dynamics simulations, while that needed when using zigzag CNTs was in the order of 60 MPa.

  17. The role of riparian vegetation density, channel orientation and water velocity in determining river temperature dynamics

    Science.gov (United States)

    Garner, Grace; Malcolm, Iain A.; Sadler, Jonathan P.; Hannah, David M.

    2017-10-01

    A simulation experiment was used to understand the importance of riparian vegetation density, channel orientation and flow velocity for stream energy budgets and river temperature dynamics. Water temperature and meteorological observations were obtained in addition to hemispherical photographs along a ∼1 km reach of the Girnock Burn, a tributary of the Aberdeenshire Dee, Scotland. Data from nine hemispherical images (representing different uniform canopy density scenarios) were used to parameterise a deterministic net radiation model and simulate radiative fluxes. For each vegetation scenario, the effects of eight channel orientations were investigated by changing the position of north at 45° intervals in each hemispheric image. Simulated radiative fluxes and observed turbulent fluxes drove a high-resolution water temperature model of the reach. Simulations were performed under low and high water velocity scenarios. Both velocity scenarios yielded decreases in mean (≥1.6 °C) and maximum (≥3.0 °C) temperature as canopy density increased. Slow-flowing water resided longer within the reach, which enhanced heat accumulation and dissipation, and drove higher maximum and lower minimum temperatures. Intermediate levels of shade produced highly variable energy flux and water temperature dynamics depending on the channel orientation and thus the time of day when the channel was shaded. We demonstrate that in many reaches relatively sparse but strategically located vegetation could produce substantial reductions in maximum temperature and suggest that these criteria are used to inform future river management.

  18. The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)

    2017-01-15

    Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.

  19. Dynamical Orientation of Large Molecules on Oxide Surfaces and its Implications for Dye-Sensitized Solar Cells

    KAUST Repository

    Brennan, Thomas P.

    2013-11-12

    A dual experimental-computational approach utilizing near-edge X-ray absorption fine structure (NEXAFS) spectroscopy and density functional theory-molecular dynamics (DFT-MD) is presented for determining the orientation of a large adsorbate on an oxide substrate. A system of interest in the field of dye-sensitized solar cells is studied: an organic cyanoacrylic acid-based donor-π-acceptor dye (WN1) bound to anatase TiO2. Assessment of nitrogen K-edge NEXAFS spectra is supported by calculations of the electronic structure that indicate energetically discrete transitions associated with the two π systems of the C-N triple bond in the cyanoacrylic acid portion of the dye. Angle-resolved NEXAFS spectra are fitted to determine the orientation of these two orbital systems, and the results indicate an upright orientation of the adsorbed dye, 63 from the TiO2 surface plane. These experimental results are then compared to computational studies of the WN1 dye on an anatase (101) TiO2 slab. The ground state structure obtained from standard DFT optimization is less upright (45 from the surface) than the NEXAFS results. However, DFT-MD simulations, which provide a more realistic depiction of the dye at room temperature, exhibit excellent agreement - within 2 on average - with the angles determined via NEXAFS, demonstrating the importance of accounting for the dynamic nature of adsorbate-substrate interactions and DFT-MD\\'s powerful predictive abilities. © 2013 American Chemical Society.

  20. Dynamical Orientation of Large Molecules on Oxide Surfaces and its Implications for Dye-Sensitized Solar Cells

    KAUST Repository

    Brennan, Thomas P.; Tanskanen, Jukka T.; Bakke, Jonathan R.; Nguyen, William H.; Nordlund, Dennis; Toney, Michael F.; McGehee, Michael D.; Sellinger, Alan; Bent, Stacey F.

    2013-01-01

    A dual experimental-computational approach utilizing near-edge X-ray absorption fine structure (NEXAFS) spectroscopy and density functional theory-molecular dynamics (DFT-MD) is presented for determining the orientation of a large adsorbate on an oxide substrate. A system of interest in the field of dye-sensitized solar cells is studied: an organic cyanoacrylic acid-based donor-π-acceptor dye (WN1) bound to anatase TiO2. Assessment of nitrogen K-edge NEXAFS spectra is supported by calculations of the electronic structure that indicate energetically discrete transitions associated with the two π systems of the C-N triple bond in the cyanoacrylic acid portion of the dye. Angle-resolved NEXAFS spectra are fitted to determine the orientation of these two orbital systems, and the results indicate an upright orientation of the adsorbed dye, 63 from the TiO2 surface plane. These experimental results are then compared to computational studies of the WN1 dye on an anatase (101) TiO2 slab. The ground state structure obtained from standard DFT optimization is less upright (45 from the surface) than the NEXAFS results. However, DFT-MD simulations, which provide a more realistic depiction of the dye at room temperature, exhibit excellent agreement - within 2 on average - with the angles determined via NEXAFS, demonstrating the importance of accounting for the dynamic nature of adsorbate-substrate interactions and DFT-MD's powerful predictive abilities. © 2013 American Chemical Society.

  1. Design and Dynamic Characterization of an Orientation Insensitive Microwave Water-Cut Sensor

    KAUST Repository

    Karimi, Muhammad Akram

    2017-06-12

    Modern reservoir management in oil and gas industry relies on accurate water fraction measurement which is produced as a by-product with oil. This paper presents a novel and contactless water fraction (also known as water-cut) measurement technique which is independent of geometric distribution of oil and water inside the pipe. The sensor is based on a modified T-resonator implemented directly on the pipe\\'s outer surface and whose resonance frequency decreases by increasing the water content in oil. The E-fields have been made to rotate and distribute well inside the pipe, despite having narrow and curved ground plane. It makes the sensor\\'s reading dependent only on the water fraction and not on the mixture distribution inside the pipe. That is why, the presented design does not require any flow conditioner to homogenize the oil/water mixture unlike many commercial water-cut (WC) sensors. The presented sensor has been realized by using extremely low-cost methods of screen printing and reusable 3-D printed mask. Complete characterization of the proposed WC sensor, both in horizontal and vertical orientations, has been carried out in an industrial flow loop. Excellent repeatability of the sensor\\'s response has been observed in \\'dispersed bubble\\' as well as in \\'stratified wavy\\' flow regimes. The performance test of the sensor confirms that the water fraction measurement is independent of the flow pattern, flow rate or orientation. The measured performance results of the sensor show full range accuracy of $± $2%-3% while tested under random orientations and wide range of flow rates.

  2. Multipole moments of water molecules in clusters and ice Ih from first principles calculations

    International Nuclear Information System (INIS)

    Batista, E.R.; Xantheas, S.S.; Jonsson, H.

    1999-01-01

    We have calculated molecular multipole moments for water molecules in clusters and in ice Ih by partitioning the charge density obtained from first principles calculations. Various schemes for dividing the electronic charge density among the water molecules were used. They include Bader close-quote s zero flux surfaces and Voronoi partitioning schemes. A comparison was also made with an induction model including dipole, dipole-quadrupole, quadrupole-quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments. We have found that the different density partitioning schemes lead to widely different values for the molecular multipoles, illustrating how poorly defined molecular multipoles are in clusters and condensed environments. For instance, the magnitude of the molecular dipole moment in ice Ih ranges between 2.3 D and 3.1 D depending on the partitioning scheme used. Within each scheme, though, the value for the molecular dipole moment in ice is larger than in the hexamer. The magnitude of the molecular dipole moment in the clusters shows a monotonic increase from the gas phase value to the one in ice Ih, with the molecular dipole moment in the water ring hexamer being smaller than the one in ice Ih for all the partitioning schemes used. copyright 1999 American Institute of Physics

  3. Continuum Navier-Stokes modelling of water ow past fullerene molecules

    DEFF Research Database (Denmark)

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  4. Continuum Navier-Stokes modelling of water flow past fullerene molecules

    DEFF Research Database (Denmark)

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  5. Explicit Consideration of Water Molecules to Study Vibrational Circular DICHROÎSM of Monosaccharide's

    Science.gov (United States)

    Moussi, Sofiane; Ouamerali, Ourida

    2014-06-01

    Carbohydrates have multiples roles in biological systems. It has been found that the glycoside bond is fundamentally important in many aspects of chemistry and biology and forms the basis of carbohydrate chemistry. That means the stereochemical information, namely, glycosidic linkages α or β, gives an significant features of the carbohydrate glycosidation position of the glycosylic acceptor. For these reasons, much effort was made for the synthesis and analysis of the glycoside bond. Vibrational circular dichroism VCD has some advantages over conventional electronic circular dichroism (ECD) due to the applicability to all organic molecules and the reliability of ab initio quantum calculation. However, for a molecule with many chiral centers such as carbohydrates, determination of the absolute configuration tends to be difficult because the information from each stereochemical center is mixed and averaged over the spectrum. In the CH stretching region, only two VCD studies on carbohydrates have been reported and spectra--structure correlation, as determined for the glycoside band, remains to be investigated. T. Taniguchi and collaborators report that methyl glycosides exhibit a characteristic VCD peak, the sign of which solely reflects the C-1 absolute configuration. This work is a theoretical contribution to study the behaviour of VCD spectrum's of the monosaccharides when the water molecules are taken explicitly. This study is focused on six different monosaccharides in theirs absolute configuration R and S. We used the method of density functional theory DFT by means of the B3LYP hybrid functional and 6-31G * basis set.

  6. Ionization of one- and three-dimensionally-oriented asymmetric-top molecules by intense circularly polarized femtosecond laser pulses

    DEFF Research Database (Denmark)

    Hansen, Jonas Lerche; Holmegaard, Lotte; Kalhøj, Line

    2011-01-01

    are quantum-state selected using a deflector and three-dimensionally (3D) aligned and oriented adiabatically using an elliptically polarized laser pulse in combination with a static electric field. A characteristic splitting in the molecular frame photoelectron momentum distribution reveals the position...... of the nodal planes of the molecular orbitals from which ionization occurs. The experimental results are supported by a theoretical tunneling model that includes and quantifies the splitting in the momentum distribution. The focus of the present article is to understand strong-field ionization from 3D...

  7. Water Orientation at Ceramide/Water Interfaces Studied by Heterodyne-Detected Vibrational Sum Frequency Generation Spectroscopy and Molecular Dynamics Simulation

    KAUST Repository

    Adhikari, Aniruddha

    2016-10-10

    Lipid/water interaction is essential for many biological processes. The water structure at the nonionic lipid interface remains little known, and there is no scope of a priori prediction of water orientation at nonionic interfaces, either. Here, we report our study combining advanced nonlinear spectroscopy and molecular dynamics simulation on the water orientation at the ceramide/water interface. We measured χ spectrum in the OH stretch region of ceramide/isotopically diluted water interface using heterodyne-detected vibrational sum-frequency generation spectroscopy and found that the interfacial water prefers an overall hydrogen-up orientation. Molecular dynamics simulation indicates that this preferred hydrogen-up orientation of water is determined by a delicate balance between hydrogen-up and hydrogen-down orientation induced by lipid-water and intralipid hydrogen bonds. This mechanism also suggests that water orientation at neutral lipid interfaces depends highly on the chemical structure of the lipid headgroup, in contrast to the charged lipid interfaces where the net water orientation is determined solely by the charge of the lipid headgroup.

  8. Water and oxygen induced degradation of small molecule organic solar cells

    DEFF Research Database (Denmark)

    Hermenau, Martin; Riede, Moritz; Leo, Karl

    2011-01-01

    Small molecule organic solar cells were studied with respect to water and oxygen induced degradation by mapping the spatial distribution of reaction products in order to elucidate the degradation patterns and failure mechanisms. The active layers consist of a 30 nm bulk heterojunction formed......,4′-diamine p-doped with C60F36 (MeO-TPD:C60F36), which acted as hole transporting layer. Indium-tin-oxide (ITO) and aluminum served as hole and electron collecting electrode, respectively. Time-of-flight secondary ion mass spectrometry (TOF-SIMS) and X-ray photoelectron spectroscopy (XPS) in conjunction...... of aluminum oxide at the BPhen/Al interface, and diffusion of water into the ZnPc:C60 layer where ZnPc becomes oxidized. Finally, diffusion from the electrodes was found to have no or a negligible effect on the device lifetime....

  9. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  10. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Al-Hamdani, Yasmine S. [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom); Alfè, Dario [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Earth Sciences, University College London, Gower Street, London WC1E 6BT (United Kingdom); Lilienfeld, O. Anatole von [Institute of Physical Chemistry and National Center for Computational Design and Discovery of Novel Materials (MARVEL), Department of Chemistry, University of Basel, Klingelbergstrasse 80, CH-4056 Basel (Switzerland); Michaelides, Angelos, E-mail: angelos.michaelides@ucl.ac.uk [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-04-21

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.

  11. Identification of Carboxylate, Phosphate, and Phenoxide Functionalities in Deprotonated Molecules Related to Drug Metabolites via Ion-Molecule Reactions with water and Diethylhydroxyborane

    Science.gov (United States)

    Zhu, Hanyu; Ma, Xin; Kong, John Y.; Zhang, Minli; Kenttämaa, Hilkka I.

    2017-10-01

    Tandem mass spectrometry based on ion-molecule reactions has emerged as a powerful tool for structural elucidation of ionized analytes. However, most currently used reagents were designed to react with protonated analytes, making them suboptimal for acidic analytes that are preferentially detected in negative ion mode. In this work we demonstrate that the phenoxide, carboxylate, and phosphate functionalities can be identified in deprotonated molecules by use of a combination of two reagents, diethylmethoxyborane (DEMB) and water. A novel reagent introduction setup that allowed DEMB and water to be separately introduced into the ion trap region of the mass spectrometer was developed to facilitate fundamental studies of this reaction. A new reagent, diethylhydroxyborane (DEHB), was generated inside the ion trap by hydrolysis of DEMB on introduction of water. Most carboxylates and phenoxides formed a DEHB adduct, followed by addition of one water molecule and subsequent ethane elimination (DEHB adduct +H2O - CH3CH3) as the major product ion. Phenoxides with a hydroxy group adjacent to the deprotonation site and phosphates formed a DEHB adduct, followed by ethane elimination (DEHB adduct - CH3CH3). Deprotonated molecules with strong intramolecular hydrogen bonds or without the aforementioned functionalities, including sulfates, were unreactive toward DEHB/H2O. Reaction mechanisms were explored via isotope labeling experiments and quantum chemical calculations. The mass spectrometry method allowed the differentiation of phenoxide-, carboxylate-, phosphate-, and sulfate-containing analytes. Finally, it was successfully coupled with high-performance liquid chromatography for the analysis of a mixture containing hymecromone, a biliary spasm drug, and its three possible metabolites. [Figure not available: see fulltext.

  12. Reactive scattering from oriented molecules: The three-center reaction K+ICl --> KI+Cl, KCl+I

    Science.gov (United States)

    Loesch, H. J.; Möller, J.

    1992-12-01

    In a crossed molecular beam experiment, we have measured the angular and time-of-flight (TOF) distributions of the products KCl and KI formed in the reaction K+ICl→KI+Cl, KCl+I at an elevated collision energy of Etr=1.64 eV. Employing the brute force method, we have prepared an oriented ICl beam and studied in addition also the orientation dependence of these distributions. The results are (i) KCl is the dominant product, but also KI is substantially formed with a branching ratio of 4:1; (ii) the double differential reaction cross section in the center-of-mass frame (contour maps) indicates that all products are preferentially forward scattered and constrained to the forward hemisphere; (iii) the KCl flux consists of two distinct components which differ markedly in kinetic energy and dependence on the ICl orientation; there are also indications of the existence of two components of KI; (iv) 65%, 84%, and 64% of the available energy is vested into the internal degrees of freedom for the fast, slow component of KCl and KI, respectively; (v) the existence of two components can be rationalized on the basis of the harpooning mechanism where the jumping electron accesses the ground state or one of the low excited states of the ICl- ion and triggers the subsequent explosion of the ion with more or less kinetic energy of the fragments depending on the initially populated state; (vi) the energies released during dissociation of ICl- in the 2Σ ground state and the first 2Π state are ≤0.19 and ≤1.2 eV, respectively; (vii) the fast KCl component features a negative steric effect suggesting favorable product formation for attacks of K to the I end of ICl, the steric effect of the slow KI component is positive, i.e., attacks to the Cl end form products favorably; the other components exhibit no significant steric effect; (viii) the steric effects can be quantitatively rationalized using the same model as mentioned above; (ix) the magnitude of the steric effect suggests a

  13. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  14. Finite-bias electronic transport of molecules in a water solution

    KAUST Repository

    Rungger, Ivan; Chen, X.; Sanvito, Stefano; Schwingenschlö gl, Udo

    2010-01-01

    The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

  15. Finite-bias electronic transport of molecules in a water solution

    KAUST Repository

    Rungger, Ivan

    2010-06-04

    The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

  16. Gravitactic orientation of Euglena gracilis – a sensitive endpoint for ecotoxicological assessment of water pollutants

    Directory of Open Access Journals (Sweden)

    Aziz eUllah

    2013-12-01

    Full Text Available Pollution of aquatic environments with natural and anthropogenically produced substances is one of the major environmental problems of the world. In many countries the decreasing quantity of water coupled with its increasing usage in multiple sectors has adversely affected water quality and caused problems of water pollution. Polluted water has been a main cause of adverse effects on plants, animals and humans throughout the world. Physicochemical analysis of water, which is a common method used for quality assessment of water, alone may not be enough as it cannot evaluate the impact on living organisms. Therefore, bioassessment of water and wastewater quality is considered to be essential to reflect the ultimate effects on living organisms. Many organisms like bacteria, algae, fish, invertebrates and protozoan are used as bioassay organisms for assessment of water quality. This review article elucidates the use of Euglena gracilis, a freshwater motile flagellate of the phylum Euglenophyta, as a suitable organism in ecotoxicological studies with special emphasis on its gravitactic orientation as a sensitive end point in ecotoxicological assessment of water pollutants.

  17. Orbiting Water Molecules Dance to Tune Of Galaxy's "Central Engine," Astronomers Say

    Science.gov (United States)

    2000-01-01

    A disk of water molecules orbiting a supermassive black hole at the core of a galaxy 60 million light-years away is "reverberating" in response to variations in the energy output from the galaxy's powerful "central engine" close to the black hole, astronomers say. The team of astronomers used the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope in New Mexico and the 100-meter-diameter radio telescope of the Max Planck Institute for Radio Astronomy at Effelsberg, Germany, to observe the galaxy NGC 1068 in the constellation Cetus. They announced their findings today at the American Astronomical Society's meeting in Atlanta. The water molecules, in a disk some 5 light-years in diameter, are acting as a set of giant cosmic radio-wave amplifiers, called masers. Using energy radiated by the galaxy's "central engine," the molecules strengthen, or brighten, radio emission at a particular frequency as seen from Earth. "We have seen variations in the radio 'brightness' of these cosmic amplifiers that we believe were caused by variations in the energy output of the central engine," said Jack Gallimore, an astronomer at the National Radio Astronomy Observatory (NRAO) in Charlottesville, VA. "This could provide us with a valuable new tool for learning about the central engine itself," he added. Gallimore worked with Stefi Baum of the Space Telescope Science Institute in Baltimore, MD; Christian Henkel of the Max Planck Institute for Radio Astronomy in Bonn, Germany; Ian Glass of the South African Astronomical Observatory; Mark Claussen of the NRAO in Socorro, NM; and Almudena Prieto of the European Southern Observatory in Munich, Germany. "Our observations show that NGC 1068 is the second-known case of a giant disk of water molecules orbiting a supermassive black hole at a galaxy's core," Gallimore said. The first case was the galaxy NGC 4258 (Messier 106), whose disk of radio-amplifying water molecules was measured by the NSF's Very Long Baseline

  18. Relationship between diffusivity of water molecules inside hydrating tablets and their drug release behavior elucidated by magnetic resonance imaging.

    Science.gov (United States)

    Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo

    2012-01-01

    We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.

  19. Orientating lipase molecules through surface chemical control for enhanced activity: A QCM-D and ToF-SIMS investigation.

    Science.gov (United States)

    Joyce, Paul; Kempson, Ivan; Prestidge, Clive A

    2016-06-01

    Bio-active materials consisting of lipase encapsulated within porous silica particles were engineered to control the adsorption kinetics and molecular orientation of lipase, which play critical roles in the digestion kinetics of triglycerides. The adsorption kinetics of Candida antartica lipase A (CalA) was monitored using quartz crystal microbalance with dissipation (QCM-D) and controlled by altering the hydrophobicity of a silica binding support. The extent of adsorption was 2-fold greater when CalA was adsorbed onto hydrophobic silica compared to hydrophilic silica. Time-of-flight secondary ion mass spectrometry (ToF-SIMS) fragmentation patterns, in conjunction with multivariate statistics, demonstrated enhanced exposure of the lipase's catalytic domain, specifically the histidine group responsible for activity, when CalA was adsorbed on hydrophilic silica. Consequently, lipid digestion kinetics were enhanced when CalA was loaded in hydrophilic porous silica particles, i.e., a 2-fold increase in the pseudo-first-order rate constant for digestion when compared to free lipase. In contrast, digestion kinetics were inhibited when CalA was hosted in hydrophobic porous silica, i.e., a 5-fold decrease in pseudo-first-order rate constant for digestion when compared to free lipase. These findings provide valuable insights into the mechanism of lipase action which can be exploited to develop smarter food and drug delivery systems consisting of porous lipid-based materials. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Surface Electrostatic Potential and Water Orientation in the presence of Sodium Octanoate Dilute Monolayers Studied by Means of Molecular Dynamics Simulations.

    Science.gov (United States)

    Bernardino, Kalil; de Moura, André F

    2015-10-13

    A series of atomistic molecular dynamics simulations were performed in the present investigation to assess the spontaneous formation of surfactant monolayers of sodium octanoate at the water-vacuum interface. The surfactant surface coverage increased until a saturation threshold was achieved, after which any further surfactant addition led to the formation of micellar aggregates within the solution. The saturated films were not densely packed, as might be expected for short-chained surfactants, and all films regardless of the surface coverage presented surfactant molecules with the same ordering pattern, namely, with the ionic heads toward the aqueous solution and the tails lying nearly parallel to the interface. The major contributions to the electrostatic surface potential came from the charged heads and the counterion distribution, which nearly canceled out each other. The balance between the oppositely charged ions rendered the electrostatic contributions from water meaningful, amounting to ca. 10% of the contributions arising from the ionic species. And even the aliphatic tails, whose atoms bear relatively small partial atomic charges as compared to the polar molecules and molecular fragments, contributed with ca. 20% of the total electrostatic surface potential of the systems under investigation. Although the aliphatic tails were not so orderly arranged as in a compact film, the C-H bonds assumed a preferential orientation, leading to an increased contribution to the electrostatic properties of the interface. The most prominent feature arising from the partitioning of the electrostatic potential into individual contributions was the long-range ordering of the water molecules. This ordering of the water molecules produced a repulsive dipole-dipole interaction between the two interfaces, which increased with the surface coverage. Only for a water layer wider than 10 nm was true bulk behavior observed, and the repulsive dipole-dipole interaction faded away.

  1. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    International Nuclear Information System (INIS)

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  2. Bond rearrangement caused by sudden single and multiple ionization of water molecules

    International Nuclear Information System (INIS)

    Ben-Itzhak, I.; Sayler, A. Max; Leonard, M.; Maseberg, J.W.; Hathiramani, D.; Wells, E.; Smith, M.A.; Xia, Jiangfan; Wang, Pengqian; Carnes, K.D.; Esry, B.D.

    2005-01-01

    Bond rearrangement, namely the dissociation of water into H 2 + +O q+ following ionization by fast proton and highly charged ion impact, was investigated. Single ionization by fast proton impact exhibits a strong isotopic effect, the dissociation of H 2 O + ->H 2 + +O being about twice as likely as D 2 O + ->D 2 + +O, with HDO + ->HD + +O in between. This suggests that the bond rearrangement does not happen during the slow dissociation, but rather during the very fast ionization, and thus H 2 + should also be produced when the water molecule is multiply ionized. We observed that the H 2 + +O + and H 2 + +O 2+ production in 1MeV/amu F 7+ +H 2 O collisions are 0.209+/-0.006% and 0.0665+/-0.003%, respectively, of the main double-ionization dissociation product, H 2 O 2+ ->H + +OH + . This ratio is similar to the triple to double ionization ratio in similar collisions with atomic targets thus suggesting that the bond-rearrangement fraction out of each ionization level is approximately constant. Similar dissociation channels in the heavier water isotopes, which are expected to be smaller, are under study. Finally, the fragmentation of HDO exhibits very strong isotopic preference for breaking the OH bond over the OD bond

  3. Adsorption of ethyl xanthate on ZnS(110) surface in the presence of water molecules: A DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Guangxi Colleges and University Key Laboratory of Minerals Engineering, 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)

    2016-05-01

    Graphical abstract: - Highlights: • Adsorption of water molecules decreases the reactivity of surface Zn atom. • Copper impurities decrease the band gap of ZnS surface. • Copper impurities enhance the adsorption of xanthate on the ZnS surface. • Water molecules have little influence on the properties of Cu-substituted ZnS surface. • The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface. - Abstracts: The interaction of collector with the mineral surface plays a very important role in the froth flotation of sphalerite. The adsorptions occurred at the interface between the mineral surface and waters; however most of DFT simulations are performed in vacuum, without consideration of water effect. Semiconductor surface has an obvious proximity effect, which will greatly influence the surface reactivity. To understand the mechanism of xanthate interacting with sphalerite surface in the presence of water molecules, the ethyl xanthate molecule adsorption on un-activated and Cu-activated ZnS(110) surface in the absence and presence of water molecules were performed using the density functional theory (DFT) method. The calculated results show that the adsorption of water molecules dramatically changes the properties of ZnS surface, resulting in decreasing the reactivity of surface Zn atoms with xanthate. Copper activation of ZnS surface changes the surface properties, leading to the totally different adsorption behaviors of xanthate. The presence of waters has little influence on the properties of Cu-activated ZnS surface. The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface, which would result in the formation of dixanthogen.

  4. Two-dimensional crystallography of amphiphilic molecules at the air-water interface

    DEFF Research Database (Denmark)

    Jacquemain, D.; Grayer Wolf, S.; Leveiller, F.

    1992-01-01

    The advent of well-collimated, high-intensity synchrotron X-ray sources and the consequent development of surface-specific X-ray diffraction and fluorescence techniques have recently revolutionized the study of Langmuir monolayers at the air-liquid interface. These methods allowed for the first......, and review recent results obtained from them for Langmuir films. The methods have been successfully applied in the elucidation of the structure of crystalline aggregates of amphiphilic molecules such as alcohols, carboxylic acids and their salts, alpha-amino acids, and phospholipids at the water surface....... In addition, it became possible to monitor by diffraction the growth and dissolution of the crystalline self-aggregates as well as structural changes occurring by phase transitions. Furthermore, the surface X-ray methods shed new light on the structure of the underlying ionic layer of attached solvent...

  5. The retributive rates, economic instrument, effective for the water decontamination in the Oriente Antioqueno

    International Nuclear Information System (INIS)

    Castro Hernandez, Luis Fernando

    1999-01-01

    The article contains the antecedents of the collection of the recompensing rates in Colombia at the beginning of the decade of the eighty it not insinuates as a mechanism for the atmospheric contamination. Later on the law 99 of 1993 defines it as the most important mechanism to not achieve the contamination of sources of water in the country. It establishes this way it the ordinance 901 of April of 1997 by means of which the process of implementation of the recompensing rates begins in the Oriente Antioqueno where at the moment is carried out the collection in eight basins. The article also registers the results that leave the economic instrument in what refers at levels of non-contamination of basins and in money collected after having billed five semesters. Likewise it reports a series of benefits that leaves the instrument after two years of implementation in the Oriente Antioqueno

  6. Synthesis of ZnO particles using water molecules generated in esterification reaction

    Science.gov (United States)

    Šarić, Ankica; Gotić, Marijan; Štefanić, Goran; Dražić, Goran

    2017-07-01

    Zinc oxide particles were synthesized without the addition of water by autoclaving (anhydrous) zinc acetate/alcohol and zinc acetate/acetic acid/alcohol solutions at 160 °C. The solvothermal synthesis was performed in ethanol or octanol. The structural, optical and morphological characteristics of ZnO particles were investigated by X-ray diffraction (XRD), UV-Vis spectroscopy, FE-SEM and TEM/STEM microscopy. 13C NMR spectroscopy revealed the presence of ester (ethyl- or octyl-acetate) in the supernatants which directly indicate the reaction mechanism. The formation of ester in this esterification reaction generated water molecule in situ, which hydrolyzed anhydrous zinc acetate and initiated nucleation and formation of ZnO. It was found that the size and shape of ZnO particles depend on the type of alcohol used as a solvent and on the presence of acetic acid in solution. The presence of ethanol in the ;pure; system without acetic acid favoured the formation of fine and uniform spherical ZnO nanoparticles (∼20 nm). With the addition of small amount of acetic acid the size of these small nanoparticles increased significantly up to a few hundred nanometers. The addition of small amount of acetic acid in the presence of octanol caused even more radical changes in the shape of ZnO particles, favouring the growth of huge rod-like particles (∼3 μm).

  7. Activation of a water molecule coordinated to manganese: four study cases

    International Nuclear Information System (INIS)

    Lassalle-Kaiser, B.

    2008-10-01

    The daunting energy consumption of western societies calls for the development of renewable energies. Among them, hydrogen stands as a major candidate. The cleanest way of producing hydrogen is water electro- or photolysis. This reaction is carried out in natural photosynthesis by a manganese-oxo cluster, the functioning of which remains unknown. Insight into this mechanism would greatly help the search for low-cost water splitting catalysts. Our contribution to this field is the understanding of the fundamental processes that govern the activation of water by manganese complexes. This manuscript describes our attempts to generate electrochemically mononuclear manganese(IV) complexes bearing a fully deprotonated water molecule (oxo ligand). We have studied four different cases, which reflect different possible coordination spheres capable of stabilizing such species. In the first chapter, we will give a brief overview of the present energetic challenges faced by western societies. In the second chapter, we will present general considerations about manganese chemistry and a description of the structure and functioning of the water oxidizing enzyme. We will also describe the basic requirements for the splitting of water and present the goals of our work. In the third chapter, we will present the synthesis of a new family of tetradentate ligands, together with the synthesis and full characterization of the corresponding nickel(II) complexes. The first results obtained with the manganese analogue will also be shown. Chapter four presents the formation and the full characterization of a mononuclear manganese(IV)-oxo complex, by electrochemical oxidation of a manganese(II)-aqua complex. We will present different pathways to generate this species and show which intermediates are involved in this 2 e - , 2 H + reaction. Chapter five describes the formation of a mononuclear manganese(IV) complex, by electrochemical oxidation of a manganese(III)-hydroxo complex. The

  8. (e,3e) and (e,3-1e) differential cross sections for the double ionization of water molecule

    International Nuclear Information System (INIS)

    Mansouri, A.; Dal Cappello, C.; Kada, I.; Champion, C.; Roy, A.C.

    2009-01-01

    We report new results for differential cross sections for the double ionization of water molecule by 1 keV electron impact. The present calculation is based on the first Born approximation. We describe the water molecule by a single centre wave function of Moccia. For the final state, an approximation of the well-known 3C wave function is used. An extensive study has been made by varying the angles of detection and the energies of each ejected electron. We have investigated the double ionization of each molecular state (1b 1 , 3a 1 , 1b 2 and 2a 1 ) and identified the mechanisms of this process.

  9. Energy-switching potential energy surface for the water molecule revisited: A highly accurate singled-sheeted form.

    Science.gov (United States)

    Galvão, B R L; Rodrigues, S P J; Varandas, A J C

    2008-07-28

    A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.

  10. Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

    Science.gov (United States)

    Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

    2010-01-01

    We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

  11. Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

    Science.gov (United States)

    Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

    1994-09-23

    The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

  12. Designing wireless sensor networks for hydrological and water resource applications: A purpose-oriented approach

    Science.gov (United States)

    Mao, F.; Hannah, D. M.; Krause, S.; Clark, J.; Buytaert, W.; Ochoa-Tocachi, B. F.

    2017-12-01

    There have been a growing number of studies using low-cost wireless sensor networks (LCWSNs) in hydrology and water resources fields. By reviewing the development of sensing and wireless communication technologies, as well as the recent relevant projects and applications, we observe that the challenges in applying LCWSNs have been moving beyond technical aspects. The large pool of available low-cost network modules, such as Arduino, Raspberry Pi, Xbee and inexpensive sensors, enable us to assemble networks rather than building them from scratch. With a wide variety of costs, functions and features, these modules support customisation of hydrological monitoring network for different user groups and purposes. Therefore, more attentions are needed to be placed on how to better design tailored LCWSNs with current technologies that create more added value for users. To address this challenge, this research proposes a tool-box for what we term `purpose-oriented' LCWSN. We identify the main LCWSN application scenarios from literature, and compare them from three perspectives including (1) the major stakeholders in each scenario, (2) the purposes for stakeholders, and (3) the network technologies and settings that meet the purposes. Notably, this innovative approach designs LCWSNs for different scenarios with considerations of not only technologies, but also stakeholders and purposes that are related to the usability, maintenance and social sustainability of networks. We conclude that this new, purpose-orientated approach can further release the potential of hydrological and water resources LCWSNs to maximise benefits for users and wider society.

  13. The effects of cold rolling orientation and water chemistry on stress corrosion cracking behavior of 316L stainless steel in simulated PWR water environments

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Junjie [Institute of Materials Science, School of Materials Science and Engineering, Shanghai University, Mailbox 269, 149 Yanchang Road, Shanghai, 200072 (China); Lu, Zhanpeng, E-mail: zplu@t.shu.edu.cn [Institute of Materials Science, School of Materials Science and Engineering, Shanghai University, Mailbox 269, 149 Yanchang Road, Shanghai, 200072 (China); State Key Laboratory of Advanced Special Steels, Shanghai University, 149 Yanchang Road, Shanghai, 200072 (China); Xiao, Qian; Ru, Xiangkun; Han, Guangdong; Chen, Zhen [Institute of Materials Science, School of Materials Science and Engineering, Shanghai University, Mailbox 269, 149 Yanchang Road, Shanghai, 200072 (China); Zhou, Bangxin [Institute of Materials Science, School of Materials Science and Engineering, Shanghai University, Mailbox 269, 149 Yanchang Road, Shanghai, 200072 (China); State Key Laboratory of Advanced Special Steels, Shanghai University, 149 Yanchang Road, Shanghai, 200072 (China); Shoji, Tetsuo [New Industry Creation Hatchery Center, Tohoku University, Sendai 980-8579 (Japan)

    2016-04-15

    Stress corrosion cracking behaviors of one-directionally cold rolled 316L stainless steel specimens in T–L and L–T orientations were investigated in hydrogenated and deaerated PWR primary water environments at 310 °C. Transgranular cracking was observed during the in situ pre-cracking procedure and the crack growth rate was almost not affected by the specimen orientation. Locally intergranular stress corrosion cracks were found on the fracture surfaces of specimens in the hydrogenated PWR water. Extensive intergranular stress corrosion cracks were found on the fracture surfaces of specimens in deaerated PWR water. More extensive cracks were found in specimen T–L orientation with a higher crack growth rate than that in the specimen L–T orientation with a lower crack growth rate. Crack branching phenomenon found in specimen L–T orientation in deaerated PWR water was synergistically affected by the applied stress direction as well as the preferential oxidation path along the elongated grain boundaries, and the latter was dominant. - Highlights: • Transgranular fatigue crack growth rate was not affected by the cold rolling orientation. • Locally intergranular SCC was found in the hydrogenated PWR water. • Extensive intergranular SCC cracks were found in deaerated PWR water. • T–L specimen showed more extensive SCC cracks and a higher crack growth rate. • Crack branching related to the applied stress and the preferential oxidation path.

  14. Anomalous diffusion of water molecules at grain boundaries in ice Ih.

    Science.gov (United States)

    Moreira, Pedro Augusto Franco Pinheiro; Veiga, Roberto Gomes de Aguiar; Ribeiro, Ingrid de Almeida; Freitas, Rodrigo; Helfferich, Julian; de Koning, Maurice

    2018-05-23

    Using ab initio and classical molecular dynamics simulations, we study pre-melting phenomena in pristine coincident-site-lattice grain boundaries (GBs) in proton-disordered hexagonal ice Ih at temperatures just below the melting point Tm. Concerning pre-melt-layer thicknesses, the results are consistent with the available experimental estimates for low-disorder impurity-free GBs. With regard to molecular mobility, the simulations provide a key new insight: the translational motion of the water molecules is found to be subdiffusive for time scales from ∼10 ns up to at least 0.1 μs. Moreover, the fact that the anomalous diffusion occurs even at temperatures just below Tm where the bulk supercooled liquid still diffuses normally suggests that it is related to the confinement of the GB pre-melt layers by the surrounding crystalline environment. Furthermore, we show that this behavior can be characterized by continuous-time random walk models in which the waiting-time distributions decay according to power-laws that are very similar to those describing dynamics in glass-forming systems.

  15. Intercalated Water and Organic Molecules for Electrode Materials of Rechargeable Batteries.

    Science.gov (United States)

    Lee, Hyeon Jeong; Shin, Jaeho; Choi, Jang Wook

    2018-03-24

    The intrinsic limitations of lithium-ion batteries (LIBs) with regard to safety, cost, and the availability of raw materials have promoted research on so-called "post-LIBs". The recent intense research of post-LIBs provides an invaluable lesson that existing electrode materials used in LIBs may not perform as well in post-LIBs, calling for new material designs compliant with emerging batteries based on new chemistries. One promising approach in this direction is the development of materials with intercalated water or organic molecules, as these materials demonstrate superior electrochemical performance in emerging battery systems. The enlarged ionic channel dimensions and effective shielding of the electrostatic interaction between carrier ions and the lattice host are the origins of the observed electrochemical performance. Moreover, these intercalants serve as interlayer pillars to sustain the framework for prolonged cycles. Representative examples of such intercalated materials applied to batteries based on Li + , Na + , Mg 2+ , and Zn 2+ ions and supercapacitors are considered, along with their impact in materials research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. NO Exchange for a Water Molecule Favorably Changes Iontophoretic Release of Ruthenium Complexes to the Skin

    Directory of Open Access Journals (Sweden)

    Danielle C. A. S. de Santana

    2017-01-01

    Full Text Available Ruthenium (Ru complexes have been studied as promising anticancer agents. Ru nitrosyl complex (Ru-NO is one which acts as a pro-drug for the release of nitric oxide (NO. The Ru-aqueous complex formed by the exchange of NO for a water molecule after NO release could also possess therapeutic effects. This study evaluates the influence of iontophoresis on enhancing the skin penetration of Ru-NO and Ru-aqueous and assesses its applicability as a tool in treating diverse skin diseases. Passive and iontophoretic (0.5 mA·cm−2 skin permeation of the complexes were performed for 4 h. The amount of Ru and NO in the stratum corneum (SC, viable epidermis (VE, and receptor solution was quantified while the influence of iontophoresis and irradiation on NO release from Ru-NO complex was also evaluated. Iontophoresis increased the amount of Ru-NO and Ru-aqueous recovered from the receptor solution by 15 and 400 times, respectively, as compared to passive permeation. Iontophoresis produced a higher accumulation of Ru-aqueous in the skin layers as compared to Ru-NO. At least 50% of Ru-NO penetrated the SC was stable after 4 h. The presence of Ru-NO in this skin layer suggests that further controlled release of NO can be achieved by photo-stimulation after iontophoresis.

