WorldWideScience

Sample records for wang xiaolei sun

  1. Honggang Wang

    Indian Academy of Sciences (India)

    Honggang Wang. Articles written in Journal of Genetics. Volume 90 Issue 3 December 2011 pp 409-425 Research Article. Wheat kernel dimensions: how do they contribute to kernel weight at an individual QTL level? Fa Cui Anming Ding Jun Li Chunhua Zhao Xingfeng Li Deshun Feng Xiuqin Wang Lin Wang Jurong Gao ...

  2. yimin sun

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. YIMIN SUN. Articles written in Journal of Genetics. Volume 96 Issue 4 September 2017 pp 687-693 RESEARCH NOTE. The association study of nonsyndromic cleft lip with or without cleft palate identified risk variants of the GLI3 gene in a Chinese population · YIRUI WANG YIMIN SUN ...

  3. Wang-Landau Without Binning

    Science.gov (United States)

    Brown, G.; Nicholson, D.; Odbadrakh, Kh.; Eisenbach, M.; Rusanu, A.

    2012-02-01

    Results are presented for Wang-Landau calculations on a Heisenberg model of BCC Fe that describe the density of states as function defined for all accessible energies instead of a function tabulated at discrete values of the energy. The density of states function described here is an analytic result valid near the ground state supplemented by a polynomial expansion. The probability density of Wang-Landau random walkers is sampled for a fixed density of states, and that probability density can be used to improve the estimated density of states. Methods for evaluating the convergence of the density of states are discussed along with the diffusion behavior of the random walkers. This work was performed at the Oak Ridge National Laboratory, which is managed by UT-Battelle, LLC under Contract No. DE-AC05-00OR22725, and sponsored by the Laboratory Directed Research and Development Program (ORNL), by the Mathematical, Information, and Computational Sciences Division; Office of Advanced Scientific Computing Research (US DOE), and by the Division of Materials Sciences and Engineering; Office of Basic Energy Sciences (US DOE). Computer resources provided by Florida State University.

  4. Changming Wang - Journal of Earth System Science | Indian ...

    Indian Academy of Sciences (India)

    Volume 125 Issue 3 April 2016 pp 585-603. Petrogenesis, zircon U–Pb age, and geochemistry of the A-type Mogou syenite, western Henan Province: Implications for Mesozoic tectono-magmatic evolution of the Qinling Orogen · Xinyu He Jionghui Wang Changming Wang Emmanuel John M Carranza Liang Chen Bin Wu.

  5. Sun protection

    Science.gov (United States)

    ... age spots are caused by exposure to the sun. This is because the damage caused by the sun is permanent. ... The two types of sun rays that can injure the skin are ultraviolet A (UVA) and ultraviolet B (UVB). UVA affects the deep layers of ...

  6. Chemical gas-dynamics beyond Wang Chang-Uhlenbeck's kinetics

    Science.gov (United States)

    Kolesnichenko, Evgeniy G.; Gorbachev, Yuriy E.

    2014-12-01

    Wang Chang-Uhlenbeck equation does not give possibility to take into account intermolecular processes such as redistribution of the energy among different degrees of freedom. The modification of the generalized Wang Chang-Uhlenbeck equation including such processes is proposed. It allows to study for instance the kinetics of non-radiative transitions. Limitations of this approach are connected with the requirements of absence of polarization of rotational momentum and phases of intermolecular vibrations.

  7. Jiajie Sun

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. Jiajie Sun. Articles written in Journal of Genetics. Volume 91 Online resources 2012 pp e54-e59. Haplotype combination of the caprine PC1 gene sequence variants and association with growth traits in Chinese Haimen breed · Jiajie Sun Jing Xue Chunlei Zhang Xianyong Lan Chuzhao ...

  8. The Sun

    CERN Document Server

    Golub, Leon

    2017-01-01

    Essential for life on earth and a major influence on our environment, the Sun is also the most fascinating object in the daytime sky. Every day we feel the effect of its coming and going – literally the difference between day and night. But figuring out what the Sun is, what it’s made of, why it glows so brightly, how old it is, how long it will last – all of these take thought and observation. Leon Golub and Jay M. Pasachoff offer an engaging and informative account of what scientists know about the Sun, and the history of these discoveries. Solar astronomers have studied the Sun over the centuries both for its intrinsic interest and in order to use it as a laboratory to reveal the secrets of other stars. The authors discuss the surface of the Sun, including sunspots and their eleven-year cycle, as well as the magnetism that causes them; the Sun’s insides, as studied mainly from seismic waves that astronomers record on its surface; the outer layers of the Sun that we see from Earth only at eclipses ...

  9. WANG TILE SIZE IN TERMS OF CIRCULAR PARTICLE DYNAMICS

    Directory of Open Access Journals (Sweden)

    David Šedlbauer

    2017-11-01

    Full Text Available The main advantage of the Wang tiling concept for material engineering is ability to create large material domains with a relatively small set of tiles. Such idea allows both a reduction of computational demands and preserving heterogeneity of a reconstructed media in comparison with traditional cell concepts. This work is dealing with a random heterogeneous material composed of monodisperse circular hard particles within a matrix. The Wang tile sets are generated via algorithm with molecular dynamics and adaptive boundaries approach. Even though previous works proved usefulness of the Wang tiling for material reconstruction, still plenty of questions remain unanswered. In here we would like to provide simulations with emphasis on the overall particle distribution and the ratio of hard disc number to tile size. The results and discussion should followers help with settings of both tile generations and the tiling algorithms when creating samples of various degree of heterogeneity.

  10. [The anatomical concept of Ma Wang Dui archeological artifacts].

    Science.gov (United States)

    Yang, Su-Tso

    2010-01-01

    Amongst the archeological findings of Ma Wang Dui that concern the human anatomy, the first noted was a well-preserved female corpse, which demonstrated superb antiseptic techniques of the ancient Chinese. Also, 14 medical books were excavated and revealed a prototype of human visceral anatomy. The differentiation between small and large intestines was absent, and only the term of "intestine" was mentioned. The term of "triple energizers" was absent, too. However, contexts of surface anatomy were already abundant. Analyzing the terms of relative position, the anatomical position portrayed by the Ma Wang Dui medical texts is very similar to that of modern medicine.

  11. Midnight sun

    Energy Technology Data Exchange (ETDEWEB)

    Brunger, A.P.; Lambert, S.B.; Gagnon, M.P.

    1990-09-01

    Midnight Sun, the University of Waterloo's solar-electric car, was designed and built by about 30 engineering, kinesiology and physics students for the GM Sunrayce USA held in July 1990. The car measures 2 m by 4.2 m, weighs 224 kg, can collect about 1000 W of solar electricity in full sun, and had a top speed of 79 km/h. The race took 11 days to cover the 1644 miles from the Epcot Center in Lake Buena Vista, Florida to the GM Technical Center in Warren, Michigan. Thirty-two cars, powered only by solar energy, competed in this race. Midnight Sun showed its potential during the race qualifying runs by completing the required qualifying course with the 12th fastest time of 52.83 seconds, and the 6th fastest trap speed of 63 km/h. During the Sunrayce, Midnight Sun came in second on day 1 of the race, tenth on day 6, and eighth on day 7, and was one of only 17 solar cars that were able to make it up the toughest hill in the race on day 8. The most serious problems encountered by the car were a weak rear suspension, power losses, and failure of bypass diodes in the photovoltaic array. Midnight Sun was in 17th place overall at the end of day 9. At about 11:00 am on day 10 in Ohio, the Waterloo car was moving at 60 km/h when it was bumped off the road by an out of control pickup truck. The solar car driver was not hurt. Despite the difficulties, the next day Midnight Sun was repaired and driven across the finish line at the ceremonial finish. After receiving time penalties for not completing the last day and a half of the race, Midnight Sun was awarded 24th place with an official cumulative time of 114 h 37 min 15 s. 4 figs., 4 tabs.

  12. Little sun

    DEFF Research Database (Denmark)

    Ebbesen, Toke Riis

    2017-01-01

    the ideas of Alfred Gell’s anthropology of art and the indicative framework derived from Argentinian semiotician Juan Pablo Bonta and Jørn Guldberg. The toy-like solar lamp Little Sun by Olafur Eliasson and Frederik Ottesen is used as case that blends the registers of social design and art......, and as an example of how designers attempt to determine meaning potentials through design in a complex interplay of different strategies. In the final analysis, what characterise objects like Little Sun is seldom that they communicate their meanings in themselves, but instead rely on forceful mediations to gain...

  13. Sun Proof

    Centers for Disease Control (CDC) Podcasts

    2012-10-23

    In this podcast for kids, the Kidtastics talk about the harmful effects of the sun and how to protect yourself from it.  Created: 10/23/2012 by Centers for Disease Control and Prevention (CDC).   Date Released: 10/23/2012.

  14. Control of accuracy in the Wang-Landau algorithm

    Science.gov (United States)

    Barash, L. Yu.; Fadeeva, M. A.; Shchur, L. N.

    2017-10-01

    The Wang-Landau (WL) algorithm has been widely used for simulations in many areas of physics. Our analysis of the WL algorithm explains its properties and shows that the difference of the largest eigenvalue of the transition matrix in the energy space from unity can be used to control the accuracy of estimating the density of states. Analytic expressions for the matrix elements are given in the case of the one-dimensional Ising model. The proposed method is further confirmed by numerical results for the one-dimensional and two-dimensional Ising models and also the two-dimensional Potts model.

  15. THE APPLICATION OF SURVEY IN ER WANG TEMPLE RESTITUTING

    Directory of Open Access Journals (Sweden)

    W. Shuai

    2013-07-01

    Full Text Available Er Wang Temple, in World Heritage Site "Dujiang Weirs and Qingchengshan Mountai", was severely destroyed in Wenchuan earthquake of May 2008. There are several problems at different level in every building, such as structural distortion, foundation displacement, wall fracture, roof damage, etc. The stage was completely collapsed in the earthquake. Tableland the stage situated had a huge crack and slope collapse. This article is for the stage renovation. The survey of damage in earthquake is the basis of Er Wang Temple restituting. Survey including field survey after the earthquake and the measurement and investigation for the remained construction member of the main wood structure. For field survey, the basis of pillars which had not have significantly affects in earthquake could be seem as the reference points for measurement. The investigation of remained main wood construction member, especially the size of the key structures and site and manufacture method of the joints, is the important basis for recovery stage. Our team did our utmost to restore the original appearance of stage in design, materials and craft by various tools, which include measured drawings in different times, old images collection, fine measuring by 3D laser scan, measurement of leftover pieces, logical inference.

  16. Ke Wang, a Chinese television soap opera with a message.

    Science.gov (United States)

    Wang, M; Singhal, A

    1992-01-01

    The Chinese soap opera, Ke Wang, was created by Li Xiaoming between August 1989 and June 1990 and produced at a cost of US$4650 per episode. The characters were drawn from everyday ordinary Chinese life: a traditional and open-minded and caring woman, a typical mother who works hard and loves her children, a highly educated upwardly mobile man who divorces his wife, a professor criticized during the Cultural Revolution, a doctor prejudiced against ordinary people, a kind honest man who marries the divorcee, a friend of the divorcee, a man who is optimistic in spite of bad experiences during the Cultural Revolution, and an excellent medical doctor who also resolves conflicts. The program was very popular, even among Communists, because of its value-based content, the real-life nature of the show, the change from highly restricted programming, the elaborate and supportive media coverage, and dialogue which closely matches audience preferences. The show has been aired by over 100 stations to date and has reached a total estimated audience of 550 million. The sale of television sets has increased since the show's appearance. The script reflects the conflicts between traditional and modern Chinese values. Pro-social values and behaviors are learned from the role models depicted; examples are given of immediate social impact. Ke Wang was a by-product of the Beijing Television Arts Center's interest in designing television programs that are relevant to the lives of ordinary people. The 60-minute scripts dealt with issues such as the status of women, social morality, family harmony, class conflict, responsible parenthood, maintenance of traditional culture, volunteerism, child development, and coping with physical disability. The Chinese government hailed Ke Wang as model television and awarded US$20,000 in prize money to the producers. The Chinese government is planning to produce other entertainment-education soap operas, which raises the problem of blatant, political

  17. Multiple Walkers in the Wang-Landau Algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Brown, G

    2005-12-28

    The mean cost for converging an estimated density of states using the Wang-Landau algorithm is measured for the Ising and Heisenberg models. The cost increases in a power-law fashion with the number of spins, with an exponent near 3 for one-dimensional models, and closer to 2.4 for two-dimensional models. The effect of multiple, simultaneous walkers on the cost is also measured. For the one-dimensional Ising model the cost can increase with the number of walkers for large systems. For both the Ising and Heisenberg models in two-dimensions, no adverse impact on the cost is observed. Thus multiple walkers is a strategy that should scale well in a parallel computing environment for many models of magnetic materials.

  18. The Wang-Meng interacting model and the gravitational collapse

    Energy Technology Data Exchange (ETDEWEB)

    Campos, Miguel de [Universidade Federal de Roraima, Boa Vista (Brazil)

    2013-07-01

    Full text: Several alternatives have appear in the literature to supply the accelerated process of universal expansion, and the simplest possibility is to consider the inclusion of a cosmological constant. The inclusion can be realized in both sides of the Einstein field equations, furnishing different physical interpretations in accord with the side of the Einstein field equations where the Λ is added. Considering the inclusion of the cosmological constant in the energy momentum tensor, this additional content is generally interpreted as the energy storage on the vacuum state of all fields in the universe. The inclusion of a vacuum component in the universal fluid furnishes an excellent description of the observed universe, but from the theoretical point of view we do not understand why the vacuum energy is so small and of the same order of magnitude of the matter density (cosmological constant problem). Depending on the point of view of the cosmological constant problem, competing approaches were developed considering a dynamical cosmological 'constant'. A more richer possibility is to consider a non-gravitational interaction models, where the interaction can occur between the dark components, the ordinary matter, and they do not evolve separately. The coupling between dark matter and dark energy has been considered in the literature in a three different ways: dark matter decaying to dark energy; dark energy decaying to dark matter; interacting in both directions. Wang and Meng (CQG 22, 283,2005) considered an alternative to the usual approach for the decay law of the Λ-term assuming the effect of the vacuum in the matter expansion rate. The simple manner adopt by the authors unified several current models that includes a vacuum decaying component interacting with matter content. The vacuum component alters the dynamics of the universal expansion process, then is a natural question: how is the influence of the vacuum energy in the gravitational

  19. P/Ge-Wang joins P/Slaughter-Burnham and P/Boethin in the club of comets in 1/1 resonance with Jupiter

    Science.gov (United States)

    Benest, Daniel G.

    Three comets are now known to be at or near the 1/1 resonance with Jupiter: P/Slaughter-Burnham, P/Boethin and the newly discovered P/Ge-Wang. Their orbital evolutions are compared, using the elliptic three-dimensional restricted three-body model sun-Jupiter-comet. Although details of the individual orbits differ, the three comets have very similar general dynamical behaviors, and stay during a long time at or near the 1/1 resonance, at least for several thousand years.

  20. Sun and Sun Worship in Different Cultures

    Science.gov (United States)

    Farmanyan, S. V.; Mickaelian, A. M.

    2014-10-01

    The Sun symbol is found in many cultures throughout history, it has played an important role in shaping our life on Earth since the dawn of time. Since the beginning of human existence, civilisations have established religious beliefs that involved the Sun's significance to some extent. As new civilisations and religions developed, many spiritual beliefs were based on those from the past so that there has been an evolution of the Sun's significance throughout cultural development. For comparing and finding the origin of the Sun we made a table of 66 languages and compared the roots of the words. For finding out from where these roots came from, we also made a table of 21 Sun Gods and Goddesses and proved the direct crossing of language and mythology.

  1. MedSun Reports

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Medical Product Safety Network (MedSun) is an adverse event reporting program launched in 2002. The primary goal for MedSun is to work collaboratively with the...

  2. Seasons by the Sun

    Science.gov (United States)

    Stark, Meri-Lyn

    2005-01-01

    Understanding the Sun has challenged people since ancient times. Mythology from the Greek, Inuit, and Inca cultures attempted to explain the daily appearance and nightly disappearance of the Sun by relating it to a chariot being chased across the sky. While people no longer believe the Sun is a chariot racing across the sky, teachers are still…

  3. Sun and Skin: The Dark Side of Sun Exposure

    Science.gov (United States)

    ... Special Issues Subscribe July 2014 Print this issue Sun and Skin The Dark Side of Sun Exposure ... Screen or Not to Screen? Wise Choices Block Sun Damage Stay in the shade. Limit sun exposure, ...

  4. The ABCs of Chinese Pop: Wang Leehom and the Marketing of a Global Chinese Celebrity

    OpenAIRE

    Grace Wang

    2012-01-01

    How did singer Wang Leehom, a Chinese American raised in the suburbs of New York, end up becoming one of the industry heavyweights of Mandopop (Mandarin-language pop music)? This essay uses Wang as a case study to investigate how discourses of race, market, and belonging are reworked in global contexts. Drawing on Sau-ling Wong’s theoretical insights on transnational processes of race, citizenship, and belonging, it argues that Wang capitalizes on a fluid dynamic of sameness and difference to...

  5. Yue Joseph Wang named Grant A. Dove Professor of Electrical and Computer Engineering

    OpenAIRE

    Owczarski, Mark

    2009-01-01

    Yue Joseph Wang, professor of electrical and computer engineering in the College of Engineering at Virginia Tech, has been named the Grant A. Dove Professor of Electrical and Computer Engineering by the Virginia Tech Board of Visitors.

  6. Why Study the Sun?

    Indian Academy of Sciences (India)

    The importance of the study of the Sun is emphasized as it is the nearest star which presents unparallelled views of surface details and numerous phenomena. Our Sun offers a unique celestial laboratory where a large variety of phenomena take place, ranging in temporal domain from a few milliseconds to several decades, ...

  7. Cryptanalysis of Wang et al.’s lattice-based key exchange protocol

    Directory of Open Access Journals (Sweden)

    Daya Sagar Gupta

    2016-09-01

    Full Text Available Wang et al. proposed a new hard problem on lattices which is an extension of the small integer solution (SIS on lattices. This new generated hard problem is named to be bilateral in-homogeneous small integer solution (Bi-ISIS. Using the hardness of Bi-ISIS, Wang et al. proposed a new key exchange protocol, which is based on the lattice-based cryptography. In this paper, we signalize that Wang et al.’s lattice-based key exchange protocol is vulnerable to an attack, namely, man-in-the-middle (MITM attack. Through this attack, Eavesdropper can intercept the authenticated messages and communicate the unauthentic messages among the communicating parties.

  8. THE SUN OF HOMER

    OpenAIRE

    Revello, Manuela

    2016-01-01

    The purpose of this paper is to outline a clear view of the Iliad and Odyssey data about the Sun, that could lead us beyond purely literary comments. The excursus identifies and analyzes those poems passages that may shed light on the Homeric world 'pre-scientific' knowledge about the Sun. We'll start from the Sun mentioned in the Achilles' Shield, the first description of the cosmos in Western literature. We will talk about his position in space, where it is mentioned after Earth, sea and sk...

  9. Maximising the sun

    CSIR Research Space (South Africa)

    Conradie, Dirk CU

    2010-08-01

    Full Text Available . The French architect Le Corbusier made the name brise-soleil (French: break-sun, from briser to break + soleil sun) popular when he developed the idea of a sun-breaker first proposed for the Durand project in Algiers in 1933. (Encyclopedia Britannica, 2010... charts for the design of sunlight and shade for buildings in South Africa. Capture Press, Pretoria. Encyclopedia Brittanica. 2010. Brise-soleil. http://www.britannica.com/EBchecked/topic/79738/brise-soleil. Accessed 12 August 2010. Holm, D. 2007...

  10. [Wang Yinglin and his answer to the questions of a Korean physician].

    Science.gov (United States)

    Liang, Y

    2000-04-01

    The book named Da Chaoxianyi Wen (Answer to the Questions of a Korean Physician), written in 1624, recorded the written answers of Wang Yinglin, a Chinese official in the Ming dynasty, to the questions of Yin Zhiwei, a Korean official physician. The 24 A&Qs concerned about the therapy of ordinary diseases, channels and the theories of TCM, etc. The study of this book could not only clarify various questions on the exchanges between Wang and Yin, but also learn more information on the development of Korean medicine at that time.

  11. Some Ratio Monotonic Properties of a New Kind of Numbers introduced by Z.-W. Sun

    OpenAIRE

    Sun, Brian Y.

    2015-01-01

    Recently, Z. W. Sun introduced a new kind of numbers $S_n$ and also posed a conjecture on ratio monotonicity of combinatorial sequences related to $S_n$. In this paper, by investigating some arithmetic properties of $S_n$, we give an affirmative answer to his conjecture. Our methods are based on a newly established criterion and interlacing method for log-convexity, and also the criterion for ratio log-concavity of a sequence due to Chen, Guo and Wang.

  12. Sun and Sjogren's Syndrome

    Science.gov (United States)

    ... California, for authoring this Patient Education Sheet. Ultraviolet (UV) radiation emitted from the sun and other light sources ( ... Protect your skin and eyes through use of sunscreen, sunglasses, ultraviolet light-protective clothing, hats, and non- ...

  13. The Sun and Earth

    Science.gov (United States)

    Gopalswamy, Natchimuthuk

    2012-01-01

    Thus the Sun forms the basis for life on Earth via the black body radiation it emits. The Sun also emits mass in the form of the solar wind and the coronal mass ejections (CMEs). Mass emission also occurs in the form of solar energetic particles (SEPs), which happens during CMEs and solar flares. Both the mass and electromagnetic energy output of the Sun vary over a wide range of time scales, thus introducing disturbances on the space environment that extends from the Sun through the entire heliosphere including the magnetospheres and ionospheres of planets and moons of the solar system. Although our habitat is located in the neutral atmosphere of Earth, we are intimately connected to the non-neutral space environment starting from the ionosphere to the magnetosphere and to the vast interplanetary space. The variability of the solar mass emissions results in the interaction between the solar wind plasma and the magnetospheric plasma leading to huge disturbances in the geospace. The Sun ionizes our atmosphere and creates the ionosphere. The ionosphere can be severely disturbed by the transient energy input from solar flares and the solar wind during geomagnetic storms. The complex interplay between Earth's magnetic field and the solar magnetic field carried by the solar wind presents varying conditions that are both beneficial and hazardous to life on earth. This seminar presents some of the key aspects of this Sun-Earth connection that we have learned since the birth of space science as a scientific discipline some half a century ago.

  14. Wang et al., Afr J Tradit Complement Altern Med. (2016) 13(1):134 ...

    African Journals Online (AJOL)

    PROF ADEWUNMI

    GB30) in patients with sciatica, and specific changes in the brain default network (Li et al., 2012). Wang et al. observed the effect of acupuncture Taichong(LR3) and Hegu(LI4) for mild cognitive impairment. (MCI) and Alzheimer diseases (AD), and ...

  15. New Wang-Landau approach to obtain phase diagrams for multicomponent alloys

    Science.gov (United States)

    Takeuchi, Kazuhito; Tanaka, Ryohei; Yuge, Koretaka

    2017-10-01

    We develop an approach to apply the Wang-Landau algorithm to multicomponent alloys in a semi-grand-canonical ensemble. Although the Wang-Landau algorithm has great advantages over conventional sampling methods, there are few applications to alloys. This is because calculating compositions in a semi-grand-canonical ensemble via the Wang-Landau algorithm requires a multidimensional density of states in terms of total energy and compositions, and constructing it is difficult from the viewpoints of both implementation and computational cost. In this study, we develop a simple approach to calculate the alloy phase diagram based on the Wang-Landau algorithm, and show that a number of one-dimensional densities of states could lead to compositions in a semi-grand-canonical ensemble as a multidimensional density of states could. Finally, we apply the present method to Cu-Au and Pd-Rh alloys and confirm that the present method successfully describes the phase diagram with high efficiency, validity, and accuracy.

  16. Lessons from the Sun

    Directory of Open Access Journals (Sweden)

    Robitaille P.-M.

    2011-07-01

    Full Text Available In this brief note, the implications of a condensed Sun will be examined. A celestial body composed of liquid metallic hydrogen brings great promise to astronomy, relative to understanding thermal emission and solar structure. At the same time, as an incom- pressible liquid, a condensed Sun calls into question virtually everything which is cur- rently believed with respect to the evolution and nature of the stars. Should the Sun be condensed, then neutron stars and white dwarfs will fail to reach the enormous densities they are currently believed to possess. Much of cosmology also falls into question, as the incompressibility of matter curtails any thought that a primordial atom once existed. Aging stars can no longer collapse and black holes will know no formative mechanism. A condensed Sun also hints that great strides must still be made in understanding the nature of liquids. The Sun has revealed that liquids possess a much greater potential for lattice order than previously believed. In addition, lessons may be gained with regards to the synthesis of liquid metallic hydrogen and the use of condensed matter as the basis for initiating fusion on Earth.

  17. Magnetohydrodynamics of the sun

    CERN Document Server

    Priest, Eric

    2014-01-01

    Magnetohydrodynamics of the Sun is a completely new up-to-date rewrite from scratch of the 1982 book Solar Magnetohydrodynamics, taking account of enormous advances in understanding since that date. It describes the subtle and complex interaction between the Sun's plasma atmosphere and its magnetic field, which is responsible for many fascinating dynamic phenomena. Chapters cover the generation of the Sun's magnetic field by dynamo action, magnetoconvection and the nature of photospheric flux tubes such as sunspots, the heating of the outer atmosphere by waves or reconnection, the structure of prominences, the nature of eruptive instability and magnetic reconnection in solar flares and coronal mass ejections, and the acceleration of the solar wind by reconnection or wave-turbulence. It is essential reading for graduate students and researchers in solar physics and related fields of astronomy, plasma physics and fluid dynamics. Problem sets and other resources are available at www.cambridge.org/9780521854719.

  18. Go Sun Smart

    Science.gov (United States)

    Scott, Michael D.; Buller, David B.; Walkosz, Barbara J.; Andersen, Peter A.; Cutter, Gary R.; Dignan, Mark B.

    2009-01-01

    This is the story of Go Sun Smart, a worksite wellness program endorsed by the North American Ski Area Association and funded by the National Cancer Institute. Between 2000 and 2002 we designed and implemented a large-scale worksite intervention at over 300 ski resorts in North America with the objective of reducing ski area employees and guests risk for skin cancer by adopting sun safe practices. The following narrative describes the intervention in toto from its design and implementation through assessment. Our theory driven, experimentally tested intervention was successful in reducing employees’ risks for skin cancer during and after the ski season. We also succeeded in making ski area guests more aware of the need to take sun safe precautions with both themselves and their children. PMID:20148119

  19. The turbulent sun

    Science.gov (United States)

    Simnett, G.

    1982-10-01

    The sun is a stable, mediocre star with a diameter of 1.4 x 10 to the 6th km, mass 2 x 10 to the 30th kg, spectral class early G, and not too far removed on the main sequence of the Hertzsprung-Russell diagram from the category of stars known as red dwarfs. It is said to be stable only when it is compared with other stars in the Galaxy, some of which are clearly very unsteady. However, despite its poor showing in the league table of variability, now that the means of probing the sun through the ingenuity of modern science are available, it is discovered that by terrestrial standards the sun is more violent and turbulent than anything which could be conceived by man.

  20. Retraction Statement: 'MicroRNA-218 increases cellular sensitivity to Rapamycin via targeting Rictor in cervical cancer' by Li J, Wang J, Wang Y, Qiu H.

    Science.gov (United States)

    2017-02-01

    The above article from APMIS, published online on 24 April 2015 in Wiley Online Library (wileyonlinelibrary.com) and in Volume 123, pp. 562-570, has been retracted by agreement between the authors, the journal Editors in Chief, Professors Bodil Norrild, Ben Vainer and Elisabeth Ralfkiaer, and John Wiley & Sons Ltd. The article has been retracted due to errors in the reported results. In this study, the authors used HeLa and SiHa cell lines to investigate the biological roles of miR-218. However, subsequently it emerged that the two cell lines were contaminated in the laboratory by other unknown cell lines. When repeating the experiments, it was found that the functions of miR-218 were not as significant as had been previously reported, especially its effects on rapamycin sensitivity. Reference Li J, Li X, Wang J, Wang Y, Qiu H. MicroRNA-218 increases cellular sensitivity to Rapamycin via targeting Rictor in cervical cancer. APMIS 2015; 123:562-570. doi: 10.1111/apm.12387. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  1. Piece of the sun

    CERN Document Server

    Wayne, Teddy

    2015-01-01

    Our rapidly industrialising world has an insatiable hunger for energy, and conventional sources are struggling to meet demand. Oil is running out, coal is damaging our climate, many nations are abandoning nuclear, yet solar, wind and water will never be a complete replacement. The solution, says Daniel Clery in this deeply researched and revelatory book, is to be found in the original energy source: the Sun itself. There, at its centre, the fusion of 630 million tonnes of hydrogen every second generates an unfathomable amount of energy. By replicating even a tiny piece of the Sun's power

  2. Sun, Earth and Sky

    CERN Document Server

    Lang, Kenneth R

    2006-01-01

    This Second Edition of Sun, Earth and Sky updates the popular text by providing comprehensive accounts of the most recent discoveries made by five modern solar spacecraft during the past decade. Their instruments have used sound waves to peer deep into the Sun’s inner regions and measure the temperature of its central nuclear reactor, and extended our gaze far from the visible Sun to record energetic outbursts that threaten Earth. Breakthrough observations with the underground Sudbury Neutrino Observatory are also included, which explain the new physics of ghostly neutrinos and solve the problematic mismatch between the predicted and observed amounts of solar neutrinos. This new edition of Sun, Earth and Sky also describes our recent understanding of how the Sun’s outer atmosphere is heated to a million degrees, and just where the Sun’s continuous winds come from. As humans we are more intimately linked with our life-sustaining Sun than with any other astronomical object, and the new edition therefore p...