  17. Magnetic orientation of nontronite clay in aqueous dispersions and its effect on water diffusion.

    Science.gov (United States)

    Abrahamsson, Christoffer; Nordstierna, Lars; Nordin, Matias; Dvinskikh, Sergey V; Nydén, Magnus

    2015-01-01

    The diffusion rate of water in dilute clay dispersions depends on particle concentration, size, shape, aggregation and water-particle interactions. As nontronite clay particles magnetically align parallel to the magnetic field, directional self-diffusion anisotropy can be created within such dispersion. Here we study water diffusion in exfoliated nontronite clay dispersions by diffusion NMR and time-dependant 1H-NMR-imaging profiles. The dispersion clay concentration was varied between 0.3 and 0.7 vol%. After magnetic alignment of the clay particles in these dispersions a maximum difference of 20% was measured between the parallel and perpendicular self-diffusion coefficients in the dispersion with 0.7 vol% clay. A method was developed to measure water diffusion within the dispersion in the absence of a magnetic field (random clay orientation) as this is not possible with standard diffusion NMR. However, no significant difference in self-diffusion coefficient between random and aligned dispersions could be observed. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Studing electronic structure of water molecules in aquocomplexes by the method of pions minus capture by hydrogen

    International Nuclear Information System (INIS)

    Dezhi, I.; Krumshtejn, Z.V.; Molnar, B.; Petrukhin, V.I.; Rybakov, V.N.; Suvorov, V.M.; Khorvat, D.; Tsisek, Z.; Yutlandov, I.A.

    1980-01-01

    Using the effect of electron shell state on π-meson capture by chemically bound hydrogen studied has been change of electron density in hydrogen atoms of water molecules bound into aquocomplexes. The fact of depression of π-meson capture probability by hydrogen of water in aquocomplexes has been established. The magnitudes of depression indicate essential decrease of electron density in a hydrogen atom of coordinated water. Interaction of ligands with oxygen-containing anions also essentially contributes to a magnitude of depression

  19. Direct numerical solution of the Ornstein-Zernike integral equation and spatial distribution of water around hydrophobic molecules

    Science.gov (United States)

    Ikeguchi, Mitsunori; Doi, Junta

    1995-09-01

    The Ornstein-Zernike integral equation (OZ equation) has been used to evaluate the distribution function of solvents around solutes, but its numerical solution is difficult for molecules with a complicated shape. This paper proposes a numerical method to directly solve the OZ equation by introducing the 3D lattice. The method employs no approximation the reference interaction site model (RISM) equation employed. The method enables one to obtain the spatial distribution of spherical solvents around solutes with an arbitrary shape. Numerical accuracy is sufficient when the grid-spacing is less than 0.5 Å for solvent water. The spatial water distribution around a propane molecule is demonstrated as an example of a nonspherical hydrophobic molecule using iso-value surfaces. The water model proposed by Pratt and Chandler is used. The distribution agrees with the molecular dynamics simulation. The distribution increases offshore molecular concavities. The spatial distribution of water around 5α-cholest-2-ene (C27H46) is visualized using computer graphics techniques and a similar trend is observed.

  20. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  1. Interaction of water with oriented DNA in the A- and B-form conformations

    International Nuclear Information System (INIS)

    Brandes, R.; Rupprecht, A.; Kearns, D.R.

    1989-01-01

    High resolution 2 H nuclear magnetic resonance (NMR) was used to investigate the interaction of D 2 O with solid samples of uniaxially oriented Li-DNA (B-form DNA) and Na-DNA (A- and B-form DNA). At low levels of hydration, 0 approximately 4 D 2 O/nucleotide, the 2 H spectra shows a very weak (due to short T2) broad single resonance, suggestive of unrestricted rotational diffusion of the water. At approximately 5 or more D 2 O/nucleotide, the Li-DNA (B-form) spectra suddenly exhibit a large doublet splitting, characteristic of partially ordered water. With increasing hydration, the general trend is a decrease of this splitting. From our analysis we show that the DNA water structure reorganizes as the DNA is progressively hydrated. The D 2 O interaction with Na-DNA is rather different than with Li-DNA. Below 10 D 2 O/nucleotide Na-DNA is normally expected to be in the A-form, and a small, or negligible splitting is observed. In the range 9-19 D 2 O/nucleotide, the splitting increases with increasing hydration. Above approximately 20 D 2 O/nucleotide Na-DNA converts entirely to the B-form and the D 2 O splittings are then similar to those found in Li-DNA. We show that the complex Na-DNA results obtained in the range 0-20 D 2 O/nucleotide are caused by a mixture of A- and B-DNA in those samples

  2. Effects of multiple electronic shells on strong-field multiphoton ionization and high-order harmonic generation of diatomic molecules with arbitrary orientation: An all-electron time-dependent density-functional approach

    International Nuclear Information System (INIS)

    Telnov, Dmitry A.; Chu, S.-I

    2009-01-01

    We present a time-dependent density-functional theory approach with proper long-range potential for an ab initio study of the effect of correlated multielectron responses on the multiphoton ionization (MPI) and high-order harmonic generation (HHG) of diatomic molecules N 2 and F 2 in intense short laser pulse fields with arbitrary molecular orientation. We show that the contributions of inner molecular orbitals to the total MPI probability can be sufficiently large or even dominant over the highest-occupied molecular orbital, depending on detailed electronic structure and symmetry, laser field intensity, and orientation angle. The multielectron effects in HHG are also very important. They are responsible for enhanced HHG at some orientations of the molecular axis. Even strongly bound electrons may have a significant influence on the HHG process.

  3. A theoretical model investigation of peptide bond formation involving two water molecules in ribosome supports the two-step and eight membered ring mechanism

    International Nuclear Information System (INIS)

    Wang, Qiang; Gao, Jun; Zhang, Dongju; Liu, Chengbu

    2015-01-01

    Highlights: • We theoretical studied peptide bond formation reaction mechanism with two water molecules. • The first water molecule can decrease the reaction barriers by forming hydrogen bonds. • The water molecule mediated three-proton transfer mechanism is the favorable mechanism. • Our calculation supports the two-step and eight membered ring mechanism. - Abstract: The ribosome is the macromolecular machine that catalyzes protein synthesis. The kinetic isotope effect analysis reported by Strobel group supports the two-step mechanism. However, the destination of the proton originating from the nucleophilic amine is uncertain. A computational simulation of different mechanisms including water molecules is carried out using the same reaction model and theoretical level. Formation the tetrahedral intermediate with proton transfer from nucleophilic nitrogen, is the rate-limiting step when two water molecules participate in peptide bond formation. The first water molecule forming hydrogen bonds with O9′ and H15′ in the A site can decrease the reaction barriers. Combined with results of the solvent isotope effects analysis, we conclude that the three-proton transfer mechanism in which water molecule mediate the proton shuttle between amino and carbon oxygen in rate-limiting step is the favorable mechanism. Our results will shield light on a better understand the reaction mechanism of ribosome

  4. Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite

    KAUST Repository

    Yoon, Seyoon; Monteiro, Paulo J.M.

    2013-01-01

    The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current

  5. Orientation-controlled parallel assembly at the air–water interface

    International Nuclear Information System (INIS)

    Park, Kwang Soon; Hoo, Ji Hao; Baskaran, Rajashree; Böhringer, Karl F

    2012-01-01

    This paper presents an experimental and theoretical study with statistical analysis of a high-yield, orientation-specific fluidic self-assembly process on a preprogrammed template. We demonstrate self-assembly of thin (less than few hundred microns in thickness) parts, which is vital for many applications in miniaturized platforms but problematic for today's pick-and-place robots. The assembly proceeds row-by-row as the substrate is pulled up through an air–water interface. Experiments and analysis are presented with an emphasis on the combined effect of controlled surface waves and magnetic force. For various gap values between a magnet and Ni-patterned parts, magnetic force distributions are generated using Monte Carlo simulation and employed to predict assembly yield. An analysis of these distributions shows that a gradual decline in yield following the probability density function can be expected with degrading conditions. The experimentally determined critical magnetic force is in good agreement with a derived value from a model of competing forces acting on a part. A general set of design guidelines is also presented from the developed model and experimental data. (paper)

  6. A planning-oriented sustainability assessment framework for peri-urban water management in developing countries.

    Science.gov (United States)

    Starkl, Markus; Brunner, Norbert; López, Eduardo; Martínez-Ruiz, José Luis

    2013-12-15

    DPSIR and the three-pillar model are well-established frameworks for sustainability assessment. This paper proposes a planning-oriented sustainability assessment framework (POSAF). It is informed by those frameworks but differs insofar as it puts more emphasis on a constructivist conception which recognises that sustainability needs to be defined anew for each planning problem. In finding such a consensus definition, POSAF uses participatory scenario analysis and participatory planning, technical feasibility study, participatory assessment, analysis of trade-offs and social networks in an unusual combination and for goals that differ from the original conceptions of these methods. POSAF was applied in a peri-urban area of Mexico City for the design of improved water service provision, integrating solid waste management. It supported consensus amongst users about the importance of environmental issues, informed planners about the values of stakeholders and users, detected local differences, and identified possible conflicts at an early stage of decision-making. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Thermodynamic analysis of water molecules at the surface of proteins and applications to binding site prediction and characterization.

    Science.gov (United States)

    Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody

    2012-03-01

    Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.

  8. Serine/threonine phosphatase tapp2cs might be served as an early signal molecule for water stress in wheat

    International Nuclear Information System (INIS)

    Song, K. H.; Tian, W. L.; Hou, B. Z.; Guo, J. X.; Mei, X. R.; Li, Y. Z.

    2015-01-01

    Much progress has been made towards understanding the role of serine/threonine phosphatases type 2C (PP2Cs) in abscisic acid (ABA) signaling transduction. However, how the negative regulator, PP2Cs, responds to plant water loss remains unclear. Here, we used a series of relative soil moisture (RSM: 85 percentage (well watered), 65 percentage (moderate stress), 45 percentage (severe stress) potted winter wheat (Triticum aestivum L.) and the detached leaves to detect ABA levels and transcripts of PP2Cs, including PP2C40, PP2C45, PP2C59 and PP2C6 as well as the core downstream signals of ABA, including ABF, SnRK2.4 and SnRK2.5. The results showed that the continual loss of water led to a consistent increase in ABA levels, and that the mRNA expression levels of PP2Cs were dependent on plant water condition. PP2Cs expression could be induced by a slight loss of water, and inhibited under severe loss of water. These results were further confirmed by the transcripts of ABF, SnRK2.4 and SnRK2.5. Furthermore, in slight loss of water, 100 μM exogenous ABA could promote PP2Cs expression; in severe loss of water, it inhibited PP2Cs expression. In conclusion, ABA accumulation is controlled by water condition and the PP2C expression is dependent on plant water condition, suggesting that PP2Cs might be served as an early signal molecule for water stress in wheat. (author)

  9. Problem - oriented studies on plant - soil - water relations : sowing strategies for maize in rainfed agriculture in Southern Mozambique : water management in bog relicts in the Netherlands

    NARCIS (Netherlands)

    Schouwenaars, J.M.

    1990-01-01

    Plant-soil-water models are applied in two case studies. Attention is given to the desired level of accuracy in (agro-)hydrological. research when applied in problem-oriented studies. In the case studies it is shown that when decision criteria are only roughly known and when only

  10. Expressional Changes of Water Transport-related Molecules in the Efferent Ductules and Initial Segment of Mouse Treated with Bisphenol A-Containing Drinking Water for Two Generations.

    Science.gov (United States)

    Han, Su-Yong; Lee, Ki-Ho

    2013-09-01

    Bisphenol A (BPA) is an estrogenic endocrine disrupter. However, depending on a way of treatment, the harmful effects of BPA have not been confirmed. Also, trans-generational effects of BPA on male reproduction are still controversial. Because the reabsorption of testicular fluid in the efferent ductules (ED) and initial segment (IS) is important for sperm maturation, the present study was designed to determine trans-generational effect of BPA administrated orally on expression of water transport-related molecules in the mouse ED and IS. Ethanol-dissolved BPA was diluted in water to be 100 ng (low), 10 μg (medium), and 1 mg/Ml water (high). BPA-containing water was provided for two generations. Expression of ion transporters and water channels in the ED and IS were measured by relative real-time PCR analysis. In the ED, BPA treatment caused expressional increases of carbonic anhydrase II, cystic fibrosis transmembrane regulator, Na(+)/K(+) ATPase α1 subunit, and aquaporin (AQP) 1. No change of Na(+)/H(+) exchange (NHE) 3 expression was detected. BPA treatment at medium dose resulted in an increase of AQP9 expression. In the IS, the highest expressional levels of all molecules tested were observed in medium-dose BPA treatment. Generally, high-dose BPA treatment resulted in a decrease or no change of gene expression. Fluctuation of NHE3 gene expression by BPA treatment at different concentrations was detected. These findings suggest that trans-generational exposure to BPA, even at low dose, could affect gene expression of water-transport related molecules. However, such effects of BPA would be differentially occurred in the ED and IS.

  11. Process-oriented tests for validation of baroclinic shallow water models: The lock-exchange problem

    Science.gov (United States)

    Kolar, R. L.; Kibbey, T. C. G.; Szpilka, C. M.; Dresback, K. M.; Tromble, E. M.; Toohey, I. P.; Hoggan, J. L.; Atkinson, J. H.

    A first step often taken to validate prognostic baroclinic codes is a series of process-oriented tests, as those suggested by Haidvogel and Beckmann [Haidvogel, D., Beckmann, A., 1999. Numerical Ocean Circulation Modeling. Imperial College Press, London], among others. One of these tests is the so-called "lock-exchange" test or "dam break" problem, wherein water of different densities is separated by a vertical barrier, which is removed at time zero. Validation against these tests has primarily consisted of comparing the propagation speed of the wave front, as predicted by various theoretical and experimental results, to model output. In addition, inter-model comparisons of the lock-exchange test have been used to validate codes. Herein, we present a high resolution data set, taken from a laboratory-scale model, for direct and quantitative comparison of experimental and numerical results throughout the domain, not just the wave front. Data is captured every 0.2 s using high resolution digital photography, with salt concentration extracted by comparing pixel intensity of the dyed fluid against calibration standards. Two scenarios are discussed in this paper, symmetric and asymmetric mixing, depending on the proportion of dense/light water (17.5 ppt/0.0 ppt) in the experiment; the Boussinesq approximation applies to both. Front speeds, cast in terms of the dimensionless Froude number, show excellent agreement with literature-reported values. Data are also used to quantify the degree of mixing, as measured by the front thickness, which also provides an error band on the front speed. Finally, experimental results are used to validate baroclinic enhancements to the barotropic shallow water ADvanced CIRCulation (ADCIRC) model, including the effect of the vertical mixing scheme on simulation results. Based on salinity data, the model provides an average root-mean-square (rms) error of 3.43 ppt for the symmetric case and 3.74 ppt for the asymmetric case, most of which can

  12. Molecular motion of water molecules in lyotropic mesophases formed from fatty acid soaps

    International Nuclear Information System (INIS)

    Olszewski, K.J.; Pislewski, N.

    1980-01-01

    The results of study of self-diffusion coefficients and relaxation times for the mesophases formed from water mixtures of potassium laurate (denoted by C 12 K), myristate (C 14 K), and palmitate (C 16 K), are presented. The samples containing by weight 70% of soaps and 30% of water as well as samples containing 30% of soaps and 70% of water were examined. It allowed to obtain lamellar and middle phase respectively. (author)

  13. Investigation of N-acyl homoserine lactone (AHL) molecule production in Gram-negative bacteria isolated from cooling tower water and biofilm samples.

    Science.gov (United States)

    Haslan, Ezgi; Kimiran-Erdem, Ayten

    2013-09-01

    In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.

  14. Low-temperature FTIR spectroscopy provides evidence for protein-bound water molecules in eubacterial light-driven ion pumps.

    Science.gov (United States)

    Nomura, Yurika; Ito, Shota; Teranishi, Miwako; Ono, Hikaru; Inoue, Keiichi; Kandori, Hideki

    2018-01-31

    Light-driven H + , Na + and Cl - pumps have been found in eubacteria, which convert light energy into a transmembrane electrochemical potential. A recent mutation study revealed asymmetric functional conversion between the two pumps, where successful functional conversions are achieved exclusively when mutagenesis reverses the evolutionary amino acid sequence changes. Although this fact suggests that the essential structural mechanism of an ancestral function is retained even after gaining a new function, questions regarding the essential structural mechanism remain unanswered. Light-induced difference FTIR spectroscopy was used to monitor the presence of strongly hydrogen-bonded water molecules for all eubacterial H + , Na + and Cl - pumps, including a functionally converted mutant. This fact suggests that the strongly hydrogen-bonded water molecules are maintained for these new functions during evolution, which could be the reason for successful functional conversion from Na + to H + , and from Cl - to H + pumps. This also explains the successful conversion of the Cl - to the H + pump only for eubacteria, but not for archaea. It is concluded that water-containing hydrogen-bonding networks constitute one of the essential structural mechanisms in eubacterial light-driven ion pumps.

  15. The impact of fibre orientation on T1-relaxation and apparent tissue water content in white matter.

    Science.gov (United States)

    Schyboll, Felix; Jaekel, Uwe; Weber, Bernd; Neeb, Heiko

    2018-02-20

    Recent MRI studies have shown that the orientation of nerve fibres relative to the main magnetic field affects the R 2 *(= 1/T 2 *) relaxation rate in white matter (WM) structures. The underlying physical causes have been discussed in several studies but are still not completely understood. However, understanding these effects in detail is of great importance since this might serve as a basis for the development of new diagnostic tools and/or improve quantitative susceptibility mapping techniques. Therefore, in addition to the known angular dependence of R 2 *, the current study investigates the relationship between fibre orientation and the longitudinal relaxation rate, R 1 (= 1/T 1 ), as well as the apparent water content. For a group of 16 healthy subjects, a series of gradient echo, echo-planar and diffusion weighted images were acquired at 3T from which the decay rates, the apparent water content and the diffusion direction were reconstructed. The diffusion weighted data were used to determine the angle between the principle fibre direction and the main magnetic field to examine the angular dependence of R 1 and apparent water content. The obtained results demonstrate that both parameters depend on the fibre orientation and exhibit a positive correlation with the angle between fibre direction and main magnetic field. These observations could be helpful to improve and/or constrain existing biophysical models of brain microstructure by imposing additional constraints resulting from the observed angular dependence R 1 and apparent water content in white matter.

  16. Bibliography of electron and photon cross sections with atoms and molecules published in the 20th century. Water vapour

    International Nuclear Information System (INIS)

    Hayashi, Makoto

    2003-12-01

    Bibliographies of original and review reports of experiments or theories of electron and photon cross sections and also electron swarm data are presented for atomic or molecular species with specified targets. These works covered 17 atoms and 51 molecules. The present bibliography is only for water vapour (H 2 O, D 2 O and HDO). About 1200 papers were compiled. A comprehensive author index is included. The bibliography covers the period 1915 through 2000 for H 2 O. Finally, author's comments for electron collision cross sections and photodissociation processes of H 2 O are given. (author)

  17. Coordination geometries of Zn(II) and Cd(II) in phosphotriesterase: Influence of water molecules in the active site

    DEFF Research Database (Denmark)

    Krauss, M; Olsen, Lars; Antony, J

    2002-01-01

    Models of the metal ion binding sites of native ZnZn and of cadmium-substituted ZnCd and CdCd phosphotriesterase, including full amino acid side chains, were geometry optimized with quantum mechanical methods, with effective fragment potentials (EFP) representing the protein environment surroundi...... to the Od1 of the carboxylate of the first-shell aspartate designated M 1, but the energy difference between Cd1Zn2 and the lowest energy Zn1Cd2 structure is only about 2 kcal/mol and decreasing with the addition of water molecules. The Zn1Cd2 arrangement is found experimentally....

  18. Prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium: DFT and Car–Parrinello molecular dynamics study

    International Nuclear Information System (INIS)

    Dutta, Bipan; De, Rina; Chowdhury, Joydeep

    2015-01-01

    Highlights: • The tautomerism of 4-MTTN molecule in solvent water medium has been investigated. • CPMD presage the possibility of PT reactions through the solvent water medium. • Concerted PT processes in 4-MTTN have been estimated from the DFT and NBO analyses. • Percentage evolution and breaking of the concerned bonds are estimated. - Abstract: The ground state prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium has been investigated with the aid of DFT and Car–Parrinello molecular dynamics (CPMD) simulation studies. The CPMD simulations envisage the possibility of proton transfer reactions of the molecule through the solvent water medium. Probable proton transfer pathways have been predicted from the DFT calculations which are substantiated by the natural bond orbital analyses. The evolution and breaking of the concerned bonds of the molecule for different proton transfer reaction pathways are also estimated.

  19. Boltzmann equation analysis of electron-molecule collision cross sections in water vapor and ammonia

    International Nuclear Information System (INIS)

    Yousfi, M.; Benabdessadok, M.D.

    1996-01-01

    Sets of electron-molecule collision cross sections for H 2 O and NH 3 have been determined from a classical technique of electron swarm parameter unfolding. This deconvolution method is based on a simplex algorithm using a powerful multiterm Boltzmann equation analysis established in the framework of the classical hydrodynamic approximation. It is well adapted for the simulation of the different classes of swarm experiments (i.e., time resolved, time of flight, and steady state experiments). The sets of collision cross sections that exist in the literature are reviewed and analyzed. Fitted sets of cross sections are determined for H 2 O and NH 3 which exhibit features characteristic of polar molecules such as high rotational excitation collision cross sections. The hydrodynamic swarm parameters (i.e., drift velocity, longitudinal and transverse diffusion coefficients, ionization and attachment coefficients) calculated from the fitted sets are in excellent agreement with the measured ones. These sets are finally used to calculate the transport and reaction coefficients needed for discharge modeling in two cases of typical gas mixtures for which experimental swarm data are very sparse or nonexistent (i.e., flue gas mixtures and gas mixtures for rf plasma surface treatment). copyright 1996 American Institute of Physics

  20. A low-cost, orientation-insensitive microwave water-cut sensor printed on a pipe surface

    KAUST Repository

    Karimi, Muhammad Akram

    2017-10-24

    This paper presents a novel and contactless water fraction (also known as water cut) measurement technique, which is independent of geometric distribution of oil and water inside the pipe. The sensor is based upon a modified dual helical stub resonators implemented directly on the pipe\\'s outer surface and whose resonance frequency decreases by increasing the water content in oil. The E-fields have been made to rotate and distribute well inside the pipe, despite having narrow and curved ground plane. It makes the sensor\\'s reading dependent only on the water fraction and not on the mixture distribution inside the pipe. That is why, the presented design does not require any flow conditioner to homogenize the oil/water mixture unlike many commercial WC sensors. The presented sensor has been realized by using extremely low cost methods of screen-printing and reusable 3D printed mask. Complete characterization of the proposed WC sensor, both in horizontal and vertical orientations, has been carried out in an industrial flow loop. Excellent repeatability of the sensor\\'s response has been observed under different flow conditions. The measured performance results of the sensor show full range accuracy of ±2-3% while tested under random orientations and wide range of flow rates.

  1. Theoretical study on microhydration of SeO42-: On the number of water molecules necessary to stabilize the dianion

    Science.gov (United States)

    Pathak, Arup Kumar

    2012-01-01

    Microhydration of SeO42-·nH2O (n = 1-5) clusters are reported at B3LYP/Aug-cc-pvtz level of theory. Lower size hydrated clusters are stabilized by only double-hydrogen-bonding arrangements and the most stable conformer for higher size cluster (n > 3) contains a cyclic water ring. It is observed that at least one water molecule is necessary to stabilize the dianion in the gas phase against spontaneous electron loss. The microscopic theory based expression provides a route to predict the instability of bare SeO42- and to obtain the VDE for a wide range of cluster sizes including the bulk from the knowledge of the same for a few stable hydrated clusters.

  2. Aqueous Solvation of Polyalanine α-Helices with Specific Water Molecules and with the CPCM and SM5.2 Aqueous Continuum Models using Density Functional Theory

    OpenAIRE

    Marianski, Mateusz; Dannenberg, J. J.

    2012-01-01

    We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum...

  3. MSINDO quantum chemical modeling study of water molecule adsorption at nano-sized anatase TiO2 surfaces

    International Nuclear Information System (INIS)

    Wahab, Hilal S.; Bredow, Thomas; Aliwi, Salah M.

    2008-01-01

    In this work, we studied the adsorption of water molecule onto the (1 0 0), (0 1 0) and (0 0 1) surfaces of nano-sized anatase TiO 2 with semiempirical SCF MO method, MSINDO. The anatase TiO 2 particles are modeled with free clusters (TiO 2 ) n, where n = 20-80. Whereas, the surfaces have been modeled with two saturated clusters, Ti 21 O 58 H 32 and Ti 36 O 90 H 36 . The surface lattice fivefold coordinated titanium atoms (Ti 5C ), which represent the Lewis acid sites, are selected as adsorption centers. We also investigated the effect of TiO 2 cluster size on the computed band gap energy. Results reveal that the electronic properties of a cluster in the lowest excited state differ from that of the ground state. Furthermore, the MSINDO band gap energies of 3.68-3.77 eV for the anatase TiO 2 are in a fair accordance with other literature data. In agreement with other computational and experimental studies, the dissociated form of water molecule adsorption on anatase TiO 2 surfaces is always more stabilized than the molecular form

  4. Effect of anodizing voltage on the sorption of water molecules on porous alumina

    Energy Technology Data Exchange (ETDEWEB)

    Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)

    2012-05-01

    The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).

  5. Distinguishing Biologically Relevant Hexoses by Water Adduction to the Lithium-Cationized Molecule.

    Science.gov (United States)

    Campbell, Matthew T; Chen, Dazhe; Wallbillich, Nicholas J; Glish, Gary L

    2017-10-03

    A method to distinguish the four most common biologically relevant underivatized hexoses, d-glucose, d-galactose, d-mannose, and d-fructose, using only mass spectrometry with no prior separation/derivatization step has been developed. Electrospray of a solution containing hexose and a lithium salt generates [Hexose+Li] + . The lithium-cationized hexoses adduct water in a quadrupole ion trap. The rate of this water adduction reaction can be used to distinguish the four hexoses. Additionally, for each hexose, multiple lithiation sites are possible, allowing for multiple structures of [Hexose+Li] + . Electrospray produces at least one structure that reacts with water and at least one that does not. The ratio of unreactive lithium-cationized hexose to total lithium-cationized hexose is unique for the four hexoses studied, providing a second method for distinguishing the isomers. Use of the water adduction reaction rate or the unreactive ratio provides two separate methods for confidently (p ≤ 0.02) distinguishing the most common biologically relevant hexoses using only femtomoles of hexose. Additionally, binary mixtures of glucose and fructose were studied. A calibration curve was created by measuring the reaction rate of various samples with different ratios of fructose and glucose. The calibration curve was used to accurately measure the percentage of fructose in three samples of high fructose corn syrup (<4% error).

  6. Incipient ferroelectricity of water molecules confined to nano-channels of beryl

    Czech Academy of Sciences Publication Activity Database

    Gorshunov, B. P.; Torgashev, V. I.; Zhukova, E.S.; Thomas, V.G.; Belyanchikov, M. A.; Kadlec, Christelle; Kadlec, Filip; Savinov, Maxim; Ostapchuk, Tetyana; Petzelt, Jan; Prokleška, J.; Tomas, P. V.; Pestrjakov, E.V.; Fursenko, D.A.; Shakurov, G.S.; Prokhorov, A. S.; Gorelik, V. S.; Kadyrov, L.S.; Uskov, V.V.; Kremer, R. K.; Dressel, M.

    2016-01-01

    Roč. 7, Sep (2016), 1-10, č. článku 12842. ISSN 2041-1723 R&D Projects: GA ČR(CZ) GA14-25639S Institutional support: RVO:68378271 Keywords : water * beryl * ferroelectricity * quantum fluctuations * Curie–Weiss behaviour Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 12.124, year: 2016

  7. Radiological and chemical characterization of drinking water supplies of Serido Oriental Region, Rio Grande do Norte, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Rojas, Lino Angel Valcarcel; Fernández, Zahily Herrero; Alvarez, Alfredo Montero [Centro de Aplicaciones Tecnológicas y Desarrollo Nuclear (CEADEN), La Habana (Cuba); Santos Júnior, José Araújo dos; Amaral, Romilton dos Santos; Santos, Josineide Marques do Nascimento [Universidade Federal de Pernambuco (DEN/UFPE), Recife, (Brazil). Departamento de Energia Nuclear; Alvarado, Jose Antonio Corcho [Federal Office for Civil Protection, Spiez Laboratory, Physics Division, Labor Spiez, Spiez (Switzerland); Milan, Marvic Ortueta [Instituto Superior de Tecnologías y Ciencias Aplicadas (InSTEC), La Habana (Cuba); Nascimento, Clístenes Williams Araújo do [Universidade Federal Rural de Pernambuco (UFRPE), Recife, (Brazil). Departamento de Agronomia

    2017-07-01

    The presence of natural radioactive anomalies in rocks and soils of the state of Rio Grande do Norte may contribute to an increased exposure of the local population to natural radiation sources. From this region, there is a lack of information on the levels of natural radioactivity in drinking water supplies. Hence, this work focused on the characterization of the radiological and chemical aspects of the drinking water consumed in several municipalities of the Seridó Oriental region. Samples of surface water and groundwater were analysed for gross alpha and beta radioactivity and for the content of {sup 226}Ra. The most important physical and chemical parameters of the water are reported. Most of the monitored water parameter showed values higher than those recommended for a good organoleptic quality of the water. Gross alpha activity, ranging from <0.05 to 1.61 Bq/L, showed values higher than de permissible ones in two samples. Gross beta activity, corrected for {sup 40}K contribution, ranged from 0.22 to 1.67 Bq/L. The activity concentration of {sup 226}Ra ranged from <0.01 to 0.53 Bq/L. Water quality can be considered poor, taking into the high levels of dissolved solids, affecting mainly the organoleptic characteristics of the water. Further investigation is needed to assess the behavior of the radiometric parameter in those samples with values higher than the permissible ones and to extent the study to other municipalities of the region. (author)

  8. Radiological and chemical characterization of drinking water supplies of Serido Oriental Region, Rio Grande do Norte, Brazil

    International Nuclear Information System (INIS)

    Rojas, Lino Angel Valcarcel; Fernández, Zahily Herrero; Alvarez, Alfredo Montero; Santos Júnior, José Araújo dos; Amaral, Romilton dos Santos; Santos, Josineide Marques do Nascimento; Milan, Marvic Ortueta; Nascimento, Clístenes Williams Araújo do

    2017-01-01

    The presence of natural radioactive anomalies in rocks and soils of the state of Rio Grande do Norte may contribute to an increased exposure of the local population to natural radiation sources. From this region, there is a lack of information on the levels of natural radioactivity in drinking water supplies. Hence, this work focused on the characterization of the radiological and chemical aspects of the drinking water consumed in several municipalities of the Seridó Oriental region. Samples of surface water and groundwater were analysed for gross alpha and beta radioactivity and for the content of 226 Ra. The most important physical and chemical parameters of the water are reported. Most of the monitored water parameter showed values higher than those recommended for a good organoleptic quality of the water. Gross alpha activity, ranging from <0.05 to 1.61 Bq/L, showed values higher than de permissible ones in two samples. Gross beta activity, corrected for 40 K contribution, ranged from 0.22 to 1.67 Bq/L. The activity concentration of 226 Ra ranged from <0.01 to 0.53 Bq/L. Water quality can be considered poor, taking into the high levels of dissolved solids, affecting mainly the organoleptic characteristics of the water. Further investigation is needed to assess the behavior of the radiometric parameter in those samples with values higher than the permissible ones and to extent the study to other municipalities of the region. (author)

  9. Texture and hydride orientation relationship of Zircaloy-4 fuel clad tube during its fabrication for pressurized heavy water reactors

    Science.gov (United States)

    Vaibhaw, Kumar; Rao, S. V. R.; Jha, S. K.; Saibaba, N.; Jayaraj, R. N.

    2008-12-01

    Zircaloy-4 material is used for cladding tube in pressurized heavy water reactors (PHWRs) of 220 MWe and 540 MWe capacity in India. These tubes are fabricated by using various combinations of thermo-mechanical processes to achieve desired mechanical and corrosion properties. Cladding tube develops crystallographic texture during its fabrication, which has significant influence on its in-reactor performance. Due to radiolytic decomposition of water Zircaloy-4 picks-up hydrogen. This hydrogen in excess of its maximum solubility in reactor operating condition (˜300 °C), precipitates as zirconium hydrides causing embrittlement of cladding tube. Hydride orientation in the radial direction of the tube limits the service life and lowers the fuel burn-up in reactor. The orientation of the hydride primarily depends on texture developed during fabrication. A correlation between hydride orientation ( F n) with the texture in the tube during its fabrication has been developed using a second order polynomial. The present work is aimed at quantification and correlation of texture evolved in Zircaloy-4 cladding tube using Kearn's f-parameter during its fabrication process.

  10. Texture and hydride orientation relationship of Zircaloy-4 fuel clad tube during its fabrication for pressurized heavy water reactors

    International Nuclear Information System (INIS)

    Vaibhaw, Kumar; Rao, S.V.R.; Jha, S.K.; Saibaba, N.; Jayaraj, R.N.

    2008-01-01

    Zircaloy-4 material is used for cladding tube in pressurized heavy water reactors (PHWRs) of 220 MWe and 540 MWe capacity in India. These tubes are fabricated by using various combinations of thermo-mechanical processes to achieve desired mechanical and corrosion properties. Cladding tube develops crystallographic texture during its fabrication, which has significant influence on its in-reactor performance. Due to radiolytic decomposition of water Zircaloy-4 picks-up hydrogen. This hydrogen in excess of its maximum solubility in reactor operating condition (∼300 deg. C), precipitates as zirconium hydrides causing embrittlement of cladding tube. Hydride orientation in the radial direction of the tube limits the service life and lowers the fuel burn-up in reactor. The orientation of the hydride primarily depends on texture developed during fabrication. A correlation between hydride orientation (F n ) with the texture in the tube during its fabrication has been developed using a second order polynomial. The present work is aimed at quantification and correlation of texture evolved in Zircaloy-4 cladding tube using Kearn's f-parameter during its fabrication process

  11. Aqueous solvation of polyalanine α-helices with specific water molecules and with the CPCM and SM5.2 aqueous continuum models using density functional theory.

    Science.gov (United States)

    Marianski, Mateusz; Dannenberg, J J

    2012-02-02

    We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum of their individual dipole moments. These waters are found to be more stable than in bulk solvent. On the other hand, individual water molecules that interact with the backbone lower the dipole moment of the helix/water complex to below that of the helix itself. Small clusters of waters at the termini increase the dipole moments of the helix/water aggregates, but the effect diminishes as more waters are added. We discuss the somewhat complex behavior of the helix with the discrete waters in the continuum models.

  12. Stress corrosion cracking of stainless steel under deaerated high-temperature water. Influence of cold work and processing orientation

    International Nuclear Information System (INIS)

    Terachi, Takumi; Yamada, Takuyo; Chiba, Goro; Arioka, Koji

    2006-01-01

    The influence of cold work and processing orientation on the propagation of stress corrosion cracking (SCC) of stainless steel under hydrogenated high-temperature water was examined. It was shown that (1) the crack growth rates increased with heaviness of cold work, and (2) processing orientation affected crack growth rate with cracking direction. Crack growth rates showed anisotropy of T-L>>T-S>L-S, with T-S and L-S branches representing high shear stress direction. Geometric deformation of crystal grains due to cold work caused the anisotropy and shear stress also assisted the SCC propagation. (3) The step intervals of slip like patterns observed on intergranular facets increased cold work. (4) Nano-indentation hardness of the crack tip together with EBSD measurement indicated that the change of hardness due to crack propagation was less than 5% cold-work, even though the distance from the crack tip was 10μm. (author)

  13. Flow-alignment of bicellar lipid mixtures: orientations of probe molecules and membrane-associated biomacromolecules in lipid membranes studied with polarized light

    KAUST Repository

    Kogan, Maxim; Beke-Somfai, Tamá s; Nordé n, Bengt

    2011-01-01

    Bicelles are excellent membrane-mimicking hosts for a dynamic and structural study of solutes with NMR, but the magnetic fields required for their alignment are hard to apply to optical conditions. Here we demonstrate that bicellar mixtures can be aligned by shear forces in a Couette flow cell, to provide orientation of membrane-bound retinoic acid, pyrene and cytochrome c (cyt c) protein, conveniently studied with linear dichroism spectroscopy. © 2011 The Royal Society of Chemistry.

  14. Thermodynamic and structural study of two-dimensional phase transitions and orientational order in films of linear molecules with a large quadrupole moment, physi-sorbed on lamellar substrates

    International Nuclear Information System (INIS)

    Terlain, Anne

    1984-01-01

    The 2D (two-dimensional) phase transitions and orientational order in N 2 O, CO 2 , C 2 N 2 and C 2 D 2 films physi-sorbed on the (0001) face of graphite or lamellar halides, were studied experimentally by adsorption isotherm measurements and neutron diffraction. The thermodynamic functions derived from sets of isotherms suggest that crystal monolayers of N 2 O, CO 2 , and C 2 N 2 adsorbed on graphite are orientationally ordered and that the quadrupolar interaction stabilizes the 2D crystal with respect to the 2D liquid. This stabilization leads to an increase in the 2D triple point temperature, T 2t as compared with the 2D critical temperature T 2c . For C 2 N 2 this stabilization is so pronounced that T 2t becomes virtually higher than T 2c , and the phase diagram qualitatively different, having no gas-liquid coexistence domain. From a neutron diffraction experiment we have determined the crystal structure of the C 2 N 2 monolayer. It supports our interpretation of the monolayer phase diagram. In N 2 O, CO 2 , C 2 N 2 films adsorbed on graphite the molecules lie flat on the surface and their orientational order hence differs from that in the bulk crystals resulting in a loss of adsorbate-adsorbate interaction energy. Beyond a given film thickness this loss will not be compensated by the adsorbate-substrate interaction and the film will stop growing. For most of the films studied a partial wetting transition is observed at which the film thickness increases discontinuously with temperature. Although C 2 N 2 and C 2 D 2 monolayers on graphite have comparable adsorption energies, only C 2 D 2 is adsorbed on lamellar halides. This adsorption is possible only because the monolayer has a large entropy due to orientational disorder. For C 2 N 2 , which has a higher moment of inertia, such an orientational disorder cannot exist. (author) [fr

  15. Ubiquitous water-soluble molecules in aquatic plant exudates determine specific insect attraction.

    Science.gov (United States)

    Sérandour, Julien; Reynaud, Stéphane; Willison, John; Patouraux, Joëlle; Gaude, Thierry; Ravanel, Patrick; Lempérière, Guy; Raveton, Muriel

    2008-10-08

    Plants produce semio-chemicals that directly influence insect attraction and/or repulsion. Generally, this attraction is closely associated with herbivory and has been studied mainly under atmospheric conditions. On the other hand, the relationship between aquatic plants and insects has been little studied. To determine whether the roots of aquatic macrophytes release attractive chemical mixtures into the water, we studied the behaviour of mosquito larvae using olfactory experiments with root exudates. After testing the attraction on Culex and Aedes mosquito larvae, we chose to work with Coquillettidia species, which have a complex behaviour in nature and need to be attached to plant roots in order to obtain oxygen. This relationship is non-destructive and can be described as commensal behaviour. Commonly found compounds seemed to be involved in insect attraction since root exudates from different plants were all attractive. Moreover, chemical analysis allowed us to identify a certain number of commonly found, highly water-soluble, low-molecular-weight compounds, several of which (glycerol, uracil, thymine, uridine, thymidine) were able to induce attraction when tested individually but at concentrations substantially higher than those found in nature. However, our principal findings demonstrated that these compounds appeared to act synergistically, since a mixture of these five compounds attracted larvae at natural concentrations (0.7 nM glycerol, insect relationships in aquatic eco-systems.