  3. Sun Ultra 5

    CERN Multimedia

    1998-01-01

    The Sun Ultra 5 is a 64-bit personal computer based on the UltraSPARC microprocessor line at a low price. The Ultra 5 has been declined in several variants: thus, some models have a processor with less cache memory to further decrease the price of the computer.

  4. The Sun in Time

    Science.gov (United States)

    Adams, Mitzi L.; Bero, Elizabeth; Sever, Thomas L.

    1999-01-01

    Leveraging funds from NASA's Initiative to Develop Education through Astronomy and Space Science (IDEAS) program, we combined the expertise of an archaeoastronomer, a solar scientist, and a teacher to trace humankind's view of the Sun and how that has changed, from the time of Stonehenge in about 1800 B.C.E., to the time of the Maya in 700 C.E., up to the modem era. Our program was aimed at middle-school students in an attempt to explain not only how science is done today, but how science has evolved from the observations of ancient societies. From these varied cultures, we touched on methods of observing the Sun, ideas of the composition of the Sun, and the relationship of the Sun to everyday life. Further, using the von Braun Astronomical Society's Planetarium in Huntsville, Alabama as a test-bed for the program, we illustrated concepts such as solstices, equinoxes, and local noon with approximately 800 eighth grade students from the local area. Our presentation to SEPA will include a description of NASA's IDEAS program and how to go about partnering with a NASA astronomer, some slides from our planetarium program and web-site, and some hands-on activities.

  5. Sun and shade

    CSIR Research Space (South Africa)

    Conradie, Dirk CU

    2017-12-01

    Full Text Available South Africa is blessed with some of the best quality sunshine in the world but at the same time has some of the most intense solar radiation. There are therefore many exciting opportunities to utilize the sun to its full potential in the design...

  6. Our Explosive Sun

    Science.gov (United States)

    Brown, D. S.

    2009-01-01

    The Sun's atmosphere is a highly structured but dynamic place, dominated by the solar magnetic field. Hot charged gas (plasma) is trapped on lines of magnetic force that can snap like an elastic band, propelling giant clouds of material out into space. A range of ground-based and space-based solar telescopes observe these eruptions, particularly…

  7. Licensing the Sun

    Science.gov (United States)

    Demski, Jennifer

    2013-01-01

    The University of San Diego (USD) and Point Loma Nazarene University (PLNU) are licensing the sun. Both California schools are generating solar power on campus without having to sink large amounts of capital into equipment and installation. By negotiating power purchasing agreements (PPAs) with Amsolar and Perpetual Energy Systems, respectively,…

  8. VizieR Online Data Catalog: Kepler multiple transiting planet systems (Wang+, 2015)

    Science.gov (United States)

    Wang, J.; Fischer, D. A.; Xie, J.-W.; Ciardi, D. R.

    2017-10-01

    The sample of MTPSs remains the same as that in Wang et al. (2014, J/ApJ/783/4). From the NASA Exoplanet Archive (http://exoplanetarchive.ipac.caltech.edu), we select Kepler objects of interest (KOIs) that satisfy the following criteria: (1) disposition of either Candidate or Confirmed; (2) with at least two planet candidates; (3) Kepler magnitude (KP) brighter than 13.5. The above selection criteria resulted in 138 MTPSs in Wang et al. (2014, J/ApJ/783/4). With the updated Exoplanet Archive, the selection criteria resulted in 208 MTPSs. In this paper, we focus on the 138 MTPSs to be consistent with previous work. (4 data files).

  9. Becoming an International Scientist in South Korea: Ho Wang Lee's Research Activity about Epidemic Hemorrhagic Fever.

    Science.gov (United States)

    Shin, Miyoung

    2017-04-01

    In the 1960-70s, South Korea was still in the position of a science latecomer. Although the scientific research environment in South Korea at that time was insufficient, there was a scientist who achieved outcomes that could be recognized internationally while acting in South Korea. He was Ho Wang Lee(1928~ ) who found Hantann Virus that causes epidemic hemorrhagic fever for the first time in the world. It became a clue to identify causative viruses of hemorrhagic diseases that were scattered here and there throughout the world. In addition, these outcomes put Ho Wang Lee on the global center of research into epidemic hemorrhagic fever. This paper examines how a Korean scientist who was in the periphery of virology could go into the central area of virology. Also this article shows the process through which the virus found by Ho Wang Lee was registered with the international academia and he proceeded with follow-up research based on this progress to reach the level at which he generalized epidemic hemorrhagic fever related studies throughout the world. While he was conducting the studies, experimental methods that he had never experienced encountered him as new difficulties. He tried to solve the new difficulties faced in his changed status through devices of cooperation and connection. Ho Wang Lee's growth as a researcher can be seen as well as a view of a researcher that grew from a regional level to an international level and could advance from the area of non-mainstream into the mainstream. This analytic tool is meaningful in that it can be another method of examining the growth process of scientists in South Korea or developing countries.

  10. Morphology and geochemistry of placer gold from Wang River, Lampang Province, Northern Thailand

    Science.gov (United States)

    Lim, D.; Lee, I.

    2011-12-01

    Wang River (Mae Nam Wang) in Lampang Province, Northern Thailand which is surrounded with many lode gold deposits has potential to develop as a placer gold deposit. Gold particles from 10 sites in Wang River range from fine to coarse (electrum or high purity gold with high fineness (1000Au/Au+Ag) levels up to 951 as well as a minor amount of Cu and Hg. Normally, the zoning patterns of Au and Ag are common in placer gold and the high fineness in rim can be explained by either selective extraction of Ag or precipitation of Au. However, there is no significant difference in fineness between core and rim in gold grains in this study even though there are differences in composition among grains. Many cavities are also shown filling with silicate and/or clay mineral in microtextures. These geochemical signatures from microtextures are capable of providing genetic implication. Furthermore, the combination of results such as shape parameter, geochemical signature, and assemblages of heavy minerals can be a useful tool in exploration for gold.

  11. The ABCs of Chinese Pop: Wang Leehom and the Marketing of a Global Chinese Celebrity

    Directory of Open Access Journals (Sweden)

    Grace Wang

    2012-06-01

    Full Text Available How did singer Wang Leehom, a Chinese American raised in the suburbs of New York, end up becoming one of the industry heavyweights of Mandopop (Mandarin-language pop music? This essay uses Wang as a case study to investigate how discourses of race, market, and belonging are reworked in global contexts. Drawing on Sau-ling Wong’s theoretical insights on transnational processes of race, citizenship, and belonging, it argues that Wang capitalizes on a fluid dynamic of sameness and difference to appeal to a heterogeneous Chinese-speaking audience that stretches across China to Taiwan, Hong Kong, Southeast Asia, and the greater Chinese diaspora. Through an examination of the racial and national contexts that frame Wang’s participation in Mandopop, this essay analyzes the particular calibrations of Chineseness that emerge from the singer’s music and public image and the imperfect translation of identities such as Chinese American, Chinese diasporic, and Chinese across diverse linguistic and national communities.

  12. The Sun from Space

    CERN Document Server

    Lang, Kenneth R

    2009-01-01

    This volume is a comprehensive, up-to-date account of solar astrophysics and how our perception and knowledge of this star have evolved as mankind has elucidated ever more of its mysteries. The emphasis of this second edition of The Sun from Space is on the last decade, which includes the findings of the SOHO, Ulysses, and Yohkoh solar spacecraft missions over an entire 11-year cycle of solar activity, the results of the RHESSI solar spacecraft launched during this interval, the early findings of the recently launched Hinode and STEREO solar spacecraft, and the ACE and Wind spacecraft that extend our investigations of the Sun to its varying input to Earth over the past ten years.

  13. SCIENCE OF SUN PHOTOMETRY

    Directory of Open Access Journals (Sweden)

    Alexandru Dan Toma

    2013-07-01

    Full Text Available Typically, the total amount of gases and particles in a column of atmosphere cannot be determined from measurements just at Earth's surface, by a single measurement essentially at the bottom of the atmosphere column. Balloons, airplanes, and rockets are all used to perform direct measurements in the atmosphere at altitudes up to and beyond the stratosphere. Satellite-based instruments provide global views, but it is difficult to infer surface and column distributions from space-based measurements, so such measurements must still be supplemented by ground-based measurements. Sun photometry is an important way of probing the atmosphere from the ground to measure the effects of the atmosphere on Sun radiation crossing through the atmosphere to Earth's surface. These indirect technique provide information about the entire atmosphere above the observer, not just the atmosphere that can be sampled directly close to Earth's surface.

  14. Seismology of the sun

    Science.gov (United States)

    Christensen-Dalsgaard, J.; Gough, D.; Toomre, J.

    1985-01-01

    The use of the sun's oscillations, caused by the constructive interference between internally reflected waves, to study the interior of the sun is examined. Pressure and buoyancy have the strongest influence on oscillations; pressure fluctuations at high frequency produce acoustic waves and at low frequency buoyancy produces internal gravity waves. The theory of acoustic wave frequency, which is used to determine measurements of sound speed and rate of rotation of the solar interior as well as the thickness of the convection zone, is presented. The classification of solar oscillations is described. The models for acoustic modes of low degree and intermediate degree are discussed. The effect of internal speed, gravity modes, and solar rotation on solar models is determined. The oscillation frequencies yield an He abundance that is consistent with cosmology, but they reinforce the severity of the neutrino problem.

  15. The sun compass revisited

    Science.gov (United States)

    Guilford, Tim; Taylor, Graham K.

    2014-01-01

    Many animals, and birds in particular, are thought to use directional information from the sun in the form of a time-compensated sun compass, with predictably deviated orientation under clock shift being regarded as the litmus test of this. We suggest that this paradigm obscures a number of other ways in which solar-derived information could be important in animal orientation. We distinguish between the known use of the sun's azimuth to provide absolute geographical direction (compass mechanism) and its possible use to detect changes in heading (heading indicator mechanism). Just as in an aircraft, these two kinds of information may be provided by separate mechanisms and used for different functions, for example for navigation versus steering. We also argue that although a solar compass must be time-referenced to account for the sun's apparent diurnal movement, this need not entail full time compensation. This is because animals might also use time-dependent solar information in an associatively acquired, and hence time-limited, way. Furthermore, we show that a solar heading indicator, when used on a sufficiently short timescale, need not require time compensation at all. Finally, we suggest that solar-derived cues, such as shadows, could also be involved in navigation in ways that depend explicitly upon position, and are therefore not strictly compass-related. This could include giving directionality to landmarks, or acting as time-dependent landmarks involved in place recognition. We conclude that clock shift experiments alone are neither necessary nor sufficient to identify the occurrence of all conceivable uses of solar information in animal orientation, so that a predictable response to clock shift should not be regarded as an acid test of the use of solar information in navigation. PMID:25389374

  16. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-06-01

    Full Text Available Weiyi Huang,* Haihua Huang,* Lei Wang, Jiong Hu, Weifeng Song Department of Oncology, The First People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Cytoskeleton is critical for carcinoma cell proliferation, migration, and invasion. Sad-1 and UNC-84 domain containing 1 (SUN1 is one of the core linkers of nucleoskeleton and cytoskeleton. However, the functions of SUN1 in lung adenocarcinoma are largely unknown.Methods: In this study, we first transduced the lentivirus delivering the short hairpin RNA (shRNA against SUN1 to lung adenocarcinoma cells (A549 and 95D cells with high efficiency. After lentivirus infection, quantitative real-time polymerase chain reaction and Western blotting were used to detect the expressions of SUN1 mRNA and protein. The cell proliferation and colony formation were detected by MTT assay and colony formation assay, respectively. The cell distribution in the cell cycle was analyzed by flow cytometry.Results: Both mRNA and protein levels of SUN1 were significantly decreased in A549 and 95D cells after lentivirus infection, as indicated by quantitative real-time polymerase chain reaction and Western blot. Next, we found that cell proliferation and colony formation were markedly reduced in SUN1 silenced cells. Moreover, suppression of SUN1 led to cell cycle arrest at G0/G1 phase. Furthermore, Cyclin D1, CDK6, and CDK2 expressions were obviously reduced in A549 cells after SUN1 silencing.Conclusion: These results suggest that SUN1 plays an essential role in proliferation of lung adenocarcinoma cells in vitro and may be used as a potential therapeutic target for the treatment of lung adenocarcinoma in the future. Keywords: SUN1, lung cancer, proliferation

  17. Sun, UV Radiation and Your Eyes

    Science.gov (United States)

    ... Eye Health / Tips & Prevention Your Eyes and the Sun Sections The Sun, UV Radiation and Your Eyes ... Best Sunglasses Sun Smart UV Safety Infographic The Sun, UV Radiation and Your Eyes Leer en Español: ...

  18. Security analysis of boolean algebra based on Zhang-Wang digital signature scheme

    Science.gov (United States)

    Zheng, Jinbin

    2014-10-01

    In 2005, Zhang and Wang proposed an improvement signature scheme without using one-way hash function and message redundancy. In this paper, we show that this scheme exits potential safety concerns through the analysis of boolean algebra, such as bitwise exclusive-or, and point out that mapping is not one to one between assembly instructions and machine code actually by means of the analysis of the result of the assembly program segment, and which possibly causes safety problems unknown to the software.

  19. Conodont index fossil Hindeodus changxingensis Wang fingers greatest mass extinction event

    Science.gov (United States)

    Metcalfe, I.; Nicoll, R.S.; Wardlaw, B.R.

    2007-01-01

    The marine conodont fossil species, Hindeodus changxingensis Wang, that has a distinctive morphology, is restricted to a very narrow stratigraphic interval essentially from the Permian-Triassic extinction event through the internationally recognized boundary and into the very earliest Triassic. The species is geographically widespread in the Tethyan Region, from Italy to South China, and serves as a characteristic index fossil to reliably identify this short but critical interval that encompasses the greatest mass extinction of life on earth and the boundary between the Paleozoic and Mesozoic Eras. ?? 2007 Nanjing Institute of Geology and Palaeontology, CAS.

  20. The Sun's Supergranulation

    Science.gov (United States)

    Rieutord, Michel; Rincon, François

    2010-06-01

    The Sun's supergranulation refers to a physical pattern covering the surface of the quiet Sun with a typical horizontal scale of approximately 30,000 km and a lifetime of around 1.8 d. Its most noticeable observable signature is as a fluctuating velocity field of 360 m st-1 rms whose components are mostly horizontal. Supergranulation was discovered more than fifty years ago, however explaining why and how it originates still represents one of the main challenges of modern solar physics. A lot of work has been devoted to the subject over the years, but observational constraints, conceptual difficulties and numerical limitations have all concurred to prevent a detailed understanding of the supergranulation phenomenon so far. With the advent of 21st century supercomputing resources and the availability of unprecedented high-resolution observations of the Sun, a stage at which key progress can be made has now been reached. A unifying strategy between observations and modelling is more than ever required for this to be possible. The primary aim of this review is therefore to provide readers with a detailed interdisciplinary description of past and current research on the problem, from the most elaborate observational strategies to recent theoretical and numerical modelling efforts that have all taken up the challenge of uncovering the origins of supergranulation. Throughout the text, we attempt to pick up the most robust findings so far, but we also outline the difficulties, limitations and open questions that the community has been confronted with over the years. In the light of the current understanding of the multiscale dynamics of the quiet photosphere, we finally suggest a tentative picture of supergranulation as a dynamical feature of turbulent magnetohydrodynamic convection in an extended spatial domain, with the aim of stimulating future research and discussions.

  1. The Sun in Time

    Science.gov (United States)

    Adams, Mitzi L.; Sever, Thomas L.; Bero, Elizabeth

    1998-01-01

    Using a grant from NASA's Initiative to Develop Education through Astronomy and Space Science (IDEAS) program, we have developed an inter-disciplinary curriculum for middle-school students which targets both history and astronomy. Our curriculum explores the attitudes and techniques of ancient spiritual leaders, specifically those of the Maya and Inca cultures, who observed and tried to control the Sun. We wish students to understand the probable importance of astronomical observations to these ancient peoples. In addition, using the experience of an archaeologist, we show how modern techniques of viewing the Earth through satellite imagery, has allowed the re-discovery of ancient sites where solar observations and attempted manipulation of the universe took place. To contrast ancient observations of the Sun with modern ones, we use the experience of a solar astronomer and bring to the classroom up-to-date information about solar astronomy and the impact of solar activity on the Earth's environment. In this presentation, we will present fragments of our curriculum as well as results from pre- and post-tests given to participating groups of students. Finally, we will discuss comments from local middle-school teachers who were asked to evaluate our curriculum.

  2. The validated sun exposure questionnaire

    DEFF Research Database (Denmark)

    Køster, B; Søndergaard, J; Nielsen, J B

    2017-01-01

    Few questionnaires used in monitoring sun-related behavior have been tested for validity. We established criteria validity of a developed questionnaire for monitoring population sun-related behavior. During May-August 2013, 664 Danes wore a personal electronic UV-dosimeter for one week...... that measured the outdoor time and dose of erythemal UVR exposure. In the following week, they answered a questionnaire on their sun-related behavior in the measurement week. Outdoor time measured by dosimetry correlated strongly with both outdoor time and the developed exposure scale measured....... The weekly sunburn fraction correlated strongly with the number of ambient sun hours (r=0.73, p

  3. Sun light European Project

    Science.gov (United States)

    Soubielle, Marie-Laure

    2015-04-01

    2015 has been declared the year of light. Sunlight plays a major role in the world. From the sunbeams that heat our planet and feed our plants to the optical analysis of the sun or the modern use of sun particles in technologies, sunlight is everywhere and it is vital. This project aims to understand better the light of the Sun in a variety of fields. The experiments are carried out by students aged 15 to 20 in order to share their discoveries with Italian students from primary and secondary schools. The experiments will also be presented to a group of Danish students visiting our school in January. All experiments are carried out in English and involve teams of teachers. This project is 3 folds: part 1: Biological project = what are the mechanisms of photosynthesis? part 2: Optical project= what are the components of sunlight and how to use it? part 3: Technical project= how to use the energy of sunlight for modern devices? Photosynthesis project Biology and English Context:Photosynthesis is a process used by plants and other organisms to convert light energy, normally from the Sun, into chemical energy that can later fuel the organisms' activities. This chemical energy is stored in molecules which are synthesized from carbon dioxide and water. In most cases, oxygen is released as a waste product. Most plants perform photosynthesis. Photosynthesis maintains atmospheric oxygen levels and supplies all of the organic compounds and most of the energy necessary for life on Earth. Outcome: Our project consists in understanding the various steps of photosynthesis. Students will shoot a DVD of the experiments presenting the equipments required, the steps of the experiments and the results they have obtained for a better understanding of photosynthesis Digital pen project Electricity, Optics and English Context: Sunlight is a complex source of light based on white light that can be decomposed to explain light radiations or colours. This light is a precious source to create

  4. Physics of the sun

    CERN Document Server

    Holzer, Thomas; Mihalas, Dimitri; Ulrich, Roger

    1986-01-01

    This volume, together with its two companion volumes, originated in a study commis­ sioned by the United States National Academy of Sciences on behalf of the National Aeronautics and Space Administration. A committee composed of Tom Holzer, Dimitri Mihalas, Roger Ulrich and myself was asked to prepare a comprehensive review of current knowledge concerning the physics of the sun. We were fortunate in being able to persuade many distinguished scientists to gather their forces for the preparation of 21 separate chapters covering not only solar physics but also relevant areas of astrophysics and solar-terrestrial relations. It proved necessary to divide the chapters into three separate volumes that cover three different aspects of solar physics. Volumes 1 and 2 are concerned with 'The Solar Interior' and with 'The Solar Atmosphere'. This volume, devoted to 'Astrophysics and Solar-Terrestrial Relations', focuses on problems of solar physics from these two different but complementary perspectives. The emphasis thr...

  5. Why the sun sucks - Architects versus the sun

    NARCIS (Netherlands)

    De Lange, N.; Niesten, J.; Taminiau, P.

    2014-01-01

    This "designers' manual" is made during the TIDO-course AR0531 Innovation and Sustainability This manual will show how not to design with the Sun. By showing examples how buildings have failed that have not taken the Sun and its effects in consideration, one should get a clearer picture of how you

  6. mechanical sun mechanical sun-tracking techn tracking techn power ...

    African Journals Online (AJOL)

    User

    solar system must be adjusted so that it is alw aimed precisely at the sun and, as a result, produ the maximum possible power. In order maximum power output from PV cells, the sunlig angle of incidence needs to be consta perpendicular to the solar panel. This requ constant tracking of the sun's apparent dayt motion, and ...

  7. Interview with Xiaoli Wang PhD winner of CACA 2016 Young Investigator Award

    Directory of Open Access Journals (Sweden)

    Xiaoli Wang

    2016-07-01

    Full Text Available Xiaoli Wang is currently an R&D Senior Scientist in Agilent’s HPLC instrument R&D group at Agilent Technologies, Waldbronn, Germany. Prior to this, he was an R&D manager in Agilent’s CrossLab Group in the US focusing on development of novel chromatographic columns. He has a B.S. degree in Chemistry from Peking University, Beijing China and a PhD. degree in Analytical Chemistry from the University of Minnesota in 2006. He started his industrial career in the pharmaceutical industry at AstraZeneca for four years before joining Agilent Technologies in 2010. Recently, he won the prestigious 2016 Young Investigator Award from Chinese American Chromatography Association (CACA. This interview was conducted by Roland J.W. Meesters PhD, Editor-in-Chief of Journal of Applied Bioanalysis.

  8. Entropy of diluted antiferromagnetic Ising models on frustrated lattices using the Wang-Landau method.

    Science.gov (United States)

    Shevchenko, Yuriy; Nefedev, Konstantin; Okabe, Yutaka

    2017-05-01

    We use a Monte Carlo simulation to study the diluted antiferromagnetic Ising model on frustrated lattices including the pyrochlore lattice to show the dilution effects. Using the Wang-Landau algorithm, which directly calculates the energy density of states, we accurately calculate the entropy of the system. We discuss the nonmonotonic dilution concentration dependence of residual entropy for the antiferromagnetic Ising model on the pyrochlore lattice, and compare it to the generalized Pauling approximation proposed by Ke et al. [Phys. Rev. Lett. 99, 137203 (2007)PRLTAO0031-900710.1103/PhysRevLett.99.137203]. We also investigate other frustrated systems, the antiferromagnetic Ising model on the triangular lattice and the kagome lattice, demonstrating the difference in the dilution effects between the system on the pyrochlore lattice and that on other frustrated lattices.

  9. Density of states for systems with multiple order parameters: a constrained Wang-Landau method

    Science.gov (United States)

    Chan, Chor-Hoi; Brown, Gregory; Rikvold, Per Arne

    2017-11-01

    A macroscopically constrained Wang-Landau Monte Carlo method was recently proposed to calculate the joint density of states (DOS) for systems with multiple order parameters. Here we demonstrate results for a nearest-neighbor Ising antiferromagnet with ferromagnetic long-range interactions (a model spin-crossover material). Its two relevant order parameters are the magnetization M and the staggered magnetization M s. The joint DOS, g(E, M, M s) where E is the total system energy, is calculated for zero external field and long-range interaction strength, and then obtained for arbitrary values of these two field-like model parameters by a simple transformation of E. Illustrations are shown for several parameter sets.

  10. Global seismology of the Sun

    Directory of Open Access Journals (Sweden)

    Sarbani Basu

    2016-08-01

    Full Text Available Abstract The seismic study of the Sun and other stars offers a unique window into the interior of these stars. Thanks to helioseismology, we know the structure of the Sun to admirable precision. In fact, our knowledge is good enough to use the Sun as a laboratory. We have also been able to study the dynamics of the Sun in great detail. Helioseismic data also allow us to probe the changes that take place in the Sun as solar activity waxes and wanes. The seismic study of stars other than the Sun is a fairly new endeavour, but we are making great strides in this field. In this review I discuss some of the techniques used in helioseismic analyses and the results obtained using those techniques. I focus on results obtained with global helioseismology, i.e., the study of the Sun using its normal modes of oscillation. I also briefly touch upon asteroseismology, the seismic study of stars other than the Sun, and discuss how seismic data of others stars are interpreted.

  11. Clustering of Sun Exposure Measurements

    DEFF Research Database (Denmark)

    Have, Anna Szynkowiak; Larsen, Jan; Hansen, Lars Kai

    2002-01-01

    In a medically motivated Sun-exposure study, questionnaires concerning Sun-habits were collected from a number of subjects together with UV radiation measurements. This paper focuses on identifying clusters in the heterogeneous set of data for the purpose of understanding possible relations between...

  12. Understanding the Sun: Borexino

    Energy Technology Data Exchange (ETDEWEB)

    Ianni, Aldo, E-mail: aldo.ianni@lngs.infn.i [INFN Laboratori Nazionali del Gran Sasso, SS 17 bis Km 18-910, 67010 Assergi (Italy)

    2010-01-01

    Solar neutrinos have been detected over the past 40 years providing the first evidence of physics beyond the Standard Model for elementary particle interactions. The hypothesis of neutrino oscillations has offered a solution to the long-standing solar neutrino problem (missing solar neutrinos). The Solar Standard Model is a fundamental ingredient in the interpretation of the solar neutrino measurements. New determinations of solar metal abundances caused the Solar Standard Model predictions to be in conflict with helioseismological measurements. The direct measurement of {sup 7}Be solar neutrinos performed by the Borexino experiment at the Gran Sasso Underground Laboratory allows to probe the Solar Standard Model assuming the neutrino oscillation scenario. At present Borexino has measured {sup 7}Be solar neutrinos at the level of 10%. In the near future a measurement at the level of 5-3% could be achieved. This accuracy could allow to determine the metal abundances at the center of the Sun. In this framework solar neutrinos offer an independent method to determine the source of the conflict between Solar Standard Model and helioseismology. The Borexino results are presented and discussed in the framework of the Solar Standard Model and neutrino oscillations.

  13. Totality eclipses of the Sun

    CERN Document Server

    Littmann, Mark; Willcox, Ken

    2008-01-01

    A total eclipse of the Sun is the most awesome sight in the heavens. Totality: Eclipses of the Sun takes you to eclipses of the past, present, and future, and lets you see - and feel - why people travel to the ends of the Earth to observe them. - ;A total eclipse of the Sun is the most awesome sight in the heavens. Totality: Eclipses of the Sun takes you to eclipses of the past, present, and future, and lets you see - and feel - why people travel to the ends of the Earth to observe them. Totality: Eclipses of the Sun is the best guide and reference book on solar eclipses ever written. It explains: how to observe them; how to photograph and videotape them; why they occur; their history and mythology; and future eclipses - when and where to see them. Totality also tells the remarkable story of how eclipses shocked scientists, revealed the workings of the Sun, and made Einstein famous. And the book shares the experiences and advice of many veteran eclipse observers. Totality: Eclipses of the Sun is profusely ill...

  14. Novel functions of SUN1

    OpenAIRE

    Li, Ping

    2015-01-01

    Mutations in several genes encoding nuclear envelope associated proteins cause Emery-Dreifuss muscular dystrophy (EDMD). We analyzed fibroblasts from a patient who had a mutation in the EMD gene (p.L84Pfs*6) leading to loss of Emerin and a heterozygous mutation in SUN1 (p.A203V). The second patient harbored a heterozygous mutation in LAP2alpha (p.P426L) and a further mutation in SUN1 (p.A614V). p.A203V is located in the N-terminal domain of SUN1 facing the nucleoplasm and situated in the vici...

  15. Sun tracking systems: a review.

    Science.gov (United States)

    Lee, Chia-Yen; Chou, Po-Cheng; Chiang, Che-Ming; Lin, Chiu-Feng

    2009-01-01

    The output power produced by high-concentration solar thermal and photovoltaic systems is directly related to the amount of solar energy acquired by the system, and it is therefore necessary to track the sun's position with a high degree of accuracy. Many systems have been proposed to facilitate this task over the past 20 years. Accordingly, this paper commences by providing a high level overview of the sun tracking system field and then describes some of the more significant proposals for closed-loop and open-loop types of sun tracking systems.

  16. Multi-GPU-based Swendsen-Wang multi-cluster algorithm with reduced data traffic

    Science.gov (United States)

    Komura, Yukihiro

    2015-10-01

    The computational performance of multi-GPU applications can be degraded by the data communication between each GPU. To realize high-speed computation with multiple GPUs, we should minimize the cost of this data communication. In this paper, I propose a multiple GPU computing method for the Swendsen-Wang (SW) multi-cluster algorithm that reduces the data traffic between each GPU. I realize this reduction in data traffic by adjusting the connection information between each GPU in advance. The code is implemented on the large-scale open science TSUBAME 2.5 supercomputer, and its performance is evaluated using a simulation of the three-dimensional Ising model at the critical temperature. The results show that the data communication between each GPU is reduced by 90%, and the number of communications between each GPU decreases by about half. Using 512 GPUs, the computation time is 0.005 ns per spin update at the critical temperature for a total system size of N =40963.

  17. Somatic embryogenesis and enhanced shoot organogenesis in Metabriggsia ovalifolia W. T. Wang

    Science.gov (United States)

    Ouyang, Yao; Chen, Yulu; Lü, Jinfeng; Teixeira da Silva, Jaime A.; Zhang, Xinhua; Ma, Guohua

    2016-01-01

    An efficient protocol providing a dual regeneration pathway via direct shoot organogenesis and somatic embryogenesis for an endangered species, Metabriggsia ovalifolia W. T. Wang, was established from leaf explants. When applied at 2.5 μM, the cytokinins 6-benzyladenine (BA) or thidiazuron (TDZ) and the auxins indole-3-butyric acid (IBA), α-naphthaleneacetic acid (NAA) and indole-3-acetic acid (IAA) could induce shoots when on basal Murashige and Skoog (MS) medium. BA and TDZ could induce more adventitious shoots (19.1 and 31.2/explant, respectively) than NAA (4.6/explant), IBA (5.7/explant) or IAA (6.4/explant). BA and TDZ at 5–10 μM could induce both shoots and somatic embryos. A higher concentration of TDZ (25 μM) induced only somatic embryos (39.8/explant). The same concentration of BA induced both adventitious shoots (23.6/explant) and somatic embryos (9.7/explant). Thus, somatic embryogenesis in this plant needs a high cytokinin concentration (BA; TDZ), as evidenced by histology. Somatic embryos germinated easily when left on the same media, but formed adventitious roots in two weeks on MS supplemented with 0.5 μM NAA, 0.5 μM IBA and 0.1% activated charcoal. Over 93% of plantlets survived following acclimatization and transfer to a mixture of sand and vermiculite (1:1, v/v) in trays. PMID:27090564

  18. NEW SUNS IN THE COSMOS?

    Energy Technology Data Exchange (ETDEWEB)

    De Freitas, D. B.; Leao, I. C.; Lopes, C. E. Ferreira; Paz-Chinchon, F.; Canto Martins, B. L.; Alves, S.; De Medeiros, J. R. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Catelan, M. [Departamento de Astronomia y Astrofisica, Pontificia Universidad Catolica de Chile, Av. Vicuna Mackenna 4860, 782-0436 Macul, Santiago (Chile)

    2013-08-20

    The present work reports on the discovery of three stars that we have identified to be rotating Sun-like stars, based on rotational modulation signatures inferred from light curves from the CoRoT mission's Public Archives. In our analysis, we performed an initial selection based on the rotation period and position in the period-T{sub eff} diagram. This revealed that the stars CoRoT IDs 100746852, 102709980, and 105693572 provide potentially good matches to the Sun with a similar rotation period. To refine our analysis, we applied a novel procedure, taking into account the fluctuations of the features associated with photometric modulation at different time intervals and the fractality traces that are present in the light curves of the Sun and of these ''New Sun'' candidates alike. In this sense, we computed the so-called Hurst exponent for the referred stars, for a sample of 14 CoRoT stars with sub- and super-solar rotational periods, and for the Sun itself in its active and quiet phases. We found that the Hurst exponent can provide a strong discriminant of Sun-like behavior, going beyond what can be achieved with solely the rotation period itself. In particular, we find that CoRoT ID 105693572 is the star that most closely matches the solar rotation properties as far as the latter's imprints on light curve behavior are concerned. The stars CoRoT IDs 100746852 and 102709980 have significant smaller Hurst exponents than the Sun, notwithstanding their similarity in rotation periods.

  19. SunShot Initiative Portfolio Book 2014

    Energy Technology Data Exchange (ETDEWEB)

    Solar Energy Technologies Office

    2014-05-01

    The 2014 SunShot Initiative Portfolio Book outlines the progress towards the goals outlined in the SunShot Vision Study. Contents include overviews of each of SunShot’s five subprogram areas, as well as a description of every active project in the SunShot’s project portfolio as of May 2014.

  20. Activity of the Baby Sun

    Science.gov (United States)

    Katsova, M. M.; Livshits, M. A.; Mishenina, T. V.; Nizamov, B. A.

    2017-05-01

    An analysis of the X-ray radiation of G-stars shows that the youngest fast rotating stars are characterized by saturation of activity, but part of stars demonstrate the solar-type activity, starting from rotational periods of 1.4 days. This type of activity, the level of which is determined by the rate of axial rotation, includes the formation of spots, flares and etc; first, activity is irregular, and only then there are conditions for the formation of cycles. The Kepler data show that stars of the same spectral type demonstrate two activity levels. This bimodality of different distributions of stars, change in a character of cycles and a level of Жiзнь i Bceлeннaya flare activity are evidences for an evolution of activity versus the age. By the nature of activity, we call conditionally G-dwarfs with rotation periods from 1 day to 5-6 days by the term "the Baby Sun" (the maximal number of these stars has Prot = 3 d), and we refer G-stars with Prot from 10 to 18 days to "the Young Suns". Ages of the main amount of the Baby Sun are around 200-600 Myr and the Young Sun are of about 1-2 Gyr. The Baby Suns are characterized by enhanced lithium content. We estimate the quasi-stationary X-ray and farultraviolet radiation of the outer atmosphere of the Baby Sun. From the GALEX data we obtain the FUV flux in the range 1350-1750 A for this kind of stars at the distance of 1 AU is 12.8 ± 4.2 erg/(cm^2 c), that exceeds the FUV-flux of the contemporary Sun by more than 6 times. The Kepler data demonstrate that the superflares happen more often namely on the Baby Suns. Our estimate is that superflares of the total energies 10^35 erg occur on the Baby Sun of about one per year.

  1. Sun Exposure and Psychotic Experiences

    Directory of Open Access Journals (Sweden)

    Izabela Pilecka

    2017-06-01

    Full Text Available ObjectiveSun exposure is considered the single most important source of vitamin D. Vitamin D deficiency has been suggested to play a role in the etiology of psychotic disorders. The aim of the present study was to evaluate the association between sun exposure and psychotic experiences (PEs in a general population sample of Swedish women.MethodsThe study population included participants from The Swedish Women’s Lifestyle and Health cohort study. The 20-item community assessment of psychic experiences (CAPEs was administered between ages 30 and 50 to establish PEs. Sun exposure as measured by (1 sunbathing holidays and (2 history of sunburn was measured between ages 10 and 39. The association between sun exposure and PEs was evaluated by quantile regression models.Results34,297 women were included in the analysis. Women who reported no sunbathing holidays and 2 or more weeks of sunbathing holidays scored higher on the CAPE scale than women exposed to 1 week of sunbathing holidays across the entire distribution, when adjusting for age and education. Similarly, compared with women who reported a history of one sunburn, the women with none or two or more sunburns showed higher scores on the CAPE scale.ConclusionThe results of the present study suggest that, in a population-based cohort of middle aged women, both low and high sun exposure is associated with increased level of positive PEs.

  2. Tang Wang Ming Mu Granule Attenuates Diabetic Retinopathy in Type 2 Diabetes Rats

    Science.gov (United States)

    Chen, Mingxia; Lv, Haibo; Gan, Jiakuan; Ren, Junguo; Liu, Jianxun

    2017-01-01

    Aims: This study aimed to determine the influence of Tang Wang Ming Mu granule (TWMM) on the diabetic retinopathy of diabetic rats. Methods: Male Wistar rats were divided into seven groups: normal control, diabetes model(DM), diabetes with TWMM (3.6, 7.2, and 14.4 g/kg) treatment, the positive control treatment groups of Qi Ming granules and Calcium dobesilate capsules. All rats were treated for 8 weeks. The levels of body weight, fasting blood glucose (FBG) and glycosylated hemoglobin (HbA1c) in blood were measured to evaluate the antihyperglycemic activity of TWMM. Furthermore, malondialdehyde (MDA), intracellular adhesion molecule-1 (ICAM-1) and vascular endothelial growth factor (VEGF) in serum were measured to study effects of TWMM on oxidative stress and inflammatory in DM2 rats. VEGF, JAK/STAT signaling pathway and SOCS3 in retina was detected by immunohistochemistry. Results: TWMM and the positive control drugs Qi Ming and Calcium dobesilate showed a remarkable suppression of retinal neovascularization and amelioration of retinal internal limiting membrane morphology. Moreover, TWMM significantly decreased HbA1c, MDA, ICAM-1, and VEGF levels in serum of diabetic rats. However, Qi Ming granules showed significantly reduced MDA and VEGF levels (P dobesilate showed significantly reduced MDA and ICAM-1levels (P dobesilate significantly increased SOCS3 in retina. Conclusion: Our data suggest that the diabetic retina protective effect of TWMM might be related to antiinflammatory, antioxidative, upregulation of SOCS3 expression, inhibition of the JAK/STAT/VEGF signaling pathway. PMID:29311988

  3. Tang Wang Ming Mu Granule Attenuates Diabetic Retinopathy in Type 2 Diabetes Rats

    Directory of Open Access Journals (Sweden)

    Mingxia Chen

    2017-12-01

    Full Text Available Aims: This study aimed to determine the influence of Tang Wang Ming Mu granule (TWMM on the diabetic retinopathy of diabetic rats.Methods: Male Wistar rats were divided into seven groups: normal control, diabetes model(DM, diabetes with TWMM (3.6, 7.2, and 14.4 g/kg treatment, the positive control treatment groups of Qi Ming granules and Calcium dobesilate capsules. All rats were treated for 8 weeks. The levels of body weight, fasting blood glucose (FBG and glycosylated hemoglobin (HbA1c in blood were measured to evaluate the antihyperglycemic activity of TWMM. Furthermore, malondialdehyde (MDA, intracellular adhesion molecule-1 (ICAM-1 and vascular endothelial growth factor (VEGF in serum were measured to study effects of TWMM on oxidative stress and inflammatory in DM2 rats. VEGF, JAK/STAT signaling pathway and SOCS3 in retina was detected by immunohistochemistry.Results: TWMM and the positive control drugs Qi Ming and Calcium dobesilate showed a remarkable suppression of retinal neovascularization and amelioration of retinal internal limiting membrane morphology. Moreover, TWMM significantly decreased HbA1c, MDA, ICAM-1, and VEGF levels in serum of diabetic rats. However, Qi Ming granules showed significantly reduced MDA and VEGF levels (P < 0.01, and P < 0.05, respectively, Calcium dobesilate showed significantly reduced MDA and ICAM-1levels (P < 0.01 and P < 0.05, respectively in serum. All drug- treated DM2 rats showed significantly lower levels of VEGF, JAK2, P-JAK2, STAT3, and P-STAT3 in retina than DM group, while TWMM and Calcium dobesilate significantly increased SOCS3 in retina.Conclusion: Our data suggest that the diabetic retina protective effect of TWMM might be related to antiinflammatory, antioxidative, upregulation of SOCS3 expression, inhibition of the JAK/STAT/VEGF signaling pathway.

  4. SU(N) irreducible Schwinger bosons

    Science.gov (United States)

    Mathur, Manu; Raychowdhury, Indrakshi; Anishetty, Ramesh

    2010-09-01

    We construct SU(N) irreducible Schwinger bosons satisfying certain U(N-1) constraints which implement the symmetries of SU(N) Young tableaues. As a result all SU(N) irreducible representations are simple monomials of (N -1) types of SU(N) irreducible Schwinger bosons. Further, we show that these representations are free of multiplicity problems. Thus, all SU(N) representations are made as simple as SU(2).

  5. Solar tracking control system Sun Chaser

    Science.gov (United States)

    Scott, D. R.; White, P. R.

    1979-01-01

    The solar tracking control system (Sun Chaser) is believed to be an improved method of tracking the Sun in all types of weather conditions. The Sun Chaser will follow the Sun from east to west in clear or cloudy weather, and reset itself to the east position after sundown in readiness for the next sunrise. A description of the Sun Chaser hardware and its operation together with results is presented.

  6. Astrophysical processes on the sun.

    Science.gov (United States)

    Parnell, Clare E

    2012-07-13

    Over the past two decades, there have been a series of major solar space missions, namely Yohkoh, SOHO, TRACE, and in the past 5 years, STEREO, Hinode and SDO, studying various aspects of the Sun and providing images and spectroscopic data with amazing temporal, spatial and spectral resolution. Over the same period, the type and nature of numerical models in solar physics have been completely revolutionized as a result of widespread accessibility to parallel computers. These unprecedented advances on both observational and theoretical fronts have led to significant improvements in our understanding of many aspects of the Sun's behaviour and furthered our knowledge of plasma physics processes that govern solar and other astrophysical phenomena. In this Theme Issue, the current perspectives on the main astrophysical processes that shape our Sun are reviewed. In this Introduction, they are discussed briefly to help set the scene.

  7. The Sun: Our Nearest Star

    Science.gov (United States)

    Adams, M. L.; Six, N. Frank (Technical Monitor)

    2002-01-01

    We have in our celestial backyard, a prime example of a variable star. The Sun, long thought to be "perfect" and unvarying, began to reveal its cycles in the early 1600s as Galileo Galilei and Christoph Scheiner used a telescope to study sunspots. For the past four hundred years, scientists have accumulated data, showing a magnetic cycle that repeats, on average, every eleven (or twenty-two) years. In addition, modern satellites have shown that the energy output at radio and x-ray wavelengths also varies with this cycle. This talk will showcase the Sun as a star and discuss how solar studies may be used to understand other stars.

  8. Sun Tracking Systems: A Review

    Directory of Open Access Journals (Sweden)

    Chiu-Feng Lin

    2009-05-01

    Full Text Available The output power produced by high-concentration solar thermal and photovoltaic systems is directly related to the amount of solar energy acquired by the system, and it is therefore necessary to track the sun’s position with a high degree of accuracy. Many systems have been proposed to facilitate this task over the past 20 years. Accordingly, this paper commences by providing a high level overview of the sun tracking system field and then describes some of the more significant proposals for closed-loop and open-loop types of sun tracking systems.

  9. Micro technology based sun sensor

    DEFF Research Database (Denmark)

    Hales, Jan Harry; Pedersen, Martin; Fléron, René

    2003-01-01

    . This fact enables students to get hands-on experience with satellite systems design and project management. This paper describes the attitude control and determination system of a Danish student satellite (DTUsat), with main focus on the two-axis MOEMS sun sensor developed. On the magnetotorquer controlled...... DTUsat sun sensors are needed along with a magnetometer to obtain unambiguous attitude determination for the ACDS and the payloads - an electrodynamic tether and a camera. The accuracy needed was not obtainable by employing conventional attitude sensors. Hence a linear slit sensor was designed...

  10. Across the board: Licheng Sun.

    Science.gov (United States)

    Sun, Licheng

    2015-01-01

    In this series of articles the board members of ChemSusChem discuss recent research articles that they consider of exceptional quality and importance for sustainability. In this entry, Prof. Licheng Sun discusses how solar fuel production (such as water splitting) can be made more efficient and economic on an industrial scale. Recommended is the work by Prof. Xuping Sun, who use non-noble metal-phosphorus-based nanostructures as efficient electrocatalysts for hydrogen generation from water. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Letter to the Editor in response to "Our unrequited love for natural ingredients," by Burdock and Wang.

    Science.gov (United States)

    Harman, Christie L; Taylor, Sean V

    2018-01-01

    This letter is in response to the review article "Our unrequited love for natural ingredients" authored by Burdock and Wang in the September edition of FCT. Our purpose is to clarify the procedure used by the FEMA Expert Panel for the safety evaluation of natural flavor complexes, as well as to note and/or correct inaccuracies that we have identified within the article. Copyright © 2017. Published by Elsevier Ltd.

  12. Becoming an International Scientist in South Korea: Ho Wang Lee’s Research Activity about Epidemic Hemorrhagic Fever

    Directory of Open Access Journals (Sweden)

    Miyoung SHIN

    2017-04-01

    Full Text Available In the 1960-70s, South Korea was still in the position of a science latecomer. Although the scientific research environment in South Korea at that time was insufficient, there was a scientist who achieved outcomes that could be recognized internationally while acting in South Korea. He was Ho Wang Lee(1928~ who found Hantann Virus that causes epidemic hemorrhagic fever for the first time in the world. It became a clue to identify causative viruses of hemorrhagic diseases that were scattered here and there throughout the world. In addition, these outcomes put Ho Wang Lee on the global center of research into epidemic hemorrhagic fever. This paper examines how a Korean scientist who was in the periphery of virology could go into the central area of virology. Also this article shows the process through which the virus found by Ho Wang Lee was registered with the international academia and he proceeded with follow-up research based on this progress to reach the level at which he generalized epidemic hemorrhagic fever related studies throughout the world. While he was conducting the studies, experimental methods that he had never experienced encountered him as new difficulties. He tried to solve the new difficulties faced in his changed status through devices of cooperation and connection. Ho Wang Lee’s growth as a researcher can be seen as well as a view of a researcher that grew from a regional level to an international level and could advance from the area of non-mainstream into the mainstream. This analytic tool is meaningful in that it can be another method of examining the growth process of scientists in South Korea or developing countries.

  13. Day the sun went out

    CERN Multimedia

    2007-01-01

    "A new british sci-fi movie envisages the death of the sun not in billions of years, but in decades. And, amazingly, the film's scientific adviser says this may not be so far from the truth..." (1/2 page)

  14. The Award Winning Black Suns

    Science.gov (United States)

    Holbrook, Jarita

    2018-01-01

    Black Suns: An Astrophysics Adventure is a documentary film focusing on the annular and total solar eclipses of 2012. We made a different kind of astronomy documentary showing the human aspects rather than just focusing on pretty astronomy pictures. The film combines personal stories with science. Our heroes are Hakeem Oluseyi and Alphonse Sterling, who valiantly travel to study the solar corona during total solar eclipses. The goals of the film included presenting three dimensional scientists, to show their paths to becoming astrophysicists, and to show them as they collect data and work as scientists. Drama and tension surround taking data during the small window of time during totality. The Black Suns was filmed in Tokyo, Cairns, Tucson, and Melbourne Florida. Uniquely, the film began through a Kickstarter campaign to fund travel and filming in Tokyo. Many American Astronomical Society members donated to the film! Black Suns won the Jury Prize at the 2017 Art of Brooklyn Film Festival. Black Suns will be screening in full on ???.

  15. Sun protection in Singapore's schools.

    Science.gov (United States)

    Nyiri, P

    2005-09-01

    The World Health Organisation has identified schools as key players in the global effort to reduce the rising incidence of skin cancer. Singapore lies 70 miles from the Equator, with one of the world's highest ultraviolet (UV) index scores. It is a multi-ethnic society, with many expatriates. Children in Singapore are likely to be exposed to high levels of UV radiation, and represent a variety of skin types. This study aimed to assess sun protection measures in schools, the frequency of reported sunburn in schoolchildren of different ethnic groups, the level of parental and school concern about sun exposure, the sun-protective measures currently in place, and the parental and school support for public education and "sunsmart" school programmes. Questionnaires were sent to principals and parents of primary schoolchildren in 20 local and eight international schools in January 2003. The majority of children in all ethnic groups in Singapore were reported to suffer to some degree from sunburn during their first ten years. Over 50 percent of parents and head teachers predicted an increased risk of skin cancer in their children. Some protective measures were in place. But teachers and parents were concerned, and most favoured the promotion of more active measures. The reported incidence of sunburn among Singaporean school children is higher than expected across all ethnic groups. Given the current level of sun protective measures in place, more could be done to educate parents and schools regarding "sunsmart practice", and reducing their future risk of skin cancer and eye damage.

  16. Tracking Planets around the Sun

    Science.gov (United States)

    Riddle, Bob

    2008-01-01

    In earlier columns, the celestial coordinate system of hour circles of right ascension and degrees of declination was introduced along with the use of an equatorial star chart (see SFA Star Charts in Resources). This system shows the planets' motion relative to the ecliptic, the apparent path the Sun follows during the year. An alternate system,…

  17. The Sun Radio Imaging Space Experiment (SunRISE) Mission

    Science.gov (United States)

    Lazio, Joseph; Kasper, Justin; Maksimovic, Milan; Alibay, Farah; Amiri, Nikta; Bastian, Tim; Cohen, Christina; Landi, Enrico; Manchester, Ward; Reinard, Alysha; Schwadron, Nathan; Cecconi, Baptiste; Hallinan, Gregg; Hegedus, Alex; Krupar, Vratislav; Zaslavsky, Arnaud

    2017-04-01

    Radio emission from coronal mass ejections (CMEs) is a direct tracer of particle acceleration in the inner heliosphere and potential magnetic connections from the lower solar corona to the larger heliosphere. Energized electrons excite Langmuir waves, which then convert into intense radio emission at the local plasma frequency, with the most intense acceleration thought to occur within 20 RS. The radio emission from CMEs is quite strong such that only a relatively small number of antennas is required to detect and map it, but many aspects of this particle acceleration and transport remain poorly constrained. Ground-based arrays would be quite capable of tracking the radio emission associated with CMEs, but absorption by the Earth's ionosphere limits the frequency coverage of ground-based arrays (ν ≳ 15 MHz), which in turn limits the range of solar distances over which they can track the radio emission (≲ 3RS). The state-of-the-art for tracking such emission from space is defined by single antennas (Wind/WAVES, Stereo/SWAVES), in which the tracking is accomplished by assuming a frequency-to-density mapping; there has been some success in triangulating the emission between the spacecraft, but considerable uncertainties remain. We describe the Sun Radio Imaging Space Experiment (SunRISE) mission concept: A constellation of small spacecraft in a geostationary graveyard orbit designed to localize and track radio emissions in the inner heliosphere. Each spacecraft would carry a receiving system for observations below 25 MHz, and SunRISE would produce the first images of CMEs more than a few solar radii from the Sun. Part of this research was carried out at the Jet Propulsion Laboratory, California Institute of Technology, under a contract with the National Aeronautics and Space Administration.

  18. Essential Outdoor Sun Safety Tips for Winter

    Science.gov (United States)

    ... Weekend Warriors expand/collapse Vitamin D Essential Outdoor Sun Safety Tips for Winter Winter sports enthusiasts are ... skiing! Be Mindful of Time Spent in the Sun, Regardless of the Season If possible, ski early ...

  19. Tanel Padar & The Sun veab õhukitarri

    Index Scriptorium Estoniae

    2008-01-01

    Õhukitarri Eesti meistrivõistlustest 19. apr. Tallinnas Rock Cafés (võistluste eestvedajaks on ansambel Tanel Padar & The Sun, kes samas esitleb oma esimest ingliskeelset albumit "Here Comes The Sun")

  20. Caddo Sun Accounts across Time and Place

    Science.gov (United States)

    Gerona, Carla

    2012-01-01

    Billy Day, a Tunica/Biloxi, recently described the significance of the sun for Caddoan people. Day quoted an "old Caddo relative" of his who said: "I used to go outside and hold my hands up and bless myself with the sun--'a'hat.' Well, I can't do that anymore because they say we are sun worshipers. We didn't worship the sun. We worshiped what was…

  1. Global Warming Blame the Sun

    CERN Document Server

    Calder, N

    1997-01-01

    Concern about climate change reaches a political peak at a UN conference in Kyoto, 1-10 December, but behind the scenes the science is in turmoil. A challenge to the hypothesis that greenhouse gases are responsible for global warming comes from the discovery that cosmic rays from the Galaxy are involved in making clouds (Svensmark and Friis-Christensen, 1997). During the 20th Century the wind from the Sun has grown stronger and the count of cosmic rays has diminished. With fewer clouds, the EarthÕs surface has warmed up. This surprising mechanism explains the link between the Sun and climate change that astronomers and geophysicists have suspected for 200 years.

  2. UV Photography Shows Hidden Sun Damage

    Science.gov (United States)

    ... var c = 0; c UV photography shows hidden sun damage A UV photograph gives us a safe way to see how the sun damages our skin. In the UV photos that ... on the right, you can see what hidden sun damage looks like. Compare these UV photos with ...

  3. The Sun A User's Manual

    CERN Document Server

    Vita-Finzi, Claudio

    2008-01-01

    The Sun is an account of the many ways in which our nearest star affects our planet, how its influence has changed over the last few centuries and millennia, and the extent to which we can predict its future impact. The Sun's rays foster the formation of Vitamin D by our bodies, but it can also promote skin cancer, cataracts, and mutations in our DNA. Besides providing the warmth and light essential to most animal and plant life, solar energy contributes substantially to global warming. Although the charged particles of the solar wind shield us from harmful cosmic rays, solar storms may damage artificial satellites and cripple communication systems and computer networks. The Sun is the ideal renewable energy source, but its exploitation is still bedevilled by the problems of storage and distribution. Our nearest star, in short, is a complex machine which needs to be treated with caution, and this book will equip every reader with the knowledge that is required to understand the benefits and dangers it can bri...

  4. Comment on "Parametric Instability Induced by X-Mode Wave Heating at EISCAT" by Wang et al. (2016)

    Science.gov (United States)

    Blagoveshchenskaya, N. F.; Borisova, T. D.; Yeoman, T. K.

    2017-12-01

    In their recent article Wang et al. (2016) analyzed observations from EISCAT (European Incoherent Scatter) Scientific Association Russian X-mode heating experiments and claimed to explain the potential mechanisms for the parametric decay instability (PDI) and oscillating two-stream instability (OTSI). Wang et al. (2016) claim that they cannot separate the HF-enhanced plasma and ion lines excited by O or X mode in the EISCAT UHF radar spectra. Because of this they distinguished the parametric instability excited by O-/X-mode heating waves according to their different excitation heights. Their reflection heights were determined from ionosonde records, which provide a rough measure of excitation altitudes and cannot be used for the separation of the O- and X-mode effects. The serious limitation in their analysis is the use of a 30 s integration time of the UHF radar data. There are also serious disagreements between their analysis and the real observational facts. The fact is that it is the radical difference in the behavior of the X- and O-mode plasma and ion line spectra derived with a 5 s resolution, which provides the correct separation of the X- and O-mode effects. It is not discussed and explained how the parallel component of the electric field under X-mode heating is generated. Apart from the leakage to the O mode, results by Wang et al. (2016) do not explain the potential mechanisms for PDI and OTSI and add nothing to understanding the physical factors accounting for the parametric instability generated by an X-mode HF pump wave.

  5. ¿Cómo podemos usar el móvil para comunicarnos mediante el pensamiento? Entrevista con Yijun Wang

    Directory of Open Access Journals (Sweden)

    Ángel Correa

    2011-01-01

    Full Text Available Un equipo de neurocientíficos ha desarrollado una interfaz cerebro ordenador basada en un teléfono móvil. Las personas con movilidad reducida podrían beneficiarse de este innovador sistema en un futuro próximo. En el experimento que aparece en la fotografía de portada, el participante utiliza únicamente su pensamiento para marcar un número de teléfono. Ciencia Cognitiva ha entrevistado al Dr. Yijun Wang, ingeniero biomédico de la Universidad de California en San Diego, que trabaja en este proyecto.

  6. 2-(p-Hydroxybenzylindoles - Side Products Formed Upon Cleavage of Indole Derivatives from Carboxylated Wang Polymer - an NMR Study

    Directory of Open Access Journals (Sweden)

    Jarl E.S. Wikberg

    2003-10-01

    Full Text Available Treatment of carboxylated Wang polymer attached to a 2-unsubstituted indole derivative with a trifluoroacetic acid based mixture resulted in a side reaction: p-hydroxybenzylation at the 2-position of the indole ring. The structure of the resulting N-3-aminopropyl-N-benzyl-4-[2-(4-hydroxybenzyl-1H-indol-3-yl]-butyramide trifluoroacetate was ascertained by a full assignment of its 1H- and 13C-NMR spectra. The side reaction could be suppressed by the use of 1,2-ethanedithiol in high concentrations (16 %.

  7. The Sun Radio Interferometer Space Experiment (SunRISE)

    Science.gov (United States)

    Alibay, F.; Lazio, J.; Kasper, J. C.; Amiri, N.; Bastian, T.; Cohen, C.; Landi, E.; Manchester, W.; Reinard, A.; Schwadron, N.; Hegedus, A. M.; Maksimovic, M.; Zaslavsky, A.; Cecconi, B.; Hallinan, G.; Krupar, V.

    2016-12-01

    Radio emission from coronal mass ejections (CMEs) is a direct tracer of the particle acceleration in the inner heliosphere and potential magnetic connections from the lower solar corona to the larger heliosphere. However, many aspects of this particle acceleration remain poorly constrained. The radio emission from CMEs is quite strong such that only a relatively small number of antennas is required to map it. However, the state-of-the-art for tracking such emission is only defined by single antennas (Wind/WAVES, Stereo/SWAVES) in which the tracking is accomplished by assuming a frequency-to-density mapping. These are limited to tracking CMEs to only a few solar radii before the frequencies of radio emission drop below the Earth's ionospheric cutoff. Triangulation between the STEREO/SWAVES and Wind/WAVES instruments have provided some initial constraints on particle acceleration sites at larger distances (lower frequencies), but the uncertainties remain considerable. We present the Sun Radio Imaging Space Experiment (SunRISE) mission concept: a space-based array designed to localize such radio emissions. This low-cost constellation is composed of small spacecraft placed in a geostationary graveyard orbit, each carrying an HF radio receiver. In this concept, each spacecraft would perform concurrent observations below 25 MHz, which would then be correlated on the ground to produce the first images of CMEs more than a few solar radii from the Sun. Part of this research was carried out at the Jet Propulsion Laboratory, California Institute of Technology, under a contract with the National Aeronautics and Space Administration.