  16. Attosecond electron dynamics in molecules and liquids

    Science.gov (United States)

    WöRner, Hans Jakob

    The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.

  17. Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

    Science.gov (United States)

    Spyrakis, Francesca; Cavasotto, Claudio N

    2015-10-01

    Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Ligand-based transport resonances of single-molecule magnet spin filters: Suppression of the Coulomb blockade and determination of the orientation of the magnetic easy axis

    OpenAIRE

    Renani, Fatemeh Rostamzadeh; Kirczenow, George

    2011-01-01

    We investigate single molecule magnet transistors (SMMTs) with ligands that support transport resonances. We find the lowest unoccupied molecular orbitals of Mn12-benzoate SMMs (with and without thiol or methyl-sulfide termination) to be on ligands, the highest occupied molecular orbitals being on the Mn12 magnetic core. We predict gate controlled switching between Coulomb blockade and coherent resonant tunneling in SMMTs based on such SMMs, strong spin filtering by the SMM in both transport ...

  19. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  20. Ubiquitous water-soluble molecules in aquatic plant exudates determine specific insect attraction.

    Directory of Open Access Journals (Sweden)

    Julien Sérandour

    Full Text Available Plants produce semio-chemicals that directly influence insect attraction and/or repulsion. Generally, this attraction is closely associated with herbivory and has been studied mainly under atmospheric conditions. On the other hand, the relationship between aquatic plants and insects has been little studied. To determine whether the roots of aquatic macrophytes release attractive chemical mixtures into the water, we studied the behaviour of mosquito larvae using olfactory experiments with root exudates. After testing the attraction on Culex and Aedes mosquito larvae, we chose to work with Coquillettidia species, which have a complex behaviour in nature and need to be attached to plant roots in order to obtain oxygen. This relationship is non-destructive and can be described as commensal behaviour. Commonly found compounds seemed to be involved in insect attraction since root exudates from different plants were all attractive. Moreover, chemical analysis allowed us to identify a certain number of commonly found, highly water-soluble, low-molecular-weight compounds, several of which (glycerol, uracil, thymine, uridine, thymidine were able to induce attraction when tested individually but at concentrations substantially higher than those found in nature. However, our principal findings demonstrated that these compounds appeared to act synergistically, since a mixture of these five compounds attracted larvae at natural concentrations (0.7 nM glycerol, <0.5 nM uracil, 0.6 nM thymine, 2.8 nM uridine, 86 nM thymidine, much lower than those found for each compound tested individually. These results provide strong evidence that a mixture of polyols (glycerol, pyrimidines (uracil, thymine, and nucleosides (uridine, thymidine functions as an efficient attractive signal in nature for Coquillettidia larvae. We therefore show for the first time, that such commonly found compounds may play an important role in plant-insect relationships in aquatic eco-systems.

  1. Design and Dynamic Characterization of an Orientation Insensitive Microwave Water-Cut Sensor

    KAUST Repository

    Karimi, Muhammad Akram; Arsalan, Muhammad; Shamim, Atif

    2017-01-01

    Modern reservoir management in oil and gas industry relies on accurate water fraction measurement which is produced as a by-product with oil. This paper presents a novel and contactless water fraction (also known as water-cut) measurement technique

  2. Physical capture and release of drug molecules, water and cations by a smectite clay

    DEFF Research Database (Denmark)

    Carvalho dos Santos, Éverton

    -fluorohectorite (LiFh, Li1.2(Mg4.8Li1.2)Si8O20F4), a synthetic clay mineral from the smectite family, have been experimentally analyzed. By means of X-rays powder diffraction (XRD), using both an in-house instrument and synchrotron radiation, UV-Vis spectroscopy, Thermogravimetric Analysis coupled to an Infrared......-analysis and inelastic neutron scattering data we established that the drug presence into the interlayer space of Fh is weakening the water-clay interactions. Furthermore, CIPRO’s release from Fh in synthetic gastric acid juice (SGA) as a function of time and temperature was also carefully followed. Our studies showed...... and toxicological tests, we demonstrated that the effectiveness and toxicity of pure CIPRO is unaffected in the clay-drug complex. To conclude, the high drug adsorption capacity as well as the slow and gradual release from CIPRO when intercalated in Fh adds this synthetic smectite to the list of promising drug...

  3. Ligand-based transport resonances of single-molecule-magnet spin filters: Suppression of Coulomb blockade and determination of easy-axis orientation

    Science.gov (United States)

    Rostamzadeh Renani, Fatemeh; Kirczenow, George

    2011-11-01

    We investigate single-molecule-magnet transistors (SMMTs) with ligands that support transport resonances. We find the lowest unoccupied molecular orbitals of Mn12-benzoate SMMs (with and without thiol or methyl-sulfide termination) to be on ligands, the highest occupied molecular orbitals being on the Mn12 magnetic core. We predict gate-controlled switching between Coulomb blockade and coherent resonant tunneling in SMMTs based on such SMMs, strong spin filtering by the SMM in both transport regimes, and that if such switching is observed, then the magnetic easy axis of the SMM is parallel to the direction of the current through the SMM.

  4. Detecting Darwinism from Molecules in the Enceladus Plumes, Jupiter's Moons, and Other Planetary Water Lagoons.

    Science.gov (United States)

    Benner, Steven A

    2017-09-01

    To the astrobiologist, Enceladus offers easy access to a potential subsurface biosphere via the intermediacy of a plume of water emerging directly into space. A direct question follows: If we were to collect a sample of this plume, what in that sample, through its presence or its absence, would suggest the presence and/or absence of life in this exotic locale? This question is, of course, relevant for life detection in any aqueous lagoon that we might be able to sample. This manuscript reviews physical chemical constraints that must be met by a genetic polymer for it to support Darwinism, a process believed to be required for a chemical system to generate properties that we value in biology. We propose that the most important of these is a repeating backbone charge; a Darwinian genetic biopolymer must be a "polyelectrolyte." Relevant to mission design, such biopolymers are especially easy to recover and concentrate from aqueous mixtures for detection, simply by washing the aqueous mixtures across a polycharged support. Several device architectures are described to ensure that, once captured, the biopolymer meets two other requirements for Darwinism, homochirality and a small building block "alphabet." This approach is compared and contrasted with alternative biomolecule detection approaches that seek homochirality and constrained alphabets in non-encoded biopolymers. This discussion is set within a model for the history of the terran biosphere, identifying points in that natural history where these alternative approaches would have failed to detect terran life. Key Words: Enceladus-Life detection-Europa-Icy moon-Biosignatures-Polyelectrolyte theory of the gene. Astrobiology 17, 840-851.

  5. Influence of the effective mass of water molecule on thermal neutron scattering; Uticaj efektivne mase molekula vode na rasejanje termalnih neutrona

    Energy Technology Data Exchange (ETDEWEB)

    Markovic, M [Belgrade Univ. (Yugoslavia). Elektrotehnicki Fakultet

    1981-07-01

    The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E{sub o} = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

  6. Management-oriented sensitivity analysis for pesticide transport in watershed-scale water quality modeling using SWAT

    International Nuclear Information System (INIS)

    Luo Yuzhou; Zhang Minghua

    2009-01-01

    The Soil and Water Assessment Tool (SWAT) was calibrated for hydrology conditions in an agricultural watershed of Orestimba Creek, California, and applied to simulate fate and transport of two organophosphate pesticides chlorpyrifos and diazinon. The model showed capability in evaluating pesticide fate and transport processes in agricultural fields and instream network. Management-oriented sensitivity analysis was conducted by applied stochastic SWAT simulations for pesticide distribution. Results of sensitivity analysis identified the governing processes in pesticide outputs as surface runoff, soil erosion, and sedimentation in the study area. By incorporating sensitive parameters in pesticide transport simulation, effects of structural best management practices (BMPs) in improving surface water quality were demonstrated by SWAT modeling. This study also recommends conservation practices designed to reduce field yield and in-stream transport capacity of sediment, such as filter strip, grassed waterway, crop residue management, and tailwater pond to be implemented in the Orestimba Creek watershed. - Selected structural BMPs are recommended for reducing loads of OP pesticides.

  7. Management-oriented sensitivity analysis for pesticide transport in watershed-scale water quality modeling using SWAT

    Energy Technology Data Exchange (ETDEWEB)

    Luo Yuzhou [University of California, Davis, CA 95616 (United States); Wenzhou Medical College, Wenzhou 325035 (China); Zhang Minghua, E-mail: mhzhang@ucdavis.ed [University of California, Davis, CA 95616 (United States); Wenzhou Medical College, Wenzhou 325035 (China)

    2009-12-15

    The Soil and Water Assessment Tool (SWAT) was calibrated for hydrology conditions in an agricultural watershed of Orestimba Creek, California, and applied to simulate fate and transport of two organophosphate pesticides chlorpyrifos and diazinon. The model showed capability in evaluating pesticide fate and transport processes in agricultural fields and instream network. Management-oriented sensitivity analysis was conducted by applied stochastic SWAT simulations for pesticide distribution. Results of sensitivity analysis identified the governing processes in pesticide outputs as surface runoff, soil erosion, and sedimentation in the study area. By incorporating sensitive parameters in pesticide transport simulation, effects of structural best management practices (BMPs) in improving surface water quality were demonstrated by SWAT modeling. This study also recommends conservation practices designed to reduce field yield and in-stream transport capacity of sediment, such as filter strip, grassed waterway, crop residue management, and tailwater pond to be implemented in the Orestimba Creek watershed. - Selected structural BMPs are recommended for reducing loads of OP pesticides.

  8. Management-oriented sensitivity analysis for pesticide transport in watershed-scale water quality modeling using SWAT.

    Science.gov (United States)

    Luo, Yuzhou; Zhang, Minghua

    2009-12-01

    The Soil and Water Assessment Tool (SWAT) was calibrated for hydrology conditions in an agricultural watershed of Orestimba Creek, California, and applied to simulate fate and transport of two organophosphate pesticides chlorpyrifos and diazinon. The model showed capability in evaluating pesticide fate and transport processes in agricultural fields and instream network. Management-oriented sensitivity analysis was conducted by applied stochastic SWAT simulations for pesticide distribution. Results of sensitivity analysis identified the governing processes in pesticide outputs as surface runoff, soil erosion, and sedimentation in the study area. By incorporating sensitive parameters in pesticide transport simulation, effects of structural best management practices (BMPs) in improving surface water quality were demonstrated by SWAT modeling. This study also recommends conservation practices designed to reduce field yield and in-stream transport capacity of sediment, such as filter strip, grassed waterway, crop residue management, and tailwater pond to be implemented in the Orestimba Creek watershed.

  9. Dihydrogen phosphate-water tape and layers vs dihydrogen phosphate layers tuned by hydrophobic isomeric pyridine-diamine functionalized molecules

    Science.gov (United States)

    Huang, Jing; Liu, Tong-Peng; Huo, Li-Hua; Deng, Zhao-Peng; Gao, Shan

    2017-01-01

    Assembly of six isomeric pyridine-diamine-based molecules, N,N‧-bis(pyridin-4-ylmethyl)ethane-1,2-diamine (M1), N,N‧-bis(pyridin-3-ylmethyl)ethane-1,2-diamine (M2), N,N‧-bis(pyridin-2-ylmethyl)ethane-1,2-diamine (M3), N,N‧-bis(pyridin-4-ylmethyl)propane-1,3-diamine (M4), N,N‧-bis(pyridin-3-ylmethyl)propane-1,2-diamine (M5), and N,N‧-bis(pyridin-2-ylmethyl)propane-1,3-diamine (M6), with phosphoric acid (H3PO4) in different ratio (1:2 and 1:4), leads to the formation of nine salts, H2M12+·2H2PO4-·4H2O (1), H2M22+·2H2PO4-·2H2O (2), H2M32+·2H2PO4-·2H2O (3), H4M14+·4H2PO4- (4), H4M24+·4H2PO4- (5), H4M34+·4H2PO4- (6), H2M42+·2H2PO4-·3H2O (7), 2H2M52+·4H2PO4-·2H3PO4 (8), and H2M62+·2H2PO4- (9), which have been characterized by elemental analysis, IR, TG, PL, powder and single-crystal X-ray diffraction. Structural analyses indicate that hydrogen-bonding patterns of H2PO4- anions, conformation of protonated cations can effectively influence the supramolecular architectures through diverse non-covalent interactions. Hydrous salts 1-3 and 7 present 2D and 3D host-guest supramolecular networks, in which the connection of H2PO4- anions and water molecules generates diverse tape and layer motifs. H2PO4- anions in anhydrous salts 4-6 interconnect with each other through hydrogen bonds to form two types of layers, which are joined by discrete H4M4+ cations into 3D inorganic-organic hybrid supramolecular networks. Salts 8-9 also present 2D and 3D host-guest supramolecular networks where the interconnection of H2PO4- anions and its combination with H3PO4 molecules leads to diverse layers. Luminescent analyses indicate that salts 1-9 exhibit violet and blue emission maximum in the range of 390-467 nm at room temperature.

  10. Thermodynamic and structural study of two-dimensional phase transitions within films of molecules physi-sorbed on graphite; the role of orientational order in wetting and roughening phenomena

    International Nuclear Information System (INIS)

    Angerand, Francois

    1987-01-01

    Two-dimensional phase transitions within films physi-sorbed upon the basal face of graphite have been investigated using two experimental methods: volumetric measurements of adsorption isotherms and neutron diffraction. Our main objective was to study the role played by orientational order in these films, its influence on their thermodynamic and structural properties, and its significance in wetting and roughening phenomena, which are indirectly accessible from adsorption studies. A comparative study of the adsorption isotherms of two molecules having comparable dipole moments, NH 3 and C 2 H 3 F, discloses very dissimilar behaviours, due to the fact that hydrogen bonding is involved in the interaction between NH 3 , but not C 2 H 3 F, molecules. The impossibility of such a bond for the interaction of the adsorbate with the substrate results in a poor cohesion energy of the NH 3 ad-film in comparison with those of its bulk condensed phases. The situation is opposite for the film of C 2 H 3 F which behaves almost as a rare gas film. From multilayer adsorption isotherms of CO it is shown that graphite (0001) is perfectly wet by the plastic (orientationally disordered) crystal phase, β-CO, whereas it is incompletely wet by the low-temperature crystal phase α-CO, in which the molecules are orientationally ordered. The critical temperatures of two-dimensional condensation have been measured for the successive ad-layers, up to the fifth. They seem to converge towards a value of 65 K, which we consider as representing the temperature of the roughening transition of the (0001) face of β-CO. A neutron diffraction study of the monolayers of N 2 O and C(CD 3 ) 4 adsorbed on graphite has been carried out. For N 2 O our results suggest a structure more involved than conjectured. For C(CD 3 ) 4 we have evidence for a triple point at 178 K. The crystal monolayer has a compact hexagonal structure. (author) [fr

  11. Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

    Science.gov (United States)

    Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

    2015-01-22

    The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

  12. Solvation study of the non-specific lipid transfer protein from wheat by intermolecular NOEs with water and small organic molecules

    International Nuclear Information System (INIS)

    Liepinsh, Edvards; Sodano, Patrick; Tassin, Severine; Marion, Didier; Vovelle, Francoise; Otting, Gottfried

    1999-01-01

    Intermolecular nuclear Overhauser effects (NOEs) were measured between the protons of various small solvent or gas molecules and the non-specific lipid transfer protein (ns-LTP) from wheat. Intermolecular NOEs were observed with the hydrophobic pocket in the interior of wheat ns-LTP, which grew in intensity in the order cyclopropane (saturated solution) < methane (140 bar) < ethane (40 bar) < acetonitrile (5% in water) < cyclohexane (saturated solution) < benzene (saturated solution). No intermolecular NOEs were observed with dioxane (5% in water). The intermolecular NOEs were negative for all of the organic molecules tested. Intermolecular NOEs between wheat ns-LTP and water were weak or could not be distinguished from exchange-relayed NOEs. As illustrated by the NOEs with cyclohexane versus dioxane, the hydrophobic pocket in wheat ns-LTP preferably binds non-polar molecules. Yet, polar molecules like acetonitrile can also be accommodated. The pressure dependence of the NOEs between methane and wheat ns-LTP indicated incomplete occupancy, even at 190 bar methane pressure. In general, NOE intensities increased with the size of the ligand molecule and its vapor pressure. NMR of the vapor phase showed excellent resolution between the signals from the gas phase and those from the liquid phase. The vapor concentration of cyclohexane was fivefold higher than that of the dioxane solution, supporting the binding of cyclohexane versus uptake of dioxane

  13. Docking ligands into flexible and solvated macromolecules. 7. Impact of protein flexibility and water molecules on docking-based virtual screening accuracy.

    Science.gov (United States)

    Therrien, Eric; Weill, Nathanael; Tomberg, Anna; Corbeil, Christopher R; Lee, Devin; Moitessier, Nicolas

    2014-11-24

    The use of predictive computational methods in the drug discovery process is in a state of continual growth. Over the last two decades, an increasingly large number of docking tools have been developed to identify hits or optimize lead molecules through in-silico screening of chemical libraries to proteins. In recent years, the focus has been on implementing protein flexibility and water molecules. Our efforts led to the development of Fitted first reported in 2007 and further developed since then. In this study, we wished to evaluate the impact of protein flexibility and occurrence of water molecules on the accuracy of the Fitted docking program to discriminate active compounds from inactive compounds in virtual screening (VS) campaigns. For this purpose, a total of 171 proteins cocrystallized with small molecules representing 40 unique enzymes and receptors as well as sets of known ligands and decoys were selected from the Protein Data Bank (PDB) and the Directory of Useful Decoys (DUD), respectively. This study revealed that implementing displaceable crystallographic or computationally placed particle water molecules and protein flexibility can improve the enrichment in active compounds. In addition, an informed decision based on library diversity or research objectives (hit discovery vs lead optimization) on which implementation to use may lead to significant improvements.

  14. Photoluminescence behaviors of single CdSe/ZnS/TOPO nanocrystals: Adsorption effects of water molecules onto nanocrystal surfaces

    International Nuclear Information System (INIS)

    Oda, Masaru; Hasegawa, Atsushi; Iwami, Noriya; Nishiura, Ken; Ando, Naohisa; Nishiyama, Akira; Horiuchi, Hiromi; Tani, Toshiro

    2007-01-01

    We report here the distinctive modifications of photoluminescence (PL) behaviors in single CdSe/ZnS/TOPO nanocrystals depending on their environments. Long-time traces of PL intensity from single nanocrystals have been obtained in both vacuum and a wet nitrogen atmosphere. While all of the nanocrystals in both environments exhibit PL blinking behaviors, i.e. on-off intermittency of PL intensity, as usual, some of the nanocrystals in the wet nitrogen atmosphere show significant increase in duration time of on-events. As for the duration time of blinking off-events, it is for the moment associated with the occasional events of carrier capturing at trap sites on or near the nanocrystal surfaces. We propose a model in which adsorbed water molecules at the trap sites on the nanocrystal surfaces transform them under light irradiation, which eventually decreases the occurrence of the trapping events due to their inactivation. It in turn increases the PL on-times. In addition to the drastic modification of the blinking profile, we also found that in the PL time traces some kinds of undulated behaviors, i.e. continuous and rather low frequency fluctuation of PL intensity, appear during each on-event in vacuum while they disappear totally in the wet nitrogen atmosphere. These results are also described on the basis of the inactivation model of the trap sites introduced above

  15. Greenlandic water and sanitation-a context oriented analysis of system challenges towards local sustainable development.

    Science.gov (United States)

    Hendriksen, Kåre; Hoffmann, Birgitte

    2017-08-28

    Today, as Greenland focuses on more economic and cultural autonomy, the continued development of societal infrastructure systems is vital. At the same time, pressure is put on the systems by a lack of financial resources and locally based professional competences as well as new market-based forms of organization. Against this background, the article discusses the challenges facing Greenland's self-rule in relation to further develop the existing water and wastewater systems so that they can contribute to the sustainable development of Greenland. The article reviews the historical development of the water supply and wastewater system. This leads to an analysis of the sectorisation, which in recent decades has reorganized the Greenlandic infrastructures, and of how this process is influencing local sustainable development. The article discusses the socio-economic and human impacts and points to the need for developing the water and sanitation system to support not only hygiene and health, but also local sustainable development.

  16. 1.9 μm superficially porous packing material with radially oriented pores and tailored pore size for ultra-fast separation of small molecules and biomolecules.

    Science.gov (United States)

    Min, Yi; Jiang, Bo; Wu, Ci; Xia, Simin; Zhang, Xiaodan; Liang, Zhen; Zhang, Lihua; Zhang, Yukui

    2014-08-22

    In this work, 1.9 μm reversed-phase packing materials with superficially porous structure were prepared to achieve the rapid and high efficient separation of peptides and proteins. The silica particles were synthesized via three steps, nonporous silica particle preparation by a modified seeded growth method, mesoporous shell formation by a one pot templated dissolution and redeposition strategy, and pore size expansion via acid-refluxing. By such a method, 1.9 μm superficially porous materials with 0.18 μm shell thickness and tailored pore diameter (10 nm, 15 nm) were obtained. After pore enlargement, the formerly dense arrays of mesoporous structure changed, the radially oriented pores dominated the superficially porous structure. The chromatographic performance of such particles was investigated after C18 derivatization. For packing materials with 1.9 μm diameter and 10 nm pore size, the column efficiency could reach 211,300 plates per m for naphthalene. To achieve the high resolution separation of peptides and proteins, particles with pore diameter of 15 nm were tailored, by which the baseline separation of 5 peptides and 5 intact proteins could be respectively achieved within 1 min, demonstrating the superiority in the high efficiency and high throughput analysis of biomolecules. Furthermore, BSA digests were well separated with peak capacity of 120 in 30 min on a 15 cm-long column. Finally, we compared our columns with a 1.7 μm Kinetex C18 column under the same conditions, our particles with 10nm pore size demonstrated similar performance for separation of the large intact proteins. Moreover, the particles with 15 nm pore size showed more symmetrical peaks for the separation of large proteins (BSA, OVA and IgG) and provided rapid separation of protein extracts from Escherichia coli in 5 min. All these results indicated that the synthesized 1.9 μm superficially porous silica packing materials would be promising in the ultra-fast and high

  17. An unstructured finite volume solver for two phase water/vapour flows based on an elliptic oriented fractional step method

    International Nuclear Information System (INIS)

    Mechitoua, N.; Boucker, M.; Lavieville, J.; Pigny, S.; Serre, G.

    2003-01-01

    Based on experience gained at EDF and Cea, a more general and robust 3-dimensional (3D) multiphase flow solver has been being currently developed for over three years. This solver, based on an elliptic oriented fractional step approach, is able to simulate multicomponent/multiphase flows. Discretization follows a 3D full unstructured finite volume approach, with a collocated arrangement of all variables. The non linear behaviour between pressure and volume fractions and a symmetric treatment of all fields are taken into account in the iterative procedure, within the time step. It greatly enforces the realizability of volume fractions (i.e 0 < α < 1), without artificial numerical needs. Applications to widespread test cases as static sedimentation, water hammer and phase separation are shown to assess the accuracy and the robustness of the flow solver in different flow conditions, encountered in nuclear reactors pipes. (authors)

  18. Effects of water depth, seasonal exposure, and substrate orientation on microbial bioerosion in the Ionian Sea (Eastern Mediterranean.

    Directory of Open Access Journals (Sweden)

    Claudia Färber

    Full Text Available The effects of water depth, seasonal exposure, and substrate orientation on microbioerosion were studied by means of a settlement experiment deployed in 15, 50, 100, and 250 m water depth south-west of the Peloponnese Peninsula (Greece. At each depth, an experimental platform was exposed for a summer period, a winter period, and about an entire year. On the up- and down-facing side of each platform, substrates were fixed to document the succession of bioerosion traces, and to measure variations in bioerosion and accretion rates. In total, 29 different bioerosion traces were recorded revealing a dominance of microborings produced by phototrophic and organotrophic microendoliths, complemented by few macroborings, attachment scars, and grazing traces. The highest bioerosion activity was recorded in 15 m up-facing substrates in the shallow euphotic zone, largely driven by phototrophic cyanobacteria. Towards the chlorophyte-dominated deep euphotic to dysphotic zones and the organotroph-dominated aphotic zone the intensity of bioerosion and the diversity of bioerosion traces strongly decreased. During summer the activity of phototrophs was higher than during winter, which was likely stimulated by enhanced light availability due to more hours of daylight and increased irradiance angles. Stable water column stratification and a resulting nutrient depletion in shallow water led to lower turbidity levels and caused a shift in the photic zonation that was reflected by more phototrophs being active at greater depth. With respect to the subordinate bioerosion activity of organotrophs, fluctuations in temperature and the trophic regime were assumed to be the main seasonal controls. The observed patterns in overall bioeroder distribution and abundance were mirrored by the calculated carbonate budget with bioerosion rates exceeding carbonate accretion rates in shallow water and distinctly higher bioerosion rates at all depths during summer. These findings

  19. Object-Oriented Technology-Based Software Library for Operations of Water Reclamation Centers

    Science.gov (United States)

    Otani, Tetsuo; Shimada, Takehiro; Yoshida, Norio; Abe, Wataru

    SCADA systems in water reclamation centers have been constructed based on hardware and software that each manufacturer produced according to their design. Even though this approach used to be effective to realize real-time and reliable execution, it is an obstacle to cost reduction about system construction and maintenance. A promising solution to address the problem is to set specifications that can be used commonly. In terms of software, information model approach has been adopted in SCADA systems in other field, such as telecommunications and power systems. An information model is a piece of software specification that describes a physical or logical object to be monitored. In this paper, we propose information models for operations of water reclamation centers, which have not ever existed. In addition, we show the feasibility of the information model in terms of common use and processing performance.

  20. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  1. A nonpolar, nonamphiphilic molecule can accelerate adsorption of phospholipids and lower their surface tension at the air/water interface.

    Science.gov (United States)

    Nguyen, Phuc Nghia; Trinh Dang, Thuan Thao; Waton, Gilles; Vandamme, Thierry; Krafft, Marie Pierre

    2011-10-04

    The adsorption dynamics of a series of phospholipids (PLs) at the interface between an aqueous solution or dispersion of the PL and a gas phase containing the nonpolar, nonamphiphilic linear perfluorocarbon perfluorohexane (PFH) was studied by bubble profile analysis tensiometry. The PLs investigated were dioctanoylphosphatidylcholine (DiC(8)-PC), dilaurylphosphatidylcholine, dimyristoylphosphatidylcholine, and dipalmitoylphosphatidylcholine. The gas phase consisted of air or air saturated with PFH. The perfluorocarbon gas was found to have an unexpected, strong effect on both the adsorption rate and the equilibrium interfacial tension (γ(eq)) of the PLs. First, for all of the PLs, and at all concentrations investigated, the γ(eq) values were significantly lower (by up to 10 mN m(-1)) when PFH was present in the gas phase. The efficacy of PFH in decreasing γ(eq) depends on the ability of PLs to form micelles or vesicles in water. For vesicles, it also depends on the gel or fluid state of the membranes. Second, the adsorption rates of all the PLs at the interface (as assessed by the time required for the initial interfacial tension to be reduced by 30%) are significantly accelerated (by up to fivefold) by the presence of PFH for the lower PL concentrations. Both the surface-tension reducing effect and the adsorption rate increasing effect establish that PFH has a strong interaction with the PL monolayer and acts as a cosurfactant at the interface, despite the absence of any amphiphilic character. Fitting the adsorption profiles of DiC(8)-PC at the PFH-saturated air/aqueous solution interface with the modified Frumkin model indicated that the PFH molecule lay horizontally at the interface. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Inorganics in Organics: Tracking down the Intrinsic Equilibriums between Organic Molecules and Trace Elements in Oceanic Waters

    Science.gov (United States)

    Lechtenfeld, O. J.; Koch, B. P.; Kattner, G.

    2010-12-01

    Recent developments in analytical instrumentation enable to describe biogeochemical processes in oceanic waters on a molecular level. This is the prerequisite to integrate biological and geochemical parameters and to develop chemical cycles on a global perspective. The state-of-the-art Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS) applications for dissolved organic matter (DOM) focus mainly on carbon, hydrogen, oxygen and nitrogen isotopes. Implementation of sulfur and especially phosphorus in the molecular formula assignment has been questionable because of ambiguous calculated elemental formulas. On the other hand, many compounds bearing these elements are well known to occur in the dissolved state as part of the permanent recycling processes (e.g. phospholipids, phosphonates) but analytics of dissolved organic phosphorus (DOP) and sulfur (DOS) are often hampered by the large inorganic P and S pools. Even less is known about complexation characteristics of the DOM moieties. Although electrochemical methods provide some information about trace metal speciation, the high amount of organic molecules and its insufficient description as chemical functional classes prevent the assignment of trace metals to ligand classes. Nevertheless, it is undoubtful that a varying but extensive amount of transition metals is bond in form of organic complexes. Hyphenation of reversed phase high performance liquid chromatography (RP-HPLC) with high resolution inductively coupled plasma mass spectrometry (HR-ICP-MS) is a valuable tool to study these metal-organic interactions in a qualitative and quantitative approach. We established a desolvation method that allows direct transfer of high organic solvent loads into the plasma. Thus, in combination with internal standardization and external calibration, the investigation of a broad polarity scale was possible. This approach overcomes previous restrictions to non-organic solvent separation techniques like size

  3. A hot water extract of Curcuma longa inhibits adhesion molecule protein expression and monocyte adhesion to TNF-α-stimulated human endothelial cells.

    Science.gov (United States)

    Kawasaki, Kengo; Muroyama, Koutarou; Yamamoto, Norio; Murosaki, Shinji

    2015-01-01

    The recruitment of arterial leukocytes to endothelial cells is an important step in the progression of various inflammatory diseases. Therefore, its modulation is thought to be a prospective target for the prevention or treatment of such diseases. Adhesion molecules on endothelial cells are induced by proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), and contribute to the recruitment of leukocytes. In the present study, we investigated the effect of hot water extract of Curcuma longa (WEC) on the protein expression of adhesion molecules, monocyte adhesion induced by TNF-α in human umbilical vascular endothelial cells (HUVECs). Treatment of HUVECs with WEC significantly suppressed both TNF-α-induced protein expression of adhesion molecules and monocyte adhesion. WEC also suppressed phosphorylation and degradation of nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκBα) induced by TNF-α in HUVECs, suggesting that WEC inhibits the NF-κB signaling pathway.

  4. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  5. The effect of water molecules on the thiol collector interaction on the galena (PbS) and sphalerite (ZnS) surfaces: A DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Xu, Zhenghe; Liu, Qingxia [Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB T6G 2V4 (Canada); Du, Zheng [National Supercomputing Center in Shenzhen, Shenzhen 518055 (China)

    2016-12-15

    Highlights: • Water adsorption has a greater effect on the electron distribution of ZnS surface than PbS surface. • Water adsorption decreases the reactivity of ZnS surface atoms but improves that of PbS. • Thiol collectors cannot interact with the hydrated ZnS surface. • The hydration has little influence on the interaction of thiol collectors with PbS surface. - Abstracts: In froth flotation the molecular interaction between reagents and mineral surfaces take place at the solid liquid interface. In this paper, the effect of water molecule on the three typical thiol collectors (xanthate, dithiocarbomate and dithiophosphate) interactions at the galena (PbS) and sphalerite (ZnS) surfaces has been studied adopting density functional theory (DFT). The results suggests that the presence of water molecule shows a greater influence on the electron distribution of ZnS surface than PbS surface, and reduce the reactivity of ZnS surface atoms but improves the reactivity of PbS surface atoms during the reaction with xanthate. Water adsorption could also reduce the covalent binding between Zn and S atoms but have little influence on Pb-S bond. In the presence of water, xanthate, dithiocarbomate (DTC) and dithiophosphate (DTP) could not adsorb on the sphalerite surface. And for galena (PbS) surface, the interaction of DTP is the strongest, then the DTC and the interaction of xanthate is the weakest. These results agree well with the flotation practice.

  6. The Comparative Study of the Effects of Extremely Low Frequency Electromagnetic Fields and Infrasound on Water Molecule Dissociation and Generation of Reactive Oxygen Species

    Science.gov (United States)

    2008-11-01

    ISTC Project No. #1592P The Comparative Study of The Effects of Extremely Low Frequency Electromagnetic Fields and Infrasound on Water Molecule...performed under the agreement with the International Science and Technology Center ( ISTC ), Moscow. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704...dissociation and generation of reactive oxygen spaces. 5a. CONTRACT NUMBER ISTC Registration No: A-1592p 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  7. Site-specific binding of a water molecule to the sulfa drugs sulfamethoxazole and sulfisoxazole: a laser-desorption isomer-specific UV and IR study.

    Science.gov (United States)

    Uhlemann, Thomas; Seidel, Sebastian; Müller, Christian W

    2018-03-07

    To determine the preferred water molecule binding sites of the polybasic sulfa drugs sulfamethoxazole (SMX) and sulfisoxazole (SIX), we have studied their monomers and monohydrated complexes through laser-desorption conformer-specific UV and IR spectroscopy. Both the SMX and SIX monomer adopt a single conformer in the molecular beam. On the basis of their conformer-specific IR spectra in the NH stretch region, these conformers were assigned to the SMX and SIX global minimum structures, both exhibiting a staggered sulfonamide group and an intramolecular C-HO[double bond, length as m-dash]S hydrogen bond. The SMX-H 2 O and SIX-H 2 O complexes each adopt a single isomer in the molecular beam. Their isomeric structures were determined based on their isomer-specific IR spectra in the NH/OH stretch region. Quantum Theory of Atoms in Molecules analysis of the calculated electron densities revealed that in the SMX-H 2 O complex the water molecule donates an O-HN hydrogen bond to the heterocycle nitrogen atom and accepts an N-HO hydrogen bond from the sulfonamide NH group. In the SIX-H 2 O complex, however, the water molecule does not bind to the heterocycle but instead donates an O-HO[double bond, length as m-dash]S hydrogen bond to the sulfonamide group and accepts an N-HO hydrogen bond from the sulfonamide NH group. Both water complexes are additionally stabilized by a C ph -HOH 2 hydrogen bond. Interacting Quantum Atoms analysis suggests that all intermolecular hydrogen bonds are dominated by the short-range exchange-correlation contribution.

  8. Seasonal variations of rotifers from a high altitude urban shallow water body, La Cantera Oriente (Mexico City, Mexico)

    Science.gov (United States)

    Gutiérrez, Sergio González; Sarma, S. S. S.; Nandini, S.

    2017-11-01

    La Cantera Oriente is a shallow freshwater volcanic water body located at an altitude of 2 270 m above sea level in the Ecological Reserve of San Angel Pedregal of Mexico City (Mexico). In order to ensure the conservation of its biological heritage including zooplankton, the present work was undertaken to quantify the seasonal changes in the diversity and density of rotifers and the selected physico-chemical variables during 2013-2014. Qualitative analysis of the zooplankton samples yielded 68 rotifer species which represented 24 genera in 15 families. B rachionus calyciflorus Pallas, 1766, B. quadridentatus Hermann, 1783, Polyarthra vulgaris Carlin, 1943, Lecane closterocerca (Schmarda, 1859) and Keratella cochlearis (Gosse, 1851) were the most common species. Preston plots of species frequency-density revealed that as many as 30% of the rotifer taxa were dominant throughout the year. The species with high population densities were Brachionus quadridentatus, Lecane closterocerca, Keratella cochlearis, and Lepadella patella; their peak densities were 2 000, 1 000, 180 and 90 ind./L, all occurring in summer. Canonical correspondence analysis showed that Platyias quadricornis was related to the concentration of phosphates available in the environment and the conductivity, while B. quadridentatus was positively correlated with chlorophyll- a. The trophic status of the lake was eutrophic based on Chl- a content but oligotrophic with relation to the Brachionus: Trichocerca ratio.

  9. Gibbs Free Energy of Hydrolytic Water Molecule in Acyl-Enzyme Intermediates of a Serine Protease: A Potential Application for Computer-Aided Discovery of Mechanism-Based Reversible Covalent Inhibitors.

    Science.gov (United States)

    Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi

    2017-01-01

    In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.

  10. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  11. Dual reorientation relaxation routes of water molecules in oxyanion’s hydration shell: A molecular geometry perspective

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Wen Jun; Yang, Yi Isaac; Gao, Yi Qin, E-mail: gaoyq@pku.edu.cn [Institute of Theoretical and Computational Chemistry, College of Chemistry and Molecular Engineering and Biodynamic Optical Imaging Center, Peking University, Beijing 100871 (China)

    2015-12-14

    In this study, we examine how complex ions such as oxyanions influence the dynamic properties of water and whether differences exist between simple halide anions and oxyanions. Nitrate anion is taken as an example to investigate the hydration properties of oxyanions. Reorientation relaxation of its hydration water can occur through two different routes: water can either break its hydrogen bond with the nitrate to form one with another water or switch between two oxygen atoms of the same nitrate. The latter molecular mechanism increases the residence time of oxyanion’s hydration water and thus nitrate anion slows down the translational motion of neighbouring water. But it is also a “structure breaker” in that it accelerates the reorientation relaxation of hydration water. Such a result illustrates that differences do exist between the hydration of oxyanions and simple halide anions as a result of different molecular geometries. Furthermore, the rotation of the nitrate solute is coupled with the hydrogen bond rearrangement of its hydration water. The nitrate anion can either tilt along the axis perpendicularly to the plane or rotate in the plane. We find that the two reorientation relaxation routes of the hydration water lead to different relaxation dynamics in each of the two above movements of the nitrate solute. The current study suggests that molecular geometry could play an important role in solute hydration and dynamics.

  12. Dual reorientation relaxation routes of water molecules in oxyanion’s hydration shell: A molecular geometry perspective

    International Nuclear Information System (INIS)

    Xie, Wen Jun; Yang, Yi Isaac; Gao, Yi Qin

    2015-01-01

    In this study, we examine how complex ions such as oxyanions influence the dynamic properties of water and whether differences exist between simple halide anions and oxyanions. Nitrate anion is taken as an example to investigate the hydration properties of oxyanions. Reorientation relaxation of its hydration water can occur through two different routes: water can either break its hydrogen bond with the nitrate to form one with another water or switch between two oxygen atoms of the same nitrate. The latter molecular mechanism increases the residence time of oxyanion’s hydration water and thus nitrate anion slows down the translational motion of neighbouring water. But it is also a “structure breaker” in that it accelerates the reorientation relaxation of hydration water. Such a result illustrates that differences do exist between the hydration of oxyanions and simple halide anions as a result of different molecular geometries. Furthermore, the rotation of the nitrate solute is coupled with the hydrogen bond rearrangement of its hydration water. The nitrate anion can either tilt along the axis perpendicularly to the plane or rotate in the plane. We find that the two reorientation relaxation routes of the hydration water lead to different relaxation dynamics in each of the two above movements of the nitrate solute. The current study suggests that molecular geometry could play an important role in solute hydration and dynamics

  13. Structural properties of water around uncharged and charged carbon nanotubes

    International Nuclear Information System (INIS)

    Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour

    2013-01-01

    Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules

  14. Carbonic anhydrase inhibitors. Comparison of chlorthalidone, indapamide, trichloromethiazide, and furosemide X-ray crystal structures in adducts with isozyme II, when several water molecules make the difference.