  8. FS5 sun exposure survivability analysis

    Directory of Open Access Journals (Sweden)

    Ming-Ying Hsu

    2017-01-01

    Full Text Available During the Acquisition and Safe Hold (ASH mode, FORMOAT-5 (FS5 satellite attitude is not fully controlled. Direct sun exposure on the Remote Sensing Instrument (RSI satellite telescope sensor may occur. The sun exposure effect on RSI sensor performance is investigated to evaluate the instrument’s survivability in orbit. Both satellite spin speed and sun exposure duration are considered as the key parameters in this study. A simple radiometry technique is used to calculate the total sun radiance exposure to examine the RSI sensor integrity. Total sun irradiance on the sensor is computed by considering the spectral variation effect through the RSI’s five-band filter. Experiments that directly expose the sensor to the sun on the ground were performed with no obvious performance degradation found. Based on both the analysis and experiment results, it is concluded that the FS5 RSI sensor can survive direct sun exposure during the ASH mode.

  9. Here comes the sun...; Here comes the sun...

    Energy Technology Data Exchange (ETDEWEB)

    Best, Robert [Centro de Investigacion en Energia (CIE) de la UNAM, Temixco, Morelos (Mexico)

    2010-07-01

    It sounds a bit strange that you can use solar energy to maintain or refrigerate products or spaces below the ambient temperature, because we know that something that makes the sun is heating; but yes indeed, the sun can produce cold, and in addition without polluting, and without consuming conventional energy. In this document are mentioned the various research projects on solar cooling that have been made in the Energy Research Center at the Universidad Nacional Autonoma de Mexico such as the thermo-chemical intermittent refrigerator, the geothermal cooling demonstration system in Mexicali, B.C., the GAX system for air conditioning, the ice producer intermittent solar refrigerator, the continuous solar refrigerator, the refrigeration by ejection-compression. It also mentions the functioning of heat pumps and the process of solar drying applications in agricultural products. [Spanish] Suena un poco extrano que se pueda utilizar la energia solar para mantener o refrigerar productos o espacios por debajo de la temperatura ambiente, ya que sabemos que algo que hace el sol es calentar; pero si, el sol puede producir frio, y ademas sin contaminar y sin consumir energia convencional. En este documento se mencionan las diferentes investigaciones sobre refrigeracion solar que se han realizado en el Centro de Investigacion en Energia de la Universidad Nacional Autonoma de Mexico como el refrigerador termoquimico intermitente, el sistema demostrativo de refrigeracion geotermico en Mexicali, B.C., el sistema GAX para aire acondicionado, el refrigerador solar intermitente productor de hielo, el refrigerador continuo solar, la refrigeracion por eyecto-compresion. Tambien se menciona el funcionamiento de las bombas de calor y el proceso de secado solar de aplicacion en productos agropecuarios.

  10. All-atom simulation study of protein PTH(1-34) by using the Wang-Landau sampling method

    Science.gov (United States)

    Kim, Seung-Yeon; Kwak, Wooseop

    2014-12-01

    We perform simulations of the N-terminal 34-residue protein fragment PTH(1-34), consisting of 581 atoms, of the 84-residue human parathyroid hormone by using the all-atom ECEPP/3 force field and the Wang-Landau sampling method. Through a massive high-performance computation, the density of states and the partition function Z( T), as a continuous function of T, are obtained for PTH(1-34). From the continuous partition function Z( T), the partition function zeros of PTH(1-34) are evaluated for the first time. From both the specific heat and the partition function zeros, two characteristic transition temperatures are obtained for the all-atom protein PTH(1-34). The higher transition temperature T 1 and the lower transition temperature T 2 of PTH(1-34) can be interpreted as the collapse temperature T θ and the folding temperature T f , respectively.

  11. Smoke (Paul Auster et Wayne Wang, 1995 : une œuvre à la croisée des arts

    Directory of Open Access Journals (Sweden)

    Delphine Letort

    2011-04-01

    Full Text Available The adaptation of the short story entitled “Auggie Wren’s Christmas Story” (1990 gathered the writer Paul Auster and the director Wayne Wang around a film project that allowed them to share their artistic practices in a collaborative work. This paper examines the question that underpins the narrative of the short-story by grappling with the appropriations of the real in other artistic modes. Paul Auster’s first encounter with the cinema points out the convergence between aural writing and cinematic writing, evoked through the double figure of the writer and that of the tale-teller/photographer in both the film and the short story.L’adaptation de la nouvelle « Auggie Wren’s Christmas Story » (1990 réunit l’écrivain Paul Auster et le réalisateur Wayne Wang autour d’un projet qui leur permit de croiser leurs pratiques artistiques dans un travail de collaboration. Cet article prolonge le questionnement artistique qui sous-tend le récit de la nouvelle en interrogeant les modalités de l’appropriation du réel par d’autres arts. La première rencontre entre Paul Auster et le cinéma met en relief les points de convergence entre écriture verbale et écriture cinématographique, évoqués autour de la double figure de l’écrivain et du conteur/photographe dans le film et dans la nouvelle.

  12. EFFECT OF THE SUN UPON ANTENNA TEMPERATURE

    Science.gov (United States)

    temperature distributions over the sun at several frequencies are presented. The method by which antenna temperature is evaluated, using the Philco...calculate the variation of carrier-to-noise ratio as an antenna scans toward the sun while receiving signals from a deep-space probe and from a random-orbit satellite.

  13. Flexible Photovoltaics: Mission Power from the Sun

    Science.gov (United States)

    2009-11-01

    UNCLASSIFIED Flexible Photovoltaics: Mission Power from the Sun NSRDEC Project Officer: Steven Tucker Senior Engineer, EE COMM 508-233-6962 DSN 256...NOV 2009 2. REPORT TYPE 3. DATES COVERED 00-00-2009 to 00-00-2009 4. TITLE AND SUBTITLE Flexible Photovoltaics: Mission Power from the Sun 5a

  14. Ultraviolet radiation, sun and tanning salons

    CERN Document Server

    1999-01-01

    The pamphlet gives some information about ultraviolet radiation (UV), UV-sources and health effects, tanning in artificial and natural sun. It also includes some sun protection advice. It is intended mainly for persons inspecting artificial tanning units and for the owners of tanning salons. (Author)

  15. Regina vs Hubbs: Determining the Sun's Position

    CERN Document Server

    Samra, Raminder Singh

    2012-01-01

    Here I determined the Sun's position as an expert witness for crown counsel. From my calculations I found the Sun's location in the sky was such that it could not impede the driver's vision, as a result it could not have been the reason for the accused to be involved in a motor vehicle accident.

  16. The Sun's Mysteries from Space - I

    Indian Academy of Sciences (India)

    Among the many exotic astronomical objects in the universe, the Sun is the principal source of new physics, ranging from the nature of the neutrinos to the intricacies of the magnetohydro- dynamic activity and to the geological evolution of terrestrial climate. Historically, it was the motion of the planets around the. Sun that ...

  17. Perspectives on the Interior of the Sun

    Indian Academy of Sciences (India)

    The interior of the Sun is not directly accessible to observations. Nonetheless, it is possible to infer the physical conditions inside the Sun with the help of structure equations governing its equilibrium and with the powerful observational tools provided by the neutrino fluxes and oscillation frequencies. The helioseismic data ...

  18. Sun protection in children: realities and challenges.

    Science.gov (United States)

    Gilaberte, Y; Carrascosa, J M

    2014-04-01

    One of the main goals of all skin cancer prevention campaigns is to protect children from ultraviolet radiation. However, little is known about how sun exposure risks differ between adults and children or about how these risks are best managed. Children's skin is more susceptible to sun damage for a number of reasons, including certain anatomical and functional aspects in children under 2 years of age and habits that predispose to greater sun exposure during the first 2 decades of life. Oil-based emulsions containing inorganic filters appear to be safest sunscreens for children, although the addition of certain organic filters is necessary to achieve a sun protection factor of 50. Oxybenzone, and probably also octocrylene, should be avoided in sunscreens for children. Sunscreen use should be part of an overall sun protection strategy that includes avoidance of exposure to midday sun and the use of protective clothing and hats. The above considerations justify the implementation of primary prevention campaigns focused on sun protection education for children and the continuation of basic and epidemiological research into specific sun protection strategies and sunscreens for each age group. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.

  19. Sun Protection for Children: A Review

    Directory of Open Access Journals (Sweden)

    Nazanin Shafie Pour

    2015-01-01

    Full Text Available Chronic ultraviolet exposure results in premature skin aging (photoaging, dyspigmentation, sallow color, textural changes, loss of elasticity, and premalignant actinic keratoses. UVB radiation is mainly responsible for acute damages such as sunburn, and long-term damage including melanoma. Today the sun's ultraviolet radiation (UVR induced skin cancer is a major issue worldwide. History of sun exposure and sunburns are the most important behavioral risks. Childhood sun exposure is considered as a substantial risk because a child’s skin has a thinner stratum corneum, lower levels of protective melanin, and a higher surface area to body-mass-ratio. Thus, protection against UVR in childhood is essential. Research has shown that people who have had a sunburn in childhood or were in the sun unprotected are more likely to have skin cancer. In this article, we review the literature to address the protection of children against sun and skin cancer.

  20. Sun Safe Mode Controller Design for LADEE

    Science.gov (United States)

    Fusco, Jesse C.; Swei, Sean S. M.; Nakamura, Robert H.

    2015-01-01

    This paper presents the development of sun safe controllers which are designed to keep the spacecraft power positive and thermally balanced in the event an anomaly is detected. Employed by NASA's Lunar Atmosphere and Dust Environment Explorer (LADEE), the controllers utilize the measured sun vector and the spacecraft body rates for feedback control. To improve the accuracy of sun vector estimation, the least square minimization approach is applied to process the sensor data, which is proven to be effective and accurate. To validate the controllers, the LADEE spacecraft model engaging the sun safe mode was first simulated and then compared with the actual LADEE orbital fight data. The results demonstrated the applicability of the proposed sun safe controllers.

  1. Vibration Based Sun Gear Damage Detection

    Science.gov (United States)

    Hood, Adrian; LaBerge, Kelsen; Lewicki, David; Pines, Darryll

    2013-01-01

    Seeded fault experiments were conducted on the planetary stage of an OH-58C helicopter transmission. Two vibration based methods are discussed that isolate the dynamics of the sun gear from that of the planet gears, bearings, input spiral bevel stage, and other components in and around the gearbox. Three damaged sun gears: two spalled and one cracked, serve as the focus of this current work. A non-sequential vibration separation algorithm was developed and the resulting signals analyzed. The second method uses only the time synchronously averaged data but takes advantage of the signal/source mapping required for vibration separation. Both algorithms were successful in identifying the spall damage. Sun gear damage was confirmed by the presence of sun mesh groups. The sun tooth crack condition was inconclusive.

  2. Drying of mint leaves in a solar dryer and under open sun: Modelling, performance analyses

    Energy Technology Data Exchange (ETDEWEB)

    Akpinar, E. Kavak [Mechanical Engineering Department, Firat University, 23279 Elazig (Turkey)

    2010-12-15

    In this study was investigated the thin-layer drying characteristics in solar dryer with forced convection and under open sun with natural convection of mint leaves, and, performed energy analysis and exergy analysis of solar drying process of mint leaves. An indirect forced convection solar dryer consisting of a solar air collector and drying cabinet was used in the experiments. The drying data were fitted to ten the different mathematical models. Among the models, Wang and Singh model for the forced solar drying and the natural sun drying were found to best explain thin-layer drying behaviour of mint leaves. Using the first law of thermodynamics, the energy analysis throughout solar drying process was estimated. However, exergy analysis during solar drying process was determined by applying the second law of thermodynamics. Energy utilization ratio (EUR) values of drying cabinet varied in the ranges between 7.826% and 46.285%. The values of exergetic efficiency were found to be in the range of 34.760-87.717%. The values of improvement potential varied between 0 and 0.017 kJ s{sup -1}. Energy utilization ratio and improvement potential decreased with increasing drying time and ambient temperature while exergetic efficiency increased. (author)

  3. H.E. Professor Wang Liheng, Minister of Aviation of the People's Republic of China, President, China Aerospace Science & Technology Corporation

    CERN Multimedia

    Patrice Loïez

    2001-01-01

    H. E. Professor Wang Liheng, Minister of Aviation, and President, China Aerospace Science & Technology Corporation, People's Republic of China (2nd from left) with (from left to right) Professor Hans Hofer, Professor Roger Cashmore, Research Director for Collider Programmes, Professor Samuel C. C. Ting, CERN and Professor Lei Gang, Secretary to the Minister, September 2001.

  4. THE SUN AS A VARIABLE STAR III.

    Science.gov (United States)

    observations has taught us more about the variations of solar type stars than about the sun itself. The observations of 15 stars of spectral types F and...stars 40 Leo, beta CVn and eta Boo this deviation is less than 0.004 mag. No evidence of variability in the stars which are similar to the sun has been...detected during this program. If we assume the sun acts in similar fashion to each of these stars, its variability over a fifteen-year period probably

  5. Semiautomatic sun shots with the WIDIF DIflux

    Science.gov (United States)

    Rasson, Jean L.; Hendrickx, Olivier; Marin, Jean-Luc

    2017-07-01

    The determination of magnetic declination angle entails finding two directions: geographic north and magnetic north. This paper deals with the former. The known way to do it by using the sun's calculable orientation in the sky is improved by using a device based on a WIDIF DIflux theodolite and split photocells positioned on its telescope ocular. Given the WIDIF accurate timing and location provided by the onboard GPS receiver, an astronomical computation can be effected to accurately and quickly determine the sun's azimuth and an auxiliary mark's azimuth. The precise sun's crossing of the split photocell, amplified by the telescope's magnification, allows azimuth accuracies of a few seconds of arc.

  6. Sun Coke Company responds to coke demand

    Energy Technology Data Exchange (ETDEWEB)

    Barkdoll, M. [Sun Coke Company, Knoxville, TN (US)

    2004-07-01

    A set of 28 slides/overheads outline in words and photographs recent developments with which Sun Coke is involved. These include a update on the Jewell Coke Plant in Vansant, VA, USA and on the Indiana Habor Coke Company plant in East Chicago, IN, USA, news on the construction of a coking plant at Haverhill, OH, USA and of Sun Coke Tubarao in Vitoria, Brazil, and of proposed projects at Haverhill and at Port Talbot, Wales, UK. Technology updates by Sun Coke are described. These include flue gas sharing, automatic door latches, charging emission control, a high performance quench tower baffle system and a flat push hot car.

  7. Vitamin D Beliefs and Associations with Sunburns, Sun Exposure, and Sun Protection

    Directory of Open Access Journals (Sweden)

    Eric J. Nehl

    2012-07-01

    Full Text Available The main objective of this study was to examine certain beliefs about vitamin D and associations with sun exposure, sun protection behaviors, and sunburns. A total of 3,922 lifeguards, pool managers, and parents completed a survey in 2006 about beliefs regarding vitamin D and sun-related behaviors. Multivariate ordinal regression analyses and linear regression analysis were used to examine associations of beliefs and other variables. Results revealed that Non-Caucasian lifeguards and pool managers were less likely to agree that they needed to go out in the sun to get enough vitamin D. Lifeguards and parents who were non-Caucasian were less likely to report that sunlight helped the body to produce vitamin D. A stronger belief about the need to go out in the sun to get enough vitamin D predicted more sun exposure for lifeguards. For parents, a stronger belief that they can get enough vitamin D from foods predicted greater sun protection and a stronger belief that sunlight helps the body produce vitamin D predicted lower sun exposure. This study provides information regarding vitamin D beliefs and their association with certain sun related behaviors across different demographic groups that can inform education efforts about vitamin D and sun protection.

  8. Vitamin D Beliefs and Associations with Sunburns, Sun Exposure, and Sun Protection

    Science.gov (United States)

    Kim, Bang Hyun; Glanz, Karen; Nehl, Eric J.

    2012-01-01

    The main objective of this study was to examine certain beliefs about vitamin D and associations with sun exposure, sun protection behaviors, and sunburns. A total of 3,922 lifeguards, pool managers, and parents completed a survey in 2006 about beliefs regarding vitamin D and sun-related behaviors. Multivariate ordinal regression analyses and linear regression analysis were used to examine associations of beliefs and other variables. Results revealed that Non-Caucasian lifeguards and pool managers were less likely to agree that they needed to go out in the sun to get enough vitamin D. Lifeguards and parents who were non-Caucasian were less likely to report that sunlight helped the body to produce vitamin D. A stronger belief about the need to go out in the sun to get enough vitamin D predicted more sun exposure for lifeguards. For parents, a stronger belief that they can get enough vitamin D from foods predicted greater sun protection and a stronger belief that sunlight helps the body produce vitamin D predicted lower sun exposure. This study provides information regarding vitamin D beliefs and their association with certain sun related behaviors across different demographic groups that can inform education efforts about vitamin D and sun protection. PMID:22851950

  9. Sun protection practices and sun exposure among children with a parental history of melanoma.

    Science.gov (United States)

    Glenn, Beth A; Lin, Tiffany; Chang, L Cindy; Okada, Ashley; Wong, Weng Kee; Glanz, Karen; Bastani, Roshan

    2015-01-01

    First-degree relatives of melanoma survivors have a substantially higher lifetime risk for melanoma than individuals with no family history. Exposure to ultraviolet radiation (UVR) is the primary modifiable risk factor for the disease. Reducing UV exposure through sun protection may be particularly important for children with a parental history of melanoma. Nonetheless, limited prior research has investigated sun protection practices and sun exposure among these children. The California Cancer Registry was used to identify melanoma survivors eligible to participate in a survey to assess their children's sun protection practices and sun exposure. The survey was administered by mail, telephone, or web to Latino and non-Latino white melanoma survivors with at least one child (0-17 years; N = 324). Sun exposure was high and the rate of sunburn was equivalent to or higher than estimates from average-risk populations. Use of sun protection was suboptimal. Latino children were less likely to wear sunscreen and hats and more likely to wear sunglasses, although these differences disappeared in adjusted analyses. Increasing age of the child was associated with lower sun protection and higher risk for sunburn, whereas higher objective risk for melanoma predicted improved sun protection and a higher risk for sunburns. Perception of high barriers to sun protection was the strongest modifiable correlate of sun protection. Interventions to improve sun protection and reduce sun exposure and sunburns in high-risk children are needed. Intervening in high-risk populations may help reduce the burden of melanoma in the United States. ©2015 American Association for Cancer Research.

  10. All-atom simulation study of protein PTH(1-34) by using the Wang-Landau sampling method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seung-Yeon [Korea National University of Transportation, Chungju (Korea, Republic of); Kwak, Woo-Seop [Chosun University, Gwangju (Korea, Republic of)

    2014-12-15

    We perform simulations of the N-terminal 34-residue protein fragment PTH(1-34), consisting of 581 atoms, of the 84-residue human parathyroid hormone by using the all-atom ECEPP/3 force field and the Wang-Landau sampling method. Through a massive high-performance computation, the density of states and the partition function Z(T), as a continuous function of T, are obtained for PTH(1-34). From the continuous partition function Z(T), the partition function zeros of PTH(1-34) are evaluated for the first time. From both the specific heat and the partition function zeros, two characteristic transition temperatures are obtained for the all-atom protein PTH(1-34). The higher transition temperature T{sub 1} and the lower transition temperature T{sub 2} of PTH(1-34) can be interpreted as the collapse temperature T{sub θ} and the folding temperature T{sub f} , respectively.

  11. Wang--Landau algorithm for entropic sampling of arch-based microstates in the volume ensemble of static granular packings

    Directory of Open Access Journals (Sweden)

    D. Slobinsky

    2015-03-01

    Full Text Available We implement the Wang-Landau algorithm to sample with equal probabilities the static configurations of a model granular system. The "non-interacting rigid arch model" used is based on the description of static configurations by means of splitting the assembly of grains into sets of stable arches. This technique allows us to build the entropy as a function of the volume of the packing for large systems. We make a special note of the details that have to be considered when defining the microstates and proposing the moves for the correct sampling in these unusual models. We compare our results with previous exact calculations of the model made at moderate system sizes. The technique opens a new opportunity to calculate the entropy of more complex granular models. Received: 19 January 2015, Accepted: 25 February 2015; Reviewed by: M. Pica Ciamarra, Nanyang Technological University, Singapore; Edited by: C. S. O'Hern; DOI: http://dx.doi.org/10.4279/PIP.070001 Cite as: D Slobinsky, L A Pugnaloni, Papers in Physics 7, 070001 (2015

  12. Time for Some Summer Sun Safety Tips

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_166721.html Time for Some Summer Sun Safety Tips Pediatricians offer ... isn't there. Summertime often means more unsupervised time Be aware that changes in your routine might ...

  13. UV Photography Shows Hidden Sun Damage

    Science.gov (United States)

    ... mcat1=de12", ]; for (var c = 0; c UV photography shows hidden sun damage A UV photograph gives ... developing skin cancer and prematurely aged skin. Normal photography UV photography 18 months of age: This boy's ...

  14. Selected Vegetables/Sun's Soup (PDQ)

    Science.gov (United States)

    ... and traditional Chinese medicine suggest they contain anticancer phytochemicals (substances found in plants that may have effects ... ingredients in Selected Vegetables/Sun's Soup may contain phytochemicals that have significant anticancer effects in humans. One ...

  15. Sun behaviour after cutaneous malignant melanoma

    DEFF Research Database (Denmark)

    Idorn, L W; Datta, P; Heydenreich, J

    2013-01-01

    Background  It has been reported that patients with cutaneous malignant melanoma (CMM) can lower their risk of a second primary melanoma by limiting recreational sun exposure. Previous studies based on questionnaires and objective surrogate measurements indicate that before their diagnosis......, patients with CMM are exposed to higher ultraviolet radiation (UVR) doses than controls, followed by a reduction after diagnosis. Objectives  In a prospective, observational case-control study, we aimed to assess sun exposure after diagnosis of CMM by objective measurements to substantiate advice about sun...... months and 6 years before the start of the study. During a summer season participants filled in sun exposure diaries daily and wore personal electronic UVR dosimeters in a wristwatch that continuously measured time-stamped UVR doses in standard erythema dose. Results  The UVR dose of recently diagnosed...

  16. The Sun murrab Baltimaadesse ja Soome

    Index Scriptorium Estoniae

    2008-01-01

    Aprillis andis ansambel Tanel Padar & The Sun Soomes, Lätis, Leedus ja Eestis üksteist kontserti. Heliplaadi "Here Gomes The Sun" lugu "Hopelessness You" on Soome raadiote tipp 300s neljakümnendal kohal, lugu "Learn the game" on Leedu FM99 raadios 33 enim mängitava loo seas, laul "One of those days" saavutas Läti raadio SWH rokkmuusika edetabelis teise koha.

  17. Sunscreen abuse for intentional sun exposure.

    Science.gov (United States)

    Autier, P

    2009-11-01

    Skin cancer is caused by exposure to ultraviolet radiation (UV) and the sun is the main source of this radiation. Sunscreens were initially formulated to prevent sunburns; laboratory studies later revealed that in rodents they could reduce UV-induced skin cancer which resembles human squamous cell carcinoma. Three randomized trials in older adults showed the ability of sunscreens to moderately reduce the occurrence of solar keratoses and of squamous cell carcinoma. However, no effect was observed for basal cell carcinoma. There is no animal model for human melanoma and observational studies often found sunscreen use associated with a higher risk of nevus, melanoma and basal cell carcinoma. These higher risks were found when sun exposure appeared to be intentional, that is, with the desire to acquire a tan, a healthy look or simply to spend as long as possible in the sun with as much skin exposed as possible. Three randomized trials showed that sunscreen use by sun sensitive subjects engaging in intentional sun exposure could increase the duration of exposure without decreasing sunburn occurrence. This increased duration could be the reason why melanoma risk is increased when sunscreen is used. Hence, sunscreen abuse may extend sun exposure duration thus allowing sun exposure behaviours that would not be possible otherwise. Advertising for sunscreens and labeling of sunscreen bottles should inform consumers of the carcinogenic hazards associated with sunscreen abuse. It would be good to use a personal UV dosimeter which would give an alert when one's individual sunburn threshold in the absence of sunscreen use is nearing. The combination of sunscreen and a UV dosimeter may be an option for reducing the melanoma risk among sun worshippers.

  18. How to Observe the Sun Safely

    CERN Document Server

    Macdonald, Lee

    2012-01-01

    How to Observe the Sun Safely, Second Edition gives all the basic information and advice the amateur astronomer needs to get started in observing our own ever-fascinating star. Unlike many other astronomical objects, you do not need a large telescope or expensive equipment to observe the Sun. And it is possible to take excellent pictures of the Sun with today's low-cost digital cameras! This book surveys what is visible on the Sun and then describes how to record solar features and measure solar activity levels. There is also an account of how to use H-alpha and Calcium-K filters to observe and record prominences and other features of the solar chromosphere, the Sun's inner atmosphere. Because we are just entering a period of high activity on the Sun, following a long, quiet period, this is a great time to get involved with solar observing. Still emphasizing safety first, this Second Edition reflects recent and exciting advances in solar observing equipment. Chapters 6 through 8 have been completely revised ...

  19. VizieR Online Data Catalog: Multicolor photometry of 135 star clusters in M31 (Wang+, 2012)

    Science.gov (United States)

    Wang, S.; Ma, J.; Fan, Z.; Wu, Z.; Zhang, T.; Zou, H.; Zhou, X.

    2014-01-01

    The sample of star clusters in this paper is selected from Caldwell et al. (2009, cat. J/AJ/137/94; 2011, cat. J/AJ/141/61). Our multicolor photometric data are from the GALEX FUV and NUV, broadband UBVRI, SDSS ugriz, 15 intermediate-band filters of Beijing-Arizona-Taipei-Connecticut (BATC) Multicolor Sky Survey, and 2MASS JHKs, which constitute the Spectral Energy Distributions (SEDs) covering 1538-20000Å. The M31 field is part of a galaxy calibration program of Beijing-Arizona-Taipei-Connecticut (BATC) Multicolor Sky Survey (Zhou et al., 1995-2005, cat. II/262). The BATC program uses the 60/90cm Schmidt Telescope at the Xinglong Station of the National Astronomical Observatories, Chinese Academy of Sciences (NAOC). This system includes 15 intermediate-band filters, covering a range of wavelength from 3000 to 10000Å (see Fan et al., 1996, cat. J/AJ/112/628, for details). Before 2006 February, a Ford Aerospace 2k*2k thick CCD camera was applied, which has a pixel size of 15μm and a field of view of 58'*58', resulting in a resolution of 1.67"/pixel. After 2006 February, a new 4k*4k CCD with a pixel size of 12μm was used, with a resolution of 1.36"/pixel (Fan et al., 2009RAA.....9..993F). We obtained 143.9hr of imaging of the M31 field covering about 6deg2, consisting of 447 images, through the set of 15 filters in five observing runs from 1995 to 2008, spanning 13 years (see Fan et al., 2009RAA.....9..993F; Wang et al., 2010, cat. J/AJ/139/1438, for details). (3 data files).

  20. Preparation of SnO2/C biomorphic materials by biotemplating from ...

    Indian Academy of Sciences (India)

    Author Affiliations. Xin-Hai He1 2 Le-Hua Qi1 Jun-Bo Wang2 Ming-Qian Shen2 Wei Chang2 Chong Fu2 Min-Ge Yang2 Xiao-Lei Su2. School of Mechatronics, Northwestern Polytechnical University, Xi'an 710072, P.R.China; College of Mechanical & Electrical Engineering, Xi'an Polytechnic University, Xi'an 710048, P.R. ...

  1. After the Bell: Developing Sun Sense--Learning about Protection from the Sun's Rays

    Science.gov (United States)

    Farenga, Stephen J.; Ness, Daniel

    2008-01-01

    The American Academy of Dermatology (2008) reports that our students will experience 80% of their lifetime exposure to the Sun by the time they are 18. Further, research has demonstrated that continued exposure to the Sun's ultraviolet rays can lead to skin aging, sunburn, immune suppression, ocular melanoma, cataracts, corneal burns, and even…

  2. BcSUN1, a B. cinerea SUN-family protein, is involved in virulence

    NARCIS (Netherlands)

    Pérez-Hernández, Alicia; González, Mario; González, Celedonio; Kan, van Jan A.L.; Brito, Nélida

    2017-01-01

    BcSUN1 is a glycoprotein secreted by Botrytis cinerea, an important plant pathogen that causes severe losses in agriculture worldwide. In this work, the role of BcSUN1 in different aspects of the B. cinerea biology was studied by phenotypic analysis of Bcsun1 knockout strains. We identified

  3. The Sun Sense Study: An Intervention to Improve Sun Protection in Children

    Science.gov (United States)

    Glasser, Alice; Shaheen, Magda; Glenn, Beth A.; Bastani, Roshan

    2010-01-01

    Objectives: To assess the effect of a multicomponent intervention on parental knowledge, sun avoidance behaviors, and sun protection practices in children 3-10 years. Methods: A randomized trial at a pediatric clinic recruited 197 caregiver-child pairs (90% parents). Intervention included a brief presentation and brochure for the parent and…

  4. The sun and space weather Second Edition

    CERN Document Server

    Hanslmeier, Arnold

    2007-01-01

    This second edition is a great enhancement of literature which will help the reader get deeper into the specific topics. There are new sections included such as space weather data sources and examples, new satellite missions, and the latest results. At the end a comprehensive index is given which will allow the reader to quickly find his topics of interest. The Sun and Space weather are two rapidly evolving topics. The importance of the Sun for the Earth, life on Earth, climate and weather processes was recognized long ago by the ancients. Now, for the first time there is a continuous surveillance of solar activity at nearly all wavelengths. These data can be used to improve our understanding of the complex Sun-Earth interaction. The first chapters of the book deal with the Sun as a star and its activity phenomena as well as its activity cycle in order to understand the complex physics of the Sun-Earth system. The reader will see that there are many phenomena but still no definite explanations and models exis...

  5. High energy neutrinos from the sun

    Science.gov (United States)

    Masip, Manuel

    2018-01-01

    The Sun is a main source of high energy neutrinos. These neutrinos appear as secondary particles after the Sun absorbs high-energy cosmic rays, that find there a low-density environment (much thinner than our atmosphere) where most secondary pions, kaons and muons can decay before they lose energy. The main uncertainty in a calculation of the solar neutrino flux is due to the effects of the magnetic fields on the absorption rate of charged cosmic rays. We use recent data from HAWC on the cosmic-ray shadow of the Sun to estimate this rate. We evaluate the solar neutrino flux and show that at 1 TeV it is over ten times larger than the atmospheric one at zenith θz =30∘ /150∘ . The flux that we obtain has a distinct spectrum and flavor composition: it is harder and richer in antineutrinos and tau/electron neutrinos than the atmospheric background. This solar flux could be detected in current and upcoming neutrino telescopes. KM3NeT, in particular, looks very promising: it will see the Sun high in the sky (the atmospheric flux is lower there than near the horizon) and expects a very good angular resolution (the Sun's radius is just 0.27°).

  6. Automatic tracking device for the sun basket

    Energy Technology Data Exchange (ETDEWEB)

    von Oppen, M.

    1978-08-01

    The construction, installation and operation of a simple, low-cost automatic tracking mechanism for the sun basket, an efficient low-cost solar cooker are described. Tracking is controlled by means of a water-clock type timing device with the sun basket being driven by a weight floating on the water level. The tracking device consists of a 10-cm diameter asbestos-cement pipe about 1.8 m long with one end closed except for an adjustable outlet, a corked one-liter bottle filled with water, a simple pulley, strings and supporting poles. The sun basket must be fitted with an axle and appropriate pole supports. It is estimated that a locally-made 1.4-m diameter sun basket with timing device can be delivered and assembled for a maximum total cost of 100 Indian Rupees. Such a sun basket can deliver 0.7 kW to a cooking pot on a clear sunny day. 2 references.

  7. 77 FR 34122 - Application of Sun Air Express, LLC, d/b/a Sun Air International for Commuter Authority

    Science.gov (United States)

    2012-06-08

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Office of the Secretary Application of Sun Air Express, LLC, d/b/a Sun Air International for Commuter... to show cause why it should not issue an order finding Sun Air Express, LLC d/b/a Sun Air...

  8. Sun ducts: new design and applications

    Energy Technology Data Exchange (ETDEWEB)

    Coch, H.; Isalgue, A. [School of Architecture, Barcelona (Spain)

    2000-07-01

    Developed in Barcelona since 1968, sun ducts are an architectural technique which takes advantage of direct sunlight, enabling it to reach interior zones of buildings which would normally be dark and gloomy. In addition to its main function of illuminating interiors with a special quality, unlike other natural lighting devices, sun ducts also offer other associated functional possibilities making their use highly advantageous in many cases of dense modern architecture. In recent years, using the experience gained since 1968, we have been attempting to produce standardised sun duct designs; new models have been researched and developed which once standardised, have begun to be used in buildings. The good results in the applications carried out and the ample possibilities for future uses of the ducts in architectural and urban design solutions in compact urban fabrics together make the development of applications of this technique very interesting. (author)

  9. Neutrinos from the centre of the sun

    Energy Technology Data Exchange (ETDEWEB)

    Kirsten, T.; Hampel, W.; Deker, U.

    1981-03-01

    Neutrinos are the elementary particles which react with other matter least. They alone are able to reach the earth directly from the centre of the sun. All other particles - including the photons captured by our telescopes - originate from the external atmosphere of the sun. First measurements have not resulted in as much as one-third of the pre-calculated neutrino stream. Is our model of the sun false, or do neutrinos behave differently from what we previously believed. A new and very difficult experiment is being carried out to answer this question. An international research team is going to set up in a goldmine a quantity of the rare metal gallium, greater than that produced in the whole world each year, to capture and count solar neutrinos.

  10. Toxicity and Phototoxicity of Chemical Sun Filters

    Energy Technology Data Exchange (ETDEWEB)

    Butt, S.T.; Christensen, T

    2000-07-01

    Two chemical sun filters that are ingredients in sunscreen products have been tested for their dark toxicity and possible toxicity to mouse cells after UV irradiation. Increased toxicity as a result of breakdown of a UVB filter, octyl methoxycinnamate, was observed. UV radiation absorbed by the pure chemical sunscreen may lead to breakdown to more reactive chemical compounds than the unexposed sunscreen filter. The UVA filter included in our tests, butyl methoxydibenzoylmethane, was also toxic in the dark, however, it was the more photostable of the two and no additional significant toxicity was induced by UV irradiation. It can be concluded that the two sun filters are toxic to cells in the dark, but the biological role of this dark toxicity in the skin is not clear. Unstable sun filters may be broken down by UV to form photoproducts that are potentially toxic. (author)

  11. Convective penetration in a young sun

    Science.gov (United States)

    Pratt, Jane; Baraffe, Isabelle; Goffrey, Tom; MUSIC developers group

    2018-01-01

    To interpret the high-quality data produced from recent space-missions it is necessary to study convection under realistic stellar conditions. We describe the multi-dimensional, time implicit, fully compressible, hydrodynamic, implicit large eddy simulation code MUSIC. We use MUSIC to study convection during an early stage in the evolution of our sun where the convection zone covers approximately half of the solar radius. This model of the young sun possesses a realistic stratification in density, temperature, and luminosity. We approach convection in a stellar context using extreme value theory and derive a new model for convective penetration, targeted for one-dimensional stellar evolution calculations. This model provides a scenario that can explain the observed lithium abundance in the sun and in solar-like stars at a range of ages.

  12. Neptune as a Mirror for the Sun

    Science.gov (United States)

    Kohler, Susanna

    2017-01-01

    How would the Kepler mission see a star like the Sun? We now know the answer to this question due to a creative approach: a new study has used the Kepler K2 mission to detect signals from the Sun reflected off of the surface of Neptune.Asteroseismology uses different oscillation modes of a star to probe its internal structure and properties. [Tosaka]Information in OscillationsKeplers most glamorous work is in discovering new planets around other stars. To successfully do this, however, the spacecraft is also quietly doing a lot of very useful work in the background, characterizing the many stars in our vicinity that planets might be found around.One of the ways Kepler gets information about these stars is from oscillations of the stars intensities. In asteroseismology, we look at oscillatory modes that are caused by convection-driven pressure changes on the inside of the star. All stars with near-surface convection oscillate like this including the Sun and by measuring the oscillations in intensity of these stars, we can make inferences about the stars properties.A Planetary MirrorWe do this by first understanding our Suns oscillations especially well (made easier by the fact that its nearby!). Then we use asteroseimic scaling relations determined empirically that relate characteristics like mass and radius of other stars to those of the Sun, based on the relation between the stars oscillation properties to the Suns.The trouble is, those oscillation properties are difficult to measure, and different instruments often measure different values. For this reason, wed like to measure the Suns oscillations with the same instrument we use to measure other stars oscillations: Kepler.Top panel: Kepler K2 49-day light curve of Neptune. Bottom panel: power density spectrum as a function of frequency (grey). Neptunes rotation frequencies and harmonics appear toward the left side (blue); the excess power due to the solar modes is visible toward the bottom right. The green curve

  13. Precise nuclear physics for the sun

    Energy Technology Data Exchange (ETDEWEB)

    Bemmerer, Daniel

    2012-07-01

    For many centuries, the study of the Sun has been an important testbed for understanding stars that are further away. One of the first astronomical observations Galileo Galilei made in 1612 with the newly invented telescope concerned the sunspots, and in 1814, Joseph von Fraunhofer employed his new spectroscope to discover the absorption lines in the solar spectrum that are now named after him. Even though more refined and new modes of observation are now available than in the days of Galileo and Fraunhofer, the study of the Sun is still high on the agenda of contemporary science, due to three guiding interests. The first is connected to the ages-old human striving to understand the structure of the larger world surrounding us. Modern telescopes, some of them even based outside the Earth's atmosphere in space, have succeeded in observing astronomical objects that are billions of light-years away. However, for practical reasons precision data that are important for understanding stars can still only be gained from the Sun. In a sense, the observations of far-away astronomical objects thus call for a more precise study of the closeby, of the Sun, for their interpretation. The second interest stems from the human desire to understand the essence of the world, in particular the elementary particles of which it consists. Large accelerators have been constructed to produce and collide these particles. However, man-made machines can never be as luminous as the Sun when it comes to producing particles. Solar neutrinos have thus served not only as an astronomical tool to understand the Sun's inner workings, but their behavior on the way from the Sun to the Earth is also being studied with the aim to understand their nature and interactions. The third interest is strictly connected to life on Earth. A multitude of research has shown that even relatively slight changes in the Earth's climate may strongly affect the living conditions in a number of densely

  14. Radio emission of the sun and planets

    CERN Document Server

    Zheleznyakov, V V

    1970-01-01

    International Series of Monographs in Natural Philosophy, Volume 25: Radio Emission of the Sun and Planets presents the origin of the radio emission of the planets. This book examines the outstanding triumphs achieved by radio astronomy of the solar system. Comprised of 10 chapters, this volume begins with an overview of the physical conditions in the upper layers of the Sun, the Moon, and the planets. This text then examines the three characteristics of radio emission, namely, the frequency spectrum, the polarization, and the angular spectrum. Other chapters consider the measurements of the i

  15. The Sun in Time: Activity and Environment

    Directory of Open Access Journals (Sweden)

    Güdel Manuel

    2007-12-01

    Full Text Available The Sun's magnetic activity has steadily declined during its main-sequence life. While the solar photospheric luminosity was about 30% lower 4.6 Gyr ago when the Sun arrived on the main sequence compared to present-day levels, its faster rotation generated enhanced magnetic activity; magnetic heating processes in the chromosphere, the transition region, and the corona induced ultraviolet, extreme-ultraviolet, and X-ray emission about 10, 100, and 1000 times, respectively, the present-day levels, as inferred from young solar-analog stars. Also, the production rate of accelerated, high-energy particles was orders of magnitude higher than in present-day solar flares, and a much stronger wind escaped from the Sun, permeating the entire solar system. The consequences of the enhanced radiation and particle fluxes from the young Sun were potentially severe for the evolution of solar-system planets and moons. Interactions of high-energy radiation and the solar wind with upper planetary atmospheres may have led to the escape of important amounts of atmospheric constituents. The present dry atmosphere of Venus and the thin atmosphere of Mars may be a product of early irradiation and heating by solar high-energy radiation. High levels of magnetic activity are also inferred for the pre-main sequence Sun. At those stages, interactions of high-energy radiation and particles with the circumsolar disk in which planets eventually formed were important. Traces left in meteorites by energetic particles and anomalous isotopic abundance ratios in meteoritic inclusions may provide evidence for a highly active pre-main sequence Sun. The present article reviews these various issues related to the magnetic activity of the young Sun and the consequent interactions with its environment. The emphasis is on the phenomenology related to the production of high-energy photons and particles. Apart from the activity on the young Sun, systematic trends applicable to the entire

  16. Ra: The Sun for Science and Humanity

    Science.gov (United States)

    1996-01-01

    To guide the development of the Ra Strategic Framework, we defined scientific and applications objectives. For our primary areas of scientific interest, we choose the corona, the solar wind, the Sun's effect on the Earth, and solar theory and model development. For secondary areas of scientific interest, we selected sunspots, the solar constant, the Sun's gravitational field, helioseismology and the galactic cosmic rays. We stress the importance of stereoscopic imaging, observations at high spatial, spectral, and temporal resolutions, as well as of long duration measurements. Further exploration of the Sun's polar regions is also important, as shown already by the Ulysses mission. From an applications perspective, we adopted three broad objectives that would derive complementary inputs for the Strategic Framework. These were to identify and investigate: possible application spin-offs from science missions, possible solar-terrestrial missions dedicated to a particular application, and possible future applications that require technology development. The Sun can be viewed as both a source of resources and of threats. Our principal applications focus was that of threat mitigation, by examining ways to improve solar threat monitoring and early warning systems. We compared these objectives to the mission objectives of past, current, and planned international solar missions. Past missions (1962-1980) seem to have been focused on improvement of scientific knowledge, using multiple instrument spacecraft. A ten year gap followed this period, during which the results from previous missions were analyzed and solar study programmes were prepared in international organizations. Current missions (1990-1996) focus on particular topics such as the corona, solar flares, and coronal mass ejections. In planned missions, Sun/Earth interactions and environmental effects of solar activity are becoming more important. The corona is the centre of interest of almost all planned missions

  17. SunShot Initiative Fact Sheet

    Energy Technology Data Exchange (ETDEWEB)

    DOE Solar Energy Technologies Office

    2015-04-01

    The U.S. Department of Energy (DOE) SunShot Initiative is a collaborative national effort launched in 2011 that aggressively drives innovation to make solar energy fully cost competitive with traditional energy sources before the end of the decade. The SunShot fact sheet outlines goals and successes of the program as it works with private companies, universities, non-profit organizations, state and local governments, and national laboratories to drive down the cost of solar electricity to $0.06 per kilowatt-hour, without incentives, by the year 2020.

  18. Skin Cancer-Sun Knowledge and Sun Protection Behaviors of Liver Transplant Recipients in Turkey.

    Science.gov (United States)

    Haney, Meryem Ozturk; Ordin, Yaprak Sarigol; Arkan, Gulcihan

    2017-09-08

    The aim of this study was to compare liver transplant recipients (LTRs) with the general population regarding their knowledge of skin cancer, sun health, sun protection behaviors, and affecting factors. This cross-sectional study was conducted in Turkey between March 2016 and September 2016 with 104 LTRs and 100 participants from the general population group (GPG). The mean age of the LTRs was 53.2 ± 11.8 and that of the GPG was 42.7 ± 14.5. The LTRs' skin cancer and sun knowledge were significantly lower than in the GPG, but there was no difference between the two groups in terms of their sun protection behavior scores. The most commonly used sun protection behaviors of LTRs were not being outside and not sunbathing between 10 a.m. and 4 p.m., wearing clothing that covers the skin, and avoiding the solarium. Behaviors commonly practiced by the GPG were wearing sunglasses, wearing sunscreen with a sun protection factor of 15 or higher before going outside, wearing sunscreen at the beach, while swimming or doing physical activity outside, and reapplying it every 2 h. Results of our study will contribute to the development of education and training programs for LTRs on skin cancer. The results also demonstrated the importance of practicing adequate sun protection behaviors which will certainly impact their future health.

  19. Sun exposure and sun protection practices of children and their parents.

    LENUS (Irish Health Repository)

    Kiely, A D

    2009-05-01

    The primary aims of this study were: to estimate sun exposure in hours of children in Cork during the summer months; to examine sun protection measures used by children and their parents and to explore parental knowledge of sun exposure and protection. A cross-sectional study, using a semi-structured questionnaire, was conducted in June 2006 in primary schools, pre-schools and creches throughout Cork City and County. Parents of 250 children aged less than 12 years were sampled. Mean sun exposure of Cork children was 40.9 hours per week in the summer months, with 77 (46.1%) children developing sunburn. 59.3% of the studied children were of skin type 1 or 2. 95 (57%) children on weekdays and 137 (82%) children at weekends were exposed to the sun between 11 am and 3 pm. Sunscreen and hats\\/caps were the most common protection measures used. A minority used protective clothing, sunglasses or sought shade. Thirty one (30.5%) children had sunscreen reapplied every 2 hours. Knowledge of sun protection was considerable among Irish parents. However the frequency of sunburn among Irish children suggests we are not providing them with adequate sun protection.

  20. The lost siblings of the Sun

    NARCIS (Netherlands)

    Portegies Zwart, S.F.

    2009-01-01

    The anomalous chemical abundances and the structure of the Edgeworth-Kuiper belt observed in the solar system constrain the initial mass and radius of the star cluster in which the Sun was born to M similar or equal to 500-3000M(circle dot) and R similar or equal to 1-3 pc. When the cluster

  1. No smoking guns under the Sun

    CERN Document Server

    CERN. Geneva

    2000-01-01

    The Sun is a typical main sequence star that generates its energy via the fusion of hydrogen into helium in two chains of nuclear reactions: the so-called pp chain and the CNO chain. If the nucleon number, electric charge, lepton flavour and energy are conserved and the Sun is in a steady state, then the total solar neutrino flux is fixed, to a good approximation, by the solar luminosity (approximately 65 billion neutrinos/cm2/s at Earth), independent of the specific nuclear reactions that power the Sun and produce neutrinos by beta decay or the electron capture of reaction products. The neutrinos from the dominant pp chain are produced by the beta decay of proton pairs (pp), boron-8 and lithium-4, and by electron capture by pp pairs and beryllium-7. Their spectra can be measured directly in the laboratory or calculated from the standard theory of electroweak interactions. To a very good approximation, they are independent of the conditions in the Sun. Only their relative contributions depend on the detailed ...

  2. The Sun's Mysteries from Space-II

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 1. The Sun's Mysteries from Space – II. B N Dwivedi A Mohan. General Article Volume 10 Issue 1 January 2005 pp 6-16. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/010/01/0006-0016 ...

  3. Sun1 deficiency leads to cerebellar ataxia in mice

    Directory of Open Access Journals (Sweden)

    Jing-Ya Wang

    2015-08-01

    Full Text Available Migration and organization of the nucleus are essential for the proliferation and differentiation of cells, including neurons. However, the relationship between the positioning of the nucleus and cellular morphogenesis remains poorly understood. Inherited recessive cerebellar ataxia has been attributed to mutations in SYNE1, a component of the linker of nucleoskeleton and cytoskeleton (LINC complex. Regardless, Syne1-mutant mice present with normal cerebellar development. The Sad1-Unc-84 homology (SUN-domain proteins are located at the inner nuclear membrane and recruit Syne proteins through the KASH domain to the outer nuclear membrane. Here, we report an unrecognized contribution of Sun1 and Sun2 to the postnatal development of murine cerebellum. Mice depleted of Sun1 showed a marked reduction in the cerebellar volume, and this phenotype is exacerbated with additional loss of a Sun2 allele. Consistent with these histological changes, Sun1−/− and Sun1−/−Sun2+/− mice exhibited defective motor coordination. Results of immunohistochemical analyses suggested that Sun1 is highly expressed in Purkinje cells and recruits Syne2 to the periphery of the nucleus. Approximately 33% of Purkinje cells in Sun1−/− mice and 66% of Purkinje cells in Sun1−/−Sun2+/− mice were absent from the surface of the internal granule layer (IGL, whereas the proliferation and migration of granule neurons were unaffected. Furthermore, the Sun1−/−Sun2+/− Purkinje cells exhibited retarded primary dendrite specification, reduced dendritic complexity and aberrant patterning of synapses. Our findings reveal a cell-type-specific role for Sun1 and Sun2 in nucleokinesis during cerebellar development, and we propose the use of Sun-deficient mice as a model for studying cerebellar ataxia that is associated with mutation of human SYNE genes or loss of Purkinje cells.

  4. Sun1 deficiency leads to cerebellar ataxia in mice.

    Science.gov (United States)

    Wang, Jing-Ya; Yu, I-Shing; Huang, Chien-Chi; Chen, Chia-Yen; Wang, Wan-Ping; Lin, Shu-Wha; Jeang, Kuan-Teh; Chi, Ya-Hui

    2015-08-01

    Migration and organization of the nucleus are essential for the proliferation and differentiation of cells, including neurons. However, the relationship between the positioning of the nucleus and cellular morphogenesis remains poorly understood. Inherited recessive cerebellar ataxia has been attributed to mutations in SYNE1, a component of the linker of nucleoskeleton and cytoskeleton (LINC) complex. Regardless, Syne1-mutant mice present with normal cerebellar development. The Sad1-Unc-84 homology (SUN)-domain proteins are located at the inner nuclear membrane and recruit Syne proteins through the KASH domain to the outer nuclear membrane. Here, we report an unrecognized contribution of Sun1 and Sun2 to the postnatal development of murine cerebellum. Mice depleted of Sun1 showed a marked reduction in the cerebellar volume, and this phenotype is exacerbated with additional loss of a Sun2 allele. Consistent with these histological changes, Sun1(-/-) and Sun1(-/-)Sun2(+/-) mice exhibited defective motor coordination. Results of immunohistochemical analyses suggested that Sun1 is highly expressed in Purkinje cells and recruits Syne2 to the periphery of the nucleus. Approximately 33% of Purkinje cells in Sun1(-/-) mice and 66% of Purkinje cells in Sun1(-/-)Sun2(+/-) mice were absent from the surface of the internal granule layer (IGL), whereas the proliferation and migration of granule neurons were unaffected. Furthermore, the Sun1(-/-)Sun2(+/-) Purkinje cells exhibited retarded primary dendrite specification, reduced dendritic complexity and aberrant patterning of synapses. Our findings reveal a cell-type-specific role for Sun1 and Sun2 in nucleokinesis during cerebellar development, and we propose the use of Sun-deficient mice as a model for studying cerebellar ataxia that is associated with mutation of human SYNE genes or loss of Purkinje cells. © 2015. Published by The Company of Biologists Ltd.

  5. School Sun-Protection Policies--Does Being SunSmart Make a Difference?

    Science.gov (United States)

    Turner, Denise; Harrison, Simone L.; Buettner, Petra; Nowak, Madeleine

    2014-01-01

    Evaluate the comprehensiveness of primary school sun-protection policies in tropical North Queensland, Australia. Pre-determined criteria were used to assess publicly available sun-protection policies from primary schools in Townsville (latitude 19.3°S; n = 43), Cairns (16.9°S; n = 46) and the Atherton Tablelands (17.3°S; n = 23) during 2009-2012.…

  6. VizieR Online Data Catalog: Energy levels & transition rates of O-like ions (Wang+, 2017)

    Science.gov (United States)

    Wang, K.; Jonsson, P.; Ekman, J.; Gaigalas, G.; Godefroid, M. R.; Si, R.; Chen, Z. B.; Li, S.; Chen, C. Y.; Yan, J.

    2017-06-01

    Employing two state-of-the-art methods, multiconfiguration Dirac-Hartree-Fock and second-order many-body perturbation theory, the excitation energies and lifetimes for the lowest 200 states of the 2s22p4, 2s2p5, 2p6, 2s22p33s, 2s22p33p, 2s22p33d, 2s2p43s, 2s2p43p, and 2s2p43d configurations, and multipole (electric dipole (E1), magnetic dipole (M1), and electric quadrupole (E2)) transition rates, line strengths, and oscillator strengths among these states are calculated for each O-like ion, from CrXVII to ZnXXIII. Our two data sets are compared with the National Institute of Standards and Technology and CHIANTI compiled values, and previous calculations. The data are accurate enough for identification and deblending of new emission lines from the Sun and other astrophysical sources. The amount of high-accuracy data is significantly increased for the n=3 states of several O-like ions of astrophysical interest, where experimental data are very scarce. (3 data files).

  7. A Tracking Sun Photometer Without Moving Parts

    Science.gov (United States)

    Strawa, Anthony W.

    2012-01-01

    This innovation is small, lightweight, and consumes very little electricity as it measures the solar energy attenuated by gases and aerosol particles in the atmosphere. A Sun photometer is commonly used on the Earth's surface, as well as on aircraft, to determine the solar energy attenuated by aerosol particles in the atmosphere and their distribution of sizes. This information is used to determine the spatial and temporal distribution of gases and aerosols in the atmosphere, as well as their distribution sizes. The design for this Sun photometer uses a combination of unique optics and a charge coupled device (CCD) array to eliminate moving parts and make the instrument more reliable. It could be selfcalibrating throughout the year. Data products would be down-welling flux, the direct-diffuse flux ratio, column abundance of gas phase constituents, aerosol optical depth at multiple-wavelengths, phase functions, cloud statistics, and an estimate of the representative size of atmospheric particles. These measurements can be used to obtain an estimate of aerosol size distribution, refractive index, and particle shape. Incident light is received at a light-reflecting (inner) surface, which is a truncated paraboloid. Light arriving from a hemispheric field of view (solid angle 2 steradians) enters the reflecting optic at an entrance aperture at, or adjacent to, the focus of the paraboloid, and is captured by the optic. Most of this light is reflected from an inner surface. The light proceeds substantially parallel to the paraboloid axis, and is detected by an array detector located near an exit aperture. Each of the entrance and exit apertures is formed by the intersection of the paraboloid with a plane substantially perpendicular to the paraboloid axis. Incident (non-reflected) light from a source of limited extent (the Sun) illuminates a limited area on the detector array. Both direct and diffuse illumination may be reflected, or not reflected, before being received on

  8. How Can I Protect My Children from the Sun?

    Science.gov (United States)

    ... How Can I Protect My Children from the Sun? Language: English (US) Español (Spanish) Recommend on Facebook ... other options to prevent UV damage. Too Much Sun Hurts Turning pink? Unprotected skin can be damaged ...

  9. Epigenetic battle of the sexes. Comment on: ;Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition; by Qian Wang et al.

    Science.gov (United States)

    Wu, Song

    2017-03-01

    Qian Wang et al. present an interesting framework, named epigenetic game theory, for modeling sex-based epigenetic dynamics during embryogenesis from a new viewpoint of evolutionary game theory [1]. That is, epigenomes of sperms and oocytes may coordinate through either cooperation or competition, or both, to affect the fitness of embryos. The work uses a set of ordinary differential equations (ODEs) to describe longitudinal trajectories of DNA methylation levels in both parental and maternal gametes and their dependence on each other. The insights gained from this review, i.e. dynamic methylation profiles and their interaction are potentially important to many fields, such as biomedicine and agriculture.

  10. Pupil constrictions to photographs of the sun.

    Science.gov (United States)

    Binda, Paola; Pereverzeva, Maria; Murray, Scott O

    2013-05-17

    The pupil constricts in response to light increments and dilates with light decrements. Here we show that a picture of the sun, introducing a small overall decrease in light level across the field of view, results in a pupillary constriction. Thus, the pictorial representation of a high-luminance object (the sun) can override the normal pupillary dilation elicited by a light decrement. In a series of experiments that control for a variety of factors known to modulate pupil size, we show that the effect (a) does not depend on the retinal position of the images and (b) is modulated by attention. It has long been known that cognitive factors can affect pupil diameter by producing pupillary dilations. Our results indicate that high-level visual analysis (beyond the simple subcortical system mediating the pupillary response to light) can also induce pupillary constriction, with an effect size of about 0.1 mm.

  11. Power producing sun shades; Elproducerende solafskaermninger

    Energy Technology Data Exchange (ETDEWEB)

    Johnsen, K.; Soerensen, Henrik; Katic, I.; Schmidt-Petersen, H.; AAroe, D.

    2012-01-15

    Integrating photovoltaics into sun shades takes advantage of the best opportunities to capture and utilize solar energy when the shades are most needed to shield users from solar radiation. The report describes results of a development project for solar shading in the form of broad, horizontal and rotating lamellae with solar cells and an integrated control function that simultaneously is optimized based on energy consumption and thermal and visual indoor climate. The project idea was to meet the needs for effective sun protection in the present office, commercial and public buildings, where glass facades are dominant. The conclusion of the development project is that it rarely would be optimal to integrate solar cells into movable shades. This will normally only be relevant in cases where it is justified by architectural considerations. (LN)

  12. BepiColombo fine sun sensor

    Science.gov (United States)

    Boslooper, Erik; van der Heiden, Nico; Naron, Daniël.; Schmits, Ruud; van der Velde, Jacob Jan; van Wakeren, Jorrit

    2017-11-01

    Design, development and verification of the passive Fine Sun Sensor (FSS) for the BepiColombo spacecraft is described. Major challenge in the design is to keep the detector at acceptable temperature levels while exposed to a solar flux intensity exceeding 10 times what is experienced in Earth orbit. A mesh type Heat Rejection Filter has been developed. The overall sensor design and its performance verification program is described.