    Science.gov (United States)

    Temperini, Claudia; Cecchi, Alessandro; Scozzafava, Andrea; Supuran, Claudiu T

    2009-02-01

    Thiazide and high ceiling diuretics were recently shown to inhibit all mammalian isoforms of carbonic anhydrase (CA, EC 4.2.1.1) with a very different profile as compared to classical inhibitors, such as acetazolamide, methazolamide, and ethoxzolamide. Some of these structurally related compounds have a very different behavior against the widespread isozyme CA II, with chlorthalidone, trichloromethiazide, and furosemide being efficient inhibitors against CA II (K(I)s of 65-138 nM), whereas indapamide is a much weaker one (K(I) of 2520 nM). Furthermore, some of these diuretics are quite efficient (low nanomolar) inhibitors of other isoforms, for example, chlorthalidone against hCA VB, VII, IX, and XIII; indapamide against CA VII, IX, XII, and XIII, trichloromethiazide against CA VII and IX, and furosemide against CA I and XIV. Examining the four X-ray crystal structures of their CA II adducts, we observed several (2-3) active site water molecules interacting with the chlorthalidone, trichloromethiazide, and furosemide scaffolds which may be responsible for this important difference of activity. Indeed, indapamide bound to CA II has no interactions with active site water molecules. Chlorthalidone bound within the CA II active site is in an enolic (lactimic) tautomeric form, with the enolic OH also participating in two strong hydrogen bonds with Asn67 and a water molecule. The newly evidenced binding modes of these diuretics may be exploited for designing better CA II inhibitors as well as compounds with selectivity/affinity for various isoforms with medicinal chemistry applications.

  15. The effect of micro-environment on luminescence of aequorin: the role of amino acids and explicit water molecules on spectroscopic properties of coelenteramide.

    Science.gov (United States)

    Li, Zuo-Sheng; Zou, Lu-Yi; Min, Chun-Gang; Ren, Ai-Min

    2013-10-05

    Despite the fact that the luminescence reaction mechanism of aequorin has been intensively investigated, details in luminescence such as the effect of important amino acids residues and explicit water molecules on spectroscopic properties of coelenteramide remain unclear. In this work, the effect of amino acids residues His16, Tyr82, Trp86, Phe113, Trp129, Tyr132, explicit water molecules Wat505 and Wat405 on the spectral properties of CLM(-) has been studied by CAM-B3LYP, TD M06L and TD CAM-B3LYP methods in hydrophobic environment and aqueous solution. In hydrophobic environment, the amino acids or water molecules have no significant effect on the absorption. Tyr82 and Trp86 move close to CLM(-) changes the hydrogen bond network, and thus, the spectral properties is significantly affected by the hydrogen bonds between His16H(+)+Tyr82+Trp86 and CLM(-). Tyr82, Trp86 hydrogen bonding to CLM(-) upshifts the excited energy and helps emission spectra shift to blue region. Therefore, it is concluded that His16H(+)+Tyr82+Trp86 modify the emission spectra. The molecular electrostatic potential indicated that the greater electron density is located at the oxygen atom of 6-p-hydroxyphenyl group of CLM(-), and it facilitates the formation of hydrogen bond with His16H(+)+Tyr82+Trp86. It is a critical condition for the modification of emission spectra. It is expected to help to understand the interactions between emitter and amino acids in the micro environment. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A low-cost, orientation-insensitive microwave water-cut sensor printed on a pipe surface

    KAUST Repository

    Karimi, Muhammad Akram; Arsalan, Muhammad; Shamim, Atif

    2017-01-01

    commercial WC sensors. The presented sensor has been realized by using extremely low cost methods of screen-printing and reusable 3D printed mask. Complete characterization of the proposed WC sensor, both in horizontal and vertical orientations, has been

  17. [Dynamics of Irreversible Evaporation of a Water-Protein Droplet and a Problem of Structural and Dynamical Experiments with Single Molecules].

    Science.gov (United States)

    Shaitan, K V; Armeev, G A; Shaytan, A K

    2016-01-01

    We discuss the effect of isothermal and adiabatic evaporation of water on the state of a water-protein droplet. The discussed problem is of current importance due to development of techniques to perform single molecule experiments using free electron lasers. In such structure-dynamic experiments the delivery of a sample into the X-ray beam is performed using the microdroplet injector. The time between the injection and delivery is in the order of microseconds. In this paper we developed a specialized variant of all-atom molecular dynamics simulations for the study of irreversible isothermal evaporation of the droplet. Using in silico experiments we determined the parameters of isothermal evaporation of the water-protein droplet with the sodium and chloride ions in the concentration range of 0.3 M at different temperatures. The energy of irreversible evaporation determined from in silico experiments at the initial stages of evaporation virtually coincides with the specific heat of evaporation for water. For the kinetics of irreversible adiabatic evaporation an exact analytical solution was obtained in the limit of high thermal conductivity of the droplet (or up to the droplet size of -100 Å). This analytical solution incorporates parameters that are determined using in silico. experiments on isothermal droplet evaporation. We show that the kinetics of adiabatic evaporation and cooling of the droplet scales with the droplet size. Our estimates of the water-protemi droplet. freezing rate in the adiabatic regime in a vacuum chamber show that additional techniques for stabilizing the temperature inside the droplet should be used in order to study the conformational transitions of the protein in single molecules. Isothermal and quasi-isothermal conditions are most suitable for studying the conformational transitions upon object functioning. However, in this case it is necessary to take into account the effects of dehydration and rapid increase of ionic strength in an

  18. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  19. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  20. Symposium report: the Waters Bioanalysis World Tour: the broadening impact and future of the DMPK laboratory--addressing large-molecule therapeutics.

    Science.gov (United States)

    De Vooght-Johnson, Ryan

    2011-03-01

    An evening symposium was held at the Museu de Historia de Catalunya (Barcelona, Spain) as a precursor to the European Bioanalysis Forum meeting, as part of the Waters Corporation Bioanalysis World Tour. The symposium was chaired by Robert Plumb and Jing Lin (Waters Corporation, MA, USA) with a focus on the future of the DMPK laboratory and its role in addressing large-molecule therapeutics and biomarkers. Lieve Dillen (Johnson and Johnson, Belgium) spoke on ultra-sensitive peptide quantification, Richard Kay (Quotient Bioresearch, UK) discussed quantifying proteins and peptides in plasma, Ian Wilson (AstraZeneca, UK) covered metabolic biomarkers and Robert Plumb concluded the evening with a presentation on the future of MS in DMPK studies. Following the presentations, all the speakers took questions from the audience and continued lively discussion over a cocktails and canapés reception.

  1. In-situ X-ray diffraction reveals the degradation of crystalline CH3NH3PbI3 by water-molecule collisions at room temperature

    Science.gov (United States)

    Hada, Masaki; Hasegawa, Yoichi; Nagaoka, Ryota; Miyake, Tomoya; Abdullaev, Ulugbek; Ota, Hiromi; Nishikawa, Takeshi; Yamashita, Yoshifumi; Hayashi, Yasuhiko

    2018-02-01

    We have developed a vacuum-compatible chamber for in-situ X-ray diffraction (XRD) studies and have used it to characterize the changing crystal structure of an inorganic-organic hybrid perovskite material, CH3NH3PbI3 (MAPbI3), during interactions with water vapor at room temperature. In the XRD spectra, we have observed the degradation of MAPbI3 and the creation of MAPbI3 hydrates, which follow simple rate equations. The time constant for the degradation of MAPbI3 during accelerated aging suggests that multiple collisions of water molecules with the MAPbI3 crystal trigger the degradation of the crystal.

  2. Ligand uptake in Mycobacterium tuberculosis truncated hemoglobins is controlled by both internal tunnels and active site water molecules [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Ignacio Boron

    2015-07-01

    Full Text Available Mycobacterium tuberculosis, the causative agent of human tuberculosis, has two proteins belonging to the truncated hemoglobin (trHb family. Mt-trHbN presents well-defined internal hydrophobic tunnels that allow O2 and •ŸNO to migrate easily from the solvent to the active site, whereas Mt-trHbO possesses tunnels interrupted by a few bulky residues, particularly a tryptophan at position G8. Differential ligand migration rates allow Mt-trHbN to detoxify Ÿ•NO, a crucial step for pathogen survival once under attack by the immune system, much more efficiently than Mt-trHbO. In order to investigate the differences between these proteins, we performed experimental kinetic measurements, Ÿ•NO decomposition, as well as molecular dynamics simulations of the wild type Mt-trHbN and two mutants, VG8F and VG8W. These mutations affect both the tunnels accessibility as well as the affinity of distal site water molecules, thus modifying the ligand access to the iron. We found that a single mutation allows Mt-trHbN to acquire ligand migration rates comparable to those observed for Mt-trHbO, confirming that ligand migration is regulated by the internal tunnel architecture as well as by water molecules stabilized in the active site.

  3. Correlation between mechanical behavior of protein films at the air/water interface and intrinsic stability of protein molecules

    NARCIS (Netherlands)

    Martin, A.H.; Cohen Stuart, M.A.; Bos, M.A.; Vliet, T. van

    2005-01-01

    The relation between mechanical film properties of various adsorbed protein layers at the air/water interface and intrinsic stability of the corresponding proteins is discussed. Mechanical film properties were determined by surface deformation in shear and dilation. In shear, fracture stress, σf,

  4. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  5. Effects of a surface oriented travelling screen and water abstraction practices on downstream migrating Salmonidae smolts in a lowland stream

    DEFF Research Database (Denmark)

    Svendsen, Jon Christian; Aarestrup, Kim; Deacon, Michael G.

    2010-01-01

    Downstream migration of immature salmonids (smolts) may be associated with severe mortalities in anthropogenically altered channels. In Pacific salmon, several investigations have suggested the use of the dominating surface orientation of smolts to improve fish by-pass structures in large and dee...

  6. Production and characterization of protonated molecular clusters containing a given number of water molecules with the DIAM set-up

    International Nuclear Information System (INIS)

    Bruny, G.

    2010-01-01

    nano-scale characterization of irradiation in bio-molecular systems requires observation of novel features which are now achievable with the recent technical progress. This work is a central part in the development of DIAM which is a new experimental set-up devoted to irradiation of bio-molecular clusters at the Institut de Physique Nucleaire de Lyon. The development of the cluster source and of a double focusing mass spectrometer leads to the production of intense beams of mass selected protonated molecular clusters. Combined with this mass selected cluster beams an innovative detection technique is demonstrated in collision induced dissociation experiments. The results contribute to the knowledge of the stability and the structure of the small protonated water clusters and mixed clusters of water and pyridine. (author)

  7. Ab initio calculations of dissociative excitation of water and methane molecules upon electron impact at low energies

    International Nuclear Information System (INIS)

    Gil, T.J.; McCurdy, C.W.; Rescigno, T.N.; Lengsfield, B.H. III

    1994-01-01

    The authors are reporting results of ab-initio calculations of electron-impact excitation of water and methane occurring at scattering energies up to 60 eV. The authors consider dissociative excited states of both systems since the understanding of their chemistry has considerable importance in plasma technology and atmospheric research. In the case of methane the authors are dealing with the promotion of a valence electron into Rydberg orbitals, while in water the excited states have one electron in an antibonding unoccupied valence orbital and support Feshbach resonances. The authors discuss issues related to convergence of the close-coupling expansion in the case of Rydberg excitation, where the authors have coupled up to 16 channels. The practical realization of the calculation within the framework of the complex Kohn variational principle represents merging of quantum chemistry and quantum scattering theory and is also discussed

  8. Atoms, Molecules, and Compounds

    CERN Document Server

    Manning, Phillip

    2007-01-01

    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  9. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  10. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  11. Attosecond dynamics of electrons in molecules and liquids

    Science.gov (United States)

    Woerner, Hans Jakob

    2016-05-01

    The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss two recent experiments carried out in our group that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18 s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. We advance high-harmonic spectroscopy to resolve spatially and temporally the migration of an electron hole immediately following ionization of iodoacetylene, while simultaneously demonstrating extensive control over the process. A multidimensional approach, based on the measurement of both even and odd harmonic orders, enables us to reconstruct both quantum amplitudes and phases of the electronic states with a resolution of ~ 100 as. We separately reconstruct quasi-field-free and laser-controlled charge migration as a function of the spatial orientation of the molecule and determine the shape of the hole created by ionization. The second experiment is carried out on a free-flowing microjet of liquid water. We use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from liquid water using the RABBIT technique. We measure a delay on the order of 50 as between electrons emitted from the HOMO of liquid water compared to that of gas-phase water and a substantially reduced modulation contrast of the corresponding sidebands. Since our measurements on solvated water molecules are referenced to isolated ones, the measured delays reflect (i) the photoionization delays caused by electron transport through the aqueous environment and (ii) the effect of solvation on the parent molecule. The relative modulation contrast, in turn, contains information on (iii) the modification of transition amplitudes and (iv) dephasing processes. These experiments make the liquid phase and its fascinating

  12. A comparison of the mechanisms of photooxidative degradation of organic molecules on irradiated semiconductor powders and in aerated supercritical water

    Energy Technology Data Exchange (ETDEWEB)

    Fox, Marye Anne [Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX (United States)

    1995-08-01

    It is the purpose of this paper to survey evidence that suggests that control of the local environment is important in both heterogeneous TiO{sub 2} photocatalysis and in thermal oxidation reactions taking place in supercritical fluids, i.e. that the expected influences of these very different methods for microcompartmentalization do indeed influence the observed reaction kinetics in an easily observable way. Variations in reaction kinetics and the photophysical properties are described for (1) small semiconductor clusters, including their altered photocatalytic activity in and on inert supports; and (2) molecular probes dispersed within the self-aggregating clusters formed within supercritical water

  13. Sorption Characteristics of Mixed Molecules of Glutaraldehyde from Water on Mesoporous Acid-Amine Modified Low-Cost Activated Carbon: Mechanism, Isotherm, and Kinetics

    Directory of Open Access Journals (Sweden)

    Mukosha Lloyd

    2015-01-01

    Full Text Available The environmental discharge of inefficiently treated waste solutions of the strong biocide glutaraldehyde (GA from hospitals has potential toxic impact on aquatic organisms. The adsorption characteristics of mixed polarized monomeric and polymeric molecules of GA from water on mesoporous acid-amine modified low-cost activated carbon (AC were investigated. It was found that the adsorption strongly depended on pH and surface chemistry. In acidic pH, the adsorption mechanism was elaborated to involve chemical sorption of mainly hydroxyl GA monomeric molecules on acidic surface groups, while in alkaline pH, the adsorption was elaborated to involve both chemical and physical sorption of GA polymeric forms having mixed functional groups (aldehyde, carboxyl, and hydroxyl on acidic and amine surface groups. The optimum pH of adsorption was about 12 with significant contribution by cooperative adsorption, elucidated in terms of hydrogen bonding and aldol condensation. Freundlich and Dubinin-Radushkevich models were fitted to isotherm data. The adsorption kinetics was dependent on initial concentration and temperature and described by the Elovich model. The adsorption was endothermic, while the intraparticle diffusion model suggested significant contribution by film diffusion. The developed low-cost AC could be used to supplement the GA alkaline deactivation process for efficient removal of residual GA aquatic toxicity.

  14. Fabrication of PLA/CaCO3 hybrid micro-particles as carriers for water-soluble bioactive molecules.

    Science.gov (United States)

    Kudryavtseva, Valeriya L; Zhao, Li; Tverdokhlebov, Sergei I; Sukhorukov, Gleb B

    2017-09-01

    We propose the use of polylactic acid/calcium carbonate (PLA/CaCO 3 ) hybrid micro-particles for achieving improved encapsulation of water-soluble substances. Biodegradable porous CaCO 3 microparticles can be loaded with wide range of bioactive substance. Thus, the formation of hydrophobic polymeric shell on surface of these loaded microparticles results on encapsulation and, hence, sealing internal cargo and preventing their release in aqueous media. In this study, to encapsulate proteins, we explore the solid-in-oil-in-water emulsion method for fabricating core/shell PLA/CaCO 3 systems. We used CaCO 3 particles as a protective core for encapsulated bovine serum albumin, which served as a model protein system. We prepared a PLA coating using dichloromethane as an organic solvent and polyvinyl alcohol as a surfactant for emulsification; in addition, we varied experimental parameters such as surfactant concentration and polymer-to-CaCO 3 ratio to determine their effect on particle-size distribution, encapsulation efficiency and capsule permeability. The results show that the particle size decreased and the size distribution narrowed as the surfactant concentration increased in the external aqueous phase. In addition, when the CaCO 3 /PLA mass ratio dropped below 0.8, the hybrid micro-particles were more likely to resist treatment by ethylenediaminetetraacetic acid and thus retained their bioactive cargos within the polymer-coated micro-particles. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Formation of the prebiotic molecule NH2CHO on astronomical amorphous solid water surfaces: accurate tunneling rate calculations.

    Science.gov (United States)

    Song, Lei; Kästner, Johannes

    2016-10-26

    Investigating how formamide forms in the interstellar medium is a hot topic in astrochemistry, which can contribute to our understanding of the origin of life on Earth. We have constructed a QM/MM model to simulate the hydrogenation of isocyanic acid on amorphous solid water surfaces to form formamide. The binding energy of HNCO on the ASW surface varies significantly between different binding sites, we found values between ∼0 and 100 kJ mol -1 . The barrier for the hydrogenation reaction is almost independent of the binding energy, though. We calculated tunneling rate constants of H + HNCO → NH 2 CO at temperatures down to 103 K combining QM/MM with instanton theory. Tunneling dominates the reaction at such low temperatures. The tunneling reaction is hardly accelerated by the amorphous solid water surface compared to the gas phase for this system, even though the activation energy of the surface reaction is lower than the one of the gas-phase reaction. Both the height and width of the barrier affect the tunneling rate in practice. Strong kinetic isotope effects were observed by comparing to rate constants of D + HNCO → NHDCO. At 103 K we found a KIE of 231 on the surface and 146 in the gas phase. Furthermore, we investigated the gas-phase reaction NH 2 + H 2 CO → NH 2 CHO + H and found it unlikely to occur at cryogenic temperatures. The data of our tunneling rate constants are expected to significantly influence astrochemical models.

  16. Tar removal from biosyngas in the biomass gasification process. (Liquid + liquid) equilibrium {water + solvent (paraxylene and methyl hexadecanoate) + model molecules of tar (benzene, toluene, phenol)}

    International Nuclear Information System (INIS)

    Bassil, Georgio; Mokbel, Ilham; Abou Naccoul, Ramy; Stephan, Juliette; Jose, Jacques; Goutaudier, Christelle

    2012-01-01

    Highlights: ► (Liquid + liquid) equilibria at atmospheric pressure. ► Solubility of benzene (or toluene or phenol) in paraxylene at (303 to 343) K. ► Solubility of benzene (or toluene or phenol) in methyl palmitate or methyl hexadecanoate at (303 to 343) K. ► Correlation of LLE using NRTL model. - Abstract: Tar is generated in the process by the condensation of the gas resulting from biomass gasification. The objective of this work is a contribution to the database on thermodynamic quantity which will be useful at the operation of tar removal from aqueous medium. With this aim, (liquid + liquid) equilibrium of {water + solvent (paraxylene and methyl hexadecanoate) + model molecules of tar (benzene, toluene, phenol)} was studied at temperatures (303.2, 323.2, and 343.2) K. The data obtained were correlated with the non-random two-liquid (NRTL) model.

  17. Emission spectra of the species ablated from a solid target submerged in liquid: vibrational temperature of C2 molecules in water-confined geometry

    International Nuclear Information System (INIS)

    Sakka, Tetsuo; Saito, Kotaro; Ogata, Yukio H.

    2002-01-01

    Emission spectra of C 2 molecules produced at the water-graphite interface by pulsed laser irradiation were obtained at various delay times from the irradiation. Vibrational temperature was determined by the Boltzmann plot based on the vibrational bands in Δν=-1 branch of the Swan system. The results show that it was ca. 5000 K and did not change significantly with the delay time. With increasing the delay time up to ca. 500 ns the signal from the Swan band disappeared before the decrease of the vibrational temperature. The results were explained by the formation of a gas cavity and its collapse at several hundreds of nanoseconds from the laser pulse

  18. Diffusion-weighted magnetic resonance imaging reveals the effects of different cooling temperatures on the diffusion of water molecules and perfusion within human skeletal muscle

    International Nuclear Information System (INIS)

    Yanagisawa, O.; Fukubayashi, T.

    2010-01-01

    Aim: To evaluate the effect of local cooling on the diffusion of water molecules and perfusion within muscle at different cooling temperatures. Materials and methods: Magnetic resonance diffusion-weighted (DW) images of the leg (seven males) were obtained before and after 30 min cooling (0, 10, and 20 o C), and after a 30 min recovery period. Two types of apparent diffusion coefficient (ADC; ADC1, reflecting both water diffusion and perfusion within muscle, and ADC2, approximating the true water diffusion coefficient) of the ankle dorsiflexors were calculated from DW images. T2-weighted images were also obtained to calculate T2 values of the ankle dorsiflexors. The skin temperature was measured before, during, and after cooling. Results: Both ADC values significantly decreased after cooling under all cooling conditions; the rate of decrease depended on the cooling temperature used (ADC1: -36% at 0 o C, -27.8% at 10 o C, and -22.6% at 20 o C; ADC2: -26% at 0 o C, -21.1% at 10 o C, and -14.6% at 20 o C). These significant decreases were maintained during the recovery period. Conversely, the T2 value showed no significant changes. Under all cooling conditions, skin temperature significantly decreased during cooling; the rate of decrease depended on the cooling temperature used (-74.8% at 0 o C, -51.1% at 10 o C, and -26.8% at 20 o C). Decreased skin temperatures were not restored to pre-cooling values during the recovery period under any cooling conditions. Conclusion: Local cooling decreased the water diffusion and perfusion within muscle with decreased skin temperature; the rates of decrease depended on the cooling temperature used. These decreases were maintained for 30 min after cooling.

  19. German Orientalism

    OpenAIRE

    Margaret Olin

    2011-01-01

    Review of: Suzanne L. Marchand, German Orientalism in the Age of Empire: Religion, Race and Scholarship, Cambridge and Washington, D.C.: Cambridge University Press, 2009. This analysis of Suzanne L. Marchand’s German Orientalism in the Age of Empire: Religion, Race and Scholarship reads her contribution in part against the background of Edward Said’s path breaking book Orientalism. Differences lie in her more expansive understanding of the term ‘Oriental’ to include the Far East and her conce...

  20. Ethanol oxidation reactions catalyzed by water molecules: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2)

    Science.gov (United States)

    Takahashi, H.; Hisaoka, S.; Nitta, T.

    2002-09-01

    Ab initio density functional theory calculations have been performed to investigate the catalytic role of water molecules in the oxidation reaction of ethanol: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2) . The results show that the potential energy barrier for the reaction is 88.0 kcal/mol in case of n=0, while it is reduced by ˜34 kcal/mol when two water molecules are involved ( n=2) in the reaction. As a result, the rate constant increases to 3.31×10 -4 s-1, which shows a significant catalytic role of water molecules in the ethanol oxidation reactions.

  1. PHOTOCHEMISTRY IN THE INNER LAYERS OF CLUMPY CIRCUMSTELLAR ENVELOPES: FORMATION OF WATER IN C-RICH OBJECTS AND OF C-BEARING MOLECULES IN O-RICH OBJECTS

    International Nuclear Information System (INIS)

    Agundez, Marcelino; Cernicharo, Jose; Guelin, Michel

    2010-01-01

    A mechanism based on the penetration of interstellar ultraviolet photons into the inner layers of clumpy circumstellar envelopes (CSEs) around asymptotic giant branch stars is proposed to explain the non-equilibrium chemistry observed in such objects. We show through a simple modeling approach that in CSEs with a certain degree of clumpiness or with moderately low mass loss rates (a few 10 -7 M sun yr -1 ) a photochemistry can take place in the warm and dense inner layers, inducing important changes in the chemical composition. In carbon-rich objects water vapor and ammonia would be formed with abundances of 10 -8 -10 -6 relative to H 2 , while in oxygen-rich envelopes ammonia and carbon-bearing molecules such as HCN and CS would form with abundances of 10 -9 -10 -7 relative to H 2 . The proposed mechanism would explain the recent observation of warm water vapor in the carbon-rich envelope IRC+10216 with the Herschel Space Observatory and predict that H 2 O should be detectable in other carbon-rich objects.

  2. Orienteering injuries

    OpenAIRE

    Folan, Jean M.

    1982-01-01

    At the Irish National Orienteering Championships in 1981 a survey of the injuries occurring over the two days of competition was carried out. Of 285 individual competitors there was a percentage injury rate of 5.26%. The article discusses the injuries and aspects of safety in orienteering.

  3. Waste water treatment by ionizing radiations. Removal of biological and chemical risks by water and sludge treatment with electron beams. Orientation 10 July 2002

    International Nuclear Information System (INIS)

    2002-01-01

    This report aims at analysing the reliability of the application of electron ionizing radiation in the treatment of waste waters and effluents, and at identifying possible fields of application and associated technological and economic implications. After some recalls on physics, electrochemistry, radiolysis, and water pollution, the report proposes an overview of the technique of irradiation of waters, with its scientific background (water radiolysis, chemical and biological effects), its process (recovery cycle and possible interventions, processed pollutants), the case of irradiation by electrons (power, rate, flexibility), an overview of benefits and drawbacks, and a brief history of this practice and an overview of current researches. After a recall of regulatory and political requirements, the report discusses possible fields of application: waste water treatment plants, domestic, agricultural and urban sewage wasters, hospital and medical wastes, liquid food industry products, industrial waters. The choice of accelerator parameters and components is then discussed

  4. Kerosene-water separation in T-junction with orientation upward branch with a 60° angle: Variation of diameter ratio

    Science.gov (United States)

    Puspitasari, Dewi; Indarto, Purnomo, Khasani

    2016-06-01

    Research on the T-junction is still underway for the flow of liquid-liquid (kerosene-water). Some research on the characteristics of kerosene-water separation was performed using T-junction oriented upward branch with a 60° angle. To observe the effect of diameters ratio on the phase separation that produced T-junction then made a test section with a horizontal pipe diameter 36 mm, while the side arm 36 mm diameter, 26 mm and 19 mm (diameters ratio of 1, 0.7 and 0.5) by using plexiglass pipe type. Based on experimental results and visualization of data flow in the test section, to the value obtained 60% water cut, the maximum separation efficiency of 94%, FK = 0.94 and FW = 0.001 with a diameter ratio of 1. For other diameter ratio of 0.7 and 0.5 respectively separation efficiency of 66%, FK = 1 and Fw = 0.34 for 0.7 and separation efficiency of 84%, FK = 1 and Fw = 0.16 for 0.5, the best value is obtained at a water cut 60% too. All the best conditions to achieve the above-stratified flow pattern.

  5. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  6. Photoanodes with fully controllable texture: the enhanced water splitting efficiency of thin hematite films exhibiting solely (110) crystal orientation

    Czech Academy of Sciences Publication Activity Database

    Kment, Š.; Schmuki, P.; Hubička, Zdeněk; Machala, L.; Kirchgeorg, R.; Liu, N.; Wang, L.; Lee, K.; Olejníček, Jiří; Čada, Martin; Gregora, Ivan; Zbořil, R.

    2015-01-01

    Roč. 9, č. 7 (2015), s. 7113-7123 ISSN 1936-0851 R&D Projects: GA MŠk LH12043 Institutional support: RVO:68378271 Keywords : hematite * iron oxide * texture * PEC water splitting * pulsed magnetron sputtering * conversion electron Mössbauer spectroscopy Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 13.334, year: 2015

  7. Single-Molecule Interfacial Electron Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Ho, Wilson [Univ. of California, Irvine, CA (United States)

    2018-02-03

    Interfacial electron transfer (ET) plays an important role in many chemical and biological processes. Specifically, interfacial ET in TiO2-based systems is important to solar energy technology, catalysis, and environmental remediation technology. However, the microscopic mechanism of interfacial ET is not well understood with regard to atomic surface structure, molecular structure, bonding, orientation, and motion. In this project, we used two complementary methodologies; single-molecule fluorescence spectroscopy, and scanning-tunneling microscopy and spectroscopy (STM and STS) to address this scientific need. The goal of this project was to integrate these techniques and measure the molecular dependence of ET between adsorbed molecules and TiO2 semiconductor surfaces and the ET induced reactions such as the splitting of water. The scanning probe techniques, STM and STS, are capable of providing the highest spatial resolution but not easily time-resolved data. Single-molecule fluorescence spectroscopy is capable of good time resolution but requires further development to match the spatial resolution of the STM. The integrated approach involving Peter Lu at Bowling Green State University (BGSU) and Wilson Ho at the University of California, Irvine (UC Irvine) produced methods for time and spatially resolved chemical imaging of interfacial electron transfer dynamics and photocatalytic reactions. An integral aspect of the joint research was a significant exchange of graduate students to work at the two institutions. This project bridged complementary approaches to investigate a set of common problems by working with the same molecules on a variety of solid surfaces, but using appropriate techniques to probe under ambient (BGSU) and ultrahigh vacuum (UCI) conditions. The molecular level understanding of the fundamental interfacial electron transfer processes obtained in this joint project will be important for developing efficient light harvesting

  8. Communication: Toward an improved control of the fixed-node error in quantum Monte Carlo: The case of the water molecule

    International Nuclear Information System (INIS)

    Caffarel, Michel; Applencourt, Thomas; Scemama, Anthony; Giner, Emmanuel

    2016-01-01

    All-electron Fixed-node Diffusion Monte Carlo calculations for the nonrelativistic ground-state energy of the water molecule at equilibrium geometry are presented. The determinantal part of the trial wavefunction is obtained from a selected Configuration Interaction calculation [Configuration Interaction using a Perturbative Selection done Iteratively (CIPSI) method] including up to about 1.4 × 10 6 of determinants. Calculations are made using the cc-pCVnZ family of basis sets, with n = 2 to 5. In contrast with most quantum Monte Carlo works no re-optimization of the determinantal part in presence of a Jastrow is performed. For the largest cc-pCV5Z basis set the lowest upper bound for the ground-state energy reported so far of −76.437 44(18) is obtained. The fixed-node energy is found to decrease regularly as a function of the cardinal number n and the Complete Basis Set limit associated with exact nodes is easily extracted. The resulting energy of −76.438 94(12) — in perfect agreement with the best experimentally derived value — is the most accurate theoretical estimate reported so far. We emphasize that employing selected configuration interaction nodes of increasing quality in a given family of basis sets may represent a simple, deterministic, reproducible, and systematic way of controlling the fixed-node error in diffusion Monte Carlo.

  9. Communication: Toward an improved control of the fixed-node error in quantum Monte Carlo: The case of the water molecule

    Energy Technology Data Exchange (ETDEWEB)

    Caffarel, Michel; Applencourt, Thomas; Scemama, Anthony [Laboratoire de Chimie et Physique Quantique, CNRS-Université de Toulouse, Toulouse (France); Giner, Emmanuel [Dipartimento di Scienze Chimiche e Farmaceutiche, Universit degli Studi di Ferrara, Ferrara (Italy)

    2016-04-21

    All-electron Fixed-node Diffusion Monte Carlo calculations for the nonrelativistic ground-state energy of the water molecule at equilibrium geometry are presented. The determinantal part of the trial wavefunction is obtained from a selected Configuration Interaction calculation [Configuration Interaction using a Perturbative Selection done Iteratively (CIPSI) method] including up to about 1.4 × 10{sup 6} of determinants. Calculations are made using the cc-pCVnZ family of basis sets, with n = 2 to 5. In contrast with most quantum Monte Carlo works no re-optimization of the determinantal part in presence of a Jastrow is performed. For the largest cc-pCV5Z basis set the lowest upper bound for the ground-state energy reported so far of −76.437 44(18) is obtained. The fixed-node energy is found to decrease regularly as a function of the cardinal number n and the Complete Basis Set limit associated with exact nodes is easily extracted. The resulting energy of −76.438 94(12) — in perfect agreement with the best experimentally derived value — is the most accurate theoretical estimate reported so far. We emphasize that employing selected configuration interaction nodes of increasing quality in a given family of basis sets may represent a simple, deterministic, reproducible, and systematic way of controlling the fixed-node error in diffusion Monte Carlo.

  10. Molecular Properties by Quantum Monte Carlo: An Investigation on the Role of the Wave Function Ansatz and the Basis Set in the Water Molecule

    Science.gov (United States)

    Zen, Andrea; Luo, Ye; Sorella, Sandro; Guidoni, Leonardo

    2014-01-01

    Quantum Monte Carlo methods are accurate and promising many body techniques for electronic structure calculations which, in the last years, are encountering a growing interest thanks to their favorable scaling with the system size and their efficient parallelization, particularly suited for the modern high performance computing facilities. The ansatz of the wave function and its variational flexibility are crucial points for both the accurate description of molecular properties and the capabilities of the method to tackle large systems. In this paper, we extensively analyze, using different variational ansatzes, several properties of the water molecule, namely, the total energy, the dipole and quadrupole momenta, the ionization and atomization energies, the equilibrium configuration, and the harmonic and fundamental frequencies of vibration. The investigation mainly focuses on variational Monte Carlo calculations, although several lattice regularized diffusion Monte Carlo calculations are also reported. Through a systematic study, we provide a useful guide to the choice of the wave function, the pseudopotential, and the basis set for QMC calculations. We also introduce a new method for the computation of forces with finite variance on open systems and a new strategy for the definition of the atomic orbitals involved in the Jastrow-Antisymmetrised Geminal power wave function, in order to drastically reduce the number of variational parameters. This scheme significantly improves the efficiency of QMC energy minimization in case of large basis sets. PMID:24526929

  11. Part I. Generation of tailored radio-frequency pulses for NMR. Part II. Deuterium NMR studies of oriented DNA, and its interaction with water

    International Nuclear Information System (INIS)

    Brandes, R.

    1988-01-01

    A novel method for generating tailored radio-frequency pulses for use in NMR is presented. For this purpose, an inexpensive device based on analog audio filters was built. As an application, the superior selectivity of this method is shown by comparing it with a soft pulse excitation. The theoretical response of the magnetization to these tailored rf pulses is also calculated. Deuterium NMR line shapes of 2 H-labeled purine bases in solid, uniaxially oriented Li- and Na-DNA have been obtained. The spectral densities of motion were determined for the Li-DNA samples to test a model for uncorrelated, restricted base motion. For the first time, a 2 H spectrum is reported for 2 H labeled DNA in the liquid crystalline state. A procedure is outlined to separate the base motion from the DNA axis motion. In addition to the studies of DNA itself, the interaction of water (D 2 O) with samples of uniaxially oriented Na- and Li-DNA have been studied by high resolution 2 H NMR

  12. Non-Water-Suppressed 1H MR Spectroscopy with Orientational Prior Knowledge Shows Potential for Separating Intra- and Extramyocellular Lipid Signals in Human Myocardium.

    Science.gov (United States)

    Fillmer, Ariane; Hock, Andreas; Cameron, Donnie; Henning, Anke

    2017-12-04

    Conditions such as type II diabetes are linked with elevated lipid levels in the heart, and significantly increased risk of heart failure; however, metabolic processes underlying the development of cardiac disease in type II diabetes are not fully understood. Here we present a non-invasive method for in vivo investigation of cardiac lipid metabolism: namely, IVS-McPRESS. This technique uses metabolite-cycled, non-water suppressed 1 H cardiac magnetic resonance spectroscopy with prospective and retrospective motion correction. High-quality IVS-McPRESS data acquired from healthy volunteers allowed us to investigate the frequency shift of extramyocellular lipid signals, which depends on the myocardial fibre orientation. Assuming consistent voxel positioning relative to myofibres, the myofibre angle with the magnetic field was derived from the voxel orientation. For separation and individual analysis of intra- and extramyocellular lipid signals, the angle myocardial fibres in the spectroscopy voxel take with the magnetic field should be within ±24.5°. Metabolite and lipid concentrations were analysed with respect to BMI. Significant correlations between BMI and unsaturated fatty acids in intramyocellular lipids, and methylene groups in extramyocellular lipids were found. The proposed IVS-McPRESS technique enables non-invasive investigation of cardiac lipid metabolism and may thus be a useful tool to study healthy and pathological conditions.

  13. User requirements and user acceptance of current and next-generation satellite mission and sensor complement, oriented toward the monitoring of water resources

    Science.gov (United States)

    Castruccio, P. A.; Loats, H. L., Jr.; Fowler, T. R.; Robinson, P.

    1975-01-01

    Principal water resources users were surveyed to determine the applicability of remotely sensed data to their present and future requirements. Analysis of responses was used to assess the levels of adequacy of LANDSAT 1 and 2 in fulfilling hydrological functions, and to derive systems specifications for future water resources-oriented remote sensing satellite systems. The analysis indicates that water resources applications for all but the very large users require: (1) resolutions on the order of 15 meters, (2) a number of radiometric levels of the same order as currently used in LANDSAT 1 (64), (3) a number of spectral bands not in excess of those used in LANDSAT 1, and (4) a repetition frequency on the order of 2 weeks. The users had little feel for the value of new sensors (thermal IR, passive and active microwaves). What is needed in this area is to achieve specific demonstrations of the utility of these sensors and submit the results to the users to evince their judgement.

  14. Estimation of Bridge Height over Water from Polarimetric SAR Image Data Using Mapping and Projection Algorithm and De-Orientation Theory

    Science.gov (United States)

    Wang, Haipeng; Xu, Feng; Jin, Ya-Qiu; Ouchi, Kazuo

    An inversion method of bridge height over water by polarimetric synthetic aperture radar (SAR) is developed. A geometric ray description to illustrate scattering mechanism of a bridge over water surface is identified by polarimetric image analysis. Using the mapping and projecting algorithm, a polarimetric SAR image of a bridge model is first simulated and shows that scattering from a bridge over water can be identified by three strip lines corresponding to single-, double-, and triple-order scattering, respectively. A set of polarimetric parameters based on the de-orientation theory is applied to analysis of three types scattering, and the thinning-clustering algorithm and Hough transform are then employed to locate the image positions of these strip lines. These lines are used to invert the bridge height. Fully polarimetric image data of airborne Pi-SAR at X-band are applied to inversion of the height and width of the Naruto Bridge in Japan. Based on the same principle, this approach is also applicable to spaceborne ALOSPALSAR single-polarization data of the Eastern Ocean Bridge in China. The results show good feasibility to realize the bridge height inversion.