  13. 21st Century Strategy Needs Sun Tzu

    Science.gov (United States)

    2012-03-22

    vital importance to the state. It is a matter of life and death, a road to safety or ruin. Therefore, it is a subject that must be studied...but also struggles to gain control of diminishing resources —energy, food , water—made more acute by a new status quo.”2 General Casey recognized...violations of military etiquette to challenge the strong. Sun Tzu carefully crafts and presents numerous tactics to address asymmetrical warfare. His

  14. Neutrinos and our Sun - Part 2

    Indian Academy of Sciences (India)

    In this part we describe the chain of nuclear re- actions that fuse protons into helium nuclei in the centres of stars. Neutrinos play an impor- tant role in the proton-proton chain and detec- tion of these neutrinos is important for a direct insight into the proc~sses taking place at the cen- tre of the sun. Experiments for the ...

  15. Outdoor Workers' Use of Sun Protection at Work and Leisure

    Directory of Open Access Journals (Sweden)

    Cheryl E. Peters

    2016-09-01

    Conclusion: This high-participation rate cohort helps characterize sun protection behaviors among outdoor workers. Workers practiced better sun protection at work than on weekends, suggesting that workplace policies supportive of sun protection could be useful for skin cancer prevention in the construction industry.

  16. The Sun Tower: An Inquiry Tool for a Dynamic Universe.

    Science.gov (United States)

    Lester, Dan; Sissom, Betty; Camden, Linda

    2000-01-01

    Explains the use of a Sun Tower in different activities at elementary grade levels while addressing national and state science standards. Shows the movement and motion of the sun in the sky. Introduces an activity that includes the sun tower in which students observe the changes of shadows every half hour. (YDS)

  17. Protective clothing in the sun | Tamas | Nigerian Journal of Clinical ...

    African Journals Online (AJOL)

    Sun protecting clothing is clothing designed for sun protection and is producted from the fabric rated for its level ultraviolet (UV) protection. Some textiles and fabrics emloyed in the use of sun protective clothing may be pre-treated with UV inhibiting ingredients during manufacture to enhance their UV blocking capacitiy.

  18. A photodiode based miniature sun sensor

    Science.gov (United States)

    Lü, Xiaozhou; Tao, Yebo; Xie, Kai; Wang, Songlin; Li, Xiaoping; Bao, Weimin; Chen, Renjie

    2017-04-01

    The solar vector is one of the most important parameters for attitude control of nanosatellites. This attitude control must be achieved without the sensors adding significantly to its size or mass. This paper presents a photodiode-based miniature sun sensor, which consists of two triangular pyramidal sensor unit structures, with each unit comprising three micro-silicon photodiodes. The two sensor units are installed on the diagonal of the nanosatellite to form a complete sun sensor capable of achieving a full-field range of solar vector measurements. In this paper, the mathematical model of the short-circuit currents of the silicon photodiodes as a function of the solar vector coordinates is deduced. A sensor sample was built and installed on a nanosatellite model, and the temperature compensation coefficient of the silicon photodiodes was obtained experimentally. The dynamic characteristic, linearity, hysteresis and repeatability of the component were measured. The sun sensor introduced in this paper can be placed on any satellite platform to allow a full range solar vector measurement, and this would result in an increase of only 1.86 g and 0.9 cm3 of the satellite’s mass and volume, respectively.

  19. Learning about the Dynamic Sun through Sounds

    Science.gov (United States)

    Quinn, M.; Peticolas, L. M.; Luhmann, J.; MacCallum, J.

    2008-06-01

    Can we hear the Sun or its solar wind? Not in the sense that they make sound. But we can take the particle, magnetic field, electric field, and image data and turn it into sound to demonstrate what the data tells us. We present work on turning data from the two-satellite NASA mission called STEREO (Solar TErrestrial RElations Observatory) into sounds and music (sonification). STEREO has two satellites orbiting the Sun near Earth's orbit to study the coronal mass ejections (CMEs) from the Corona. One sonification project aims to inspire musicians, museum patrons, and the public to learn more about CMEs by downloading STEREO data and using it to make music. We demonstrate the software and discuss the way in which it was developed. A second project aims to produce a museum exhibit using STEREO imagery and sounds from STEREO data. We demonstrate a "walk across the Sun" created for this exhibit so people can hear the features on solar images. We show how pixel intensity translates into pitches from selectable scales with selectable musical scale size and octave locations. We also share our successes and lessons learned.

  20. The structure and evolution of the Sun

    CERN Document Server

    Severino, Giuseppe

    2017-01-01

    This book equips the reader with a coherent understanding of the structure of the Sun and its evolution and provides all the knowledge required to construct a simplified model of the Sun. The early chapters cover key aspects of basic physics and describe the Sun’s size, mass, luminosity, and temperature. Using a semi-empirical approach, the structure of the present Sun is then modeled in detail, layer by layer, proceeding from the photosphere to the convection zone, radiation zone, and core. Finally, all stages of the Sun’s evolution, from its formation to the end of its life, are carefully explained. The book is primarily intended for university students taking the initial steps in moving from physics to astrophysics. It includes worked exercises and problems to illustrate the concepts discussed, as well as additional problems for independent study. With the aim of helping the reader as much as possible, most of the mathematics required to use the book are provided in the text.

  1. Seismic sounding of convection in the Sun

    Science.gov (United States)

    Sreenivasan, Katepalli R.

    2015-11-01

    Thermal convection is the dominant mechanism of energy transport in the outer envelope of the Sun (one-third by radius). It drives global fluid circulations and magnetic fields observed on the solar surface. Convection excites a broadband spectrum of acoustic waves that propagate within the interior and set up modal resonances. These acoustic waves, also called seismic waves, are observed at the surface of the Sun by space- and ground-based telescopes. Seismic sounding, the study of these seismic waves to infer the internal properties of the Sun, constitutes helioseismology. Here we review our knowledge of solar convection, especially that obtained through seismic inference. Several characteristics of solar convection, such as differential rotation, anisotropic Reynolds stresses, the influence of rotation on convection and supergranulation, are considered. On larger scales, several inferences suggest that convective velocities are substantially smaller than those predicted by theory and simulations. This discrepancy challenges the models of internal differential rotation that rely on convective stresses as a driving mechanism and provide an important benchmark for numerical simulations. In collaboration with Shravan Hanasoge, Tata Institute of Fundamental Research, Mumbai and Laurent Gizon, Max-Planck-Institut fuer Sonnensystemforschung, Goettingen.

  2. Monitoring Holes in the Sun's Corona

    Science.gov (United States)

    Kohler, Susanna

    2016-09-01

    Coronal holes are where the fast solar wind streams out of the Suns atmosphere, sending charged particles on rapid trajectories out into the solar system. A new study examines how the distribution of coronal holes has changed over the last 40 years.Coronal holes form where magnetic field lines open into space (B) instead of looping back to the solar surface (A). [Sebman81]Source of the Fast Solar WindAs a part of the Suns natural activity cycle, extremely low-density regions sometimes form in the solar corona. These coronal holes manifest themselves as dark patches in X-ray and extreme ultraviolet imaging, since the corona is much hotter than the solar surface that peeks through from underneath it.Coronal holes form when magnetic field lines open into space instead of looping back to the solar surface. In these regions, the solar atmosphere escapes via these field lines, rapidly streaming away from the Suns surface in whats known as the fast solar wind.Coronal Holes Over Space and TimeAutomated detection of coronal holes from image-based analysis is notoriously difficult. Recently, a team of scientists led by Kenichi Fujiki (ISEE, Nagoya University, Japan) has developed an automated prediction technique for coronal holes that relies instead on magnetic-field data for the Sun, obtained at the National Solar Observatorys Kitt Peak between 1975 and 2014. The team used these data to produce a database of 3335 coronal hole predictions over nearly 40 years.Latitude distribution of 2870 coronal holes (each marked by an x; color indicates polarity), overlaid on the magnetic butterfly map of the Sun. The low-latitude coronal holes display a similar butterfly pattern, in which they move closer to the equator over the course of the solar cycle. Polar coronal holes are more frequent during solar minima. [Fujiki et al. 2016]Examining trends in the coronal holes distribution in latitude and time, Fujiki and collaborators find a strong correlation between the total area covered

  3. The Sun: the Earth light source

    Science.gov (United States)

    Berrilli, Francesco; Giovannelli, Luca; Del Moro, Dario; Piazzesi, Roberto; Catena, Liu` Maria; Amicucci, Giordano; Vittorio, Nicola

    2015-04-01

    We have implemented at Department of Physics of University of Rome Tor Vergata a project called "The Sun: the Earth light source". The project obtained the official endorsement from the IAU Executive Committee Working Group for the International Year of Light. The project, specifically designed for high school students, is focused on the "scientific" study of Sun light by means of a complete acquisition system based on "on the shelf" appropriately CMOS low-cost sensor with free control s/w and self-assembled telescopes. The project (hereafter stage) plan is based on a course of two weeks (60 hours in total). The course contains 20 hours of theoretical lectures, necessary to learn basics about Sun, optics, telescopes and image sensors, and 40 hours of laboratory. During the course, scientists and astronomers share with high schools students, work activities in real research laboratories. High schools teachers are intensely involved in the project. Their role is to share activities with university teachers and realize outreach actions in the home institutions. Simultaneously, they are introduced to innovative teaching methods and the project in this way is regarded as a professional development course. Sun light analysis and Sun-Earth connection through light are the main scientific topics of this project. The laboratory section of the stage is executed in two phases (weeks): First phase aims are the realization of a keplerian telescope and low-cost acquisition system. During this week students are introduced to astronomical techniques used to safety collect and acquire solar light; Second phase aims is the realization of a low-cost instrument to analyse sunlight extracting information about the solar spectrum, solar irradiance and Sun-Earth connection. The proposed stage has been already tested in Italy reached the fifth edition in 2014. Since 2010, the project has been a cornerstone outreach program of the University of Rome Tor Vergata, the Italian Ministry of

  4. Sun Focus Comes First, Interstellar Comes Second

    Science.gov (United States)

    Maccone, C.

    Gravitational lensing is one of the most amazing discoveries produced by Einstein's general theory of relativity. To date, hundreds of gravitational lenses have been observed by astronomers and they led to a number of new results in extrasolar planet search, astrophysics and cosmology. SETI also could benefit from gravitational lensing if we could just get to 550 AU from the Sun and beyond. This is because the gravitational lens of the Sun would highly intensify there any weak radio signal reaching the solar system from distant civilizations in the Galaxy, as shown by this author in his 2009 book `` Deep Space Flight and Communications ''.The gravitational lens of the Sun, however, has a drawback: the solar Corona. Electrons in the Corona make electromagnetic waves ``diverge'' and this ``pushes the focus out'' to distances higher than 550 AU. For instance, at the CMB peak frequency of 160 GHz, the true focus lies at 763 AU. It would be safer to let the FOCAL spacecraft reach 1,000 AU.We could get rid of all solar-Corona-related problems, however, if we could reach the six-times higher distance of 6,077 AU. This is where the focal sphere of Jupiter lies. Jupiter is the second larger mass in the solar system after the Sun, but in this focal game not only the mass matters: rather, what really matters is the ratio between the radius of the body squared and the mass of the body. In this regard, Jupiter qualifies as the second best choice for a FOCAL space mission, requiring the FOCAL spacecraft to reach 6,077 AU.What about the other planets as gravitational lenses, then? Neptune qualifies third, with a focal sphere of 13,520 AU and Saturn comes fourth with a focal sphere of 14,420 AU. But the real surprise is the Earth, that qualifies just fifth with a focal sphere of 15,370 AU. And the Earth is indeed the best body we could use as a gravitational lens since we know about its atmosphere better than about any other planetary atmosphere.We have discovered a new BELT (made

  5. Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta: A New Species from South China Sea Based on Morphological Observation and rbcL Gene Sequences Analysis

    Directory of Open Access Journals (Sweden)

    Ling Yu

    2013-01-01

    Full Text Available Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1 thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2 cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3 the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81–108 bp from the sequences of other samples in Grateloupia; there are 114–133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia.

  6. Grateloupia ramosa Wang & Luan sp. nov. (Halymeniaceae, Rhodophyta), a new species from China based on morphological evidence and comparative rbcL sequences

    Science.gov (United States)

    Cao, Cuicui; Liu, Miao; Guo, Shaoru; Zhao, Dan; Luan, Rixiao; Wang, Hongwei

    2016-03-01

    Grateloupia ramosa Wang & Luan sp. nov. (Halymeniaceae, Rhodophyta) is newly described from Hainan Province, southern China. The organism has the following morphological features: (1) purplish red, cartilaginous and lubricous thalli 5-10 cm in height; (2) compressed percurrent axes bearing abundant branches with opposite arrangement; (3) claw-like apices on top, constricted to 2-4 cm at the base; (4) cortex consisting of 3-6 layers of elliptical or anomalous cells and a medulla covered by compact medullary filaments; (5) reproductive structures distributed throughout the thallus, especially centralized at the bottom of the end portion of the branches; and (6) 4-celled Carpogonial branches and 3-celled auxiliary-cell branches, both of the Grateloupia-type. The morphological diff erences were supported by molecular phylogenetics based on ribulose-1, 5-bisphosphate carboxylase/oxygenase ( rbcL) gene sequence analysis. There was only a 1 bp divergence between specimens collected from Wenchang and Lingshui of Hainan province. The new species was embedded in the large Grateloupia clade of the Halymeniaceae. The pairwise distances between G. ramosa and other species within Grateloupia ranged from 26 to 105 bp, within pairwise distances of 13-111 bp between species of the large genus Grateloupia in Halymeniaceae. Thus, we propose this new species as G. ramosa Wang & Luan sp. nov.

  7. Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta): a new species from South China Sea based on morphological observation and rbcL gene sequences analysis.

    Science.gov (United States)

    Yu, Ling; Wang, Hongwei; Luan, Rixiao

    2013-01-01

    Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1) thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2) cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3) the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81-108 bp from the sequences of other samples in Grateloupia; there are 114-133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia.

  8. Sun exposure and protection behavior of Danish farm children

    DEFF Research Database (Denmark)

    Bodekær, Mette; Øager Petersen, Bibi; Philipsen, Peter Alshede

    2014-01-01

    Healthy sun habits acquired in childhood could reduce skin cancer incidence. We examined the sun exposure and protection behavior of an expected high-exposure group of children, and the association to their parents. Open, prospective cohort study. One hundred and thirty nine participants (40...... families) kept daily sun behavior diaries (sun exposure, sunscreen use, sunburns) over a 4-month summer period (15,985 diary days). The Pigment Protection Factor (PPF), an objective measure of sun exposure, was measured at two body sites, before and after summer. All participants presented data from...... the same 115 days. Risk behavior (sun exposure of upper body) took place on 9.5 days (boys) and 15.6 days (girls). Sunburn and sunscreen use were infrequent. Boys' sun exposure resulted in an increased photo protection over the study period of 1.7 SED (upper arm) and 0.8 SED (shoulder) to elicit erythema...

  9. Associations between authoritative parenting and the sun exposure and sun protective behaviours of adolescents and their friends.

    Science.gov (United States)

    Mewse, Avril J; Lea, Stephen E G; Ntala, Eleni; Eiser, J Richard

    2011-05-01

    Associations between the sun exposure and sun protective behaviours of adolescents and their friends were examined along with the role played by authoritative parenting and other family and peer socialisation factors. Four hundred and two adolescents (198 males, 204 females) participated in the research. It was found that these adolescents and their friends shared similar sun exposure and sun protective behaviours and had similar parenting backgrounds. Parental authoritativeness was positively associated with the use of sun protection, even after the effects of other familial and peer variables were controlled, but not with the time spent sunbathing which was associated with friends' behaviours. The theoretical and practical implications of these findings are discussed.

  10. The rotation of the Sun's core.

    Science.gov (United States)

    Paterno, L.; Sofia, S.; di Mauro, M. P.

    1996-10-01

    The rotation of the Sun's core, below 0.3Rsun_, is inferred from two independent new results. The first is based on the recent oblateness measurements carried out by the Solar Disk Sextant (SDS) instrument outside the Earth's atmosphere, and the second on the very accurate measurements of rotational splittings of the lowest degree acoustic modes, carried out in the framework of the helioseismic network IRIS. By using the theory of slowly rotating stars applied to a solar standard model, we deduce a set of rotational laws for the innermost layers, which are consistent with both the measured oblateness value and the results of the inversion of helioseismic data. The SDS and IRIS results indicate that the Sun's central regions rotate at a rate in between 1.5 and 2 times the surface equatorial angular velocity. As a result of our analysis, we deduce a quadrupole moment J_2_=2.22x10^-7^, which implies an advance of Mercury's perihelion of 42.98arcsec/c, in agreement with the theory of General Relativity and the measurements of Mercury's orbit by means of planetary radar ranging. However, very recent results obtained by the helioseismic network BISON indicate that core rotation is even slower than the polar surface rotation and therefore imply a completely different scenario than that proposed here. If we assume the intermediate solution of rigid body rotation, an alternate source of the oblateness may be attributed to a magnetic field of the order of 10^5^Gauss in the interior of the Sun.

  11. Hinode, the Sun, and public outreach

    Science.gov (United States)

    Yaji, K.; Tonooka, H.; Shimojo, M.; Tokimasa, N.; Suzuki, D.; Nakamichi, A.; Shimoikura, I.

    2015-03-01

    Extended Abstract Hinode is a solar observation satellite in Japan and its launch was in September 2006. Its name means ``SUNRISE`` in Japanese. It has three instruments onboard in visible light, X-ray, EUV to solve mystery of coronal heating and origins of magnetic fields. Hinode has been providing us with impressive solar data, which are very important for not only investigating solar phenomena but also giving new knowledge about the sun to the public. In order to efficiently communicate Hinode data to the public, we organized working group for public use of Hinode data. which are composed of both researchers and educators in collaboration. As follow, we introduce our activities in brief. For the public use of Hinode data, at first, we produced two DVDs introducing Hinode observation results. In particular, second DVD contains a movie for kids, which are devloped to picturebook. Now, it is under producing an illustrated book and a planetarium program. It turn out that the DVDs help the public understand the sun from questionnaire surveys. Second, we developed teaching materials from Hinode data and had a science classroom about the sun, solar observations, practice with PC such as imaging software at junior high school. As the results, they had much interests in Hinode data. Third, we have joint observations with high school students and so on in a few years. The students compare their own data with Hinode data and have a presentation at science contests. The joint observations make their motivation higher in their activities. It is important to record and report our activities in some ways. So, we positively publish papers and have presentions in domestic/international meetings. Though we are supported in budget, resources and so on by NAOJ Hinode Team, we apply research funds for promoting our EPO activities and acquire some funds such as NAOJ Joint Research Expenses and Grands-Aid for Scientific Research Funds since the launch. This way, since its launch, we

  12. Asymmetric dark matter and the Sun

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Sarkar, Subir

    2010-01-01

    Cold dark matter particles with an intrinsic matter-antimatter asymmetry do not annihilate after gravitational capture by the Sun and can affect its interior structure. The rate of capture is exponentially enhanced when such particles have self-interactions of the right order to explain structure...... formation on galactic scales. A `dark baryon' of mass 5 GeV is a natural candidate and has the required relic abundance if its asymmetry is similar to that of ordinary baryons. We show that such particles can solve the `solar composition problem'. The predicted small decrease in the low energy neutrino...

  13. Quiet Sun unaffected by Activity Cycle

    Science.gov (United States)

    Livingston, W.; Gray, D.; Wallace, L.; White, O. R.

    2005-12-01

    The Sun's 11 year sunspot cycle, and all related phenomena, are driven by magnetism in the form of hot flux tubes which thread through the surface from below. Full disk chromospheric Ca K intensity observations track the activity cycle. But center disk Ca K and photospheric temperature sensitive lines are invariant to cycle magnetism. Recent high resolution photographs of the photosphere show that the flux tubes are confined between the granulation cells and do not interact with them. The result is a constant basal atmosphere without cyclic consequences for the Earth.

  14. Asymmetric dark matter and the sun.

    Science.gov (United States)

    Frandsen, Mads T; Sarkar, Subir

    2010-07-02

    Cold dark matter particles with an intrinsic matter-antimatter asymmetry do not annihilate after gravitational capture by the Sun and can affect its interior structure. The rate of capture is exponentially enhanced when such particles have self-interactions of the right order to explain structure formation on galactic scales. A "dark baryon" of mass 5 GeV is a natural candidate and has the required relic abundance if its asymmetry is similar to that of ordinary baryons. We show that such particles can solve the "solar composition problem." The predicted small decrease in the low energy neutrino fluxes may be measurable by the Borexino and SNO+ experiments.

  15. Helping Nevada School Children Become Sun Smart

    Centers for Disease Control (CDC) Podcasts

    2017-11-28

    This podcast features Christine Thompson, Community Programs Manager at the Nevada Cancer Coalition, and author of a recent study detailing a school-based program to help Nevada school children establish healthy sun safety habits and decrease UV exposure. Christine answers questions about her research and what impact her what impact the program had on children’s skin health.  Created: 11/28/2017 by Preventing Chronic Disease (PCD), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 11/28/2017.

  16. Sun, heat, and cold injuries in cyclists.

    Science.gov (United States)

    Helzer-Julin, M

    1994-01-01

    Cyclists are vulnerable to weather and commonly experience problems as they relate to extremes in both heat and cold. Educating cyclists on prevention of sunburn, dehydration, heat illness, hypothermia, and frostbite is the key. Limited sun exposure and proper use of sunscreens are the mainstay of treatment for prevention of sunburn. Adequate fluid and electrolyte replacement is necessary to avoid problems with dehydration and heat illness. Wind- and water-resistant clothing is recommended to protect against hypothermia and frostbite. Adequate training and acclimatization are, of course, recommended to all recreational and competitive riders for safe cycling.

  17. Occupational sun exposure and mycosis fungoides

    DEFF Research Database (Denmark)

    Morales-Suárez-Varela, Maria M.; Olsen, Jorn; Johansen, Preben

    2006-01-01

    OBJECTIVE: We sought to study the association between occupational sun exposure and mycosis fungoides (MF), a peripheral T-cell lymphoma. SUBJECTS and METHODS: A European multicenter case-control study including seven rare cases (one being MF) was conducted between 1995 and 1997. From the 118...... accepted cases, 104 were interviewed, of which 76 were definite cases. Population controls were selected randomly from the regions of case ascertainment. Information based on occupational experiences was coded according to industry types. A job exposure matrix was created according to the expected exposure...

  18. Sun-Earth Day Connects History, Culture and Science

    Science.gov (United States)

    Cline, T.; Thieman, J.

    2003-12-01

    The NASA Sun-Earth Connection Education forum annually promotes and event called Sun-Earth Day: a national celebration of the Sun, the space around the Earth (geospace), and how all of it affects life on our planet. For the past 3 years this event has provided a venue by which classrooms, museums, planetaria, and at NASA centers have had a sensational time sharing stories, images, and activities related to the Sun-Earth connections and the views o fthe Sun from Earth. Each year we select a different theme by which NASA Space Science can be further related to cross-curricular activities. Sun-Earth Day 2002, "Celebrate the Equinox", drew parallels between Native American Cultures and NASA's Sun-Earth Connection research via cultural stories, interviews, web links, activities and Native American participation. Sun-Earth Day 2003, "Live From the Aurora", shared the beauty of the Aurora through a variety of activities and stories related to perspectives of Northern Peoples. Sun-Earth Day 2004 will share the excitement of the transit of Venus through comparisons of Venus with Earth and Mars, calculations of the distances to nearby stars, and the use of transits to identify extra-solar planets. Finally, Sun-Earth Day 2005 will bring several of these themes together by turning our focus to the history and culture surrounding ancient observatories such as Chaco Canyon, Machu Picchu, and Chichen Itza.

  19. Factors associated with risky sun exposure behaviors among operating engineers.

    Science.gov (United States)

    Duffy, Sonia A; Choi, Seung Hee; Hollern, Rachael; Ronis, David L

    2012-09-01

    The objective of this study was to determine the factors associated with sun exposure behaviors among Operating Engineers (heavy equipment operators). Operating Engineers (N = 498) were asked to complete a cross-sectional survey. Linear and logistic regression analyses were used to determine health behavioral, perceptional, and demographic factors associated with sun exposure behavior (sun burns, blistering, use of sunscreen, and interest in sun protection services). Almost half reported two or more sunburns/summer and the median times blistering was 2 with a range of 0-100. About one-third never used sun block, while just over one-third rarely used sun block. Almost one-quarter were interested in sun protection guidance. Multivariate analyses showed that perceptions of skin type, alcohol problems, fruit intake, BMI, sleep quality, age, sex, and race were significantly associated with at least one of the outcome variables (P Operating Engineers are at high risk for skin cancer due to high rates of exposure to ultraviolet light and low rates of sun block use. Subgroups of Operating Engineers are particularly at risk for sun damage. Interventions are needed to decrease sun exposure among Operating Engineers. Copyright © 2012 Wiley Periodicals, Inc.

  20. The Sun and the Earth's Climate

    Directory of Open Access Journals (Sweden)

    Haigh Joanna D.

    2007-10-01

    Full Text Available Variations in solar activity, at least as observed in numbers of sunspots, have been apparent since ancient times but to what extent solar variability may affect global climate has been far more controversial. The subject had been in and out of fashion for at least two centuries but the current need to distinguish between natural and anthropogenic causes of climate change has brought it again to the forefront of meteorological research. The absolute radiometers carried by satellites since the late 1970s have produced indisputable evidence that total solar irradiance varies systematically over the 11-year sunspot cycle, relegating to history the term “solar constant”, but it is difficult to explain how the apparent response to the Sun, seen in many climate records, can be brought about by these rather small changes in radiation. This article reviews some of the evidence for a solar influence on the lower atmosphere and discusses some of the mechanisms whereby the Sun may produce more significant impacts than might be surmised from a consideration only of variations in total solar irradiance.

  1. 'Here comes the sun': pigmentary traits and sun habits in women with endometriosis.

    Science.gov (United States)

    Somigliana, Edgardo; Viganò, Paola; Abbiati, Annalisa; Gentilini, Davide; Parazzini, Fabio; Benaglia, Laura; Vercellini, Paolo; Fedele, Luigi

    2010-03-01

    There is limited but interesting evidence suggesting that endometriosis may be associated with specific pigmentary traits and sun habits. In this case-control study, we aimed to further clarify this point. Consecutive patients with a first laparoscopic diagnosis of endometriosis according to Holt and Weiss criteria were selected as cases. Controls were women who underwent laparoscopy during the same study period, but who were found to be free of the disease. Selected women were interviewed and examined by two trained physicians. An unconditional logistic regression model that included age and baseline variables significantly differing between the two groups was used to estimate the adjusted odds ratios (OR). There were 98 women with endometriosis and 94 controls selected. Overall, women with the disease had a more photo-sensitive phenotype and were exposed less to sun or ultraviolet radiation. A statistically significant difference was documented for eye color, skin reaction to first sun exposure, freckles score and the use of tanning creams. The adjusted OR (95% CI) for the disease was 1.95 (1.02-3.72) for women with green/blue eyes, 2.19 (1.12-4.28) for those who frequently/always had skin burn reaction to first sun exposure, 5.67 (1.98-16.24) for those with a higher number of freckles and 0.35 (0.15-0.85) for the use of tanning creams. Women with endometriosis have a specific photo-sensitive phenotype and protect themselves more from the sun. This latter habit may be consequent to the former. We speculate that there is a shared genetic background between pigmentation and endometriosis.

  2. 王弼《老子注》的詮釋辨證/ Interpretative Dialectics of Wang Bi’s Exegesis of Lao-Tzu

    Directory of Open Access Journals (Sweden)

    Jung-Tao TSAI

    2012-09-01

    Wang Bi, the most prominent scholar of metaphysics of the Wei and Jin Dynasties, was an unprecedented genius throughout the history of Chinese philosophy. In this article, the author examines the brilliant contributions made by Lin Li Zhen, Yu Dun Kang and Rudolf G. Wagner, who are noticed for their research of Exegesis of Lao-Tzu. It is a synthesis of the directions of investigation, approaches, and significant findings they have come up with. Among the three interpretations, Lin focuses on the explanation of Wang’s metaphysic thinking while Yu emphasizes Wang’s secular concerns by proposing the “philosophy of thoroughness” and political holism. As for Wagner, he approaches this work with the views of linguistic philosophy and suggests refined stylistics as interpretative strategy, which functions to enrich the textual contents.