  15. Hangman Catalysis for Photo–and Photoelectro–Chemical Activation of Water Proton-Coupled Electron Transfer Mechanisms of Small Molecule Activation

    Energy Technology Data Exchange (ETDEWEB)

    Nocera, Daniel G. [Harvard Univ., Cambridge, MA (United States)

    2013-03-15

    The weakest link for the large-scale deployment of solar energy and for that matter, any renewable energy source, is its storage. The energy needs of future society demands are so large that storage must be in the form of fuels owing to their high energy density. Indeed, society has intuitively understood this disparity in energy density as it has developed over the last century as all large-scale energy storage in our society is in the form of fuels. But these fuels are carbon-based. The imperative for the discipline of chemistry, and more generally science, is to develop fuel storage methods that are easily scalable, carbon-neutral and sustainable. These methods demand the creation of catalysts to manage the multi-electron, multi-proton transformations of the conversion of small molecules into fuels. The splitting of water using solar light is a fuel-forming reaction that meets the imperative of large scale energy storage. As light does not directly act on water to engender its splitting into its elemental components, we have designed “hangman” catalysts to effect the energy conversion processes needed for the fuel forming reactions. The hangman construct utilizes a pendant acid/base functionality within the secondary coordination sphere that is “hung” above the redox platform onto which substrate binds. In this way, we can precisely control the delivery of a proton to the substrate, thus ensuring efficient coupling between the proton and electron. An emphasis was on the coupling of electron and proton in the hydrogen evolution reaction (HER) on Ni, Co and Fe porphyrin platforms. Electrokinetic rate laws were developed to define the proton-coupled electron transfer (PCET) mechanism. The HER of Co and Fe porphyrins was metal-centered. Surprisingly, HER this was not the case for Ni porphyrins. In this system, the PCET occurred at the porphyrin platform to give rise to a phlorin. This is one of the first examples of an HER occurring via ligand non

  16. Cotransport of clay colloids and viruses through water-saturated vertically oriented columns packed with glass beads: Gravity effects.

    Science.gov (United States)

    Syngouna, Vasiliki I; Chrysikopoulos, Constantinos V

    2016-03-01

    The cotransport of clay colloids and viruses in vertically oriented laboratory columns packed with glass beads was investigated. Bacteriophages MS2 and ΦX174 were used as model viruses, and kaolinite (ΚGa-1b) and montmorillonite (STx-1b) as model clay colloids. A steady flow rate of Q=1.5 mL/min was applied in both vertical up (VU) and vertical down (VD) flow directions. In the presence of KGa-1b, estimated mass recovery values for both viruses were higher for VD than VU flow direction, while in the presence of STx-1b the opposite was observed. However, for all cases examined, the produced mass of viruses attached onto suspended clay particles were higher for VD than VU flow direction, suggesting that the flow direction significantly influences virus attachment onto clays, as well as packed column retention of viruses attached onto suspended clays. KGa-1b hindered the transport of ΦX174 under VD flow, while STx-1b facilitated the transport of ΦX174 under both VU and VD flow directions. Moreover, KGa-1b and STx-1b facilitated the transport of MS2 in most of the cases examined except of the case where KGa-1b was present under VD flow. Also, the experimental data were used for the estimation of virus surface-coverages and virus surface concentrations generated by virus diffusion-limited attachment, as well as virus attachment due to sedimentation. Both sedimentation and diffusion limited virus attachment were higher for VD than VU flow, except the case of MS2 and STx-1b cotransport. The diffusion-limited attachment was higher for MS2 than ΦΧ174 for all cases examined. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Observation of pendular butterfly Rydberg molecules

    Science.gov (United States)

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig

    2016-01-01

    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  18. Development of a process-oriented vulnerability concept for water travel time in karst aquifers-case study of Tanour and Rasoun springs catchment area.

    Science.gov (United States)

    Hamdan, Ibraheem; Sauter, Martin; Ptak, Thomas; Wiegand, Bettina; Margane, Armin; Toll, Mathias

    2017-04-01

    Key words: Karst aquifer, water travel time, vulnerability assessment, Jordan. The understanding of the groundwater pathways and movement through karst aquifers, and the karst aquifer response to precipitation events especially in the arid to semi-arid areas is fundamental to evaluate pollution risks from point and non-point sources. In spite of the great importance of the karst aquifer for drinking purposes, karst aquifers are highly sensitive to contamination events due to the fast connections between the land-surface and the groundwater (through the karst features) which is makes groundwater quality issues within karst systems very complicated. Within this study, different methods and approaches were developed and applied in order to characterise the karst aquifer system of the Tanour and Rasoun springs (NW-Jordan) and the flow dynamics within the aquifer, and to develop a process-oriented method for vulnerability assessment based on the monitoring of different multi-spatially variable parameters of water travel time in karst aquifer. In general, this study aims to achieve two main objectives: 1. Characterization of the karst aquifer system and flow dynamics. 2. Development of a process-oriented method for vulnerability assessment based on spatially variable parameters of travel time. In order to achieve these aims, different approaches and methods were applied starting from the understanding of the geological and hydrogeological characteristics of the karst aquifer and its vulnerability against pollutants, to using different methods, procedures and monitored parameters in order to determine the water travel time within the aquifer and investigate its response to precipitation event and, finally, with the study of the aquifer response to pollution events. The integrated breakthrough signal obtained from the applied methods and procedures including the using of stable isotopes of oxygen and hydrogen, the monitoring of multi qualitative and quantitative parameters

  19. Experimental study of the attenuation waves oriented to transients caused by the sodium-water explosive reaction in fast reactors

    International Nuclear Information System (INIS)

    Pedroso, L.J.

    1990-01-01

    One of the problems related to fluid-structure interaction that can compromise the structural integrity of components of a fast reactor is the explosion caused by the sodium-water reaction, in the case of a flood at the level of the thermic exchange wall at the steam generator. In this paper we have considered the aspects of the pressure-waves damping caused by the reaction, when these waves transverse certain perforated structures. In order to solve this problem, we also adopted a parametric experimental approach, using a scale model (RIO test rig). (author)

  20. Origin of preferential clay particle orientation in faults, and relationships with pore-water flow and water-sediment interactions. Two natural examples

    International Nuclear Information System (INIS)

    Labaume, P.

    1998-01-01

    Two natural examples are presented of shear deformation associated with thrust faulting in clayey sediments. The first example is the basal decollement fault of the Barbados accretionary prism (Lesser Antilles), drilled during ODP Leg 156. This decollement is an active fault where the relationships between pore-water and deformation can be studied in situ. The second example is the Eocene south-Pyrenean basin (northern Spain), studied by the European Community EBRO Network Working Group. In this case, fluid activity in fossil thrust-faults was studied indirectly through the products of water-sediment interactions. (author)

  1. Tapping mode AFM study on the surface dynamics of a single glucose oxidase molecule on a Au(1 1 1) surface in water with implication for a surface-induced unfolding pathway

    International Nuclear Information System (INIS)

    Otsuka, Ichiro; Yaoita, Masashi; Higano, Michi; Nagashima, Seiiichi; Kataoka, Ryoichi

    2004-01-01

    We have investigated a surface-induced unfolding dynamics of a single glucose oxidase (GO) molecule on Au(1 1 1) in air-saturated water, using tapping mode atomic force microscopy (TMAFM). We followed the unfolding process by measuring the maximum height of a well-isolated GO molecule on a terrace near a step-edge of the surface as a function of contact time. We find three linear portions with two intersections in a power-law fit to the selected values of the observed heights. The kinetic TMAFM result implies that there exist at least two distinct dynamic regimes in the unfolding

  2. Geochemical orientation survey of stream sediment, stream water, and ground water near uranium prospects, Monticello area, New York. National Uranium Resource Evaluation Program

    International Nuclear Information System (INIS)

    Rose, A.W.; Smith, A.T.; Wesolowski, D.

    1982-08-01

    A detailed geochemical test survey has been conducted in a 570 sq km area around six small copper-uranium prospects in sandstones of the Devonian Catskill Formation near Monticello in southern New York state. This report summarizes and interprets the data for about 500 stream sediment samples, 500 stream water samples, and 500 ground water samples, each analyzed for 40 to 50 elements. The groundwater samples furnish distinctive anomalies for uranium, helium, radon, and copper near the mineralized localities, but the samples must be segregated into aquifers in order to obtain continuous well-defined anomalies. Two zones of uranium-rich water (1 to 16 parts per billion) can be recognized on cross sections; the upper zone extends through the known occurrences. The anomalies in uranium and helium are strongest in the deeper parts of the aquifers and are diluted in samples from shallow wells. In stream water, copper and uranium are slightly anomalous, as in an ore factor derived from factor analysis. Ratios of copper, uranium, and zinc to conductivity improve the resolution of anomalies. In stream sediment, extractable uranium, copper, niobium, vanadium, and an ore factor furnish weak anomalies, and ratios of uranium and copper to zinc improve the definition of anomalies. The uranium/thorium ratio is not helpful. Published analyses of rock samples from the nearby stratigraphic section show distinct anomalies in the zone containing the copper-uranium occurrences. This report is being issued without the normal detailed technical and copy editing, to make the data available to the public before the end of the National Uranium Reconnaissance Evaluation program

  3. Geochemical orientation survey of stream sediment, stream water, and ground water near uranium prospects, Monticello area, New York. National Uranium Resource Evaluation Program

    Energy Technology Data Exchange (ETDEWEB)

    Rose, A. W.; Smith, A. T.; Wesolowski, D.

    1982-08-01

    A detailed geochemical test survey has been conducted in a 570 sq km area around six small copper-uranium prospects in sandstones of the Devonian Catskill Formation near Monticello in southern New York state. This report summarizes and interprets the data for about 500 stream sediment samples, 500 stream water samples, and 500 ground water samples, each analyzed for 40 to 50 elements. The groundwater samples furnish distinctive anomalies for uranium, helium, radon, and copper near the mineralized localities, but the samples must be segregated into aquifers in order to obtain continuous well-defined anomalies. Two zones of uranium-rich water (1 to 16 parts per billion) can be recognized on cross sections; the upper zone extends through the known occurrences. The anomalies in uranium and helium are strongest in the deeper parts of the aquifers and are diluted in samples from shallow wells. In stream water, copper and uranium are slightly anomalous, as in an ore factor derived from factor analysis. Ratios of copper, uranium, and zinc to conductivity improve the resolution of anomalies. In stream sediment, extractable uranium, copper, niobium, vanadium, and an ore factor furnish weak anomalies, and ratios of uranium and copper to zinc improve the definition of anomalies. The uranium/thorium ratio is not helpful. Published analyses of rock samples from the nearby stratigraphic section show distinct anomalies in the zone containing the copper-uranium occurrences. This report is being issued without the normal detailed technical and copy editing, to make the data available to the public before the end of the National Uranium Reconnaissance Evaluation program.

  4. Heat Conductivity Resistance of Concrete Wall Panel by Water Flowing in Different Orientations of Internal PVC pipe

    Science.gov (United States)

    Umi, N. N.; Norazman, M. N.; Daud, N. M.; Yusof, M. A.; Yahya, M. A.; Othman, M.

    2018-04-01

    Green building technology and sustainability development is current focus in the world nowadays. In Malaysia and most tropical countries the maximum temperature recorded typically at 35°C. Air-conditioning system has become a necessity in occupied buildings, thereby increasing the cost of electric consumption. The aim of this study is to find out the solution in minimizing heat transfer from the external environment and intentions towards going green. In this study, the experimental work includes testing three types of concrete wall panels. The main heat intervention material in this research is 2 inch diameter Polyvinyl Chloride (PVC) pipe embedded at the center of the concrete wall panel, while the EPS foam beads were added to the cement content in the concrete mix forming the outer layer of the wall panel. Water from the rainwater harvesting system is regulated in the PVC pipe to intervene with the heat conductivity through the wall panel. Results from the experimental works show that the internal surface temperature of these heat resistance wall panels is to 3□C lower than control wall panel from plain interlocking bricks.

  5. Orienteering club

    CERN Multimedia

    Club d'orientation

    2015-01-01

    Course d'orientation La reprise des courses d’orientation était attendue dans la région puisque près de 150 coureurs ont participé à la première épreuve automnale organisée par le club d’orientation du CERN sur le site de La Faucille. Les circuits ont été remportés par Yann Locatelli du club d’Orientation Coeur de Savoie avec 56 secondes d’avance sur Damien Berguerre du club SOS Sallanches pour le parcours technique long, Marie Vuitton du club CO CERN (membre également de l’Equipe de France Jeune) pour le parcours technique moyen avec presque 4 minutes d’avance sur Jeremy Wichoud du club Lausanne-Jorat, Victor Dannecker pour le circuit technique court devant Alina Niggli, Elliot Dannecker pour le facile moyen et Alice Merat sur le facile court, tous membres du club O’Jura. Les résultats comp...

  6. Oriental cholangiohepatitis

    International Nuclear Information System (INIS)

    Scheible, F.W.; Davis, G.B.; California Univ., San Diego, La Jolla

    1981-01-01

    The recent influx of immigrants from Southeast Asia into the United States has increased the likelihood of encountering unusual diseases heretofore rarely seen in this country. Among these disorders is Oriental cholangiohepatitis, a potentially life-threatening process whose early diagnosis is facilitated by roentgenographic findings. Ultrasonography can also provide useful information, although potential pitfalls in diagnosis should be recognized. (orig.)

  7. Oriental cholangiohepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Scheible, F.W.; Davis, G.B.

    1981-07-15

    The recent influx of immigrants from Southeast Asia into the United States has increased the likelihood of encountering unusual diseases heretofore rarely seen in this country. Among these disorders is Oriental cholangiohepatitis, a potentially life-threatening process whose early diagnosis is facilitated by roentgenographic findings. Ultrasonography can also provide useful information, although potential pitfalls in diagnosis should be recognized.

  8. Organic Photovoltaic Devices Based on Oriented n-Type Molecular Films Deposited on Oriented Polythiophene Films.

    Science.gov (United States)

    Mizokuro, Toshiko; Tanigaki, Nobutaka; Miyadera, Tetsuhiko; Shibata, Yousei; Koganezawa, Tomoyuki

    2018-04-01

    The molecular orientation of π-conjugated molecules has been reported to significantly affect the performance of organic photovoltaic devices (OPVs) based on molecular films. Hence, the control of molecular orientation is a key issue toward the improvement of OPV performance. In this research, oriented thin films of an n-type molecule, 3,4,9,10-Perylenetetracarboxylic Bisbenzimida-zole (PTCBI), were formed by deposition on in-plane oriented polythiophene (PT) films. Orientation of the PTCBI films was evaluated by polarized UV-vis spectroscopy and 2D-Grazing incidence X-ray diffraction. Results indicated that PTCBI molecules on PT film exhibit nearly edge-on and in-plane orientation (with molecular long axis along the substrate), whereas PTCBI molecules without PT film exhibit neither. OPVs composed of PTCBI molecular film with and without PT were fabricated and evaluated for correlation of orientation with performance. The OPVs composed of PTCBI film with PT showed higher power conversion efficiency (PCE) than that of film without PT. The experiment indicated that in-plane orientation of PTCBI molecules absorbs incident light more efficiently, leading to increase in PCE.

  9. Channels with ordered water and bipyridine molecules in the porous coordination polymer {[Cu(SiF6(C10H8N22]·2C10N2H8·5H2O}n

    Directory of Open Access Journals (Sweden)

    Emmanuel Aubert

    2016-11-01

    Full Text Available The coordination polymer {[Cu(SiF6(C10H8N22]·2C10H8N2·5H2O}n, systematic name: poly[[bis(μ2-4,4′-bipyridine(μ2-hexafluoridosilicatocopper(II] 4,4′-bipyridine disolvate pentahydrate], contains pores which are filled with water and 4,4′-bipyridine molecules. As a result of the presence of these ordered species, the framework changes its symmetry from P4/mmm to P21/c. The 4,4′-bipyridine guest molecules form chains inside the 6.5 × 6.9 Å pores parallel to [100] in which the molecules interact through π–π stacking. Ordered water molecules form infinite hydrogen-bonded chains inside a second pore system (1.6 × 5.3 Å free aperture perpendicular to the 4,4′-bipyridine channels.

  10. Water infiltration and hydraulic conductivity in a natural Mediterranean oak forest: impacts of hydrology-oriented silviculture on soil hydraulic properties

    Science.gov (United States)

    Di Prima, Simone; Bagarello, Vincenzo; Bautista, Inmaculada; Cerdà, Artemi; Cullotta, Sebastiano; del Campo, Antonio; González-Sanchis, María; Iovino, Massimo; Maetzke, Federico

    2016-04-01

    microcontroller platform, Arduino. The very limited cost of the system could represent a step towards a cheaper and more widespread application of accurate and automated infiltration rate measurement. However, automatic data collection increases measurement speed, permits measurement at short time intervals, improves measurement precision, allows for more efficient data handling and analysis, and reduces the amount of effort involved and the potential for errors that may occur when manual procedures are applied (Di Prima et al., 2016). The main objective of this study was to determine soil hydraulic properties by using the combination of the automated infiltrometer and the BEST algorithm in a natural Mediterranean oak forest. The forest is located in a typical Mediterranean area, within the public forest La Hunde, Valencia (NE Spain). Two contiguous plots established in previous studies conducted by González-Sanchis et al. (2015) were selected, one of them was thinned reducing the forest density from 861 to 414 tree per ha. Control plot was not thinned. These authors studied the water cycle during the period 2012-2013. In particular, they characterized and compared the plots in term of throughfall, stemflow, soil moisture and transpiration, concluding that the AFM results in an increasing water availability, and at the same time in a substantial maintenance of overland and surface flow, precluding therefore enhancement of erosion rate. In this paper, the focus was put on the impacts of thinning on soil hydraulic properties, such as infiltration capacity, hydraulic conductivity and soil water retention, determined by simplified and low-cost methods in connection with a hydrology-oriented silviculture. Acknowledgements This study is a part of research projects: "Indagini sperimentali per la simulazione dei processi di formazione del deflusso superficiale nei suoli boscati, Progetto FIRB 2012 - MIMOSE", and "CGL2011-28776-C02-02, HYDROSIL" References Alagna, V., Bagarello, V., Di

  11. Electron Impact Excitation-Ionization of Molecules

    Science.gov (United States)

    Ali, Esam Abobakr A.

    In the last few decades, the study of atomic collisions by electron-impact has made significant advances. The most difficult case to study is electron impact ionization of molecules for which many approximations have to be made and the validity of these approximations can only be checked by comparing with experiment. In this thesis, I have examined the Molecular three-body distorted wave (M3DW) or Molecular four-body distorted wave (M4DW) approximations for electron-impact ionization. These models use a fully quantum mechanical approach where all particles are treated quantum mechanically and the post collision interaction (PCI) is treated to all orders of perturbation. These electron impact ionization collisions play central roles in the physics and chemistry of upper atmosphere, biofuel, the operation of discharges and lasers, radiation induced damage in biological material like damage to DNA by secondary electrons, and plasma etching processes. For the M3DW model, I will present results for electron impact single ionization of small molecules such as Water, Ethane, and Carbon Dioxide and the much larger molecules Tetrahydrofuran, phenol, furfural, 1-4 Benzoquinone. I will also present results for the four-body problem in which there are two target electrons involved in the collision. M4DW results will be presented for dissociative excitation-ionization of orientated D2. I will show that M4DW calculations using a variational wave function for the ground state that included s- and p- orbital states give better agreement to the experimental measurements than a ground state approximated as a product of two 1s-type Dyson orbitals.

  12. Laser Controlled Molecular Orientation Dynamics

    International Nuclear Information System (INIS)

    Atabek, O.

    2004-01-01

    Molecular orientation is a challenging control issue covering a wide range of applications from reactive collisions, high order harmonic generation, surface processing and catalysis, to nanotechnologies. The laser control scenario rests on the following three steps: (i) depict some basic mechanisms producing dynamical orientation; (ii) use them both as computational and interpretative tools in optimal control schemes involving genetic algorithms; (iii) apply what is learnt from optimal control to improve the basic mechanisms. The existence of a target molecular rotational state combining the advantages of efficient and post-pulse long duration orientation is shown. A strategy is developed for reaching such a target in terms of a train of successive short laser pulses applied at predicted time intervals. Each individual pulse imparts a kick to the molecule which orients. Transposition of such strategies to generic systems is now under investigation

  13. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  14. Strong orientational coordinates and orientational order parameters for symmetric objects

    International Nuclear Information System (INIS)

    Haji-Akbari, Amir; Glotzer, Sharon C

    2015-01-01

    Recent advancements in the synthesis of anisotropic macromolecules and nanoparticles have spurred an immense interest in theoretical and computational studies of self-assembly. The cornerstone of such studies is the role of shape in self-assembly and in inducing complex order. The problem of identifying different types of order that can emerge in such systems can, however, be challenging. Here, we revisit the problem of quantifying orientational order in systems of building blocks with non-trivial rotational symmetries. We first propose a systematic way of constructing orientational coordinates for such symmetric building blocks. We call the arising tensorial coordinates strong orientational coordinates (SOCs) as they fully and exclusively specify the orientation of a symmetric object. We then use SOCs to describe and quantify local and global orientational order, and spatiotemporal orientational correlations in systems of symmetric building blocks. The SOCs and the orientational order parameters developed in this work are not only useful in performing and analyzing computer simulations of symmetric molecules or particles, but can also be utilized for the efficient storage of rotational information in long trajectories of evolving many-body systems. (paper)

  15. Orientation Club

    CERN Multimedia

    Club d'orientation

    2014-01-01

    COURSE ORIENTATION Résultats de samedi 10 mai    C’est sur une carte entièrement réactualisée dans les bois de Versoix, que plus de 100 coureurs sont venus participer à la course d’orientation, type longue distance, préparée par des membres du club du CERN. Le terrain plutôt plat nécessitait une orientation à grande vitesse, ce qui a donné les podiums suivants :  Technique long avec 17 postes : 1er Jurg Niggli, O’Jura en 52:48, 2e Beat Muller, COLJ Lausanne-Jorat en 58:02, 3e Christophe Vuitton, CO CERN en 58:19 Technique moyen avec 13 postes : 1er Jean-Bernard Zosso, CO CERN, en 46:05 ; 2e Yves Rousselot, Balise 25 Besançon, en 55:11 ; 3e Laurent Merat, O'Jura, en 55:13 Technique court avec 13 postes : 1er Julien Vuitton, CO CERN en 40:59, 2e Marc Baumgartner, CO CERN en 43:18, 3e Yaelle Mathieu en 51:42 Su...

  16. Orienteering Club

    CERN Multimedia

    Club d'orientation

    2013-01-01

    Courses d’orientation ce printemps Le Club d’orientation du CERN vous invite à venir découvrir la course d’orientation et vous propose, en partenariat avec d’autres clubs de la région, une dizaine de courses populaires. Celles-ci ont lieu les samedis après-midi, elles sont ouvertes à tous, quel que soit le niveau, du débutant au sportif confirmé, en famille ou en individuel, en promenade ou en course. Si vous êtes débutant vous pouvez profiter d’une petite initiation offerte par l’organisateur avant de vous lancer sur un parcours. Divers types de parcours sont à votre choix lors de chaque épreuve : facile court (2-3 km), facile moyen (3-5 km), technique court (3-4 km), technique moyen (4-5 km) et technique long (5-7 km). Les dates à retenir sont les suivantes : Samedi 23 mars: Pully (Vd) Samedi 13 avril: Pougny...

  17. Orienteering club

    CERN Multimedia

    Club d'orientation

    2013-01-01

    Courses d’orientation Le soleil enfin de retour a incité nombre de sportifs et promeneurs à nous rejoindre dans la belle forêt de Challex /Pougny pour la deuxième étape de notre coupe de printemps 2013. Certains sont revenus crottés et fourbus alors que d’autres avaient les joues bien roses après un grand bol d’air frais. Mais tous avaient passé un agréable moment dans la nature. Nous rappelons que nos activités sont ouvertes à tous, jeunes, moins jeunes, sportifs, familles, du CERN ou d’ailleurs, et que le seul inconvénient est que si vous goûtez à la course d’orientation, il vous sera difficile de ne pas y revenir ! Samedi 20 avril 2013, nous serons sur le Mont Mourex (entre Gex et Divonne) pour notre prochaine épreuve et vous y serez les bienvenus. Les inscriptions et les départ...

  18. Orienteering club

    CERN Multimedia

    Club d’Orientation du CERN

    2015-01-01

    Courses d’orientation Nouvelle saison nouveau programme Le Club d’orientation du CERN, en partenariat avec d’autres clubs de la région, vous propose une dizaine de courses populaires comptant pour la coupe Genevoise de printemps: samedi 28 mars: Vernand Dessus samedi 18 avril: Pougny/Challex samedi 25 avril: Chancy/Valleiry samedi 2 mai: Mauvernay samedi 9 mai: Longchaumois samedi 16 mai: Genolier samedi 30 mai: Prevondavaux samedi 6 juin: Biere-Ballens samedi 13 juin: Haut-Jura samedi 20 juin: Bonmont - Finale Ces courses sont ouvertes à tous, quel que soit le niveau, du débutant au sportif confirmé, en famille ou en individuel, en promenade ou en course. Les inscriptions se font sur place le jour de l’épreuve. Si vous êtes débutant, vous pouvez profiter d’une initiation offerte par l’organisateur avant de vous lancer sur un parcours. Le club propose aussi...

  19. Orienteering club

    CERN Multimedia

    Orienteering Club

    2016-01-01

    Course d'orientation Calendrier des courses d’orientation Coupe genevoise d’automne 2016 Samedi 3 septembre : La Faucille (01) Samedi 10 septembre : Prémanon (39) Samedi 17 septembre : Saint-Cergue (VD) Samedi 24 septembre : Jorat / Corcelles (VD) Samedi 1 octobre: Bière - Ballens (VD) -relais Vendredi 14 octobre : Parc Mon Repos (GE) - nocturne Samedi 15 octobre : Terrasse de Genève (74) Samedi 29 octobre : Bonmont (VD) Samedi 5 novembre : Pomier (74) – one-man-relay - Finale   Courses ouvertes à toutes et à tous, sportifs, familles, débutants ou confirmés, du CERN ou d’ailleurs. Cinq circuits disponibles, ceci va du facile court (2 km) adapté aux débutants et aux enfants jusqu’au parcours technique long de 6 km pour les chevronnés en passant par les parcours facile moyen (4&am...

  20. COURSE ORIENTATION

    CERN Multimedia

    Club d'orientation du CERN

    2015-01-01

      Les coureurs d’orientation de la région se sont donné rendez-vous samedi dernier dans les bois de Pougny/Challex lors de l’épreuve organisée par le club d’orientation du CERN. La carte proposée pour les 5 circuits offrait aussi bien un coté très technique avec un relief pentu qu’un coté avec de grandes zones plates à forêt claire. Le parcours technique long comportant 20 postes a été remporté par Beat Muller du COLJ Lausanne en 56:26 devançant Denis Komarov, CO CERN en 57:30 et Yvan Balliot, ASO Annecy en 57:46. Pour les autres circuits les résultats sont les suivants: Technique moyen (13 postes): 1er Joël Mathieu en 52:32 à une seconde du 2e Vladimir Kuznetsov, COLJ Lausanne-Jorat, 3e Jean-Bernard Zosso, CO CERN, en 54:01 Technique court (12 postes): 1er Lennart Jirden, ...

  1. Orienteering Club

    CERN Multimedia

    Club d'Orientation

    2013-01-01

    Course d’orientation Face aux Championnats de France des Clubs à Poitiers, et à une météo hivernale (vent glaciale et pluie), il ne restait qu’une cinquantaine d’orienteurs pour participer à l’épreuve organisée le samedi 25 mai à Grange-Malval. Les participants ont tout de même bien apprécié les 5 circuits proposés par le Satus Genève. Les résultats sont disponibles sur notre site http://cern.ch/club-orientation. En plus des résultats, vous pourrez noter des informations sur la nouvelle école de CO encadrée par B. Barge, Prof. EPS à Ferney-Voltaire pour les jeunes à partir de 6 ans. La prochaine étape de la coupe genevoise se déroulera samedi 1er juin à Morez (39). Epreuve organisée par le club O’Jura&nb...

  2. Orienteering Club

    CERN Multimedia

    Le Club d’orientation du CERN

    2017-01-01

    COURSE ORIENTATION Finale de la coupe d’automne Le club d’orientation du CERN (COC Genève) a organisé sa dernière course populaire de la saison samedi 4 novembre au lieu-dit Les Terrasses de Genève (74). Cette 9e épreuve qui se courait sous la forme d’un One-Man-Relay, clôturait ainsi la coupe genevoise d’automne dont les lauréats sont : Circuit technique long : 1. Julien Vuitton (COC Genève), 2. Berni Wehrle (COC Genève), 3. Christophe Vuitton (COC Genève). Circuit technique moyen : 1. Vladimir Kuznetsov (Lausanne-Jorat), 2. J.-Bernard Zosso (COC Genève), 3. Laurent Merat (O’Jura). Circuit technique court : 1. Thibault Rouiller (COC Genève), 2. exæquo Lennart Jirden (COC Genève) et Katya Kuznetsova (Lausanne-Jorat). Circuit facile moyen : 1. Tituan Barge ...

  3. Orienteering Club

    CERN Multimedia

    Le Club d’orientation du CERN

    2017-01-01

    COURSE ORIENTATION Finale de la coupe d’automne Le club d’orientation du CERN (COC Genève) a organisé sa dernière course populaire de la saison samedi 4 novembre au lieu-dit Les Terrasses de Genève (74). Cette 9e épreuve qui se courait sous la forme d’un One-Man-Relay, clôturait ainsi la coupe genevoise d’automne dont les lauréats sont : Circuit technique long : 1. Julien Vuitton (COC Genève), 2. Berni Wehrle (COC Genève), 3. Christophe Vuitton (COC Genève). Circuit technique moyen : 1. Vladimir Kuznetsov (Lausanne-Jorat), 2. J.-Bernard Zosso (COC Genève), 3. Laurent Merat (O’Jura). Circuit technique court : 1. Thibault Rouiller (COC Genève), 2. exæquo Lennart Jirden (COC Genève) et Katya Kuznetsova (Lausanne-Jorat). Circuit facile moyen : 1. Tituan Barge...

  4. Orienteering Club

    CERN Multimedia

    Club d'Orientation

    2015-01-01

    Course orientation C’est au pied du Salève, proche du Golf de Bosset, que le club d’orientation du CERN (CO CERN) a organisé samedi 19 septembre une nouvelle épreuve comptant pour la Coupe Genevoise d’automne. La zone « des Terrasses de Genève » avait été cartographiée et mise en service l’année dernière. Les participants ont pu apprécier un terrain ludique avec beaucoup de microreliefs, de points d’eau et de gros rochers, le tout au milieu d’une forêt assez claire et agréable à courir. Sur le parcours technique long, le résultat a été très serré puisque Pierrick Merino du club d’Annecy a gagné avec seulement 9 secondes d’avance sur Gaëtan Vuitton (CO CERN) qui confiait avoir perdu beaucoup du te...

  5. Orienteering Club

    CERN Multimedia

    Le Club d’orientation du CERN

    2017-01-01

    Course orientation Les courses d’orientation comptant pour la coupe genevoise de printemps s’enchainent dans la région franco-suisse. Samedi dernier, une bonne centaine de coureurs se sont retrouvés au Mont Mourex où le club du CERN avait préparé la sixième épreuve. A l’issue de la course, les participants confirmaient l’exigence des circuits, à savoir la condition physique et le côté technique du traçage. Le parcours technique long comportant 20 postes a été remporté par Darrell High du Care Vevey en 1:22:38 devançant Beat Muller du COLJ Lausanne-Jorat en 1:25:25 et Alison High également du Care Vevey en 1:28:51. Le circuit technique moyen a été remporté par Christophe Vuitton du CO CERN et le circuit technique court par Claire-Lise Rouiller, CO CERN. Les trois pr...

  6. Orienteering Club

    CERN Multimedia

    Club d'orientation

    2010-01-01

    COURSE D’ORIENTATION La finale de la coupe de printemps Après avoir remporté le challenge club, samedi 29 juin lors du relais inter-club à Lausanne, le Club d’orientation du CERN organisait la dernière étape de la coupe genevoise de printemps samedi 5 juin à Saint-Cergue dans les bois de Monteret (Canton de Vaud). Plus de 100 participants se sont déplacés pour venir participer à la finale et découvrir une toute nouvelle carte dans une forêt vallonnée. Les résultats pour chaque circuit de cette étape sont : Technique long : 1. Jurg Niggli du club O’Jura, 2. Clément Poncet, 3. Oystein Midttun. Technique moyen : 1. Zoltan Trocsanyi CO CERN, 2. Christophe Ingold, 3. Christina Falga. Technique court : 1. Pierre-Andre Baum, CARE Vevey, 2. Emese Szunyog, 3. Solène Balay. Facile moyen : 1. Elisa P...

  7. Club Orientation

    CERN Multimedia

    Club d'orientation

    2014-01-01

      COURSE ORIENTATION   Pas moins de 100 concurrents sont venus s’affronter sur les parcours proposés par le club d’orientation du CERN ce samedi 26 avril lors de la 4e étape de la coupe genevoise de printemps. Les podiums ont été attribués à :  Technique long avec 19 postes : 1er Yvan Balliot, ASO Annecy en 1:01:39 ; 2e Dominique Fleurent, ASO Annecy, en 1:05:12 ; 3e Rémi Fournier, SOS Sallanches, en 1:05:40. Technique moyen avec 14 postes : 1er Jean-Bernard Zosso, CO CERN, en 46:42 ; 2e Céline Zosso, CO CERN, en 50:51 ; 3e Clément Poncet, O’Jura Prémanon, en 51:27. Technique court avec 13 postes : 1er Jaakko Murtomaki, YKV Seinaejoki, en 36:04 ; 2e Marc Baumgartner en 41:27 ; 3e Natalia Niggli, O’Jura Prémanon, en 52:43. Sur les parcours facile moyen et facile court, victoire respectivement de Stéphanie...

  8. Orienteering Club

    CERN Multimedia

    Le Club d’orientation du CERN

    2017-01-01

    Calendrier des courses de la Coupe Genevoise – printemps 2017 Club d'orientation - Julien,  jeune membre du club. Le Club d’orientation du CERN, en partenariat avec d’autres clubs de la région, vous propose une série de courses populaires, qui se dérouleront des deux côtés de la frontière franco-suisse, à savoir : Samedi 1 avril : Pougny/Challex (01) Samedi 8 avril: Ballens (VD) Samedi 22 avril: Apples (VD) Samedi 29 avril: Mont Mussy (01) Samedi 6 mai: Prémanon (39) Samedi 13 mai: Mont Mourex (01) Samedi 20 mai: Prévondavaux (VD) Samedi 10 juin: Chancy/Valleiry (74) Samedi 17 juin: Trélex - Finale (VD) Ces courses sont ouvertes à tous, quel que soit le niveau, du débutant au sportif confirmé, en famille ou en individuel. Les inscriptions sur un des 5 parcours proposés se font sur place le jour de l...

  9. Orienting hypnosis.

    Science.gov (United States)

    Hope, Anna E; Sugarman, Laurence I

    2015-01-01

    This article presents a new frame for understanding hypnosis and its clinical applications. Despite great potential to transform health and care, hypnosis research and clinical integration is impaired in part by centuries of misrepresentation and ignorance about its demonstrated efficacy. The authors contend that advances in the field are primarily encumbered by the lack of distinct boundaries and definitions. Here, hypnosis, trance, and mind are all redefined and grounded in biological, neurological, and psychological phenomena. Solutions are proposed for boundary and language problems associated with hypnosis. The biological role of novelty stimulating an orienting response that, in turn, potentiates systemic plasticity forms the basis for trance. Hypnosis is merely the skill set that perpetuates and influences trance. This formulation meshes with many aspects of Milton Erickson's legacy and Ernest Rossi's recent theory of mind and health. Implications of this hypothesis for clinical skills, professional training, and research are discussed.

  10. Oriented Approach

    Directory of Open Access Journals (Sweden)

    Seyed Mohammad Moghimi

    2013-12-01

    Full Text Available Promoting productivity is one of the goals of usinginformation technology in organizations. The purpose of this research isexamining the impact of IT on organizational productivity andrecognizing its mechanisms based on process-oriented approach. For thisend, by reviewing the literature of the subject a number of impacts of ITon organizational processes were identified. Then, through interviewswith IT experts, seven main factors were selected and presented in aconceptual model. This model was tested through a questionnaire in 148industrial companies. Data analysis shows that impact of IT onproductivity can be included in the eight major categories: Increasing ofthe Automation, Tracking, Communication, Improvement, Flexibility,Analytic, Coordination and Monitoring in organizational processes.Finally, to improve the impact of information technology onorganizational productivity, some suggestions are presented.

  11. Physical state of poorly water soluble therapeutic molecules loaded into SBA-15 ordered mesoporous silica carriers: a case study with itraconazole and ibuprofen.

    Science.gov (United States)

    Mellaerts, Randy; Jammaer, Jasper A G; Van Speybroeck, Michiel; Chen, Hong; Van Humbeeck, Jan; Augustijns, Patrick; Van den Mooter, Guy; Martens, Johan A

    2008-08-19

    The ordered mesoporous silica material SBA-15 was loaded with the model drugs itraconazole and ibuprofen using three different procedures: (i) adsorption from solution, (ii) incipient wetness impregnation, and (iii) heating of a mixture of drug and SBA-15 powder. The location of the drug molecules in the SBA-15 particles and molecular interactions were investigated using nitrogen adsorption, TGA, DSC, DRS UV-vis, and XPS. The in vitro release of hydrophobic model drugs was evaluated in an aqueous environment simulating gastric fluid. The effectiveness of the loading method was found to be strongly compound dependent. Incipient wetness impregnation using a concentrated itraconazole solution in dichloromethane followed by solvent evaporation was most efficient for dispersing itraconazole in SBA-15. The itraconazole molecules were located on the mesopore walls and inside micropores of the mesopore walls. When SBA-15 was loaded by slurrying it in a diluted itraconazole solution from which the solvent was evaporated, the itraconazole molecules ended up in the mesopores that they plugged locally. At a loading of 30 wt %, itraconazole exhibited intermolecular interactions inside the mesopores revealed by UV spectroscopy and endothermic events traced with DSC. The physical mixing of itraconazole and SBA-15 powder followed by heating above the itraconazole melting temperature resulted in formulations in which glassy itraconazole particles were deposited externally on the SBA-15 particles. Loading with ibuprofen was successful with each of the three loading procedures. Ibuprofen preferably is positioned inside the micropores. In vitro release experiments showed fast release kinetics provided the drug molecules were evenly deposited over the mesoporous surface.

  12. EDITORIAL: Optical orientation Optical orientation

    Science.gov (United States)

    SAME ADDRESS *, Yuri; Landwehr, Gottfried

    2008-11-01

    priority of the discovery in the literature, which was partly caused by the existence of the Iron Curtain. I had already enjoyed contact with Boris in the 1980s when the two volumes of Landau Level Spectroscopy were being prepared [2]. He was one of the pioneers of magneto-optics in semiconductors. In the 1950s the band structure of germanium and silicon was investigated by magneto-optical methods, mainly in the United States. No excitonic effects were observed and the band structure parameters were determined without taking account of excitons. However, working with cuprous oxide, which is a direct semiconductor with a relative large energy gap, Zakharchenya and his co-worker Seysan showed that in order to obtain correct band structure parameters, it is necessary to take excitons into account [3]. About 1970 Boris started work on optical orientation. Early work by Hanle in Germany in the 1920s on the depolarization of luminescence in mercury vapour by a transverse magnetic field was not appreciated for a long time. Only in the late 1940s did Kastler and co-workers in Paris begin a systematic study of optical pumping, which led to the award of a Nobel prize. The ideas of optical pumping were first applied by Georges Lampel to solid state physics in 1968. He demonstrated optical orientation of free carriers in silicon. The detection method was nuclear magnetic resonance; optically oriented free electrons dynamically polarized the 29Si nuclei of the host lattice. The first optical detection of spin orientation was demonstrated by with the III-V semiconductor GaSb by Parsons. Due to the various interaction mechanisms of spins with their environment, the effects occurring in semiconductors are naturally more complex than those in atoms. Optical detection is now the preferred method to detect spin alignment in semiconductors. The orientation of spins in crystals pumped with circularly polarized light is deduced from the degree of circular polarization of the recombination

  13. Molecular dynamics study on condensation/evaporation coefficients of chain molecules at liquid-vapor interface.

    Science.gov (United States)

    Nagayama, Gyoko; Takematsu, Masaki; Mizuguchi, Hirotaka; Tsuruta, Takaharu

    2015-07-07

    The structure and thermodynamic properties of the liquid-vapor interface are of fundamental interest for numerous technological implications. For simple molecules, e.g., argon and water, the molecular condensation/evaporation behavior depends strongly on their translational motion and the system temperature. Existing molecular dynamics (MD) results are consistent with the theoretical predictions based on the assumption that the liquid and vapor states in the vicinity of the liquid-vapor interface are isotropic. Additionally, similar molecular condensation/evaporation characteristics have been found for long-chain molecules, e.g., dodecane. It is unclear, however, whether the isotropic assumption is valid and whether the molecular orientation or the chain length of the molecules affects the condensation/evaporation behavior at the liquid-vapor interface. In this study, MD simulations were performed to study the molecular condensation/evaporation behavior of the straight-chain alkanes, i.e., butane, octane, and dodecane, at the liquid-vapor interface, and the effects of the molecular orientation and chain length were investigated in equilibrium systems. The results showed that the condensation/evaporation behavior of chain molecules primarily depends on the molecular translational energy and the surface temperature and is independent of the molecular chain length. Furthermore, the orientation at the liquid-vapor interface was disordered when the surface temperature was sufficiently higher than the triple point and had no significant effect on the molecular condensation/evaporation behavior. The validity of the isotropic assumption was confirmed, and we conclude that the condensation/evaporation coefficients can be predicted by the liquid-to-vapor translational length ratio, even for chain molecules.

  14. Orienteering Club

    CERN Multimedia

    Club d'orientation

    2013-01-01

    Course d'orientation Le coup d’envoi de la coupe genevoise a été donné samedi 31 août dans les bois de Combe Froide à Prémanon. Plus de 150 coureurs avaient fait le déplacement. Les parcours facile court, facile moyen et technique court ont été remportés par des coureurs du club O’Jura - Ulysse Dannecker, Léo Lonchampt, Franck Lonchampt, le technique moyen par Pekka Marti du club Ol Biel Seeland et le technique long par Térence Risse du CA Rosé – également membre de l’équipe nationale suisse des moins de 20 ans. Pour le club du CERN, les meilleures résultats ont été obtenus pas Emese Szunyog sur technique court et Marie Vuitton sur technique moyen avec une 4e place. La prochaine course aura lieu samedi 14 septembre à La Faucille. Le club propose aussi...

  15. Orienteering club

    CERN Multimedia

    Club d'orientation

    2014-01-01

    Course d'orientation Finale de la coupe d’automne La dernière épreuve de la coupe d’automne organisée par le club s’est déroulée ce samedi 1er novembre avec une course type «one-man-relay» dans la forêt de Trelex (Vd). Les concurrents des circuits techniques devaient parcourir trois boucles et ceux des circuits «faciles» deux boucles, avec changements de carte. Le parcours technique long a été remporté par un membre du club, Berni Wehrle. A l’issue de cette course, le Président du club, L. Jirden annonçait le classement général de la coupe d’automne, basé sur les 6 meilleurs résultats de la saison : Circuit technique long : 1er Juerg Niggli (O’Jura), 2e Berni Wehrle, 3e Beat Mueller. Circuit technique moyen : 1er Laurent Merat (O&r...

  16. Orienteering club

    CERN Multimedia

    Club d'orientation

    2013-01-01

    Course d'orientation Finale de la coupe genevoise Rapide et méthodique, voilà les qualités dont il fallait faire preuve pour remporter la dernière étape de la coupe organisée par le club du CERN dans les bois de Monteret. Il s’agissait d’une course au score où chaque concurrent disposait d’un temps imparti pour poinçonner le maximum de balises. Le parcours technique a été remporté par Tomas Shellman et le parcours facile par Victor Dannecker. Cette dernière étape était aussi décisive pour la désignation des lauréats de la coupe genevoise de printemps. Les résultats officiels étaient donnés par le président du club, L. Jirden : Circuit Technique Long : Berni Wehrle, Bruno Barge, Edvins Reisons Circuit Technique Moyen : J.-Bernard Zosso, ...

  17. Orienteering Club

    CERN Multimedia

    Club d'Orientation

    2011-01-01

    Course d'orientation Avec la CO en nocturne organisée par le club du CERN vendredi 14 octobre au stade des Eveaux (Ge), et la CO à Savigny (Vd) proposée par le club de Lausanne-Jorat le lendemain, les étapes de la coupe genevoise d’automne s’enchainent rapidement. Il ne reste plus que 3 rendez-vous pour boucler la saison. Les premières places devraient certainement se jouer entre des membres du club du CERN, du O’Jura ou de Lausanne-Jorat. La prochaine course du club est programmée pour samedi 22 octobre à Pomier, près de Cruseilles. L’accueil se fera à partir de 12h30 et les départs s’échelonneront de 13h à 15h. * * * * * * * Nouvelle belle victoire samedi 8 octobre à Saint Cergue du jeune finlandais Ville Keskisaari (COLJ) en 50:56 devant Jürg Niggli (O’Jura) en 1:03:32, et Alexandre...

  18. Orienteering Club

    CERN Document Server

    Club d'orientation

    2013-01-01

    De jour comme de nuit Les amateurs de course d’orientation ont pu s’en donner à cœur joie ce week-end puisqu’ils avaient la possibilité de courir sur deux épreuves en moins de 24 heures. En effet, le club du CERN organisait une course de nuit aux Evaux et la 7e étape de la coupe genevoise se tenait samedi après-midi dans les bois du Grand Jorat à Savigny. Les vainqueurs pour chaque course sont : Technique long CO de nuit: Julien Charlemagne, SOS Sallanches CO samedi: Philipp Khlebnikov, ANCO   Technique moyen CO de nuit: Céline Zosso, CO CERN CO samedi: Pavel Khlebnikov, ANCO Technique court CO de nuit: Colas Ginztburger, SOS Sallanches CO samedi: Victor Kuznetsov, COLJ Lausannne Facile moyen CO de nuit: Gaëtan Rickenbacher, CO CERN CO samedi: Tamas Szoke   Facile court CO de nuit:Oriane Rickenbacher, CO CERN CO samedi: Katya Kuznetsov...

  19. Orienteering Club

    CERN Multimedia

    Club d'Orientation

    2015-01-01

    Course orientation Finale de la coupe genevoise La série des courses de printemps s’est achevée samedi dernier dans les bois de Bonmont (Vaud) avec une épreuve «one-man-relay» organisée par le club. Le vainqueur du parcours technique  long, Yann Locatelli (Club de Chambéry Savoie) a réalisé les deux boucles comportant 24 balises avec presque 6 minutes d’avance sur le second concurrent Domenico Lepori (Club CARE Vevey). Cette dernière étape était aussi décisive pour la désignation des lauréats de la coupe genevoise de printemps, en comptabilisant les 6 meilleurs résultats sur les 10 épreuves. Le podium officiel était donné par le président du club, L. Jirden, qui profitait de l’occasion pour remercier tous les participants et également tous les...

  20. Orienteering Club

    CERN Multimedia

    CLUB D'ORIENTATION

    2013-01-01

    Calendrier de la coupe d’automne Le Club d’orientation du CERN, en partenariat avec d’autres clubs de la région, vous propose, pour cette nouvelle coupe d’automne genevoise, une série de 10 courses. Le club du O’Jura donnera le coup d’envoi le samedi 31 août. Les courses s’enchaîneront selon le calendrier suivant : Samedi 31 août : Prémanon (39) - longue distance Samedi 14 septembre : La Faucille (01) - longue distance Samedi 21 septembre : Saint Cergue (VD) - longue distance Samedi 28 septembre : Ballens (VD) - relais Samedi 5 octobre : La Pile (VD) - longue distance Vendredi 11 octobre : Les Evaux (GE) - nocturne Samedi 12 octobre : Grand Jorat, Savigny (VD) - longue distance Samedi 19 octobre : Terrasses de Genève (74) - longue distance Samedi 26 octobre : Prémanon (39) - longue distance Samedi 2 novembre : Bois Tollot (GE) - score - Finale Les &a...

  1. Orienteering club

    CERN Multimedia

    Club d'orientation

    2014-01-01

    Course d'orientation C’est sous un beau soleil samedi 4 octobre que s’est déroulée la 6e étape de la Coupe genevoise d’automne organisée par le club. Plus d’une centaine de concurrents provenant de 7 clubs de CO avaient fait le déplacement pour courir sur un des cinq parcours proposés dans les bois de Trélex-Génolier (VD). Le podium est le suivant : Technique long (5,9 km, 19 postes) : 1er Jurg Niggli, O’Jura (1:00:02); 2e Berni Wehrle, CO CERN (1:06:44); 3e Konrad Ehrbar, COLJ (1:07:08) Technique moyen (4,8 km, 18 postes) : 1er Christophe Vuitton, CO CERN (54:25); 2e J.B. Zosso, CO CERN (1:01:19); 3e Jeremy Wichoud, COLJ (1:06:21) Technique court (3,8 km, 14 postes) : 1er Julien Vuitton, CO CERN (36:19); 2e Vladimir Kuznetsov, COLJ (48:47); 3e Natalia Niggli, O’Jura (50:38) Facile moyen (3,2 km, 11 postes) : 1ère Alina Niggli, O&...

  2. Orienteering Club

    CERN Multimedia

    Club d'Orientation

    2012-01-01

    Relais inter-club/Challenge Carlo Milan Samedi dernier, lors de l’épreuve de course d’orientation organisée par le club du O’Jura, le moteur de la discipline était l’esprit d’équipe, puisqu’il était question d’un relais inter-club avec le Challenge Carlo Milan. Les clubs avaient aligné leurs coureurs soit sur le relais technique (trois participants) soit sur le relais facile (deux participants). Côté O’Jura, il fallait noter la participation de François Gonon, champion du monde 2011, côté club du CERN, Marie et Gaëtan Vuitton, jeunes espoirs du club, devaient préparer la piste pour lancer le dernier relayeur. Côté Lausanne-Jorat, il fallait compter sur le très jeune Viktor Kuznetsov. Les 31 équipes engagées n’ont pas m&ea...

  3. Orienteering Club

    CERN Multimedia

    Club d'Orientation

    2012-01-01

     Finale de la coupe de printemps   La dernière course d’orientation comptant pour la Coupe de printemps a eu lieu samedi dernier dans le village des Rousses et vers le Fort. Il s’agissait d’un sprint organisé par le club O’Jura. Les temps de course ont avoisiné les 20 minutes que ce soit pour le parcours technique moyen ou technique long. Tous les habitués étaient au rendez-vous pour venir consolider ou améliorer leur place au classement. A l’issue de cette course, le classement général de la Coupe de printemps prenant en compte les 6 meilleurs résultats des 9 courses était établi et les lauréats de chaque catégorie sont les suivants: Circuit technique long : 1er Berni Wehrle, 2e Bruno Barge, 3e Edvins Reisons. Circuit technique moyen : 1er Jean-Bernard Zosso, 2e Cédric Wehrl&...

  4. Orienteering club

    CERN Multimedia

    Club d'orientation

    2010-01-01

    COURSE D’ORIENTATION  De La Rippe à Sauvabellin, la coupe genevoise continue ! Le rendez-vous était donné samedi 8 mai aux amateurs de course d’orientation dans les bois de La Rippe (Canton de Vaud). Cette 6e épreuve était organisée par le Club Satus Grutli de Genève. Il est dommage que les participants n’aient pas été aussi nombreux que lors des dernières courses, les Championnats de France des clubs à Dijon ayant certainement retenus plus d’un compétiteur. La première place est revenue à : – Technique long : Berni Wehrle – Technique moyen : Jean-Bernard Zosso – Technique court : Berni Wehrle – Facile moyen : Peter Troscanyi – Facile court : Claire Droz. Il ne restera plus que deux épreuves ...

  5. Orienteering club

    CERN Multimedia

    Club d'orientation

    2013-01-01

    Courses d’orientation Samedi 20 avril, les organisateurs du Club de CO du CERN ont accueilli au Mont Mourex 70 participants qui n’ont pas hésité à venir malgré la forte bise. Berni Wehrle du CO CERN s’est octroyé la première place en 1:04:49 sur le parcours technique long devant Pyry Kettunen du Saynso Juankoski en 1:06:52, la 3e place revenant à Bruno Barge, CO CERN, à 7 secondes. Les autres parcours ont été remportés par : Technique moyen : 1er Jacques Moisset, Chamonix (47:44), 2e Yves Rousselot, Balise 25 Besançon (57:16), 3e Jean-Bernard Zosso, CO CERN (59:28). Technique court : 1er Victor Kuznetsov, COLJ (51:53), 2e Pierrick Collet, CO CERN (1:12:52), 3e Dominique Balay, CO CERN (1:16:04). Pour les parcours facile moyen et facile court, Ralf Nardini et Léa Nicolas, tous deux du CO CERN, terminaient respectivement premier. Voi...

  6. Selecting an optimal number of binding site waters to improve virtual screening enrichments against the adenosine A2A receptor.

    Science.gov (United States)

    Lenselink, Eelke B; Beuming, Thijs; Sherman, Woody; van Vlijmen, Herman W T; IJzerman, Adriaan P

    2014-06-23

    A major challenge in structure-based virtual screening (VS) involves the treatment of explicit water molecules during docking in order to improve the enrichment of active compounds over decoys. Here we have investigated this in the context of the adenosine A2A receptor, where water molecules have previously been shown to be important for achieving high enrichment rates with docking, and where the positions of some binding site waters are known from a high-resolution crystal structure. The effect of these waters (both their presence and orientations) on VS enrichment was assessed using a carefully curated set of 299 high affinity A2A antagonists and 17,337 decoys. We show that including certain crystal waters greatly improves VS enrichment and that optimization of water hydrogen positions is needed in order to achieve the best results. We also show that waters derived from a molecular dynamics simulation - without any knowledge of crystallographic waters - can improve enrichments to a similar degree as the crystallographic waters, which makes this strategy applicable to structures without experimental knowledge of water positions. Finally, we used decision trees to select an ensemble of structures with different water molecule positions and orientations that outperforms any single structure with water molecules. The approach presented here is validated against independent test sets of A2A receptor antagonists and decoys from the literature. In general, this water optimization strategy could be applied to any target with waters-mediated protein-ligand interactions.

  7. Theoretical study of the interaction of N2 with water molecules. (H2O)/sub n/:N2, n = 1--8

    International Nuclear Information System (INIS)

    Curtiss, L.A.; Eisgruber, C.L.

    1984-01-01

    Ab initio molecular orbital calculations including correlation energy have been carried out on the interaction of a single H 2 O molecule with N 2 . The potential energy surface for H 2 O:N 2 is found to have a minimum corresponding to a HOH xxx N 2 structure with a weak ( -1 ) hydrogen bond. A second, less stable, configuration corresponding to a H 2 O xxx N 2 structure with N 2 bonded side on to the oxygen of H 2 O was found to be either a minimum or a saddle point in the potential energy surface depending on the level of calculation. The minimal STO-3G basis set was used to investigate the interaction of up to eight H 2 O molecules with N 2 . Two types of clusters, one containing only HOH xxx N 2 interactions and the other containing both HOH xxxN 2 and H 2 O xxx N 2 interactions, were investigated for [N 2 :(H 2 O)/sub n/, n = 2--8

  8. Water

    Science.gov (United States)

    ... www.girlshealth.gov/ Home Nutrition Nutrition basics Water Water Did you know that water makes up more ... to drink more water Other drinks How much water do you need? top Water is very important, ...

  9. Protection of a PWR nuclear power stations against corrosion using hydrogen molecules to capture oxygen molecules

    International Nuclear Information System (INIS)

    Nahili, M.

    2004-01-01

    A protection method for the primary loops metals of nuclear power plants from corrosion was investigated. Hydrogen molecules were added to the primary circuit to eliminate oxygen molecules produced by radiolysis of coolant at the reactor core. The hydrogen molecules were produced by electrolyses of water and then added when the coolant water was passing through the primary coolant circuit. Thermodynamical process and the protection methods from corrosion were discussed, the discussion emphasized on the removal of oxygen molecules as one of the protection methods, and compared with other methods. The amount of hydrogen molecules needed for complete removal of oxygen was estimated in two cases: in the case without passing the water through the oxygen removal system, and in the case of passing water through the system. A pressurized water reactor VVER was chosen to be investigated in this study. The amount of hydrogen molecules was estimated so as to eliminate completely the oxygen molecules from coolant water. The estimated value was found to be less than the permissible range for coolant water for such type of reactors. A simulation study for interaction mechanism between hydrogen and oxygen molecules as water flowing in a tube similar to that of coolant water was performed with different water flow velocities. The interaction between the molecules of hydrogen and oxygen was described. The gas diffusion at the surface of the tube was found to play a major role in the interaction. A mathematical model was found to give full description of the change of oxygen concentration through the tube, as well as, to calculate the length of the tube where the concentration of oxygen reduced to few order of magnitude. (Author)

  10. Sexual Orientation (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Sexual Orientation KidsHealth / For Parents / Sexual Orientation What's in this ... orientation is part of that process. What Is Sexual Orientation? The term sexual orientation refers to the gender ( ...

  11. Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions.

    Science.gov (United States)

    Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen

    2007-11-06

    The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

  12. Strategy to discover diverse optimal molecules in the small molecule universe.

    Science.gov (United States)

    Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N

    2015-03-23

    The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.

  13. Orientational diffusion of n-alkyl cyanides

    International Nuclear Information System (INIS)

    Zhu Xiang; Farrer, Richard A; Zhong Qin; Fourkas, John T

    2005-01-01

    Ultrafast optical Kerr effect spectroscopy has been used to study the temperature-dependent orientational dynamics of a series of nitriles with n-alkyl chains ranging from one to 11 carbons in length. In all cases the orientational diffusion is found to be described by a single-exponential decay. Analysis of the orientational correlation times using the Debye-Stokes-Einstein equation suggests that the molecules adopt extended configurations and reorient as rigid rods. The liquids with shorter alkyl chains undergo an apparent ordering transition as they are cooled

  14. Dipole Correlation of the Electronic Structures of theConformations of Water Molecule Evolving Through theNormal Modes of Vibrations Between Angular (C2v to Linear(D∝h Shapes

    Directory of Open Access Journals (Sweden)

    Arindam Chakraborty

    2006-03-01

    Full Text Available In order to settle the issue of equivalence or non-equivalence of the two lone pairsof electrons on oxygen atom in water molecule, a quantum chemical study of the dipolecorrelation of the electronic structure of the molecule as a function of conformationsgenerated following the normal modes of vibrations between the two extremeconformations, C2v (∠HOH at 90o and D∝h (∠HOH at 180o, including the equilibrium one,has been performed. The study invokes quantum mechanical partitioning of moleculardipoles into bond moment and lone pair moment and localization of delocalized canonicalmolecular orbitals, CMO’s into localized molecular orbitals, LMO’s. An earlier suggestion,on the basis of photoelectron spectroscopy, that one lone pair is in p-type and the other is ins-type orbital of O atom of water molecule at its equilibrium shape, and also the qualitative“Squirrel Ears” structure are brought under serious scrutiny. A large number ofconformations are generated and the charge density matrix, dipole moment of eachconformation is computed in terms of the generated canonical molecular orbitals, CMO’sand then Sinanoğlu’s localization method is invoked to localize the CMO’s of eachconformation and the quantum mechanical hybridizations of all the bonds and lone pairs onO center are evaluated in terms of the localized molecular orbitals. Computed datademonstrate that the electronic structures i.e. two bond pairs and two lone pairs and itshybridization status of all conformations of water molecule are straightforward in terms ofthe LMO’s. It is further revealed that the pattern of orbital hybridization changescontinuously as a function of evolution of molecular shape. The close analysis of thegenerated LMO’s reveals that one lone pair is accommodated in a pure p orbital and anotherlone pair is in a hybrid

  15. Formation of Ultracold Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

    2016-01-28

    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  16. Effects of Magnetized Water with Small Molecules Mass on Albumin Extraction from Kidney Bean%小分子团磁化水对芸豆清蛋白浸出效果的影响

    Institute of Scientific and Technical Information of China (English)

    包国凤; 刁静静; 井雪莲; 张丽萍

    2015-01-01

    以垦芸2号芸豆品种为原料,以自来水和纯净水作对比试验,研究小分子团磁化水促进芸豆清蛋白的浸出作用,并优化了提取技术参数。通过对提取温度、提取时间、液料比和粉碎粒度四个因素的单因素试验和响应面分析,结果表明:提取温度31℃,提取时间2 h,液料比22∶1,粉碎粒度60目时芸豆清蛋白的提取率均最高,其中小分子团磁化水组提取率为48.96%,高于自来水组(42.79%)和纯净水组(40.87%);并对小分子团磁化水提取的芸豆清蛋白进行SDS-PAGE电泳测试,得出分子量排布主要集中在42.01 kDa左右,说明所得蛋白为清蛋白。%Using Kenyun 2 kidney beans as raw material and tap water and pure water as comparison tests,the infusion effects of magnetized water with small molecules mass to kidney bean were studied,and the extraction parameters of albumin from kidney bean were optimized. Through single factor and response surface analysis of four factors such as extraction temperature,extraction time, ratio of liquid to material and particle size,the results showed that the optimum extraction conditions was as follows:extraction temperature 31 ℃,extraction time 2 h,ratio of liquid to material 22∶1,particle size 60 mesh. Under such conditions,the extraction yield of magnetized water with small molecules group was 48.96% and higher than that of tap water group (42.79%)and purified water group (40.87%).SDS-PAGE result showed that the molecular weight of the extracted protein was about 42.01 kDa,and the protein was albumin.

  17. Gestione delle acque, pace nel Medio Oriente e un ruolo per la Banca Mondiale (Water Management, Middle East Peace and a Role for the World Bank

    Directory of Open Access Journals (Sweden)

    Hossein Askari

    2012-04-01

    Full Text Available The region comprising North Africa and the Middle East is the driest in the world. Thus conflicts over water have been a part of the landscape. These conflicts over water are invariably seen as a zero sum game; such a view does not incorporate the notion that water is an economic good and is therefore scarce. Given the limitation of competitive markets, optimal water allocation could only but help. However, even if one country allocates water efficiently within its own territory, its allocation could be sub-optimal if water interdependencies with other countries are not incorporated in a regional optimization model. The World Bank is in the best position to adopt a regional optimization model and thus ameliorate water conditions in the Middle East and in other regions around the world.       JEL Codes: Q25, Q28, Q15, Q13Keywords: Water

  18. The status of molecules

    International Nuclear Information System (INIS)

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN

    1994-06-01

    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  19. Molecular hydrogen solvated in water – A computational study

    International Nuclear Information System (INIS)

    Śmiechowski, Maciej

    2015-01-01

    The aqueous hydrogen molecule is studied with molecular dynamics simulations at ambient temperature and pressure conditions, using a newly developed flexible and polarizable H 2 molecule model. The design and implementation of this model, compatible with an existing flexible and polarizable force field for water, is presented in detail. The structure of the hydration layer suggests that first-shell water molecules accommodate the H 2 molecule without major structural distortions and two-dimensional, radial-angular distribution functions indicate that as opposed to strictly tangential, the orientation of these water molecules is such that the solute is solvated with one of the free electron pairs of H 2 O. The calculated self-diffusion coefficient of H 2 (aq) agrees very well with experimental results and the time dependence of mean square displacement suggests the presence of caging on a time scale corresponding to hydrogen bond network vibrations in liquid water. Orientational correlation function of H 2 experiences an extremely short-scale decay, making the H 2 –H 2 O interaction potential essentially isotropic by virtue of rotational averaging. The inclusion of explicit polarizability in the model allows for the calculation of Raman spectra that agree very well with available experimental data on H 2 (aq) under differing pressure conditions, including accurate reproduction of the experimentally noted trends with solute pressure or concentration

  20. Cold Rydberg molecules

    Science.gov (United States)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  1. Circular Intensity Differential Scattering of chiral molecules

    Energy Technology Data Exchange (ETDEWEB)

    Bustamante, C.J.

    1980-12-01

    In this thesis a theory of the Circular Intensity Differential Scattering (CIDS) of chiral molecules as modelled by a helix oriented with respect to the direction of incidence of light is presented. It is shown that a necessary condition for the existence of CIDS is the presence of an asymmetric polarizability in the scatterer. The polarizability of the scatterer is assumed generally complex, so that both refractive and absorptive phenomena are taken into account.

  2. Off-resonant vibrational excitation: Orientational dependence and spatial control of photofragments

    DEFF Research Database (Denmark)

    Machholm, Mette; Henriksen, Niels Engholm

    2000-01-01

    Off-resonant and resonant vibrational excitation with short intense infrared (IR) laser pulses creates localized oscillating wave packets, but differs by the efficiency of the excitation and surprisingly by the orientational dependence. Orientational selectivity of the vibrational excitation...... of randomly oriented heteronuclear diatomic molecules can be obtained under simultaneous irradiation by a resonant and an off-resonant intense IR laser pulse: Molecules with one initial orientation will be vibrationally excited, while those with the opposite orientation will be at rest. The orientation-dependent...... distribution. (C) 2000 American Institute of Physics....

  3. Theoretical vibrational sum-frequency generation spectroscopy of water near lipid and surfactant monolayer interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Roy, S.; Gruenbaum, S. M.; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, 1101 University Ave., University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States)

    2014-11-14

    Understanding the structure of water near cell membranes is crucial for characterizing water-mediated events such as molecular transport. To obtain structural information of water near a membrane, it is useful to have a surface-selective technique that can probe only interfacial water molecules. One such technique is vibrational sum-frequency generation (VSFG) spectroscopy. As model systems for studying membrane headgroup/water interactions, in this paper we consider lipid and surfactant monolayers on water. We adopt a theoretical approach combining molecular dynamics simulations and phase-sensitive VSFG to investigate water structure near these interfaces. Our simulated spectra are in qualitative agreement with experiments and reveal orientational ordering of interfacial water molecules near cationic, anionic, and zwitterionic interfaces. OH bonds of water molecules point toward an anionic interface leading to a positive VSFG peak, whereas the water hydrogen atoms point away from a cationic interface leading to a negative VSFG peak. Coexistence of these two interfacial water species is observed near interfaces between water and mixtures of cationic and anionic lipids, as indicated by the presence of both negative and positive peaks in their VSFG spectra. In the case of a zwitterionic interface, OH orientation is toward the interface on the average, resulting in a positive VSFG peak.

  4. Entrepreneurial orientation, market orientation, and competitive environment

    DEFF Research Database (Denmark)

    Sørensen, Hans Eibe; Cadogan, John W.

    This study sheds light on the role that the competitive environment plays in determining how elements of market orientation and elements of entrepreneurial orientation interact to influence business success. We develop a model in which we postulate that market orientation, entrepreneurial...... orientation, and competitive environment shape business performance via a three-way interaction. We test the model using primary data from the CEOs of 270 CEO of manufacturing firms, together with secondary data on these firms' profit performance. An assessment of the results indicates that customer...... orientation moderates the positive relationships between the competitiveness element of entrepreneurial orientation and market share and return on assets (ROA): the positive relationships between competitiveness and market share and competitiveness and ROA become stronger the greater the firms' customer...

  5. TIRF and its application to protein adsorption : electrostatics and orientation

    NARCIS (Netherlands)

    Bos, M.A.

    1994-01-01

    The aim of the study in this thesis was to develop a method for determining the orientation of adsorbed protein molecules and to study the influence of the electrical potential of the interface on the interfacial properties of proteins, including their orientation.

    In the adsorption

  6. Molecule of the Month

    Indian Academy of Sciences (India)

    Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...

  7. Molecule of the Month

    Indian Academy of Sciences (India)

    Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...

  8. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  9. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  10. Multinuclear NMR characterization of CTAB-hexanol-water, sodium oleate-butanol-water and triton X-100-decanol-water microemulsions

    International Nuclear Information System (INIS)

    Nagy, J.B.; Bodart-Ravet, I.; Derouane, E.G.; Gourgue, A.; Verfaillie, J.P.

    1989-01-01

    Multinuclear NMR is a very valuable tool to characterize micellar systems or microemulsions. It allows one to determine c.m.c. values, to study the dissolution of organic molecules, the solvation of cations and anions, the structural changes occurring in a ternary diagram, the mobility of the molecules, etc. This review paper essentially deals with the characterization of cationic (CTAB-hexanol-water), anionic (sodium oleate-butanol-water) and neutral (Triton X-100-decanol-water) reversed micelles. The use of paramagnetic ions [Ni(II), CO(II), Fe(III), etc.] is particularly emphasized to characterize the site of solubilization and their interaction with surfactant and cosurfactant molecules 13 C-NMR). It is concluded, that the metallic ions are basically solvated in the inner water cores and one or more hexanol molecules are included in their first coordination shells in the CTAB-hexanol-water microemulsions. In the Triton X-100-decanol-water microemulsions, both decanol and Triton X-100 molecules enter the first coordination shell of Co(II) ions which are dissolved in both aqeous water cores and the organic medium. 19 F-NMR of a fluorinated probe molecule is particularly useful to study the size of the inner water cores. The method is based on the partition of the molecules between the interface and the organic medium. However, this method has to be applied with great care, and the computed data have to be compared to other physico-chemical results. Both 19 F- and 23 Na-NMR results show a great variation of the behaviour of the sodium oleate-butanol-water system in the so-called bicontinuous region. The Na + ions are oriented independently on a hypothetical inverse micellar droplet. (author). 43 refs.; 18 figs.; 7 tabs

  11. Surface species formed by the adsorption and dissociation of water molecules on Ru(0001) surface containing a small coverage of carbon atoms studied by scanning tunneling microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Dept of Materials Science and Engineering UCB; Dept of Applied Science and Technology, UCB; Institut de Ciencia de Materials de Barcelona, Barcelona, Spain; Instituto de Ciencia de Materiales de Madrid, Madrid, Spain; Department of Mechanical Engineering, Yale University; Salmeron, Miquel; Shimizu, Tomoko K.; Mugarza, Aitor; Cerda, Jorge I.; Heyde, Markus; Qi, Yabing; Schwarz, Udo D.; Ogletree, D. Frank; Salmeron, Miquel

    2008-04-26

    The adsorption and dissociation of water on a Ru(0001) surface containing a small amount ({le} 3 %) of carbon impurities was studied by scanning tunneling microscopy (STM). Various surface species are formed depending on the temperature. These include molecular H{sub 2}O, H{sub 2}O-C complexes, H, O, OH and CH. Clusters of either pure H{sub 2}O or mixed H{sub 2}O-OH species are also formed. Each of these species produces a characteristic contrast in the STM images and can be identified by experiment and by ab initio total energy calculations coupled with STM image simulations. Manipulation of individual species via excitation of vibrational modes with the tunneling electrons has been used as supporting evidence.

  12. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  13. Water in Room Temperature Ionic Liquids

    Science.gov (United States)

    Fayer, Michael

    2014-03-01

    Room temperature ionic liquids (or RTILs, salts with a melting point below 25 °C) have become a subject of intense study over the last several decades. Currently, RTIL application research includes synthesis, batteries, solar cells, crystallization, drug delivery, and optics. RTILs are often composed of an inorganic anion paired with an asymmetric organic cation which contains one or more pendant alkyl chains. The asymmetry of the cation frustrates crystallization, causing the salt's melting point to drop significantly. In general, RTILs are very hygroscopic, and therefore, it is of interest to examine the influence of water on RTIL structure and dynamics. In addition, in contrast to normal aqueous salt solutions, which crystallize at low water concentration, in an RTIL it is possible to examine isolated water molecules interacting with ions but not with other water molecules. Here, optical heterodyne-detected optical Kerr effect (OHD-OKE) measurements of orientational relaxation on a series of 1-alkyl-3-methylimidazolium tetrafluoroborate RTILs as a function of chain length and water concentration are presented. The addition of water to the longer alkyl chain RTILs causes the emergence of a long time bi-exponential orientational anisotropy decay. Such decays have not been seen previously in OHD-OKE experiments on any type of liquid and are analyzed here using a wobbling-in-a-cone model. The orientational relaxation is not hydrodynamic, with the slowest relaxation component becoming slower as the viscosity decreases for the longest chain, highest water content samples. The dynamics of isolated D2O molecules in 1-butyl-3-methylimidazolium hexafluorophosphate (BmImPF6) were examined using two dimensional infrared (2D IR) vibrational echo spectroscopy. Spectral diffusion and incoherent and coherent transfer of excitation between the symmetric and antisymmetric modes are examined. The coherent transfer experiments are used to address the nature of inhomogeneous

  14. Comparison of arsenic acid with phosphoric acid in the interaction with a water molecule and an alkali/alkaline-earth metal cation.

    Science.gov (United States)

    Park, Sung Woo; Kim, Chang Woo; Lee, Ji Hyun; Shim, Giwoong; Kim, Kwang S

    2011-10-20

    Recently, Wolfe-Simon has discovered a bacterium which is able to survive using arsenic(V) rather than phosphorus(V) in its DNA. Thus it is important to investigate some important structural and chemical similarities and dissimilarities between phosphate and arsenate. We compared the monohydrated structures and the alkali/alkaline-earth metal (Na(+), K(+), Mg(2+) and Ca(2+)) complexes of the arsenic acid/anions with those of the phosphoric acid/anions [i.e., H(m)PO(4)(-(3-m)) vs H(m)AsO(4)(-(3-m)) (m = 1-3)]. We carried out geometry optimization along with harmonic frequency calculations using ab initio calculations. Despite the increased van der Waals radius of As, the hydrated structures of both P and As systems show very close similarity (within 0.25 Å in the P/As···O(water) distance and within a few kJ/mol in binding energy) because of the increased induction energies by more polar arsenic acid/anons and slightly increased dispersion energy by a larger size of the As atom. In the metal complexes, the arsenic acid has a slightly larger binding distance (by 0.07-1.0 Å) and weaker binding energy because the As(V) ion has a slightly larger radius than the P(V) ion, and the electrostatic interaction is the dominating feature in these systems.

  15. Dynamics of Activated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)

    2016-11-16

    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  16. Sugar Blowing-Induced Porous Cobalt Phosphide/Nitrogen-Doped Carbon Nanostructures with Enhanced Electrochemical Oxidation Performance toward Water and Other Small Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Chengzhou [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Fu, Shaofang [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Xu, Bo Z. [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Song, Junhua [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Shi, Qiurong [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Engelhard, Mark H. [Environmental Molecular Science Laboratory, Pacific Northwest National Laboratory, Richland WA 99352 USA; Li, Xiaolin [Energy and Environmental Directory, Pacific Northwest National Laboratory, Richland WA 99352 USA; Beckman, Scott P. [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Sun, Junming [The Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman WA 99164 USA; Du, Dan [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Lin, Yuehe [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA

    2017-06-28

    Finely controlled synthesis of high active and robust nonprecious metal catalysts with excellent catalytic efficiency in oxygen evolution reaction (OER) is extremely vital for making the water splitting process more energy-efficient and economical. Among these noble metal-free catalysts, transition-metal-based nanomaterials are considered as one of the most promising OER catalysts due to their relatively low-cost intrinsic activities, high abundance and diversity in terms of structure and morphology. In this work, we reported a facile sugar-blowing technique and low-temperature phosphorization to generate 3D self-supported metal involved carbon nanostructures, which termed as Co2P@Co/nitrogen-doped carbon (Co2P@Co/N-C). By capitalizing on the 3D porous nanostructures with high surface area, generously dispersed active sites, the intimate interaction between active sites and 3D N-doped carbon, the resultant Co2P@Co/N-C exhibited satisfying OER performance superior to CoO@Co/N-C, delivering 10 mA cm-2 at overpotential of 0.32 V. It is noting that in contrast to the substantial current density loss of RuO2, Co2P@Co/N-C showed much enhanced catalytic activity during the stability test and the 1.8-fold increase in current density was observed after stability test. Furthermore, the obtained Co2P@Co/N-C can also be served as an excellent nonprecious metal catalyst for methanol and glucose electrooxidation in alkaline media, further extending their potential applications.

  17. Dissociation in small molecules

    International Nuclear Information System (INIS)

    Dehmer, P.M.

    1982-01-01

    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  18. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  19. Electron-molecule collisions

    CERN Document Server

    Takayanagi, Kazuo

    1984-01-01

    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  20. Molecules to Materials

    Indian Academy of Sciences (India)

    evolved as a new line of thinking wherein a single molecule or perhaps a collection .... In photonic communication processes, laser light has to be modulated and .... The author wishes to thank G Rajaram for a critical reading of the manuscript.

  1. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    overall absorption spectrum of a molecule is a superposition of many such sharp lines .... dilute solution of the enzyme and the substrate over few drops of silicone oil placed ..... Near-field Scanning Optical Microscopy (NSOM): Development.

  2. Quantum dot molecules

    CERN Document Server

    Wu, Jiang

    2014-01-01

    This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

  3. Molecule of the Month

    Indian Academy of Sciences (India)

    Molecule of the Month - Adamantane - A Plastic Piece of Diamond. J Chandrasekhar. Volume 16 Issue 12 ... Keywords. Adamantane; diamondoid systems; plastic crystals. ... Resonance – Journal of Science Education | News. © 2017 Indian ...

  4. Insight into the molecular mechanism of water evaporation via the finite temperature string method.

    Science.gov (United States)

    Musolino, Nicholas; Trout, Bernhardt L

    2013-04-07

    The process of water's evaporation at its liquid/air interface has proven challenging to study experimentally and, because it constitutes a rare event on molecular time scales, presents a challenge for computer simulations as well. In this work, we simulated water's evaporation using the classical extended simple point charge model water model, and identified a minimum free energy path for this process in terms of 10 descriptive order parameters. The measured free energy change was 7.4 kcal/mol at 298 K, in reasonable agreement with the experimental value of 6.3 kcal/mol, and the mean first-passage time was 1375 ns for a single molecule, corresponding to an evaporation coefficient of 0.25. In the observed minimum free energy process, the water molecule diffuses to the surface, and tends to rotate so that its dipole and one O-H bond are oriented outward as it crosses the Gibbs dividing surface. As the water molecule moves further outward through the interfacial region, its local density is higher than the time-averaged density, indicating a local solvation shell that protrudes from the interface. The water molecule loses donor and acceptor hydrogen bonds, and then, with its dipole nearly normal to the interface, stops donating its remaining hydrogen bond. At that point, when the final, accepted hydrogen bond is broken, the water molecule is free. We also analyzed which order parameters are most important in the process and in reactive trajectories, and found that the relative orientation of water molecules near the evaporating molecule, and the number of accepted hydrogen bonds, were important variables in reactive trajectories and in kinetic descriptions of the process.