  3. De Hemingway au chinois classique : le travail de la langue de l’écrivain taïwanais Wang Wen-hsing

    Directory of Open Access Journals (Sweden)

    Sandrine Marchand

    2014-04-01

    Full Text Available Dans les années 1970, l’« occidentalisation » de Wang Wen-hsing lui attire les foudres de la critique. On lui reproche, entre autres choses, de mal écrire, d’être incompréhensible et d’écrire dans une langue occidentalisée. Lui-même semble prendre pour modèle son professeur de français, dont le niveau de chinois classique était très élevé. Entre chinois classique, moderne, dialecte de sa région natale (très proche du dialecte de Taïwan, anglais, et français idéalisé, Wang Wen-hsing invente sa propre langue. Dans les manuscrits de son premier roman, il recourt au syllabaire que les enfants utilisent en cours d’apprentissage de la langue chinoise pour remplacer les caractères d’écriture, syllabaire qui disparaît ensuite à la publication. Que nous apprend l’utilisation de ce syllabaire sur le travail créatif de l’auteur ?Wang Wen-hsing est un auteur qui, entre extrême précision et violence, consacre sa vie et toute son énergie au travail de la langue. Quelle langue tente-t-il d’approcher : le chinois normatif des temps anciens, la langue américaine de Hemingway, ou un mélange des deux ?Multilingue à l’intérieur de la langue chinoise moderne, elle-même langue encore proche du chinois classique, abandonné seulement au début du xxe siècle, l’écriture romanesque de Wang Wen-hsing, qui a pour critère de valeur le « tong-shun » (clarté et aisance, est le fruit de l’oralité et d’une langue expérimentale. Ce rapport à la langue vient-il de sa situation d’émigration, de son isolement des milieux politiques et intellectuels, comme cela lui a été reproché lorsque justement on l’accusait d’écrire dans une langue incompréhensible pour le lecteur ? Pourquoi ces romans sont-ils jugés incompréhensibles ? En raison du niveau du lecteur moyen ? Pour des raisons géopolitiques, car il est un émigré en position dominante dans l’île ? Parce que la langue chinoise est dans

  4. A new concept: Epigenetic game theory. Comment on: ;Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition; by Qian Wang et al.

    Science.gov (United States)

    Zheng, Xiu-Deng; Tao, Yi

    2017-03-01

    The evolutionary significance of the interaction between paternal and maternal genomes in fertilized zygotes is a very interesting and challenging question. Wang et al. developed the concept of epigenetic game theory, and they try to use this concept to explain the interaction between paternal and maternal genomes in fertilized zygotes [1]. They emphasize that the embryogenesis can be considered as an ecological system in which two highly distinct and specialized gametes coordinate through either cooperation or competition, or both, to maximize the fitness of embryos under Darwinian selection. More specifically, they integrate game theory to model the pattern of coordination of paternal genome and maternal genomes mediated by DNA methylation dynamics, and they called this epigenetic game theory.

  5. Sun Tzu and Machiavelli in Syria: Attacking Alliances

    Science.gov (United States)

    2015-12-01

    means, as well as conducted data collection overseas. On the cover Left: statue of Chinese military strategist and philosopher Sun ...the issue. For now the purpose of this short work is to contextualize the ongoing conflict in Syria through the combined lens of Sun Tzu and...variables and intentions of the actors involved. The second part lays out the strategic principles of Sun Tzu as pertaining to the conflict to

  6. Multi-Aperture CMOS Sun Sensor for Microsatellite Attitude Determination

    Directory of Open Access Journals (Sweden)

    Michele Grassi

    2009-06-01

    Full Text Available This paper describes the high precision digital sun sensor under development at the University of Naples. The sensor determines the sun line orientation in the sensor frame from the measurement of the sun position on the focal plane. It exploits CMOS technology and an original optical head design with multiple apertures. This allows simultaneous multiple acquisitions of the sun as spots on the focal plane. The sensor can be operated either with a fixed or a variable number of sun spots, depending on the required field of view and sun-line measurement precision. Multiple acquisitions are averaged by using techniques which minimize the computational load to extract the sun line orientation with high precision. Accuracy and computational efficiency are also improved thanks to an original design of the calibration function relying on neural networks. Extensive test campaigns are carried out using a laboratory test facility reproducing sun spectrum, apparent size and distance, and variable illumination directions. Test results validate the sensor concept, confirming the precision improvement achievable with multiple apertures, and sensor operation with a variable number of sun spots. Specifically, the sensor provides accuracy and precision in the order of 1 arcmin and 1 arcsec, respectively.

  7. Microflaring in Low-Lying Core Fields and Extended Coronal Heating in the Quiet Sun

    Science.gov (United States)

    Porter, Jason G.; Falconer, D. A.; Moore, Ronald L.

    1999-01-01

    We have previously reported analyses of Yohkoh SXT data examining the relationship between the heating of extended coronal loops (both within and stemming from active regions) and microflaring in core fields lying along neutral lines near their footpoints (J. G. Porter, D. A. Falconer, and R. L. Moore 1998, in Solar Jets and Coronal Plumes, ed. T. Guyenne, ESA SP-421, and references therein). We found a surprisingly poor correlation of intensity variations in the extended loops with individual microflares in the compact heated areas at their feet, despite considerable circumstancial evidence linking the heating processes in these regions. Now, a study of Fe XII image sequences from SOHO EIT show that similar associations of core field structures with the footpoints of very extended coronal features can be found in the quiet Sun. The morphology is consistent with the finding of Wang et al. (1997, ApJ 484, L75) that polar plumes are rooted at sites of mixed polarity in the magnetic network. We find that the upstairs/downstairs intensity variations often follow the trend, identified in the active region observations, of a weak correspondence. Apparently much of the coronal heating in the extended loops is driven by a type of core field magnetic activity that is "cooler" than the events having the coronal signature of microflares, i.e., activity that results in little heating within the core fields themselves. This work was funded by the Solar Physics Branch of NASA's Office of Space Science through the SR&T Program and the SEC Guest Investigator Program.

  8. Measuring the Sun's motion with stellar streams

    Science.gov (United States)

    Malhan, Khyati; Ibata, Rodrigo A.

    2017-10-01

    We present a method for measuring the Sun's motion using the proper motions of Galactic halo star streams. The method relies on the fact that the motion of the stars perpendicular to a stream from a low-mass progenitor is close to zero when viewed from a non-rotating frame at rest with respect to the Galaxy, and that the deviation from zero is due to the reflex motion of the observer. The procedure we implement here has the advantage of being independent of the Galactic mass distribution. We run a suite of simulations to test the algorithm we have developed, and find that we can recover the input solar motion to good accuracy with data of the quality that will soon become available from the ESA/Gaia mission.

  9. An Encounter between the Sun and Venus

    CERN Document Server

    2004-01-01

    The astronomical event of the year will take place on Tuesday, 8 June, when Venus transits across the disk of the sun. In the framework of CERN's 50th anniversary celebrations, the CERN Astronomy Club and the Orion Club invite you to attend their observation of the event on the car park of the Val-Thoiry shopping centre (France) between 7.15 a.m. and 1.30 p.m. Various instruments will be set up in a special tent so that the event can be observed without any risk of damage to the eyes. As the observation of this astronomical event will depend on the weather forecast, confirmation of the above arrangements will be given on the 50th anniversary website the day before.

  10. AHP 21: Review: The Sun Rises

    Directory of Open Access Journals (Sweden)

    Mark Bender

    2012-12-01

    Full Text Available The Sun Rises is a model study contextualizing an oral narrative tradition in the social and ritual fabric of a remote community in northeast India. In many ways a companion volume to Himalayan Tribal Tales (Blackburn 2008, the text presents the first substantial translation of a key ritual text of the Apantani Valley dwellers in Arunachal Pradesh, located on the contested border between China (Tibet and India. The Apatani speak a Tibeto-Burman language, practice intensive rice agriculture in carefully terraced fields, and number about 35,000. Their clans populate several centuries-old villages. Until recently, they were separated from the lowlands of Assam and surrounded only by peoples practicing various forms of shifting agriculture. The valley dwellers have increasingly encountered modernization over the last few decades, including Indian and global popular culture, and Christianity. ...

  11. The Sun Makes You Number One!

    Energy Technology Data Exchange (ETDEWEB)

    Epstein, Marianne; Luckyanova, Maria; Manke, Kara

    2013-07-18

    Representing the Solid-State Solar-Thermal Energy Conversion Center (S3TEC), this document is one of the entries in the Ten Hundred and One Word Challenge. As part of the challenge, the 46 Energy Frontier Research Centers were invited to represent their science in images, cartoons, photos, words and original paintings, but any descriptions or words could only use the 1000 most commonly used words in the English language, with the addition of one word important to each of the EFRCs and the mission of DOE energy. The mission of S3TEC is advancing fundamental science and developing materials to harness heat from the sun and convert this heat into electricity via solid-state thermoelectric and thermophotovoltaic technologies.

  12. Cartography of the sun and the stars

    CERN Document Server

    Neiner, Coralie

    2016-01-01

    The mapping of the surface of stars requires diverse skills, analysis techniques and advanced modeling, i.e. the collaboration of scientists in various specialties. This volume gives insights into new techniques allowing for the first time to obtain resolved images of stars. It takes stock of what has been achieved so far in Chile, on the ESO VLTI instrument or, in the States, on the CHARA instrument. In recent times interferometry, combined with adaptive optics has allowed to reconstruct images of stars. Besides the Sun (of course) by now five stars have been resolved in detail. In addition to interferometry, this book highlights techniques used for mapping the surfaces of stars using photometry made by space observatories; Zeeman- and Doppler Imaging; mapping the surface element abundances via spectroscopy. This book will also take stock of the best images of the  solar surface, made by connecting the differential rotation to the underlying physical parameters derived from helioseismology. Recent measureme...

  13. Imaging convection and magnetism in the sun

    CERN Document Server

    Hanasoge, Shravan

    2015-01-01

    This book reviews the field of helioseismology and its outstanding challenges and also offers a detailed discussion of the latest computational methodologies. The focus is on the development and implementation of techniques to create 3-D images of convection and magnetism in the solar interior and to introduce the latest computational and theoretical methods to the interested reader. With the increasing availability of computational resources, demand for greater accuracy in the interpretation of helioseismic measurements and the advent of billion-dollar instruments taking high-quality observations, computational methods of helioseismology that enable probing the 3-D structure of the Sun have increasingly become central. This book will benefit students and researchers with proficiency in basic numerical methods, differential equations and linear algebra who are interested in helioseismology.

  14. Weekend sun protection and sunburn in Australia trends (1987-2002) and association with SunSmart television advertising.

    Science.gov (United States)

    Dobbinson, Suzanne J; Wakefield, Melanie A; Jamsen, Kris M; Herd, Natalie L; Spittal, Matthew J; Lipscomb, John E; Hill, David J

    2008-02-01

    The Australian state of Victoria has run a population-based skin cancer prevention program called SunSmart since 1988, incorporating substantial public education efforts and environmental change strategies. Trends over 15 years in behavioral risk factors for skin cancer were examined in a population exposed to the SunSmart program. Whether outcomes were associated with extent of SunSmart television advertising was then assessed. In nine cross-sectional surveys from 1987 to 2002, 11,589 adults were interviewed by telephone about their sun exposure and sun protection during outdoor activities on summer weekends. Analyses completed in 2007 adjusted for ambient temperature and ultraviolet radiation. Sun protection and sunburn show substantial general improvement over time, but have stalled in recent years. Use of hats and sunscreens significantly increased over time and peaked during the mid to late 1990s, compared with the pre-SunSmart baseline. The mean proportion of unprotected skin was reduced and was lowest in the summer of 1997-1998. Summer sunburn incidence declined over time and was 9.1% in 2002, almost half baseline (OR=0.53; 95% CI=0.39-0.73). Higher exposure to SunSmart advertising in the 4 weeks before the interview increased: (1) preference for no tan, (2) hat and sunscreen use, and (3) proportion of body surface protected from the sun. The general improvement in sun-protective behaviors over time highlight that a population's sun-protective behaviors are amenable to change. Population-based prevention programs incorporating substantial television advertising campaigns into the mix of strategies may be highly effective in improving a population's sun-protective behaviors.

  15. Predictors of sun protection behaviours and sunburn among Australian adolescents

    Directory of Open Access Journals (Sweden)

    Simone Pettigrew

    2016-07-01

    Full Text Available Abstract Background Excessive sun exposure and sunburn increase individuals’ risk of skin cancer. It is especially important to prevent sunburn in childhood due to the higher relative risk of skin cancer across the life span compared to risk associated with sunburn episodes experienced later in life. This study examined demographic and attitudinal factors associated with engagement in a range of sun protection behaviours (wearing a hat, wearing protective clothing, staying in the shade, and staying indoors during the middle of the day and the frequency of sunburn among Western Australian adolescents to provide insights of relevance for future sun protection campaigns. Methods Cross-sectional telephone surveys were conducted annually with Western Australians between 2005/06 and 2014/15. The results from 4150 adolescents aged 14–17 years were used to conduct a path analysis of factors predicting various sun protection behaviours and sunburn. Results Significant primary predictors of the sun protection behaviours included in the study were skin type (sun sensitivity, gender, tanning-related attitudes and behaviours, and perceived relevance of public service advertisements that advocate sun protection. Of the four sun protection behaviours investigated, staying in the shade and staying indoors during the middle of the day were associated with a lower frequency of sunburn. Conclusion There is a particular need to target sun protection messages at adolescent males who are less likely to engage in the most effective sun protection behaviours and demonstrate an increased propensity to experience sunburn. The results suggest that such future sun protection messages should include a focus on the importance of staying in the shade or indoors during periods of high UV radiation to increase awareness of the efficacy of these methods of avoiding skin cancer.

  16. Sun Protection Policies of Australian Primary Schools in a Region of High Sun Exposure

    Science.gov (United States)

    Harrison, S. L.; Garzón-Chavez, D. R.; Nikles, C. J.

    2016-01-01

    Queensland, Australia has the highest rates of skin cancer globally. Predetermined criteria were used to score the comprehensiveness of sun protection policies (SPP) of primary schools across Queensland. SPP were sought for schools in 10 regions (latitude range 16.3°S-28.1°S) from 2011 to 2014. Of the 723 schools sampled, 90.9% had a written SPP…

  17. Quadrant to Measure the Sun's Altitude

    Science.gov (United States)

    Windsor, A Morgan, Jr.

    2013-01-01

    The changing altitude of the Sun (either over the course of a day or longer periods) is a phenomenon that students do not normally appreciate. However, the altitude of the Sun affects many topics in disciplines as diverse as astronomy, meteorology, navigation, or horology, such as the basis for seasons, determination of latitude and longitude, or…

  18. Child sun safety: Application of an Integrated Behavior Change model.

    Science.gov (United States)

    Hamilton, Kyra; Kirkpatrick, Aaron; Rebar, Amanda; Hagger, Martin S

    2017-09-01

    Childhood sun exposure increases risk of skin cancer in later life. Parents of young children play an important role in minimizing childhood sun exposure. The aim of the current study was to identify the motivational, volitional, and implicit antecedents of parents' sun-protective behaviors based on an Integrated Behavior Change model. Parents (N = 373) of 2- to 5-year-old children self-reported their intentions, attitudes, subjective norm, perceived behavioral control, autonomous and controlled motivation, action plans, habit, and past behaviors with respect to sun-protective behaviors for their children. Two weeks later (n = 273), the parents self-reported their participation in sun-protective behaviors for their child. Data were analyzed using variance-based structural equation modeling. Results showed significant direct effects of attitudes, subjective norm, perceived behavioral control, and past behavior on intentions, and significant direct effects of autonomous motivation, perceived behavioral control, intentions, action planning, habit, and past behavior on parents' participation in sun-protective behaviors for their child. There were also significant total indirect effects of autonomous motivation on intentions mediated by attitudes and subjective norm. Current results indicate that parents' sun-protective behaviors toward their children are a function of motivational (autonomous motivation, intentions), volitional (action planning), and implicit (habit) factors. The findings from the current study provide formative data to inform the development of behavior change interventions to increase parents' participation in sun-protective behaviors for their children. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  19. Growth and morphogenesis of sun and shade plants

    NARCIS (Netherlands)

    Corre, W.J.

    1984-01-01

    A number of species of sun and shade plants in the vegetative phase were grown in different light intensities, different light qualities (r/fr ratio) and different combinations of light intensity and nutrient supply. Sun and shade species were also grown at various plant densities and in

  20. Low Frequency Radio Emission from the'Quiet'Sun

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Permanent link: http://www.ias.ac.in/article/fulltext/joaa/021/03-04/0237-0240. Keywords. Sun; corona; radio observations; streamers; scattering. Abstract. We present observations of the 'quiet' Sun close to the recent solar minimum (Cycle 22), with the Gauribidanur radioheliograph. Our main conclusion is ...

  1. Cell Phones and Sun Shadows: Exploring the Equation of Time

    Science.gov (United States)

    Madden, Sean P.

    2010-01-01

    For thousands of years before the invention of reliable clocks, humans measured their days by the motion of the sun. Astronomically, one day was the length of time it took for the sun to return to the same position in the sky. With the advent of precise mechanical chronometers such as Harrison's timekeepers (Sobel and Andrewes 1998), which ran at…

  2. Cassava Sun Drying Performance on Various Surfaces and Drying ...

    African Journals Online (AJOL)

    Cassava Sun Drying Performance on Various Surfaces and Drying Bed Depths. ... Tanzania Journal of Agricultural Sciences ... The experiments were done using kiroba cassava variety obtained from the University farm, which was peeled and sliced into thin chips (2-3 mm) then sun dried on wire mesh, black polythene, ...

  3. Blood biochemistry and haematology of weaner rabbits fed sun ...

    African Journals Online (AJOL)

    Blood biochemistry and haematology of weaner rabbits fed sun-dried, ensiled, and fermented cassava peel-based diets. ... Ghana Journal of Agricultural Science ... 16.20 and 16.08 per cent CP in which 10 per cent maize of the control diet was replaced, respectively, with sun-dried, ensiled and fermented cassava peels.

  4. Sun Safety Knowledge, Attitudes, and Behaviors among Beachgoing Adolescents

    Science.gov (United States)

    Merten, Julie Williams; Higgins, Sue; Rowan, Alan; Pragle, Aimee

    2014-01-01

    Background: Skin cancer rates are rising and could be reduced with better sun protection behaviors. Adolescent exposure to ultraviolet (UV) radiation is damaging because it can lead to skin cancer. This descriptive study extends understanding of adolescent sun exposure attitudes, knowledge, and behaviors. Methods: A sample of 423 beachgoing…

  5. Low Frequency Radio Emission from the 'Quiet' Sun

    Indian Academy of Sciences (India)

    tribpo

    Astr. (2000) 21, 237 240. Low Frequency Radio Emission from the 'Quiet' Sun. R. Ramesh, Indian Institute of Astrophysics, Bangalore 560034, India, e mail: ramesh@iiap. ernet. in. Abstract. We present observations of the 'quiet' Sun close to the recent solar minimum (Cycle 22), with the Gauribidanur radioheliograph. Our.

  6. Regular Biology Students Learn Like AP Students with SUN

    Science.gov (United States)

    Batiza, Ann; Luo, Wen; Zhang, Bo; Gruhl, Mary; Nelson, David; Hoelzer, Mark; Ning, Ling; Roberts, Marisa; Knopp, Jonathan; Harrington, Tom; LaFlamme, Donna; Haasch, Mary Anne; Vogt, Gina; Goodsell, David; Marcey, David

    2016-01-01

    The SUN approach to biological energy transfer education is fundamentally different from past practices that trace chemical and energy inputs and outputs. The SUN approach uses a hydrogen fuel cell to convince learners that electrons can move from one substance to another based on differential attraction. With a hydrogen fuel cell, learners can…

  7. Relationship Factors and Couples' Engagement in Sun Protection

    Science.gov (United States)

    Manne, S. L.; Coups, E. J.; Kashy, D. A.

    2016-01-01

    Individuals may be more motivated to adopt health practices if they consider the benefits of these behaviors for their close relationships. The goal of this study was to examine couple concordance with sun protection and use the interdependence and communal coping theory to evaluate the role of relationship factors in sun protection. One hundred…

  8. The Sun is Condensed Matter and has a Real Surface

    Science.gov (United States)

    Robitaille, Pierre-Marie

    2014-03-01

    The idea that the Sun was a gaseous in nature was born from 1858-65. At that time, a group of men, including Herbert Spencer, Father Angelo Secchi, Warren de la Rue, Balfour Stewart, and Benjamin Loewy, advanced that the Sun was a ball of gas. In 1865, Hervé Faye was the first to argue that the solar surface was merely an illusion. Dismissing all signs to the contrary, solar physics has promoted this idea to the present day, as manifested by the Standard Solar Model. In this work, overwhelming observational evidence will be presented that the Sun does indeed possess a distinct surface (see P.M. Robitaille, Forty Lines of Evidence for Condensed Matter -- The Sun on Trial: Liquid Metallic Hydrogen as a Solar Building Block, Progress in Physics, 2013, v. 4, 90-143). Our telescopes and satellites are sampling real structures on the surface of the Sun.

  9. The Faint Young Sun and Faint Young Stars Paradox

    Science.gov (United States)

    Martens, Petrus C.

    2017-10-01

    The purpose of this paper is to explore a resolution for the Faint Young Sun Paradox that has been mostly rejected by the community, namely the possibility of a somewhat more massive young Sun with a large mass loss rate sustained for two to three billion years. This would make the young Sun bright enough to keep both the terrestrial and Martian oceans from freezing, and thus resolve the paradox. It is found that a large and sustained mass loss is consistent with the well observed spin-down rate of Sun-like stars, and indeed may be required for it. It is concluded that a more massive young Sun must be considered a plausible hypothesis.

  10. Cosmic Influence on the Sun-Earth Environment

    Directory of Open Access Journals (Sweden)

    Saumitra Mukherjee

    2008-12-01

    Full Text Available SOHO satellite data reveals geophysical changes before sudden changes in the Earth's Sun-Earth environment. The influence of extragalactic changes on the Sun as well as the Sun-Earth environment seems to be both periodic and episodic. The periodic changes in terms of solar maxima and minima occur every 11 years, whereas the episodic changes can happen at any time. Episodic changes can be monitored by cosmic ray detectors as a sudden increase or decrease of activity. During these solar and cosmic anomaly periods the environment of the Earth is affected. The Star-Sun-Earth connection has the potential to influence the thermosphere, atmosphere, ionosphere and lithosphere. Initial correlation of the cosmic and Sun-Earth connection has shown the possibility of predicting earthquakes, sudden changes in atmospheric temperatures and erratic rainfall/snowfall patterns.

  11. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  12. Knowledge and Practice of Sun Protection in Schools in South Africa Where No National Sun Protection Programme Exists

    Science.gov (United States)

    Wright, Caradee Y.; Reeder, Anthony I.; Albers, Patricia N.

    2016-01-01

    Interventions in primary schools that increase sun-protective behaviours and decrease ultraviolet radiation exposure, sunburn incidence and skin cancer risk can be effective. SunSmart School Accreditation Programmes (SSAP) are recommended. Prior to SSAP implementation in South Africa, we explored the feasibility of obtaining national baseline…

  13. How Does the Sun's Spectrum Vary?

    Science.gov (United States)

    Lean, Judith L.; DeLand, Matthew T.

    2011-01-01

    Recent observations made by the Spectral Irradiance Monitor (SIM) on the Solar Radiation and Climate Experiment (SORCE) spacecraft suggest that the Sun's visible and infrared spectral irradiance increased from 2004 to 2008, even as the total solar irradiance measured simultaneously by SORCE's Total Irradiance Monitor (TIM) decreased. As well, solar ultraviolet (UV) irradiance decreased 3 to 10 times more than expected from prior observations and model calculations of the known effects of sunspot and facular solar features. Analysis of the SIM spectral irradiance observations during the solar minimum epoch of 2008, when solar activity was essentially invariant, exposes trends in the SIM observations relative to both total solar irradiance and solar activity that are unlikely solar in origin. We suggest that the SIM's radically different solar variability characterization is a consequence of undetected instrument sensitivity drifts, not true solar spectrum changes. It is thus doubtful that simulations of climate and atmospheric change using SIM measurements are indicative of real behavior in the Earth's climate and atmosphere.

  14. Observing the Sun with Coronado telescopes telescopes

    CERN Document Server

    Pugh, Philip

    2007-01-01

    The Sun provides amateur astronomers with one of the few opportunities for daytime astronomy. In order to see the major features of our nearest star, special telescopes that have a very narrow visible bandwidth are essential. The bandwidth has to be as narrow as 1 A- 10-10 m (1 Angstrom) and centred on the absorption line of neutral hydrogen. This makes many major features of the Suna (TM)s chromosphere visible to the observer. Such narrow-band "Fabry-Perot etalon filters" are high technology, and until the introduction of the Coronado range of solar telescopes, were too expensive for amateur use. The entry-level Coronado telescope, the PST (Personal Solar Telescope) costs under 500. Solar prominences (vast columns of plasma, best seen at the edge of the solar disk), filaments, flares, sunspots, plage and active regions are all visible and can be imaged to produce spectacular solar photographs. Philip Pugh has assembled a team of contributors who show just how much solar work can be done with Coronado telesco...

  15. MHD wave transmission in the Sun's atmosphere

    Science.gov (United States)

    Stangalini, M.; Del Moro, D.; Berrilli, F.; Jefferies, S. M.

    2011-10-01

    Magnetohydrodynamics (MHD) wave propagation inside the Sun's atmosphere is closely related to the magnetic field topology. For example, magnetic fields are able to lower the cutoff frequency for acoustic waves, thus allowing the propagation of waves that would otherwise be trapped below the photosphere into the upper atmosphere. In addition, MHD waves can be either transmitted or converted into other forms of waves at altitudes where the sound speed equals the Alfvén speed. We take advantage of the large field-of-view provided by the IBIS experiment to study the wave propagation at two heights in the solar atmosphere, which is probed using the photospheric Fe 617.3 nm spectral line and the chromospheric Ca 854.2 nm spectral line, and its relationship to the local magnetic field. Among other things, we find substantial leakage of waves with five-minute periods in the chromosphere at the edges of a pore and in the diffuse magnetic field surrounding it. By using spectropolarimetric inversions of Hinode SOT/SP data, we also find a relationship between the photospheric power spectrum and the magnetic field inclination angle. In particular, we identify well-defined transmission peaks around 25° for five-minute waves and around 15° for three-minute waves. We propose a very simple model based on wave transmission theory to explain this behavior. Finally, our analysis of both the power spectra and chromospheric amplification spectra suggests the presence of longitudinal acoustic waves along the magnetic field lines.

  16. The impact of an underground cut-off wall on nutrient dynamics in groundwater in the lower Wang River watershed, China.

    Science.gov (United States)

    Kang, Pingping; Xu, Shiguo

    2017-03-01

    Underground cut-off walls in coastal regions are mainly used to prevent saltwater intrusion, but their impact on nutrient dynamics in groundwater is not clear. In this study, a combined analysis of multiple isotopes ([Formula: see text]) and nitrogen and phosphorus concentrations is used in order to assess the impact of the underground cut-off walls on the nutrient dynamics in groundwater in the lower Wang River watershed, China. Compared with the nitrogen and phosphorus concentrations in groundwater downstream of the underground cut-off walls, high [Formula: see text] and total dissolved nitrogen concentrations and similar concentration levels of [Formula: see text] and total dissolved phosphorus are found in groundwater upstream of the underground cut-off walls. The isotopic data indicated the probable occurrence of denitrification and nitrification processes in groundwater upstream, whereas the fingerprint of these processes was not shown in groundwater downstream. The management of fertilizer application is critical to control nitrogen concentrations in groundwater restricted by the underground cut-off walls.

  17. Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. III. Impact of combining rules on mixtures properties

    Energy Technology Data Exchange (ETDEWEB)

    Desgranges, Caroline; Delhommelle, Jerome [Department of Chemistry, University of North Dakota, 151 Cornell Street Stop 9024, Grand Forks, North Dakota 58202 (United States)

    2014-03-14

    Combining rules, such as the Lorentz-Berthelot rules, are routinely used to calculate the thermodynamic properties of mixtures using molecular simulations. Here we extend the expanded Wang-Landau simulation approach to determine the impact of the combining rules on the value of the partition function of binary systems, and, in turn, on the phase coexistence and thermodynamics of these mixtures. We study various types of mixtures, ranging from systems of rare gases to biologically and technologically relevant mixtures, such as water-urea and water-carbon dioxide. Comparing the simulation results to the experimental data on mixtures of rare gases allows us to rank the performance of combining rules. We find that the widely used Lorentz-Berthelot rules exhibit the largest deviations from the experimental data, both for the bulk and at coexistence, while the Kong and Waldman-Hagler provide much better alternatives. In particular, in the case of aqueous solutions of urea, we show that the use of the Lorentz-Berthelot rules has a strong impact on the Gibbs free energy of the solute, overshooting the value predicted by the Waldman-Hagler rules by 7%. This result emphasizes the importance of the combining rule for the determination of hydration free energies using molecular simulations.

  18. Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. III. Impact of combining rules on mixtures properties

    Science.gov (United States)

    Desgranges, Caroline; Delhommelle, Jerome

    2014-03-01

    Combining rules, such as the Lorentz-Berthelot rules, are routinely used to calculate the thermodynamic properties of mixtures using molecular simulations. Here we extend the expanded Wang-Landau simulation approach to determine the impact of the combining rules on the value of the partition function of binary systems, and, in turn, on the phase coexistence and thermodynamics of these mixtures. We study various types of mixtures, ranging from systems of rare gases to biologically and technologically relevant mixtures, such as water-urea and water-carbon dioxide. Comparing the simulation results to the experimental data on mixtures of rare gases allows us to rank the performance of combining rules. We find that the widely used Lorentz-Berthelot rules exhibit the largest deviations from the experimental data, both for the bulk and at coexistence, while the Kong and Waldman-Hagler provide much better alternatives. In particular, in the case of aqueous solutions of urea, we show that the use of the Lorentz-Berthelot rules has a strong impact on the Gibbs free energy of the solute, overshooting the value predicted by the Waldman-Hagler rules by 7%. This result emphasizes the importance of the combining rule for the determination of hydration free energies using molecular simulations.