  5. Theories of Sexual Orientation.

    Science.gov (United States)

    Storms, Michael D.

    1980-01-01

    Results indicated homosexuals, heterosexuals, and bisexuals did not differ within each sex on measures of masculinity and femininity. Strong support was obtained for the hypothesis that sexual orientation relates primarily to erotic fantasy orientation. (Author/DB)

  6. Phase changes induced by guest orientational ordering of filled ice Ih methane hydrate under high pressure and low temperature

    International Nuclear Information System (INIS)

    Hirai, H; Tanaka, T; Yagi, T; Matsuoka, T; Ohishi, Y; Ohtake, M; Yamamoto, Y

    2014-01-01

    Low-temperature and high-pressure experiments were performed with filled ice Ih structure of methane hydrate under pressure and temperature conditions of 2.0 to 77.0 GPa and 30 to 300 K, respectively, using diamond anvil cells and a helium-refrigeration cryostat. Distinct changes in the axial ratios of the host framework were revealed by In-situ X-ray diffractometry. Splitting in the CH vibration modes of the guest methane molecules, which was previously explained by the orientational ordering of the guest molecules, was observed by Raman spectroscopy. The pressure and temperature conditions at the split of the vibration modes agreed well with those of the axial ratio changes. The results indicated that orientational ordering of the guest methane molecules from orientational disordered-state occurred at high pressures and low temperatures, and that this guest ordering led to the axial ratio changes in the host framework. Existing regions of the guest disordered-phase and the guest ordered-phase were roughly estimated by the X-ray data. In addition, above the pressure of the guest-ordered phase, another high pressure phase was developed at a low-temperature region. The deuterated-water host samples were also examined and isotopic effects on the guest ordering and phase changes were observed.

  7. Free and binary rotation of polyatomic molecules

    International Nuclear Information System (INIS)

    Konyukhov, V K

    2003-01-01

    A modification of the quantum-mechanical theory of rotation of polyatomic molecules (binary rotation) is proposed, which is based on the algebra and representations of the SO(4) group and allows the introduction of the concept of parity, as in atomic spectroscopy. It is shown that, if an asymmetric top molecule performing binary rotation finds itself in a spatially inhomogeneous electric field, its rotational levels acquire the additional energy due to the quadrupole moment. The existence of the rotational states of polyatomic molecules that cannot transfer to the free rotation state is predicted. In particular, the spin isomers of a water molecule, which corresponds to such states, can have different absolute values of the adsorption energy due to the quadrupole interaction of the molecule with a surface. The difference in the adsorption energies allows one to explain qualitatively the behaviour of the ortho- and para-molecules of water upon their adsorption on the surface of solids in accordance with experimental data. (laser applications and other topics in quantum electronics)

  8. Water

    Science.gov (United States)

    ... drink and water in food (like fruits and vegetables). 6. Of all the earth’s water, how much is ocean or seas? 97 percent of the earth’s water is ocean or seas. 7. How much of the world’s water is frozen? Of all the water on earth, about 2 percent is frozen. 8. How much ...

  9. Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

    Science.gov (United States)

    Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

    2017-01-01

    Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

  10. Electron-molecule collisions

    International Nuclear Information System (INIS)

    Shimamura, I.; Takayanagi, K.

    1984-01-01

    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  11. Structural and dynamical properties of water confined between two hydrophilic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)

    2009-10-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  12. Structural and dynamical properties of water confined between two hydrophilic surfaces

    International Nuclear Information System (INIS)

    Di Napoli, Solange; Gamba, Zulema

    2009-01-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  13. Understanding political market orientation

    DEFF Research Database (Denmark)

    Ormrod, Robert P.; Henneberg, Stephan C.

    influences of such behavior. The study includes structural equation modeling to investigate several propositions. While the results show that political parties need to focus on several different aspects of market-oriented behavior, especially using an internal and external orientation as cultural antecedents......This article develops a conceptual framework and measurement model of political market orientation that consists of attitudinal and behavioural constructs. The article reports on perceived relationships among different behavioral aspects of political market orientation and the attitudinal......, a more surprising result is the inconclusive effect of a voter orientation on market-oriented behaviours. The article discusses the findings in the context of the existing literature in political marketing and commercial market orientation....

  14. MOLECULES IN η CARINAE

    International Nuclear Information System (INIS)

    Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.

    2012-01-01

    We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.

  15. Water

    International Nuclear Information System (INIS)

    Chovanec, A.; Grath, J.; Kralik, M.; Vogel, W.

    2002-01-01

    An up-date overview of the situation of the Austrian waters is given by analyzing the status of the water quality (groundwater, surface waters) and water protection measures. Maps containing information of nitrate and atrazine in groundwaters (analyses at monitoring stations), nitrate contents and biological water quality of running waters are included. Finally, pollutants (nitrate, orthophosphate, ammonium, nitrite, atrazine etc.) trends in annual mean values and median values for the whole country for the years 1992-1999 are presented in tables. Figs. 5. (nevyjel)

  16. Impacts of the dam-orientated water-sediment regulation scheme on the lower reaches and delta of the Yellow River (Huanghe): A review

    Science.gov (United States)

    Wang, Houjie; Wu, Xiao; Bi, Naishuang; Li, Song; Yuan, Ping; Wang, Aimei; Syvitski, James P. M.; Saito, Yoshiki; Yang, Zuosheng; Liu, Sumei; Nittrouer, Jeffrey

    2017-10-01

    The water-sediment regulation scheme (WSRS), beginning in 2002, is an unprecedented engineering effort to manage the Yellow River with the aims to mitigate the siltation both in the lower river channel and within the Xiaolangdi Reservoir utilizing the dam-regulated flood water. Ten years after its initial implementation, multi-disciplinary indicators allow us to offer a comprehensive review of this human intervention on a river-coastal system. The WSRS generally achieved its objective, including bed erosion in the lower reaches with increasing capacity for flood discharge and the mitigation of reservoir siltation. However, the WSRS presented unexpected disturbances on the delta and coastal system. Increasing grain size of suspended sediment and decreasing suspended sediment concentration at the river mouth resulted in a regime shift of sediment transport patterns that enhanced the disequilibrium of the delta. The WSRS induced an impulse delivery of nutrients and pollutants within a short period ( 20 days), which together with the altered hydrological cycle, impacted the estuarine and coastal ecosystem. We expect that the sediment yield from the loess region in the future will decrease due to soil-conservation practices, and the lower channel erosion will also decrease as the riverbed armors with coarser sediment. These, in combination with uncertain water discharge concomitant with climate change, increasing water demands and delta subsidence, will put the delta and coastal ocean at high environmental risks. In the context of global change, this work depicts a scenario of human impacts in the river basin that were transferred along the hydrological pathway to the coastal system and remotely transformed the different components of coastal environment. The synthesis review of the WSRS indicates that an integrated management of the river-coast continuum is crucially important for the sustainability of the entire river-delta system. The lessons learned from the WSRS in

  17. Study of a magnetically oriented lyotropic mesophase

    International Nuclear Information System (INIS)

    Amaral, L.Q.; Pimentel, C.A.; Tavares, M.R.; Vanin, J.A.

    A study of a magnetically oriented lyomesophase formed by a quaternary system (Na decyl sulfate/water/decanol/ Na sulfate) is reported. Small angle X-ray diffraction measurements have been performed on unoriented samples and samples previously subjected to the action of magnetic fields (H vector). A model of finite planar micelles surrounded by water is proposed [pt

  18. Solvation structures of lithium halides in methanol–water mixtures

    International Nuclear Information System (INIS)

    Sarkar, Atanu; Dixit, Mayank Kumar; Tembe, B.L.

    2015-01-01

    Highlights: • Potentials of mean force for Li + -halides are calculated in methanol–water mixtures. • Stable CIP for x methanol = 1.0 becomes unstable at and below x methanol = 0.75. • The Li + ion is preferentially solvated by methanol molecules. • The halide ions are preferentially solvated by water molecules. - Abstract: The potentials of mean force (PMFs) for the ion pairs, Li + −Cl − , Li + −Br − and Li + −I − have been calculated in five methanol–water compositions. The results obtained are verified by trailing the trajectories and calculating the ion pair distance residence times. Local structures around the ions are studied using the radial distribution functions, density profiles, orientational correlation functions, running coordination numbers and excess coordination numbers. The major change in PMF is observed as the methanol mole fraction (x methanol ) is changed from 1.0 to 0.75. The stable contact ion pair occurring for x methanol = 1.0 becomes unstable at and below x methanol = 0.75. The preferential solvation data show that the halide ions are always preferentially solvated by water molecules. Although the lithium ion is preferentially solvated by methanol molecules, there is significant affinity towards water molecules as well

  19. Fabrication of Supramolecular Chirality from Achiral Molecules at the Liquid/Liquid Interface Studied by Second Harmonic Generation.

    Science.gov (United States)

    Lin, Lu; Zhang, Zhen; Guo, Yuan; Liu, Minghua

    2018-01-09

    We present the investigation into the supramolecular chirality of 5-octadecyloxy-2-(2-pyridylazo)phenol (PARC18) at water/1,2-dichloroethane interface by second harmonic generation (SHG). We observe that PARC18 molecules form supramolecular chirality through self-assembly at the liquid/liquid interface although they are achiral molecules. The bulk concentration of PARC18 in the organic phase has profound effects on the supramolecular chirality. By increasing bulk concentration, the enantiomeric excess at the interface first grows and then decreases until it eventually vanishes. Further analysis reveals that the enantiomeric excess is determined by the twist angle of PARC18 molecules at the interface rather than their orientational angle. At lower and higher bulk concentrations, the average twist angle of PARC18 molecules approaches zero, and the assemblies are achiral; whereas at medium bulk concentrations, the average twist angle is nonzero, so that the assemblies show supramolecular chirality. We also estimate the coverage of PARC18 molecules at the interface versus the bulk concentration and fit it to Langmuir adsorption model. The result indicates that PARC18 assemblies show strongest supramolecular chirality in a half-full monolayer. These findings highlight the opportunities for precise control of supramolecular chirality at liquid/liquid interfaces by manipulating the bulk concentration.

  20. Electron Accumulative Molecules.

    Science.gov (United States)

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc

    2018-02-28

    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  1. Water

    Science.gov (United States)

    ... can be found in some metal water taps, interior water pipes, or pipes connecting a house to ... reduce or eliminate lead. See resources below. 5. Children and pregnant women are especially vulnerable to the ...

  2. Single molecule microscopy and spectroscopy: concluding remarks.

    Science.gov (United States)

    van Hulst, Niek F

    2015-01-01

    Chemistry is all about molecules: control, synthesis, interaction and reaction of molecules. All too easily on a blackboard, one draws molecules, their structures and dynamics, to create an insightful picture. The dream is to see these molecules in reality. This is exactly what "Single Molecule Detection" provides: a look at molecules in action at ambient conditions; a breakthrough technology in chemistry, physics and biology. Within the realms of the Royal Society of Chemistry, the Faraday Discussion on "Single Molecule Microscopy and Spectroscopy" was a very appropriate topic for presentation, deliberation and debate. Undoubtedly, the Faraday Discussions have a splendid reputation in stimulating scientific debates along the traditions set by Michael Faraday. Interestingly, back in the 1830's, Faraday himself pursued an experiment that led to the idea that atoms in a compound were joined by an electrical component. He placed two opposite electrodes in a solution of water containing a dissolved compound, and observed that one of the elements of the compound accumulated on one electrode, while the other was deposited on the opposite electrode. Although Faraday was deeply opposed to atomism, he had to recognize that electrical forces were responsible for the joining of atoms. Probably a direct view on the atoms or molecules in his experiment would have convinced him. As such, Michael Faraday might have liked the gathering at Burlington House in September 2015 (). Surely, with the questioning eyes of his bust on the 1st floor corridor, the non-believer Michael Faraday has incited each passer-by to enter into discussion and search for deeper answers at the level of single molecules. In these concluding remarks, highlights of the presented papers and discussions are summarized, complemented by a conclusion on future perspectives.

  3. Wetting of doped carbon nanotubes by water droplets

    DEFF Research Database (Denmark)

    Kotsalis, E. M.; Demosthenous, E.; Walther, Jens Honore

    2005-01-01

    We study the wetting of doped single- and multi-walled carbon nanotubes by water droplets using molecular dynamics simulations. Chemisorbed hydrogen is considered as a model of surface impurities. We study systems with varying densities of surface impurities and we observe increased wetting......, as compared to the pristine nanotube case, attributed to the surface dipole moment that changes the orientation of the interfacial water. We demonstrate that the nature of the impurity is important as here hydrogen induces the formation of an extended hydrogen bond network between the water molecules...

  4. Reduced Solubility of Polymer-Oriented Water for Sodium Salts, Sugars, Amino Acids, and other Solutes Normally Maintained at Low Levels in Living Cells,

    Science.gov (United States)

    1983-01-01

    following were obtained: gum arabic (64C-0252; gum ghatti (42C-2380; gum guar (32C1930); gum Karaya (103C-0720); gum locust bean (42C-2900); gum ...plotted against time of incubation. In the efflux method, usually the dry polymer powder was dissolved 22 + 35 in water containing the radioactive label...tragacanth (74C-0207); and gum xantham (888-0200); corn starch (6813-0216); potato starch (65B-2060); pectin (107B-0090); alginic acid (766-818); also

  5. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 2. Molecule of the Month Isomers of Benzene - Still Pursuing Dreams. J Chandrasekhar. Feature Article Volume 1 Issue 2 February 1996 pp 80-83. Fulltext. Click here to view fulltext PDF. Permanent link:

  6. Electrons in Molecules

    Indian Academy of Sciences (India)

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  7. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule of the Month - A Stable Dibismuthene - A Compound with a Bi-Bi Double Bond. V Chandrasekhar. Volume 16 ... Author Affiliations. V Chandrasekhar1. Department of Chemistry, Indian Institute of Technology, Kanpur 208 016, India.

  8. OMG: Open molecule generator

    NARCIS (Netherlands)

    Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.

    2012-01-01

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical

  9. Molecule-based magnets

    Indian Academy of Sciences (India)

    Administrator

    Employing self-assembly methods, it is possible to engineer a bulk molecular material ... synthesis of molecular magnets in 1986, a large variety of them have been synthesized, which can be catego- ... maintained stably per organic molecule, stabilization of a ..... rotating freely under an applied field because it is a magne-.

  10. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 5. Molecule of the Month Molecular–Chameleon: Solvatochromism at its Iridescent Best! Photon Rao. Feature Article Volume 2 Issue 5 May 1997 pp 69-72. Fulltext. Click here to view fulltext PDF. Permanent link:

  11. The roles of bulk and interfacial molecular orientations in determining the performance of organic bilayer solar cells

    KAUST Repository

    Ngongang Ndjawa, Guy O.

    2014-09-09

    Molecular orientation plays a significant role in determining the performance of small molecule solar cells. Key photovoltaic processes in these cells are strongly dependent on how the molecules are oriented in the active layer. We isolate contributions arising from the bulk molecular orientations vs. those from interfacial orientations in ZnPc/C60 bilayer systems and we probe these contributions by comparing device pairs in which only the bulk or the interface differ. By controlling the orientation in the bulk the current can be strongly modulated, whereas controlling the interfacial molecular orientation and degree of intermixing mediate the voltage.

  12. The roles of bulk and interfacial molecular orientations in determining the performance of organic bilayer solar cells

    KAUST Repository

    Ngongang Ndjawa, Guy O.; Graham, Kenneth R.; Conron, Sarah; Erwin, Patrick; Li, Ruipeng; Chou, Kang Wei; Burkhard, George; Krishnan Jagadamma, Lethy; Hoke, Eric T.; McGehee, Michael D.; Thompson, Mark E.; Amassian, Aram

    2014-01-01

    Molecular orientation plays a significant role in determining the performance of small molecule solar cells. Key photovoltaic processes in these cells are strongly dependent on how the molecules are oriented in the active layer. We isolate contributions arising from the bulk molecular orientations vs. those from interfacial orientations in ZnPc/C60 bilayer systems and we probe these contributions by comparing device pairs in which only the bulk or the interface differ. By controlling the orientation in the bulk the current can be strongly modulated, whereas controlling the interfacial molecular orientation and degree of intermixing mediate the voltage.

  13. Exotic helium molecules

    International Nuclear Information System (INIS)

    Portier, M.

    2007-12-01

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  14. OMG: Open Molecule Generator.

    Science.gov (United States)

    Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas

    2012-09-17

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  15. OMG: Open Molecule Generator

    Directory of Open Access Journals (Sweden)

    Peironcely Julio E

    2012-09-01

    Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  16. Density functional theory studies on the solvent effects in Al(H2O)63+ water-exchange reactions: the number and arrangement of outer-sphere water molecules.

    Science.gov (United States)

    Liu, Li; Zhang, Jing; Dong, Shaonan; Zhang, Fuping; Wang, Ye; Bi, Shuping

    2018-03-07

    Density functional theory (DFT) calculations combined with cluster models are performed at the B3LYP/6-311+G(d,p) level for investigating the solvent effects in Al(H 2 O) 6 3+ water-exchange reactions. A "One-by-one" method is proposed to obtain the most representative number and arrangement of explicit H 2 Os in the second hydration sphere. First, all the possible ways to locate one explicit H 2 O in second sphere (N m ' = 1) based on the gas phase structure (N m ' = 0) are examined, and the optimal pathway (with the lowest energy barrier) for N m ' = 1 is determined. Next, more explicit H 2 Os are added one by one until the inner-sphere is fully hydrogen bonded. Finally, the optimal pathways with N m ' = 0-7 are obtained. The structural and energetic parameters as well as the lifetimes of the transition states are compared with the results obtained with the "Independent-minimum" method and the "Independent-average" method, and all three methods show that the pathway with N m ' = 6 may be representative. Our results give a new idea for finding the representative pathway for water-exchange reactions in other hydrated metal ion systems.

  17. Structure factors for tunneling ionization rates of molecules

    DEFF Research Database (Denmark)

    Madsen, L.B.; Jensen, F.; Tolstikhin, O.I.

    2013-01-01

    Within the weak-field asymptotic theory, the dependence of the tunneling ionization rate of a molecule in a static electric field on its orientation with respect to the field is determined by the structure factor for the highest occupied molecular orbital (HOMO). An accurate determination...

  18. Entrepreneurial Orientation and Internationalisation

    DEFF Research Database (Denmark)

    Decker, Arnim; Rollnik-Sadowska, Ewa; Servais, Per

    Entrepreneurial orientation is a multidimensional construct that determines the strategic posture of a firm. In this study we investigate a sample of six manufacturing firms which are located both in a remote area and in a transition economy. Through interpreting the construct of entrepreneurial...... orientation as an attitude held by principals we investigate how entrepreneurial orientation affected the behaviour of these firms, specifically in terms of their internationalisation. Despite the fact that all firms have identical roots we find that entrepreneurial orientation held by their principals affect...

  19. Observing single molecule chemical reactions on metal nanoparticles.

    Energy Technology Data Exchange (ETDEWEB)

    Emory, S. R. (Steven R.); Ambrose, W. Patrick; Goodwin, P. M. (Peter M); Keller, Richard A.

    2001-01-01

    We report the study of the photodecomposition of single Rhodamine 6G (R6G) dye molecules adsorbed on silver nanoparticles. The nanoparticles were immobilized and spatially isolated on polylysine-derivatized glass coverslips, and confocal laser microspectroscopy was used to obtain surface-enhanced Raman scattering (SERS) spectra from individual R6G molecules. The photodecomposition of these molecules was observed with 150-ms temporal resolution. The photoproduct was identified as graphitic carbon based on the appearance of broad SERS vibrational bands at 1592 cm{sup -1} and 1340 cm{sup -1} observed in both bulk and averaged single-molecule photoproduct spectra. In contrast, when observed at the single-molecule level, the photoproduct yielded sharp SERS spectra. The inhomogeneous broadening of the bulk SERS spectra is due to a variety of photoproducts in different surface orientations and is a characteristic of ensemble-averaged measurements of disordered systems. These single-molecule studies indicate a photodecomposition pathway by which the R6G molecule desorbs from the metal surface, an excited-state photoreaction occurs, and the R6G photoproduct(s) readsorbs to the surface. A SERS spectrum is obtained when either the intact R6G or the R6G photoproduct(s) are adsorbed on a SERS-active site. This work further illustrates the power of single-molecule spectroscopy (SMS) to reveal unique behaviors of single molecules that are not discernable with bulk measurements.

  20. Sol-gel method for encapsulating molecules

    Science.gov (United States)

    Brinker, C. Jeffrey; Ashley, Carol S.; Bhatia, Rimple; Singh, Anup K.

    2002-01-01

    A method for encapsulating organic molecules, and in particular, biomolecules using sol-gel chemistry. A silica sol is prepared from an aqueous alkali metal silicate solution, such as a mixture of silicon dioxide and sodium or potassium oxide in water. The pH is adjusted to a suitably low value to stabilize the sol by minimizing the rate of siloxane condensation, thereby allowing storage stability of the sol prior to gelation. The organic molecules, generally in solution, is then added with the organic molecules being encapsulated in the sol matrix. After aging, either a thin film can be prepared or a gel can be formed with the encapsulated molecules. Depending upon the acid used, pH, and other processing conditions, the gelation time can be from one minute up to several days. In the method of the present invention, no alcohols are generated as by-products during the sol-gel and encapsulation steps. The organic molecules can be added at any desired pH value, where the pH value is generally chosen to achieve the desired reactivity of the organic molecules. The method of the present invention thereby presents a sufficiently mild encapsulation method to retain a significant portion of the activity of the biomolecules, compared with the activity of the biomolecules in free solution.

  1. Cold guided beams of polar molecules

    International Nuclear Information System (INIS)

    Motsch, Michael

    2010-01-01

    This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion

  2. Field-free molecular orientation of nonadiabatically aligned OCS

    Science.gov (United States)

    Sonoda, Kotaro; Iwasaki, Atsushi; Yamanouchi, Kaoru; Hasegawa, Hirokazu

    2018-02-01

    We investigate an enhancement of the orientation of OCS molecules by irradiating them with a near IR (ω) ultrashort laser pulse for alignment followed by another ultrashort laser pulse for orientation, which is synthesized by a phase-locked coherent superposition of the near IR laser pulse and its second harmonic (2ω). On the basis of the asymmetry in the ejection direction of S3+ fragment ions generated by the Coulomb explosion of multiply charged OCS, we show that the extent of the orientation of OCS is significantly enhanced when the delay between the alignment pulse and the orientation pulse is a quarter or three quarters of the rotational period. The recorded enhanced orientation was interpreted well by a numerical simulation of the temporal evolution of a rotational wave packet prepared by the alignment and orientation pulses.

  3. Hydride Molecules towards Nearby Galaxies

    Science.gov (United States)

    Monje, Raquel R.; La, Ngoc; Goldsmith, Paul

    2018-06-01

    Observations carried out by the Herschel Space Observatory revealed strong spectroscopic signatures from light hydride molecules within the Milky Way and nearby active galaxies. To better understand the chemical and physical conditions of the interstellar medium, we conducted the first comprehensive survey of hydrogen fluoride (HF) and water molecular lines observed through the SPIRE Fourier Transform Spectrometer. By collecting and analyzing the sub-millimeter spectra of over two hundred sources, we found that the HF J = 1 - 0 rotational transition which occurs at approximately 1232 GHz was detected in a total of 39 nearby galaxies both in absorption and emission. The analysis will determine the main excitation mechanism of HF in nearby galaxies and provide steady templates of the chemistry and physical conditions of the ISM to be used in the early universe, where observations of hydrides are more scarce.

  4. Single-Molecule Nanomagnets

    Science.gov (United States)

    Friedman, Jonathan R.; Sarachik, Myriam P.

    2010-04-01

    Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

  5. Superexcited states of molecules

    International Nuclear Information System (INIS)

    Nakamura, Hiroki; Takagi, Hidekazu.

    1990-01-01

    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  6. An Observation Task Chain Representation Model for Disaster Process-Oriented Remote Sensing Satellite Sensor Planning: A Flood Water Monitoring Application

    Directory of Open Access Journals (Sweden)

    Chao Yang

    2018-03-01

    Full Text Available An accurate and comprehensive representation of an observation task is a prerequisite in disaster monitoring to achieve reliable sensor observation planning. However, the extant disaster event or task information models do not fully satisfy the observation requirements for the accurate and efficient planning of remote-sensing satellite sensors. By considering the modeling requirements for a disaster observation task, we propose an observation task chain (OTChain representation model that includes four basic OTChain segments and eight-tuple observation task metadata description structures. A prototype system, namely OTChainManager, is implemented to provide functions for modeling, managing, querying, and visualizing observation tasks. In the case of flood water monitoring, we use a flood remote-sensing satellite sensor observation task for the experiment. The results show that the proposed OTChain representation model can be used in modeling process-owned flood disaster observation tasks. By querying and visualizing the flood observation task instances in the Jinsha River Basin, the proposed model can effectively express observation task processes, represent personalized observation constraints, and plan global remote-sensing satellite sensor observations. Compared with typical observation task information models or engines, the proposed OTChain representation model satisfies the information demands of the OTChain and its processes as well as impels the development of a long time-series sensor observation scheme.

  7. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  8. Photonic Molecule Lasers Revisited

    Science.gov (United States)

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

    2014-05-01

    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  9. Interstellar molecules and masers

    International Nuclear Information System (INIS)

    Nguyen-Q-Rieu; Guibert, J.

    1978-01-01

    The study of dense and dark clouds, in which hydrogen is mostly in molecular form, became possible since the discovery of interstellar molecules, emitting in the centimeter and millimeter wavelengths. The molecular lines are generally not in local thermal equilibrium (LTE). Their intensity can often be explained by invoking a population inversion mechanism. Maser emission lines due to OH, H 2 O and SiO molecules are among the most intense molecular lines. The H 2 CO molecule, detected in absorption in front of the cold cosmic background radiation of 2.7 K, illustrates the inverse phenomenon, the antimaser absorption. For a radio transition of frequency v, the inversion rate Δn (relative population difference between the upper and lower level) as well as the maser gain can be determined from the radio observations. In the case of the OH lines in the 2 PIsub(3/2), J=3/2 state, the inversion rates approximately 1 to 2% derived from the observations, are comparable with those obtained in the laboratory. The determination of the excitation mechanisms of the masers, through the statistical equilibrium and radiative transfer equations, implies the knowledge of collisional and radiative transition probabilities. A pumping model, which can satisfactorily explain the radio observations of some interstellar OH clouds, will be discussed [fr

  10. Water

    CSIR Research Space (South Africa)

    Van Wyk, Llewellyn V

    2010-08-01

    Full Text Available Water scarcity is without a doubt on of the greatest threats to the human species and has all the potential to destabilise world peace. Falling water tables are a new phenomenon. Up until the development of steam and electric motors, deep groudwater...

  11. Water

    OpenAIRE

    Hertie School of Governance

    2010-01-01

    All human life depends on water and air. The sustainable management of both is a major challenge for today's public policy makers. This issue of Schlossplatz³ taps the streams and flows of the current debate on the right water governance.

  12. Wildlife value orientations

    DEFF Research Database (Denmark)

    Gamborg, Christian; Jensen, Frank Søndergaard

    2016-01-01

    This article examined value orientations toward wildlife among the adult general Danish public in relation to age, sex, past and present residence, education, and income, using a U.S. survey instrument on Wildlife Value Orientations (WVO). The study used an Internet-based questionnaire sent...

  13. Edward Said and "Orientalism"

    Science.gov (United States)

    Chronicle of Higher Education, 2007

    2007-01-01

    In the nearly 30 years since Edward Said published the hugely influential Orientalism, his indictment of racism and imperialism in Western scholarship on the Orient has had its share of plaudits and condemnations. Now Robert Irwin, the Middle East editor of The Times Literary Supplement, has reignited the controversy with his broadside against the…

  14. Orientalism/Occidentalism

    NARCIS (Netherlands)

    Minca, C.; Ong, C.E.

    2017-01-01

    Orientalism and Occidentalism are interrelated concepts. Orientalism is defined in three keys ways: (i) as a study of “the Orient”; (ii) as a cultural and aesthetic concern with “the Orient”; and (iii) as a critical approach to understanding the construction of “the Orient” by European and American

  15. Aspect-Oriented Programming

    NARCIS (Netherlands)

    Bergmans, Lodewijk; Videira Lopes, Cristina; Moreira, Ana; Demeyer, Serge

    1999-01-01

    Aspect-oriented programming is a promising idea that can improve the quality of software by reduce the problem of code tangling and improving the separation of concerns. At ECOOP'97, the first AOP workshop brought together a number of researchers interested in aspect-orientation. At ECOOP'98, during

  16. Object oriented programming

    International Nuclear Information System (INIS)

    Kunz, P.F.

    1990-01-01

    This paper is an introduction to object oriented programming techniques. It tries to explain the concepts by using analogies with traditional programming. The object oriented approach not inherently difficult, but most programmers find a relatively high threshold in learning it. Thus, this paper will attempt to convey the concepts with examples rather than explain the formal theory

  17. Development of non-bonded interaction parameters between graphene and water using particle swarm optimization.

    Science.gov (United States)

    Bejagam, Karteek K; Singh, Samrendra; Deshmukh, Sanket A

    2018-05-05

    New Lennard-Jones parameters have been developed to describe the interactions between atomistic model of graphene, represented by REBO potential, and five commonly used all-atom water models, namely SPC, SPC/E, SPC/Fw, SPC/Fd, and TIP3P/Fs by employing particle swarm optimization (PSO) method. These new parameters were optimized to reproduce the macroscopic contact angle of water on a graphene sheet. The calculated line tension was in the order of 10 -11 J/m for the droplets of all water models. Our molecular dynamics simulations indicate the preferential orientation of water molecules near graphene-water interface with one OH bond pointing toward the graphene surface. Detailed analysis of simulation trajectories reveals the presence of water molecules with ≤∼1, ∼2, and ∼4 hydrogen bonds at the surface of air-water interface, graphene-water interface, and bulk region of the water droplet, respectively. Presence of water molecules with ≤∼1 and ∼2 hydrogen bonds suggest the existence of water clusters of different sizes at these interfaces. The trends observed in the libration, bending, and stretching bands of the vibrational spectra are closely associated with these structural features of water. The inhomogeneity in hydrogen bond network of water at the air-water and graphene-water interface is manifested by broadening of the peaks in the libration band for water present at these interfaces. The stretching band for the molecules in water droplet shows a blue shift as compared to the pure bulk water, which conjecture the presence of weaker hydrogen bond network in a droplet. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  18. Structure of the floating water bridge and water in an electric field.

    Science.gov (United States)

    Skinner, Lawrie B; Benmore, Chris J; Shyam, Badri; Weber, J K R; Parise, John B

    2012-10-09

    The floating water bridge phenomenon is a freestanding rope-shaped connection of pure liquid water, formed under the influence of a high potential difference (approximately 15 kV). Several recent spectroscopic, optical, and neutron scattering studies have suggested that the origin of the bridge is associated with the formation of anisotropic chains of water molecules in the liquid. In this work, high energy X-ray diffraction experiments have been performed on a series of floating water bridges as a function of applied voltage, bridge length, and position within the bridge. The two-dimensional X-ray scattering data showed no direction-dependence, indicating that the bulk water molecules do not exhibit any significant preferred orientation along the electric field. The only structural changes observed were those due to heating, and these effects were found to be the same as for bulk water. These X-ray scattering measurements are supported by molecular dynamics (MD) simulations which were performed under electric fields of 10(6) V/m and 10(9) V/m. Directional structure factor calculations were made from these simulations parallel and perpendicular to the E-field. The 10(6) V/m model showed no significant directional-dependence (anisotropy) in the structure factors. The 10(9) V/m model however, contained molecules aligned by the E-field, and had significant structural anisotropy.

  19. Localization and Orientation of Xanthophylls in a Lipid Bilayer

    OpenAIRE

    Grudzinski, Wojciech; Nierzwicki, Lukasz; Welc, Renata; Reszczynska, Emilia; Luchowski, Rafal; Czub, Jacek; Gruszecki, Wieslaw I.

    2017-01-01

    Xanthophylls (polar carotenoids) play diverse biological roles, among which are modulation of the physical properties of lipid membranes and protection of biomembranes against oxidative damage. Molecular mechanisms underlying these functions are intimately related to the localization and orientation of xanthophyll molecules in lipid membranes. In the present work, we address the problem of localization and orientation of two xanthophylls present in the photosynthetic apparatus of plants and i...

  20. Effect of simple solutes on the long range dipolar correlations in liquid water

    Energy Technology Data Exchange (ETDEWEB)

    Baul, Upayan, E-mail: upayanb@imsc.res.in; Anishetty, Ramesh, E-mail: ramesha@imsc.res.in; Vemparala, Satyavani, E-mail: vani@imsc.res.in [The Institute of Mathematical Sciences, C.I.T. Campus, Taramani, Chennai 600113 (India); Kanth, J. Maruthi Pradeep, E-mail: jmpkanth@gmail.com [Vectra LLC, Mount Road, Chennai 600006 (India)

    2016-03-14

    Intermolecular correlations in liquid water at ambient conditions have generally been characterized through short range density fluctuations described through the atomic pair distribution functions. Recent numerical and experimental results have suggested that such a description of order or structure in liquid water is incomplete and there exist considerably longer ranged orientational correlations in water that can be studied through dipolar correlations. In this study, using large scale classical, atomistic molecular dynamics simulations using TIP4P-Ew and TIP3P models of water, we show that salts such as sodium chloride (NaCl), potassium chloride (KCl), caesium chloride (CsCl), and magnesium chloride (MgCl{sub 2}) have a long range effect on the dipolar correlations, which cannot be explained by the notion of structure making and breaking by dissolved ions. Observed effects are explained through orientational stratification of water molecules around ions and their long range coupling to the global hydrogen bond network by virtue of the sum rule for water. The observations for single hydrophilic solutes are contrasted with the same for a single methane (CH{sub 4}) molecule. We observe that even a single small hydrophobe can result in enhancement of long range orientational correlations in liquid water, contrary to the case of dissolved ions, which have been observed to have a reducing effect. The observations from this study are discussed in the context of hydrophobic effect.

  1. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  2. Water

    Directory of Open Access Journals (Sweden)

    E. Sanmuga Priya

    2017-05-01

    Full Text Available Phytoremediation through aquatic macrophytes treatment system (AMATS for the removal of pollutants and contaminants from various natural sources is a well established environmental protection technique. Water hyacinth (Eichhornia crassipes, a worst invasive aquatic weed has been utilised for various research activities over the last few decades. The biosorption capacity of the water hyacinth in minimising various contaminants present in the industrial wastewater is well studied. The present review quotes the literatures related to the biosorption capacity of the water hyacinth in reducing the concentration of dyestuffs, heavy metals and minimising certain other physiochemical parameters like TSS (total suspended solids, TDS (total dissolved solids, COD (chemical oxygen demand and BOD (biological oxygen demand in textile wastewater. Sorption kinetics through various models, factors influencing the biosorption capacity, and role of physical and chemical modifications in the water hyacinth are also discussed.

  3. Quark chemistry: charmonium molecules

    International Nuclear Information System (INIS)

    De Rujula, A.; Jaffe, R.L.

    1977-01-01

    The theoretical and experimental evidence for two quark-two antiquark hadrons is reviewed. Concentration is placed on predictions for S-wave ''charmonium molecules,'' built of a c anti c charmonium pair and a light quark-antiquark pair. Their spectrum and quantum numbers are predicted and an estimate of their decay couplings and their prediction in monochromatic pion decays from charmonium resonances produced in e + e - -annihilation is given. Some S-wave charmonium resonances should be detectable in these decays, but typical branching ratios are only at the 1% level. 19 references

  4. Ultra-cold molecule production

    International Nuclear Information System (INIS)

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

    2005-01-01

    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  5. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  6. Manipulating ultracold polar molecules with microwave radiation: The influence of hyperfine structure

    International Nuclear Information System (INIS)

    Aldegunde, J.; Hutson, Jeremy M.; Ran Hong

    2009-01-01

    We calculate the microwave spectra of ultracold 40 K 87 Rb alkali-metal dimers, including hyperfine interactions and in the presence of electric and magnetic fields. We show that microwave transitions may be used to transfer molecules between different hyperfine states, but only because of the presence of nuclear quadrupole interactions. Hyperfine splittings may also complicate the use of ultracold molecules for quantum computing. The spectrum of molecules oriented in electric fields may be simplified dramatically by applying a simultaneous magnetic field.

  7. Photoexcitation circular dichroism in chiral molecules

    Science.gov (United States)

    Beaulieu, S.; Comby, A.; Descamps, D.; Fabre, B.; Garcia, G. A.; Géneaux, R.; Harvey, A. G.; Légaré, F.; Mašín, Z.; Nahon, L.; Ordonez, A. F.; Petit, S.; Pons, B.; Mairesse, Y.; Smirnova, O.; Blanchet, V.

    2018-05-01

    Chiral effects appear in a wide variety of natural phenomena and are of fundamental importance in science, from particle physics to metamaterials. The standard technique of chiral discrimination—photoabsorption circular dichroism—relies on the magnetic properties of a chiral medium and yields an extremely weak chiral response. Here, we propose and demonstrate an orders of magnitude more sensitive type of circular dichroism in neutral molecules: photoexcitation circular dichroism. This technique does not rely on weak magnetic effects, but takes advantage of the coherent helical motion of bound electrons excited by ultrashort circularly polarized light. It results in an ultrafast chiral response and the efficient excitation of a macroscopic chiral density in an initially isotropic ensemble of randomly oriented chiral molecules. We probe this excitation using linearly polarized laser pulses, without the aid of further chiral interactions. Our time-resolved study of vibronic chiral dynamics opens a way to the efficient initiation, control and monitoring of chiral chemical change in neutral molecules at the level of electrons.

  8. Extending Single-Molecule Microscopy Using Optical Fourier Processing

    Science.gov (United States)

    2015-01-01

    This article surveys the recent application of optical Fourier processing to the long-established but still expanding field of single-molecule imaging and microscopy. A variety of single-molecule studies can benefit from the additional image information that can be obtained by modulating the Fourier, or pupil, plane of a widefield microscope. After briefly reviewing several current applications, we present a comprehensive and computationally efficient theoretical model for simulating single-molecule fluorescence as it propagates through an imaging system. Furthermore, we describe how phase/amplitude-modulating optics inserted in the imaging pathway may be modeled, especially at the Fourier plane. Finally, we discuss selected recent applications of Fourier processing methods to measure the orientation, depth, and rotational mobility of single fluorescent molecules. PMID:24745862

  9. Implementing Strategic Orientation

    Science.gov (United States)

    Fischer, Arthur K.; Brownback, Sarah

    2012-01-01

    An HRM case dealing with problems and issues of setting up orientation programs which align with corporate strategy. Discussion concerns how such a case can be used to exhibit the alignment between HRM and business strategy.

  10. How do glycerol and dimethyl sulphoxide affect local tetrahedral structure of water around a nonpolar solute at low temperature? Importance of preferential interaction

    Science.gov (United States)

    Daschakraborty, Snehasis

    2018-04-01

    Glycerol and dimethyl sulphoxide (DMSO) have vital roles in cryoprotection of living cells, tissues, etc. The above action has been directly linked with disruption of hydrogen (H-) bond structure and dynamics of water by these cosolvents at bulk region and around various complex units, such as peptide, amino acid, protein, and lipid membrane. However, the disruption of the local structure of the water solvent around a purely hydrophobic solute is still not studied extensively. The latter is also important in the context of stabilization of protein from cold denaturation. Through all-atom molecular dynamics simulation, we have investigated the comparative effect of glycerol and DMSO on the orientational order of water around a nonpolar solute at -5 °C. A steady reduction of the tetrahedral order of water is observed at bulk (>10 Å distance from the solute) and solute interface (structure of the interfacial water more than that of the bulk water, glycerol affects the water structure almost uniformly at all regions around the solute. Furthermore, while glycerol helps to retain water molecules at the interface, DMSO significantly reduces the water content in that region. We have put forward a plausible mechanism for these contrasting roles of these cosolvents. The solute-cosolvent hydrophobic-interaction-induced orientational alignment of an interfacial cosolvent molecule determines whether the involvement of the cosolvent molecules in H-bonding with solvent water in the interface is akin to the bulk region or not.

  11. Solvation in supercritical water

    International Nuclear Information System (INIS)

    Cochran, H.D.; Cummings, P.T.; Karaborni, S.

    1991-01-01

    The aim of this work is to determine the solvation structure in supercritical water composed with that in ambient water and in simple supercritical solvents. Molecular dynamics studies have been undertaken of systems that model ionic sodium and chloride, atomic argon, and molecular methanol in supercritical aqueous solutions using the simple point charge model of Berendsen for water. Because of the strong interactions between water and ions, ionic solutes are strongly attractive in supercritical water, forming large clusters of water molecules around each ion. Methanol is found to be a weakly-attractive solute in supercritical water. The cluster of excess water molecules surrounding a dissolved ion or polar molecule in supercritical aqueous solutions is comparable to the solvent clusters surrounding attractive solutes in simple supercritical fluids. Likewise, the deficit of water molecules surrounding a dissolved argon atom in supercritical aqueous solutions is comparable to that surrounding repulsive solutes in simple supercritical fluids. The number of hydrogen bonds per water molecule in supercritical water was found to be about one third the number in ambient water. The number of hydrogen bonds per water molecule surrounding a central particle in supercritical water was only mildly affected by the identify of the central particle--atom, molecule, or ion. These results should be helpful in developing a qualitative understanding of important processes that occur in supercritical water. 29 refs., 6 figs

  12. Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.

    Science.gov (United States)

    Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

    2018-04-19

    Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

  13. Lanthanide single molecule magnets

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jinkui; Zhang, Peng [Chinese Academy of Sciences, Changchun (China). Changchun Inst. of Applied Chemistry

    2015-10-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures - an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and explore new directions.

  14. Lanthanide single molecule magnets

    CERN Document Server

    Tang, Jinkui

    2015-01-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs, and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures – an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and...

  15. Molecules in the Spotlight

    Energy Technology Data Exchange (ETDEWEB)

    Cryan, James

    2010-01-26

    SLAC has just unveiled the world's first X-ray laser, the LCLS. This machine produces pulses of X-rays that are ten billion times brighter than those from conventional sources. One of the goals of this machine is to make movies of chemical reactions, including reactions necessary for life and reactions that might power new energy technologies. This public lecture will show the first results from the LCLS. As a first target, we have chosen nitrogen gas, the main component of the air we breathe. Using the unprecedented power of the LCLS X-rays as a blasting torch, we have created new forms of this molecule and with unique electronic arrangements. Please share with us the first insights from this new technology.

  16. Magnetic field modification of ultracold molecule-molecule collisions

    International Nuclear Information System (INIS)

    Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

    2009-01-01

    We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

  17. Determination of collagen fibril structure and orientation in connective tissues by X-ray diffraction

    Science.gov (United States)

    Wilkinson, S. J.; Hukins, D. W. L.

    1999-08-01

    Elastic scattering of X-rays can provide the following information on the fibrous protein collagen: its molecular structure, the axial arrangement of rod-like collagen molecules in a fibril, the lateral arrangement of molecules within a fibril, and the orientation of fibrils within a biological tissue. The first part of the paper reviews the principles involved in deducing this information. The second part describes a new computer program for measuring the equatorial intensity distribution, that provides information on the lateral arrangement of molecules within a fibril, and the angular distribution of the equatorial peaks that provides information on the orientation of fibrils. Orientation of fibrils within a tissue is quantified by the orientation distribution function, g( φ), which represents the probability of finding a fibril oriented between φ and φ+ δφ. The application of the program is illustrated by measurement of g( φ) for the collagen fibrils in demineralised cortical bone from cow tibia.

  18. The primary processes by impact of ionizing radiations with water

    International Nuclear Information System (INIS)

    Znamirovschi, V.; Mastan, I.; Cozar, O.

    1976-01-01

    The problem concerning primary processes in radiolysis of water is discussed. The results on the excitation and ionization of water molecule, dissociation of the parent-molecular ion of water and dissociation of excited molecule of water are presented. (author)

  19. Anisotropy in highly charged ion induced molecule fragmentation

    International Nuclear Information System (INIS)

    Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

    2006-01-01

    Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

  20. Simple kinetic theory model of reactive collisions. IV. Laboratory fixed orientational cross sections

    International Nuclear Information System (INIS)

    Evans, G.T.

    1987-01-01

    The differential orientational cross section, obtainable from molecular beam experiments on aligned molecules, is calculated using the line-of-normals model for reactive collisions involving hard convex bodies. By means of kinetic theory methods, the dependence of the cross section on the angle of attack γ 0 is expressed in a Legendre function expansion. Each of the Legendre expansion coefficients is given by an integral over the molecule-fixed cross section and functions of the orientation dependent threshold energy

  1. Microscopic properties of nanopore water from its time-dependent dielectric response

    International Nuclear Information System (INIS)

    Koefinger, Juergen; Dellago, Christoph

    2010-01-01

    We present a simple kinetic model for the orientational dynamics of a chain of hydrogen-bonded molecules due to the diffusion of orientational defects. We derive an event-driven algorithm which allows us to do kinetic simulations for chains from nanoscopic to macroscopic lengths, spanning huge orders of magnitude in time. Our simulations and analytical calculations show that nanopore water exhibits Debye behavior arising from the diffusive dynamics of orientational defects. For the limits of short and long chains we derive analytical expressions for the relaxation times which allow to extract the diffusion constant, the effective interaction, and the excitation energy of these defects from dielectric spectroscopy experiments. We also discuss the possibility to use such experiments to detect if the two possible kinds of orientational defects differ in excitation energy and diffusion constant.

  2. A Brief Introduction to Single-Molecule Fluorescence Methods.

    Science.gov (United States)

    van den Wildenberg, Siet M J L; Prevo, Bram; Peterman, Erwin J G

    2018-01-01

    One of the more popular single-molecule approaches in biological science is single-molecule fluorescence microscopy, which will be the subject of the following section of this volume. Fluorescence methods provide the sensitivity required to study biology on the single-molecule level, but they also allow access to useful measurable parameters on time and length scales relevant for the biomolecular world. Before several detailed experimental approaches will be addressed, we will first give a general overview of single-molecule fluorescence microscopy. We start with discussing the phenomenon of fluorescence in general and the history of single-molecule fluorescence microscopy. Next, we will review fluorescent probes in more detail and the equipment required to visualize them on the single-molecule level. We will end with a description of parameters measurable with such approaches, ranging from protein counting and tracking, single-molecule localization super-resolution microscopy, to distance measurements with Förster Resonance Energy Transfer and orientation measurements with fluorescence polarization.

  3. Electron-excited molecule interactions

    International Nuclear Information System (INIS)

    Christophorou, L.G.; Tennessee Univ., Knoxville, TN

    1991-01-01

    In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

  4. Structure of C60: Partial orientational order in the room-temperature modification of C60

    International Nuclear Information System (INIS)

    Buergi, H.B.; Restori, R.; Schwarzenbach, D.

    1993-01-01

    Using published synchrotron X-ray data, the room-temperature scattering density distribution of pure C 60 has been parametrized in terms of a combination of eight oriented symmetry-related images of the molecule, and of a freely spinning molecule. Corresponding populations are 61 and 39%. The oriented part of the model is obtained, in good approximation, by imposing m anti 3m symmetry on the energetically more favourable major orientation in the low-temperature structure of C 60 . The model was refined using angle restraints to impose the icosahedral molecular symmetry and displacement-factor restraints to restrict thermal movements to rigid-body translations and librations. Translational displacement factors are in the range 0.017-0.023 A 2 . The orientational probability density distribution obtained from the model shows maxima for C 60 orientations possessing anti 3m crystallographic site symmetry. It is also relatively large for the C 60 orientations with cubic site symmetry m anti 3. The smallest energy barrier for reorientation between different anti 3m orientations via an m anti 3 orientation appears to be less than 2 kJ mol -1 . On average, 75% of the intermolecular contacts of the oriented molecules are longer than those observed in the low-temperature structure, the other 25% are less favourable. The second orientation of C 60 found in the low-temperature structure could not be identified at room temperature. (orig.)

  5. Effects of water-channel attractions on single-file water permeation through nanochannels

    International Nuclear Information System (INIS)

    Xu, Yousheng; Zheng, Youqu; Tian, Xingling; Lv, Mei; He, Bing; Deng, Maolin; Xiu, Peng; Tu, Yusong

    2016-01-01

    Single-file transportation of water across narrow nanochannels such as carbon nanotubes has attracted much attention in recent years. Such permeation can be greatly affected by the water-channel interactions; despite some progress, this issue has not been fully explored. Herein we use molecular dynamics simulations to investigate the effects of water-channel attractions on occupancy, translational (transportation) and orientational dynamics of water inside narrow single-walled carbon nanotubes (SWNTs). We use SWNTs as the model nanochannels and change the strength of water-nanotube attractions to mimic the changes in the hydrophobicity/polarity of the nanochannel. We investigate the dependence of water occupancy inside SWNTs on the water-channel attraction and identify the corresponding threshold values for drying states, wetting-drying transition states, and stably wetting states. As the strength of water-channel attractions increases, water flow increases rapidly first, and then decreases gradually; the maximal flow occurs in the case where the nanochannel is predominately filled with the 1D water wire but with a small fraction of ‘empty states’, indicating that appropriate empty-filling (drying-wetting) switching can promote water permeation. This maximal flow is unexpected, since in traditional view, the stable and tight hydrogen-bonding network of the water wire is the prerequisite for high permeability of water. The underlying mechanism is discussed from an energetic perspective. In addition, the effect of water-channel attractions on reorientational dynamics of the water wire is studied, and a negative correlation between the flipping frequency of water wire and the water-channel attraction is observed. The underlying mechanism is interpreted in term of the axial total dipole moment of inner water molecules. This work would help to better understand the effects of water-channel attractions on wetting properties of narrow nanochannels, and on single

  6. Organic Molecules in Meteorites

    Science.gov (United States)

    Martins, Zita

    2015-08-01

    Carbonaceous meteorites are primitive samples from the asteroid belt, containing 3-5wt% organic carbon. The exogenous delivery of organic matter by carbonaceous meteorites may have contributed to the organic inventory of the early Earth. The majority (>70%) of the meteoritic organic material consist of insoluble organic matter (IOM) [1]. The remaining meteoritic organic material (meteorites contain soluble organic molecules with different abundances and distributions, which may reflect the extension of aqueous alteration or thermal metamorphism on the meteorite parent bodies. Extensive aqueous alteration on the meteorite parent body may result on 1) the decomposition of α-amino acids [5, 6]; 2) synthesis of β- and γ-amino acids [2, 6-9]; 3) higher relative abundances of alkylated polycyclic aromatic hydrocarbons (PAHs) [6, 10]; and 4) higher L-enantiomer excess (Lee) value of isovaline [6, 11, 12].The soluble organic content of carbonaceous meteorites may also have a contribution from Fischer-Tropsch/Haber-Bosch type gas-grain reactions after the meteorite parent body cooled to lower temperatures [13, 14].The analysis of the abundances and distribution of the organic molecules present in meteorites helps to determine the physical and chemical conditions of the early solar system, and the prebiotic organic compounds available on the early Earth.[1] Cody and Alexander (2005) GCA 69, 1085. [2] Cronin and Chang (1993) in: The Chemistry of Life’s Origin. pp. 209-258. [3] Martins and Sephton (2009) in: Amino acids, peptides and proteins in organic chemistry. pp. 1-42. [4] Martins (2011) Elements 7, 35. [5] Botta et al. (2007) MAPS 42, 81. [6] Martins et al. (2015) MAPS, in press. [7] Cooper and Cronin (1995) GCA 59, 1003. [8] Glavin et al. (2006) MAPS. 41, 889. [9] Glavin et al. (2011) MAPS 45, 1948. [10] Elsila et al. (2005) GCA 5, 1349. [11] Glavin and Dworkin (2009) PNAS 106, 5487. [12] Pizzarello et al. (2003) GCA 67, 1589. [13] Chan et al. (2012) MAPS. 47, 1502

  7. Ground water chemistry. Practice oriented guideline for the numerical modelling concerning condition, contamination and remediation of aquatic systems. 2. ed.; Grundwasserchemie. Praxisorientierter Leitfaden zur numerischen Modellierung von Beschaffenheit, Kontamination und Sanierung aquatischer Systeme

    Energy Technology Data Exchange (ETDEWEB)

    Merkel, Broder J.; Planer-Friedrich, Britta [TU Bergakademie Freiberg (Germany). Inst. fuer Geologie

    2008-07-01

    The second print run of 'ground water chemistry' is supposed to be a practice oriented guideline for a fast introduction into the thermodynamic modeling. Besides a minimum theoretical background the book is focused to practical examples using the computer program PHREEQC. The reprint includes the additional possibilities of the CD-MUSIC concept for surface modeling. Examples concerning reactive mass transport include not only the 1D transport code PGREEQC, but also a 3D example using PHAST und the graphical user interface WPHAST. Uncertainties of thermodynamic data may be modeled using the program LJGUNSKILE. As before detailed descriptions allow the user to reach step by step more complex hydrogeochemical modeling. All of the cited computer codes are compiled on an enclosed CD. [German] Auch die zweite Auflage von 'Grundwasserchemie' bietet als praxisorientierter Leitfaden einen schnellen Einstieg in die thermodynamische Modellierung. Neben einem minimalen theoretischen Hintergrund liegt der Fokus auf praktischen Beispielen mit dem Computerprogramm PHREEQC. In der Neuauflage sind nun zusaetzlich die Moeglichkeiten des CD-MUSIC Konzepts zur Oberflaechenmodellierung erklaert. Beispiele zum reaktiven Stofftransport umfassen nicht nur den 1d Transport in PHREEQC, sondern auch ein 3d Beispiel mittels PHAST und der graphischen Benutzeroberflaeche WPHAST. Unsicherheiten thermodynamischer Daten koennen mit Hilfe des Programms LJGUNSKILE modelliert werden. Wie in der ersten Auflage helfen detaillierte Beschreibungen der Loesungen dem Nutzer, Schritt fuer Schritt von einfachen hin zu immer komplexeren hydrogeochemischen Modellierungen zu gelangen. Alle Programme sowie die Loesungen zu den Aufgaben befinden sich auf der CD zum Buch. (orig.)

  8. Tunnelling of a molecule

    International Nuclear Information System (INIS)

    Jarvis, P.D.; Bulte, D.P.

    1998-01-01

    A quantum-mechanical description of tunnelling is presented for a one-dimensional system with internal oscillator degrees of freedom. The 'charged diatomic molecule' is frustrated on encountering a barrier potential by its centre of charge not being coincident with its centre of mass, resulting in transitions amongst internal states. In an adiabatic limit, the tunnelling of semiclassical coherent-like oscillator states is shown to exhibit the Hartman and Bueuttiker-Landauer times t H and t BL , with the time dependence of the coherent state parameter for the tunnelled state given by α(t) = α e -iω(t+Δt) , Δt = t H - it BL . A perturbation formalism is developed, whereby the exact transfer matrix can be expanded to any desired accuracy in a suitable limit. An 'intrinsic' time, based on the oscillator transition rate during tunnelling, transmission or reflection, is introduced. In simple situations the resulting intrinsic tunnelling time is shown to vanish to lowest order. In the general case a particular (nonzero) parametrisation is inferred, and its properties discussed in comparison with the literature on tunnelling times for both wavepackets and internal clocks. Copyright (1998) CSIRO Australia

  9. Single molecule tracking

    Science.gov (United States)

    Shera, E. Brooks

    1988-01-01

    A detection system is provided for identifying individual particles or molecules having characteristic emission in a flow train of the particles in a flow cell. A position sensitive sensor is located adjacent the flow cell in a position effective to detect the emissions from the particles within the flow cell and to assign spatial and temporal coordinates for the detected emissions. A computer is then enabled to predict spatial and temporal coordinates for the particle in the flow train as a function of a first detected emission. Comparison hardware or software then compares subsequent detected spatial and temporal coordinates with the predicted spatial and temporal coordinates to determine whether subsequently detected emissions originate from a particle in the train of particles. In one embodiment, the particles include fluorescent dyes which are excited to fluoresce a spectrum characteristic of the particular particle. Photones are emitted adjacent at least one microchannel plate sensor to enable spatial and temporal coordinates to be assigned. The effect of comparing detected coordinates with predicted coordinates is to define a moving sample volume which effectively precludes the effects of background emissions.

  10. Oriental upper blepharoplasty.

    Science.gov (United States)

    Weng, Chau-Jin

    2009-02-01

    Aesthetic surgery of the upper eyelids is a very common procedure performed in cosmetic practices around the world. The word blepharoplasty, however, has a different meaning in Asia than it does elsewhere. Orientals have different periorbital anatomic characteristics, their motivations for seeking eyelid treatment are different, and operative techniques have been adapted consequently. There are also many eyelid shapes among Orientals, mostly with regard to the presence and location of the supratarsal fold and/or presence of an epicanthal fold. The surgeon must therefore master a range of surgical procedures to treat these variations adequately. It is critical to know the indications for each blepharoplasty technique as well as their complications to select the right surgery and avoid unfavorable results. Epicanthoplasty performed on the right patient can greatly improve aesthetic results while retaining ethnic characteristics. This article will discuss Oriental eyelid characteristics, preoperative patient assessment, commonly used corrective techniques for the "double-eyelid" creation, and complications and how to avoid them.

  11. Future-Oriented LCA

    DEFF Research Database (Denmark)

    Olsen, Stig Irving; Borup, Mads; Andersen, Per Dannemand

    2018-01-01

    LCA is often applied for decision-making that concerns actions reaching near or far into the future. However, traditional life cycle assessment methodology must be adjusted for the prospective and change-oriented purposes, but no standardised way of doing this has emerged yet. In this chapter some...... challenges are described and some learnings are derived. Many of the future-oriented LCAs published so far perform relatively short-term prediction of simple comparisons. But for more long-term time horizons foresight methods can be of help. Scenarios established by qualified experts about future...... technological and economic developments are indispensable in future technology assessments. The uncertainties in future-oriented LCAs are to a large extent qualitative and it is important to emphasise that LCA of future technologies will provide a set of answers and not ‘the’ answer....

  12. Cultural Orientation and Interdisciplinarity

    DEFF Research Database (Denmark)

    Nielsen, Sofie Søndergaard

    2004-01-01

    I begin the article with an account of the background to the German debate on ‘Literaturwissenschaft als Kulturwissenschaft’, including the introduction of the concept of ’cultural orientation’ as a strategy for achieving interdisciplinarity. This is followed by a consideration of the discussion ...... of the object of literary studies as a way of defining the disciplinarity or identity of literary studies. Finally I summarize some of the characteristics of culturally orientated literary studies.......I begin the article with an account of the background to the German debate on ‘Literaturwissenschaft als Kulturwissenschaft’, including the introduction of the concept of ’cultural orientation’ as a strategy for achieving interdisciplinarity. This is followed by a consideration of the discussion...

  13. Age and Value Orientations

    Directory of Open Access Journals (Sweden)

    Asya Kh. Kukubayeva

    2013-01-01

    Full Text Available The present article deals with value orientations and their role in men’s lives, particularly, in young people’s lives. This notion was introduced by the American theoretical sociologist T. Parsons, one of the creators of modern theoretical sociology. The scientist made an attempt to construct the structural and analytical theory of social action, combining personal interests (needs and aims and situation, it takes place in. The issue of value orientations remains acute for psychology. Herein we have considered several most important works, relating to the considered issue. Age aspects of young people’s value orientations are of peculiar interest to us. When analyzing this phenomenon, one should take into consideration the psychological formations, inhere for a certain age. In fact every age has its unique structure, which may change when passing from one development stage to another. Basing on this fact, we’ve considered the values, depending on the age features of the youth, relying upon the works of the scientists, working with different categories of the youth, such as: teenagers, students, children of different nationalities. It is not surprising that most scientists have come to the conclusion that the chief role in value orientation belongs to a family, originates in relations with parents and teachers. The positive reinforcement to the future develops throughout life in accordance with a lifestyle of a family, society and political situation in a state.Life orientations as a type of value orientations show different types of young people’s preferences. Value structure of its consciousness has its own specific character, depending on the age peculiarities. The dynamics of the transition from one age to another is accompanied with the reappraisal of values, eventually, influencing the life strategy of the future generation

  14. Strong-field ionization of linear molecules by a bicircular laser field: Symmetry considerations

    Science.gov (United States)

    Gazibegović-Busuladžić, A.; Busuladžić, M.; Hasović, E.; Becker, W.; Milošević, D. B.

    2018-04-01

    Using the improved molecular strong-field approximation, we investigate (high-order) above-threshold ionization [(H)ATI] of various linear polyatomic molecules by a two-color laser field of frequencies r ω and s ω (with integer numbers r and s ) having coplanar counter-rotating circularly polarized components (a so-called bicircular field). Reflection and rotational symmetries for molecules aligned in the laser-field polarization plane, analyzed for diatomic homonuclear molecules in Phys. Rev. A 95, 033411 (2017), 10.1103/PhysRevA.95.033411, are now considered for diatomic heteronuclear molecules and symmetric and asymmetric linear triatomic molecules. There are additional rotational symmetries for (H)ATI spectra of symmetric linear molecules compared to (H)ATI spectra of the asymmetric ones. It is shown that these symmetries manifest themselves differently for r +s odd and r +s even. For example, HATI spectra for symmetric molecules with r +s even obey inversion symmetry. For ATI spectra of linear molecules, reflection symmetry appears only for certain molecular orientation angles ±90∘-j r 180∘/(r +s ) (j integer). For symmetric linear molecules, reflection symmetry appears also for the angles -j r 180∘/(r +s ) . For perpendicular orientation of molecules with respect to the laser-field polarization plane, the HATI spectra are very similar to those of the atomic targets, i.e., both spectra are characterized by the same type of the (r +s )-fold symmetry.

  15. Theoretical Investigations Regarding Single Molecules

    DEFF Research Database (Denmark)

    Pedersen, Kim Georg Lind

    Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...

  16. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  17. Object-oriented communications

    International Nuclear Information System (INIS)

    Chapman, L.J.

    1989-01-01

    OOC is a high-level communications protocol based on the object-oriented paradigm. OOC's syntax, semantics, and pragmatics balance simplicity and expressivity for controls environments. While natural languages are too complex, computer protocols are often insufficiently expressive. An object-oriented communications philosophy provides a base for building the necessary high-level communications primitives like I don't understand and the current value of X is K. OOC is sufficiently flexible to express data acquisition, control requests, alarm messages, and error messages in a straightforward generic way. It can be used in networks, for inter-task communication, and even for intra-task communication

  18. Orientation specific deposition of mesoporous particles

    Directory of Open Access Journals (Sweden)

    Tomas Kjellman

    2014-11-01

    Full Text Available We present a protocol for a facile orientation specific deposition of plate-like mesoporous SBA-15 silica particles onto a surface (mesopores oriented normal to surface. A drop of an aqueous dispersion of particles is placed on the surface and water vaporizes under controlled relative humidity. Three requirements are essential for uniform coverage: particle dispersion should not contain aggregates, a weak attraction between particles and surface is needed, and evaporation rate should be low. Aggregates are removed by stirring/sonication. Weak attraction is realized by introducing cationic groups to the surface. Insight into the mechanisms of the so-called coffee stain effect is also provided.

  19. Biofuels: from microbes to molecules

    National Research Council Canada - National Science Library

    Lu, Xuefeng

    2014-01-01

    .... The production of different biofuel molecules including hydrogen, methane, ethanol, butanol, higher chain alcohols, isoprenoids and fatty acid derivatives, from genetically engineered microbes...

  20. Labelled molecules, modern research implements

    International Nuclear Information System (INIS)

    Pichat, L.; Langourieux, Y.

    1974-01-01

    Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14 CO 2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed [fr

  1. Orientation Sensitivity of Oxygen Evolution Reaction on Hematite

    NARCIS (Netherlands)

    Zhang, X. Q.; Cao, C.; Bieberle, A.

    2016-01-01

    The sensitivity of the surface orientation on photoelectrochemical water oxidation has recently been reported by experimental studies. However, a detailed theoretical understanding is still missing. Density functional theory + Hubbard U (DFT + U) calculations are therefore carried out in order to

  2. Molecular dynamics simulations on PGLa using NMR orientational constraints

    Energy Technology Data Exchange (ETDEWEB)

    Sternberg, Ulrich, E-mail: ulrich.sternberg@partner.kit.edu; Witter, Raiker [Tallinn University of Technology, Technomedicum (Estonia)

    2015-11-15

    NMR data obtained by solid state NMR from anisotropic samples are used as orientational constraints in molecular dynamics simulations for determining the structure and dynamics of the PGLa peptide within a membrane environment. For the simulation the recently developed molecular dynamics with orientational constraints technique (MDOC) is used. This method introduces orientation dependent pseudo-forces into the COSMOS-NMR force field. Acting during a molecular dynamics simulation these forces drive molecular rotations, re-orientations and folding in such a way that the motional time-averages of the tensorial NMR properties are consistent with the experimentally measured NMR parameters. This MDOC strategy does not depend on the initial choice of atomic coordinates, and is in principle suitable for any flexible and mobile kind of molecule; and it is of course possible to account for flexible parts of peptides or their side-chains. MDOC has been applied to the antimicrobial peptide PGLa and a related dimer model. With these simulations it was possible to reproduce most NMR parameters within the experimental error bounds. The alignment, conformation and order parameters of the membrane-bound molecule and its dimer were directly derived with MDOC from the NMR data. Furthermore, this new approach yielded for the first time the distribution of segmental orientations with respect to the membrane and the order parameter tensors of the dimer systems. It was demonstrated the deuterium splittings measured at the peptide to lipid ratio of 1/50 are consistent with a membrane spanning orientation of the peptide.

  3. Growing interstellar molecules with ion-molecule reactions

    International Nuclear Information System (INIS)

    Bohme, D.K.

    1989-01-01

    Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present

  4. Water growth on metals and oxides: binding, dissociation and role of hydroxyl groups

    Energy Technology Data Exchange (ETDEWEB)

    Salmeron, M.; Bluhm, H.; Tatarkhanov, M.; Ketteler, G.; Shimizu, T.K.; Mugarza, A.; Deng, Xingyi; Herranz, T.; Yamamoto, S.; Nilsson, A.

    2008-09-01

    The authors discuss the role of the presence of dangling H bonds from water or from surface hydroxyl species on the wetting behavior of surfaces. Using Scanning Tunneling and Atomic Force Microscopies, and Photoelectron Spectroscopy, they have examined a variety of surfaces, including mica, oxides, and pure metals. They find that in all cases, the availability of free, dangling H-bonds at the surface is crucial for the subsequent growth of wetting water films. In the case of mica electrostatic forces and H-bonding to surface O atoms determine the water orientation in the first layer and also in subsequent layers with a strong influence in its wetting characteristics. In the case of oxides like TiO{sub 2}, Cu{sub 2}O, SiO{sub 2} and Al{sub 2}O{sub 3}, surface hydroxyls form readily on defects upon exposure to water vapor and help nucleate the subsequent growth of molecular water films. On pure metals, such as Pt, Pd, and Ru, the structure of the first water layer and whether or not it exhibits dangling H bonds is again crucial. Dangling H-bonds are provided by molecules with their plane oriented vertically, or by OH groups formed by the partial dissociation of water. By tying the two II atoms of the water molecules into strong H-bonds with pre-adsorbed O on Ru can also quench the wettability of the surface.

  5. Molecular Structure and Dynamics in Thin Water Films at the Silica and Graphite Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Argyris, Dr. Dimitrios [University of Oklahoma; Tummala, Dr. Naga Rajesh [University of Oklahoma; StrioloDr., A [Vanderbilt University; Cole, David R [ORNL

    2008-01-01

    The structure and dynamic properties of interfacial water at the graphite and silica solid surfaces were investigated using molecular dynamics simulations. The effect of surface properties on the characteristics of interfacial water was quantified by computing density profiles, radial distribution functions, surface density distributions, orientation order parameters, and residence and reorientation correlation functions. In brief, our results show that the surface roughness, chemical heterogeneity, and surface heterogeneous charge distribution affect the structural and dynamic properties of the interfacial water molecules, as well as their rate of exchange with bulk water. Most importantly, our results indicate the formation of two distinct water layers at the SiO2 surface covered by a large density of hydroxyl groups. Further analysis of the data suggests a highly confined first layer where the water molecules assume preferential hydrogen-down orientation and a second layer whose behavior and characteristics are highly dependent on those of the first layer through a well-organized hydrogen bond network. The results suggest that water-water interactions, in particular hydrogen bonds, may be largely responsible for macroscopic interfacial properties such as adsorption and contact angle.

  6. Molecular orientation and electronic structure at organic heterojunction interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Zhong, Shu [Department of Chemistry, National University of Singapore, 3 Science Drive 3, 117543 Singapore (Singapore); Zhong, Jian Qiang; Wee, Andrew T.S. [Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Chen, Wei, E-mail: phycw@nus.edu.sg [Department of Chemistry, National University of Singapore, 3 Science Drive 3, 117543 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); National University of Singapore (Suzhou) Research Institute, Suzhou (China)

    2015-10-01

    Highlights: • Molecular orientation at the organic heterojunction interfaces. • Energy level alignments at the organic heterojunction interfaces. • Gap-states mediated interfacial energy level alignment. - Abstract: Due to the highly anisotropic nature of π-conjugated molecules, the molecular orientation in organic thin films can significantly affect light absorption, charge transport, energy level alignment (ELA) and hence device performance. Synchrotron-based near-edge X-ray absorption fine structure (NEXAFS) spectroscopy represents a powerful technique for probing molecular orientation. The aim of this review paper is to provide a balanced assessment on the investigation of molecular orientation at the organic–organic heterojunction (OOH) interface by NEXAFS, as well as the gap-states mediated orientation dependent energy level alignment at OOH interfaces. We highlight recent progress in elucidating molecular orientation at OOH interfaces dominated by various interfacial interactions, gap-states controlled orientation dependent energy level alignments at OOH interfaces, and the manipulations of molecular orientation and ELA in OOH.

  7. Possible heterogeneity of centres of binding 1,8-ANS in molecules of oxygenated hemoglobin

    International Nuclear Information System (INIS)

    Parul', D.A.; Bokut', S.B.; Milyutin, A.A.; Petrov, E.P.; Nemkovich, N.A.; Sobchuk, A.N.; Dzhagarov, B.M.

    1999-01-01

    Forming of oxygenated hemoglobin is one of effects of ionizing radiation action on organism. It was revealed heterogeneity of centers of binding of 1,8-ANS in intact molecule of oxygenated hemoglobin. Two types of binding centers possible reflect the existence of two regions in protein molecule with different accessibility to molecules of water

  8. QUANTIFYING WILDLIFE ORIENTATION

    African Journals Online (AJOL)

    environment (P);. Attitudes expressed towards the natural environment (A);. Activity, or the involvement of a person in conservation actions in the broader sense {I). Different combinations of these functions give rise to four typologies of orientation. (Newgard et al., 1986) in the following way: TYPOLOGY. CHARACTERISTICS.

  9. Orientals and Orientalists

    DEFF Research Database (Denmark)

    Reade, Julian

    2004-01-01

    Reviews three books on archaeology. "Possessors and Possessed: Museums, Archaeology, and the Visualization of History in the Late Ottoman Empire," by Wendy M. K. Shaw; "Orientalism and Visual Culture: Imagining Mesapotamia in Nineteenth-Century Europe," by Frederick N. Bohrer; "Empires of the Pla......: Henry Rawlinson and the Lost Languages of Babylon," by Lesley Adkins....

  10. Management oriented process

    International Nuclear Information System (INIS)

    2004-01-01

    ANAV decided to implement process-oriented management by adopting the U. S. NEI (Nuclear Electric Industry) model. The article describes the initial phases of the project, its current status and future prospects. The project has been considered as an improvement in the areas of organization and human factors. Recently, IAEA standard drafts are including processes as an accepted management model. (Author)

  11. Aspect-Oriented Programming

    NARCIS (Netherlands)

    Lopes, C.; Bergmans, Lodewijk; Lopes, C.

    1999-01-01

    Aspect-oriented programming is a promising idea that can improve the quality of software by reduce the problem of code tangling and improving the separation of concerns. At ECOOP’97, the first AOP workshop brought together a number of researchers interested in aspectorientation. At ECOOP’98, during

  12. Managing Entrepreneurial Orientation

    NARCIS (Netherlands)

    S. van Doorn (Sebastiaan)

    2012-01-01

    textabstractIn this dissertation, we evaluate the roles senior management teams and individual middle managers play in realizing the performance benefits of entrepreneurial orientations. We investigate the role of senior management teams by focusing on a sample of 9.000 firms in the Netherlands. The

  13. Component-oriented programming

    NARCIS (Netherlands)

    Bosch, J; Szyperski, C; Weck, W; Buschmann, F; Buchmann, AP; Cilia, MA

    2003-01-01

    This report covers the eighth Workshop on Component-Oriented Programming (WCOP). WCOP has been affiliated with ECOOP since its inception in 1996. The report summarizes the contributions made by authors of accepted position papers as well as those made by all attendees of the workshop sessions.

  14. Solvent Flux Method (SFM): A Case Study of Water Access to Candida antarctica Lipase B.

    Science.gov (United States)

    Benson, Sven P; Pleiss, Jürgen

    2014-11-11

    The solvent flux method (SFM) was developed to comprehensively characterize the influx of solvent molecules from the solvent environment into the active site of a protein in the framework of molecular dynamics simulations. This was achieved by introducing a solvent concentration gradient as well as partially reorienting and rescaling the velocity vector of all solvent molecules contained within a spherical volume enclosing the protein, thus inducing an accelerated solvent influx toward the active site. In addition to the detection of solvent access pathway within the protein structure, it is hereby possible to identify potential amino acid positions relevant to solvent-related enzyme engineering with high statistical significance. The method is particularly aimed at improving the reverse hydrolysis reaction rates in nonaqueous media. Candida antarctica lipase B (CALB) binds to a triglyceride-water interface with its substrate entrance channel oriented toward the hydrophobic substrate interface. The lipase-triglyceride-water system served as a model system for SFM to evaluate the influx of water molecules to the active site. As a proof of principle for SFM, a previously known water access pathway in CALB was identified as the primary water channel. In addition, a secondary water channel and two pathways for water access which contribute to water leakage between the protein and the triglyceride-water interface were identified.

  15. Thermal Instability Induced Oriented 2D Pores for Enhanced Sodium Storage.

    Science.gov (United States)

    Kong, Lingjun; Xie, Chen-Chao; Gu, Haichen; Wang, Chao-Peng; Zhou, Xianlong; Liu, Jian; Zhou, Zhen; Li, Zhao-Yang; Zhu, Jian; Bu, Xian-He

    2018-04-19

    Hierarchical porous structures are highly desired for various applications. However, it is still challenging to obtain such materials with tunable architectures. Here, this paper reports hierarchical nanomaterials with oriented 2D pores by taking advantages of thermally instable bonds in vanadium-based metal-organic frameworks (MOFs). High-temperature calcination of these MOFs accompanied by the loss of coordinated water molecules and other components enables the formation of orderly slit-like 2D pores in vanadium oxide/porous carbon nanorods (VO x /PCs). This unique combination leads to an increase of the reactive surface area. In addition, optimized VO x /PCs demonstrate high-rate capability and ultralong cycling life for sodium storage. The assembled full cells also show high capacity and cycling stability. This report provides an effective strategy for producing MOFs-derived composites with hierarchical porous architectures for energy storage. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Magnetization reversal in single molecule magnets

    Science.gov (United States)

    Bokacheva, Louisa

    2002-09-01

    I have studied the magnetization reversal in single molecule magnets (SMMs). SMMs are Van der Waals crystals, consisting of identical molecules containing transition metal ions, with high spin and large uniaxial magnetic anisotropy. They can be considered as ensembles of identical, iso-oriented nanomagnets. At high temperature, these materials behave as superparamagnets and their magnetization reversal occurs by thermal activation. At low temperature they become blocked, and their magnetic relaxation occurs via thermally assisted tunneling or pure quantum tunneling through the anisotropy barrier. We have conducted detailed experimental studies of the magnetization reversal in SMM material Mn12-acetate (Mn12) with S = 10. Low temperature measurements were conducted using micro-Hall effect magnetometry. We performed hysteresis and relaxation studies as a function of temperature, transverse field, and magnetization state of the sample. We identified magnetic sublevels that dominate the tunneling at a given field, temperature and magnetization. We observed a crossover between thermally assisted and pure quantum tunneling. The form of this crossover depends on the magnitude and direction of the applied field. This crossover is abrupt (first-order) and occurs in a narrow temperature interval (tunneling mechanisms in Mn12.

  17. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr

    2014-09-01

    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  18. Organizing and addressing magnetic molecules.

    Science.gov (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  19. Ion-Molecule Reaction Dynamics.

    Science.gov (United States)

    Meyer, Jennifer; Wester, Roland

    2017-05-05

    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  20. Dynamical spin accumulation in large-spin magnetic molecules

    Science.gov (United States)

    Płomińska, Anna; Weymann, Ireneusz; Misiorny, Maciej

    2018-01-01

    The frequency-dependent transport through a nanodevice containing a large-spin magnetic molecule is studied theoretically in the Kondo regime. Specifically, the effect of magnetic anisotropy on dynamical spin accumulation is of primary interest. Such accumulation arises due to finite components of frequency-dependent conductance that are off diagonal in spin. Here, employing the Kubo formalism and the numerical renormalization group method, we demonstrate that the dynamical transport properties strongly depend on the relative orientation of spin moments in electrodes of the device, as well as on intrinsic parameters of the molecule. In particular, the effect of dynamical spin accumulation is found to be greatly affected by the type of magnetic anisotropy exhibited by the molecule, and it develops for frequencies corresponding to the Kondo temperature. For the parallel magnetic configuration of the device, the presence of dynamical spin accumulation is conditioned by the interplay of ferromagnetic-lead-induced exchange field and the Kondo correlations.