  19. Game theory in epigenetic reprogramming. Comment on: ;Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition; by Qian Wang et al.

    Science.gov (United States)

    Hsu, Fei-Man; Chen, Pao-Yang

    2017-03-01

    Von Neumann and Morgenstern published the Theory of Games and Economic Behavior in 1944, describing game theory as a model in which intelligent rational decision-makers manage to find their best strategies in conflict, cooperative or other mutualistic relationships to acquire the greatest benefit [1]. This model was subsequently incorporated in ecology to simulate the ;fitness; of a species during natural selection, designated evolutionary game theory (EGT) [2]. Wang et al. proposed ;epiGame;, taking paternal and maternal genomes as ;intelligent; players that compete, cooperate or both during embryogenesis to maximize the fitness of the embryo [3]. They further extended game theory to an individual or single cell environment. During early zygote development, DNA methylation is reprogrammed such that the paternal genome is demethylated before the maternal genome. After the reset, the blastocyst is re-methylated during embryogenesis. At that time, the paternal and maternal genomes have a conflict of interest related to the expression of their own genes. The proposed epiGame models such interactive regulation between the parental genomes to reach a balance for embryo development (equation (2)).

  20. Unintended Sunburn: A Potential Target for Sun Protection Messages

    Directory of Open Access Journals (Sweden)

    Geraldine F. H. McLeod

    2017-01-01

    Full Text Available New Zealand (NZ has the highest melanoma incidence rate in the world. Primary prevention efforts focus on reducing sunburn incidence and increasing sun protective practices in the population. However, sunburn from excessive ultraviolet radiation (UVR remains common. To reduce sunburn incidence, it is important to examine those individuals who experience unintended sunburn. This study aims to use data from the NZ Triennial Sun Protection Survey to describe respondents who were not intending to tan but were sunburnt after outdoor UVR exposure. Information on sociodemographics, concurrent weather conditions, sun protection attitudes and knowledge, and outdoor behaviour was also collected. The results showed 13.5% of respondents’ experienced unintended sunburn during the survey weekend but had not attempted to obtain a tan that summer. Respondents who reported unintended sunburn were more likely than others to have been near water and in unshaded areas, used sunscreen, had higher SunSmart knowledge scores, had lower positive attitudes towards tanning, and were outdoors for a longer duration with less body coverage. As sunburn was unintended these respondents’ outdoor sun protective behaviours may be amenable to change. Future public health initiatives should focus on increasing sun protection (clothing and shade and reducing potential barriers to sun protection.

  1. The Sun as a Hot Liquid Plasma: Additional Evidence

    Science.gov (United States)

    Robitaille, Pierre-Marie

    2004-04-01

    Current astrophysical models view the Sun as a compressible gas. In contrast, it has been advanced by the author that the Sun is an incompressible liquid (or liquid plasma). The first line of evidence for the condensed state of the solar surface is based on the Planckian appearance of the photospheric spectrum (note that the Sun is nonetheless in violation of Kirchhoff's Law of thermal emission). However, ample additional evidence points to a liquid Sun. In this talk, it will be demonstrated that all gaseous models are irreconcilable with the presence of seismological activity on the surface of the Sun. The photospheric densities advanced by the gaseous models ( 0.0000001 g/cm3) are comparable to some of the best vacuums known on earth. Such densities are unable to sustain seismological activity as will be demonstrated by a review of the literature. In addition, the presence of solar oblateness ( 0.000005) also provides powerful evidence that the Sun is a liquid. This is because such a degree of oblateness can only be explained by treating the Sun as a rigid body with a constant interior density.

  2. Ineffectiveness of sun awareness posters in dermatology clinics.

    Science.gov (United States)

    Jung, G W; Senthilselvan, A; Salopek, T G

    2010-06-01

    Although sun awareness posters have been used in doctors' offices and clinics for decades to promote sun protective behaviour, there is no evidence of their usefulness. To investigate whether sun awareness posters lead to inquiry of skin cancer and sun protection measures. Patients considered at risk for skin cancer seen at a dermatology clinic were randomly asked to complete a questionnaire designed to assess the effectiveness of three different sun awareness posters placed in patient rooms. The posters were selected on the basis of their catchy slogan and eye-appealing images, and included those featuring parental interest, sex appeal and informative advice. Only half of the patients noticed the posters (50.6%). The poster with sex appeal garnered the most attention (67.8%), followed by the informative poster (49.2%) and the parental interest poster (35.8%) (P poster inquired about cutaneous cancers and sun protection practices twice as often as those who did not notice the poster, only one-tenth of such inquiries were attributed to the poster ( approximately 5% of the target population). As reported in the questionnaire, the posters themselves were less effective than the advice of physicians in influencing patient attitudes towards sun protection measures. Organizations that produce and disseminate posters should consider beyond focus groups when they design their posters and should consider field testing their products to ensure that they are reaching the targeted audience and are having the expected beneficial effect, otherwise their posters are simply decorative.

  3. Traditions of the Sun, One Model for Expanding Audience Access

    Science.gov (United States)

    Hawkins, I.; Paglierani, R.

    2006-12-01

    The Internet is a powerful tool with which to expand audience access, bringing students, teachers and the public to places and resources they might not otherwise visit or make use of. We will present Traditions of the Sun, an experiential Web site that invites exploration of the world's ancient observatories with special emphasis on Chaco Culture National Historic Park in the Four Corners region of the US and several sites in the Yucatan Peninsula in Mexico. Traditions of the Sun includes resources in English and Spanish along with a unique trilingual on-line book, "Traditions of the Sun, A Photographic Journal," containing explanatory text in Yucatec Maya as well. Traditions of the Sun offers rich opportunities for virtual visits to ancient sites used for solar observing while learning about current NASA research on the Sun and indigenous solar practices within a larger historical and cultural context. The site contains hundreds of photographs, historic images and rich multimedia to help tell the story of the Sun-Earth Connection. Visitors to the site can zoom in on the great Mayan cities of Chichen Itza, Uxmal, Dzibilchaltun, and Mayapan to learn about Mayan astronomy, history, culture, and science. They can also visit Chaco Canyon to watch sunrise over Pueblo Bonito on the summer solstice, take a virtual reality tour of the great kiva at Casa Rinconada or see panoramic vistas from Fajada Butte, an area which, for preservation purposes, is restricted to the public. Traditions of the Sun provides one model of how exploration and discovery can come to life for both formal and informal audiences via the Internet. Traditions of the Sun is a collaborative project between NASA's Sun-Earth Connection Education Forum, the National Park Service, Instituto National de Antropologia e Historia, Universidad Nacional Autonoma de Mexico, and Ideum.

  4. Human eye and the sun hot and cold light

    CERN Document Server

    Vavilov, S I

    1965-01-01

    The Human Eye and the Sun, """"Hot"""" and """"Cold"""" Light is a translation from the Russian language and is a reproduction of texts from Volume IV of S.I. Vavilov, president of the U.S.S.R. Academy of Sciences. The book deals with theoretical and practical developments in lighting techniques. The text gives a brief introduction on the relationship of the human eye and the sun, describing the properties of light, of the sun, and of the human eye. The book describes hot (incandescence) and cold light (luminescence) as coming from different sources. These two types of light are compared. The

  5. Nearest star the surprising science of our sun

    CERN Document Server

    Golub, Leon

    2014-01-01

    How did the Sun evolve, and what will it become? What is the origin of its light and heat? How does solar activity affect the atmospheric conditions that make life on Earth possible? These are the questions at the heart of solar physics, and at the core of this book. The Sun is the only star near enough to study in sufficient detail to provide rigorous tests of our theories and help us understand the more distant and exotic objects throughout the cosmos. Having observed the Sun using both ground-based and spaceborne instruments, the authors bring their extensive personal experience to this sto

  6. The Iconography and Symbolism of Sun God in Urartian Art

    Science.gov (United States)

    Poghosyan, Gayane

    2016-12-01

    The predominating symbol of the winged sun disc in Urartian religious iconography testifies the significant role and importance of the sun in worship. The stylistic variation and peculiar iconographic features of the winged discs, sacred animals and divine images associated with solar deity shows the relationship between the cult of the sun god, sequence of the different phases of the year and constellations in Urartian culture. Such kind of iconography is possibly formed and stylized in result of interaction of ancient human imaginations, influence of rock paintings and religious beliefs.

  7. The Magnetic Future of the Sun

    Science.gov (United States)

    Judge, Philip G.; Egeland, Ricky; Metcalfe, Travis S.; Guinan, Edward; Engle, Scott

    2017-10-01

    We analyze space- and ground-based data for the old (7.0 ± 0.3 Gyr) solar analogs 16 Cyg A and B. The stars were observed with the Cosmic Origins UV Spectrographs on the Hubble Space Telescope (HST) on 2015 October 23 and 2016 February 3, respectively, and with the Chandra X-ray Observatory on 2016 February 7. Time-series data in Ca ii data are used to place the UV data in context. The UV spectra of 18 Sco (3.7 ± 0.5 Gyr), the Sun (4.6 ± 0.04 Gyr), and α Cen A ({5.4}-0.2+1.2 {Gyr}) appear remarkably similar, pointing to a convergence of magnetic heating rates for G2 main-sequence stars older than ≈2–4 Gyr. But the B component’s X-ray (0.3–2.5 keV) flux lies 20× below a well-known minimum level reported by Schmitt. As reported for α Cen A, the coronal temperature probably lies below that detectable in soft X-rays. No solar UV flux spectra of comparable resolution to those of stellar data exist, but they are badly needed for comparison with stellar data. Center-to-limb variations are reevaluated for lines such as Ca ii through X-rays, with important consequences for observing activity cycles in such features. We also call into question work that has mixed solar intensity–intensity statistics with flux–flux relations of stars.

  8. Orbit-attitude coupled motion around small bodies: Sun-synchronous orbits with Sun-tracking attitude motion

    Science.gov (United States)

    Kikuchi, Shota; Howell, Kathleen C.; Tsuda, Yuichi; Kawaguchi, Jun'ichiro

    2017-11-01

    The motion of a spacecraft in proximity to a small body is significantly perturbed due to its irregular gravity field and solar radiation pressure. In such a strongly perturbed environment, the coupling effect of the orbital and attitude motions exerts a large influence that cannot be neglected. However, natural orbit-attitude coupled dynamics around small bodies that are stationary in both orbital and attitude motions have yet to be observed. The present study therefore investigates natural coupled motion that involves both a Sun-synchronous orbit and Sun-tracking attitude motion. This orbit-attitude coupled motion enables a spacecraft to maintain its orbital geometry and attitude state with respect to the Sun without requiring active control. Therefore, the proposed method can reduce the use of an orbit and attitude control system. This paper first presents analytical conditions to achieve Sun-synchronous orbits and Sun-tracking attitude motion. These analytical solutions are then numerically propagated based on non-linear coupled orbit-attitude equations of motion. Consequently, the possibility of implementing Sun-synchronous orbits with Sun-tracking attitude motion is demonstrated.

  9. Retraction statement: 'Formin-like2 regulates Rho/ROCK pathway to promote actin assembly and cell invasion of colorectal cancer' by Yuanfeng Zeng, Huijun Xie, Yudan Qiao, Jianmei Wang, Xiling Zhu, Guoyang He, Yuling Li, Xiaoli Ren, Feifei Wang, Li Liang and Yanqing Ding.

    Science.gov (United States)

    2016-07-01

    The above article in Cancer Science (doi: 10.1111/cas.12768), published online on 26 October 2015 in Wiley Online Library (http://wileyonlinelibrary.com), has been retracted by agreement between the authors, the journal Editor in Chief, Yusuke Nakamura, and Wiley Publishing Asia Pty Ltd. The retraction has been agreed as Panels +C3 and +Y27632 of SW480 Mock shown in Figure 2a appear to have been taken from the same image, Panels + C3 and +Y27632 of HT29 FMNL2 shown in Figure 2a appear to have been taken from the same image, Panels shFMNL2-1 and shmDial1-1 in Figure 3a appear to have been taken from the same image, shFMNL2-2 and shmDial1-2 in Figure 3a appear to have been taken from the same image, Panels of shFMNL2-1 + shmDial1-1 and shFMNL2-1 + shmDial1-2 of +LPA appear to have been taken from the same image, gel bands of FLAG in Figure 4e appear to have been have been manipulated by erasing gel bands. Reference Zeng Y, Xie H, Qiao Y, Wang J, Zhu X, He G, Li Y, Ren X, Wang F, Liang L, Ding Y. Formin-like2 regulates Rho/ROCK pathway to promote actin assembly and cell invasion of colorectal cancer. Cancer Sci 2015; 106: 1385-93. doi: 10.1111/cas.12768. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  10. White Sharks Exploit the Sun during Predatory Approaches.

    Science.gov (United States)

    Huveneers, Charlie; Holman, Dirk; Robbins, Rachel; Fox, Andrew; Endler, John A; Taylor, Alex H

    2015-04-01

    There is no conclusive evidence of any nonhuman animal using the sun as part of its predation strategy. Here, we show that the world's largest predatory fish-the white shark (Carcharodon carcharias)-exploits the sun when approaching baits by positioning the sun directly behind them. On sunny days, sharks reversed their direction of approach along an east-west axis from morning to afternoon but had uniformly distributed approach directions during overcast conditions. These results show that white sharks have sufficient behavioral flexibility to exploit fluctuating environmental features when predating. This sun-tracking predation strategy has a number of potential functional roles, including improvement of prey detection, avoidance of retinal overstimulation, and predator concealment.

  11. VUV Spectroscopy of the Sun as a Star

    Science.gov (United States)

    Kankelborg, Charles; Philip, Judge; Winebarger, Amy R.; Kobayashi, Ken; Smart, Roy

    2017-08-01

    We describe a new sounding rocket mission to obtain the first high resolution, high quality VUV (100-200 nm) spectrum of the Sun-as-a-star. Our immediate science goal is to understand better the processes of chromospheric and coronal heating. HST data exist for a dozen or so Sun-like stars of a quality already beyond our ability to construct a comparable sun-as-a-star UV spectrum. The solar spectrum we obtain will enable us to understand the nature of magnetic energy dissipation as a Sun-like star evolves, and the dependence of magnetic activity on stellar mass and metallicity. This poster presents the instrument design, scientific prospects, and broader impacts of the proposed mission.

  12. 'Eye Freckles' May Predict Sun-Related Problems

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_167479.html 'Eye Freckles' May Predict Sun-Related Problems The spots ... on the iris -- the colored part of the eye -- aren't cancerous, but these "eye freckles" could ...

  13. Solar Power for Near Sun, High-Temperature Missions

    Science.gov (United States)

    Landis, Geoffrey A.

    2008-01-01

    Existing solar cells lose performance at the high temperatures encountered in Mercury orbit and inward toward the sun. For future missions designed to probe environments close to the sun, it is desirable to develop array technologies for high temperature and high light intensity. Approaches to solar array design for near-sun missions include modifying the terms governing temperature of the cell and the efficiency at elevated temperature, or use of techniques to reduce the incident solar energy to limit operating temperature. An additional problem is found in missions that involve a range of intensities, such as the Solar Probe + mission, which ranges from a starting distance of 1 AU from the sun to a minimum distance of 9.5 solar radii, or 0.044 AU. During the mission, the solar intensity ranges from one to about 500 times AM0. This requires a power system to operate over nearly three orders of magnitude of incident intensity.

  14. Clothing reduces the sun protection factor of sunscreens

    DEFF Research Database (Denmark)

    Beyer, Ditte Maria; Faurschou, Annesofie; Haedersdal, M

    2010-01-01

    Individuals are recommended to wait for 20 min following sunscreen application before dressing. However, this is probably seldom done in daily life, and therefore we investigated how dressing earlier than 20 min after application affected the sun protection factor (SPF)....

  15. The sun, the solar wind, and the heliosphere

    CERN Document Server

    Miralles, Mari Paz

    2011-01-01

    This volume presents a concise, up-to-date overview of current research on the observations, theoretical interpretations, and empirical and physical descriptions of the Sun, the Solar Wind, and the Heliosphere, from the solar interior outward to the planets.

  16. Cassava Sun Drying Performance on Various Surfaces and Drying ...

    African Journals Online (AJOL)

    prolong its shelf life, and reduce its bulkiness. Traditional processing ... comparison with drying in a direct box solar dryer; by using trays with various bottom surfaces. The experiments .... experimented sun drying systems. The assessment.

  17. Sun, Sky and Cloud: Where light and matter meet

    National Research Council Canada - National Science Library

    Nityananda, Rajaram

    2015-01-01

    .... In Nature, it often happens that we see light which has undergone these processes many times, sunlight passing through clouds is just one example, related phenomena occur on the visible surfaces of the Sun and stars...

  18. CRUQS: A Miniature Fine Sun Sensor for Nanosatellites

    Science.gov (United States)

    Heatwole, Scott; Snow, Carl; Santos, Luis

    2013-01-01

    A new miniature fine Sun sensor has been developed that uses a quadrant photodiode and housing to determine the Sun vector. Its size, mass, and power make it especially suited to small satellite applications, especially nanosatellites. Its accuracy is on the order of one arcminute, and it will enable new science in the area of nanosatellites. The motivation for this innovation was the need for high-performance Sun sensors in the nanosatellite category. The design idea comes out of the LISS (Lockheed Intermediate Sun Sensor) used by the sounding rocket program on their solar pointing ACS (Attitude Control System). This system uses photodiodes and a wall between them. The shadow cast by the Sun is used to determine the Sun angle. The new sensor takes this concept and miniaturizes it. A cruciform shaped housing and a surface-mount quadrant photodiode package allow for a two-axis fine Sun sensor to be packaged into a space approx.1.25xl x0.25 in. (approx.3.2x2.5x0.6 cm). The circuitry to read the photodiodes is a simple trans-impedance operational amplifier. This is much less complex than current small Sun sensors for nanosatellites that rely on photo-arrays and processing of images to determine the Sun center. The simplicity of the circuit allows for a low power draw as well. The sensor consists of housing with a cruciform machined in it. The cruciform walls are 0.5-mm thick and the center of the cruciform is situated over the center of the quadrant photodiode sensor. This allows for shadows to be cast on each of the four photodiodes based on the angle of the Sun. A simple operational amplifier circuit is used to read the output of the photodiodes as a voltage. The voltage output of each photodiode is summed based on rows and columns, and then the values of both rows or both columns are differenced and divided by the sum of the voltages for all four photodiodes. The value of both difference over sums for the rows and columns is compared to a table or a polynomial fit

  19. Why stellar astronomers should be interested in the sun

    Science.gov (United States)

    Schmelz, J.

    By all accounts, the Sun is a garden-variety star with an average age, a standard size, a regular temperature, a normal mass, an ordinary structure, and a typical chemical composition. Only one feature makes it special - the Sun is our star. It is located in the center of our solar system, and therefore, is responsible for all l fe on Earth.i Astronomically speaking, the Sun is the only star in the sky that we can study up- close and personal. The unaided human eye does a better job of resolving the Sun than the finest telescope does for any other star. Stellar astronomers issue a press release whenever they can lay a few pixels of some state-of the-art instrument across a nearby supergiant. The resolution of the Sun, however, is something we can see routinely in the magnificent images that are downloaded every day from the TRACE spacecraft. In a very real sense, the Sun is the Rosetta Stone of the Stars. It was observations of the Sun deflecting starlight that ushered in a new way of thinking about gravity. Zeeman observations of the Sun showed that stellar atmospheres were controlled by magnetic fields. Models of the solar chromosphere required the development of more complex non-LTE analysis. The discovery of solar helium founded the science of stellar spectroscopy. Measurements of the solar mass, radius, and temperature allowed scientists to probe the interiors of stars for the first time. The ancient age of the Sun implied that stars shine as a result of thermonuclear fusion. Observations of solar flares stimulated developments in rapid magnetic reconnection theory. The study of solar coronal holes lead to a deeper understanding of the role that mass loss plays in the evolution of stars. Detailed analysis of the solar activity cycle inspired the development of MHD dynamo theory. The detection and understanding of the solar corona u covered one of the longest unsolvedn mysteries in all of astrophysics - the coronal-heating problem. And the list goes on. The Sun

  20. Assessment of Elementary School Students’ Sun Protection Behaviors

    Science.gov (United States)

    Hunter, Seft; Wells, Kristen J.; Jacobsen, Paul B.; Lee, Ji-Hyun; Boulware, David; Love-Jackson, Kymia; Abdulla, Rania; Roetzheim, Richard G.

    2013-01-01

    Introduction Emerging studies suggest that excessive sun exposure in childhood contributes to the development of skin cancer later in life. Children rarely wear a wide-brimmed hat when outside although these hats offer the best protection to the areas on the face where children are most likely to be sunburned. The current study explores 4th grade student assessment of their sun protection behaviors outside at school and at times other than when they are at school. Method This study utilized baseline data collected in the Fall of 2006 for the Sun Protection for Florida’s Children (SPF) project. In brief, the SPF project is a group randomized trial to test the effectiveness of a school based intervention promoting sun protection in general, and hat use in particular. The project targets all 4th grade students in Hillsborough County Schools, FL. The data reported in this study were collected at baseline before any intervention activities was initiated. Approximately 2,086 4th grade students completed self-report surveys evaluating sun protection behaviors. Trained research assistants carried out 99 direct observations of physical education classes over a five week period during Fall 2006 in Tampa, Florida. Results In general, the self-reported use of various methods of sun protection was low. Approximately one third of students reported that they wore sunscreen (32.8%) or sunglasses (32.3%) before leaving home for school. Only a small percentage of students wore long sleeves (15.0%) or a hat with a brim (16.4%) before leaving for school. In addition, few students wore a hat with a wide brim when outside but not at school (16.4%). Students spent an average of 59.1 minutes per week outdoors while attending school and 35.5 minutes during peak sun exposure. In general, female students and Hispanic, African American, and students of other racial and ethnic groups were more likely to practice sun protection behaviors at school than white or male students. Students who

  1. SunShot Vision Study: February 2012 (Book)

    Energy Technology Data Exchange (ETDEWEB)

    2012-02-01

    The objective of the SunShot Vision Study is to provide an in-depth assessment of the potential for solar technologies to meet a significant share of electricity demand in the United States during the next several decades. Specifically, it explores a future in which the price of solar technologies declines by about 75% between 2010 and 2020 - in line with the U.S. Department of Energy (DOE) SunShot Initiative's targets.

  2. Grid Modeling for the SunShot Vision Study

    Energy Technology Data Exchange (ETDEWEB)

    Brinkman, G.; Denholm, P.; Drury, E.; Ela, E.; Mai, T.; Margolis, R.; Mowers, M.

    2012-02-01

    This document describes the use of production cost modeling in the SunShot Vision study, including methods used to create the SunShot Vision scenarios, their implementation in the Gridview model, and assumptions regarding transmission system and operation of each generator type. It also describes challenges and limitations of modeling solar generation technologies in production cost models, and suggests methods for improving their representation in current models.

  3. Clothing reduces the sun protection factor of sunscreens

    DEFF Research Database (Denmark)

    Beyer, Ditte Maria; Faurschou, Annesofie; Haedersdal, M

    2010-01-01

    Individuals are recommended to wait for 20 min following sunscreen application before dressing. However, this is probably seldom done in daily life, and therefore we investigated how dressing earlier than 20 min after application affected the sun protection factor (SPF).......Individuals are recommended to wait for 20 min following sunscreen application before dressing. However, this is probably seldom done in daily life, and therefore we investigated how dressing earlier than 20 min after application affected the sun protection factor (SPF)....

  4. CONCEPTUAL STEPS TOWARDS EXPLORING THE FUNDAMENTAL NATURE OF OUR SUN

    Directory of Open Access Journals (Sweden)

    Attila Grandpierre

    2004-06-01

    Full Text Available One of the basic questions of solar research is the nature of the Sun. We show here how the plasma nature of the Sun leads to the self-generation of solar activity. The release of magnetic, rotational, gravitational, nuclear energies and that of the gravity mode oscillations deviate from uniformity and spherical symmetry. Through instabilities they lead to the emergence of sporadic and localized regions like flux tubes, electric filaments, magnetic elements and high temperature regions. A systematic approach exploring the solar collective degrees of freedom, extending to ordering phenomena of the magnetic features related to Higgs fields, is presented. Handling solar activity as transformations of energies from one form to another one presents a picture on the network of the energy levels of the Sun, showing that the Sun is neither a mere "ball of gas" nor a "quiescent steady-state fusion-reactor machine", but a complex self-organizing system. Since complex self-organizing systems are similar to living systems (and, by some opinion, identical with them, we also consider what arguments indicate the living nature of the Sun. Thermodynamic characteristics of the inequilibrium Sun are found important in this respect and numerical estimations of free energy rate densities and specific exergies are derived.

  5. Sun position calculator (SPC) for Landsat imagery with geodetic latitudes

    Science.gov (United States)

    Seong, Jeong C.

    2015-12-01

    Landsat imagery comes with sun position information such as azimuth and sun elevation, but they are available only at the center of a scene. To aid in the use of Landsat imagery for various solar radiation applications such as topographic correction, solar power, urban heat island, agriculture, climate and vegetation, it is necessary to calculate the sun position information at every pixel. This research developed a PC application that creates sun position data layers in ArcGIS at every pixel in a Landsat scene. The SPC program is composed of two major routines - converting universal transverse Mercator (UTM) projection coordinates to geographic longitudes and latitudes, and calculating sun position information based on the Meeus' routine. For the latter, an innovative method was also implemented to account for the Earth's flattening on an ellipsoid. The Meeus routine implemented in this research showed about 0.2‧ of mean absolute difference from the National Renewable Energy Laboratory (NREL) Solar Position Algorithm (SPA) routine when solar zenith and azimuth angles were tested with every 30 min data at four city locations (Fairbanks, Atlanta, Sydney and Rio Grande) on June 30, 2014. The Meeus routine was about ten times faster than the SPA routine. Professionals who need the Sun's position information for Landsat imagery will benefit from the SPC application.

  6. Analisis senyawa volatil dari ekstrak tanaman yang berpotensi sebagai atraktan parasitoid telur wereng batang coklat, Anagrus nilaparvatae (Pang et Wang (Hymenoptera: Mymaridae

    Directory of Open Access Journals (Sweden)

    Surjani Wonorahardjo

    2015-09-01

    Full Text Available Plants produce volatiles as communication cues intra- or inter- species. Infested plants by herbivores will produce volatiles as indirect defense mechanism that attracts natural enemies of herbivores. Analysis of volatiles compounds produced by rice plant as result of infested brown plant hopper (BPH, Nilaparvata lugens Stâl, was done to identify compounds in the volatiles that potentially can be used as attractant for egg parasitoids of BPH, Anagrus nilaparvatae (Pang et Wang (Hymenoptera: Mymaridae. This research was an early stage to develop formulation of parasitoid attractant. The research activities include volatiles extraction of infested rice stem by BPH eggs using acetone, n-hexane as the extraction solvents; analyses of volatile compounds with GC-MS; and bioassay of parasitoid orientation behavior to the volatiles using olfactometer methods. Extraction methods applied were maceration and continuous extraction followed by concentration. Bioassay on the parasitoid orientation behavior was done by using Y-tube olfactometer and every lot of bioassay using 30 parasitoid females with 3 replicates. The results showed that the volatile compounds of extract of infested rice stem by BPH eggs comprise of 16 components. The highest proportion of the components extracted with acetone is 2-Pentanone, 4-hydroxy-4-methyl (19,9%, while those with n-hexane is Hexanedioic acid, dioctyl ester (65%. A. nilaparvatae showed positive response to the volatiles extracted from infested rice plant by N. lugens eggs. Therefore, the volatiles can be used as an attractant for the egg A. nilaparvatae to support rice pest management.

  7. The Oxygen Isotopic Composition of the Sun

    Science.gov (United States)

    McKeegan, K. D.; Kallio, A.; Heber, V. S.; Jarzebinski, G.; Mao, P.; Coath, C.; Kunihiro, T.; Wiens, R. C.; Judith, A.; Burnett, D. S.

    2010-12-01

    An accurate and precise determination of the oxygen isotopic composition of the Sun is the highest priority scientific goal of the Genesis Mission [1] as such data would provide a baseline from which one could interpret the oxygen isotopic anomalies found at all spatial scales in inner solar system materials. We have measured oxygen isotope compositions of implanted solar wind in 40 spots along a radial traverse of the Genesis SiC target sample 60001 by depth profiling with the UCLA MegaSIMS [2]. Mass-dependent fractionation induced by the solar wind concentrator [3] ion optics was corrected by comparison of the concentrator 22Ne/20Ne with that measured in a bulk solar wind target (diamond-like carbon on Si, [4]). The solar wind captured at L1 has an isotopic composition of (δ18O, δ17O) ≈ (-99, -79)‰, a value which is far removed from the terrestrial mass fractionation line. Profiles from the central portion of the target, where solar concentrations are highest and background corrections minimal, yield a mean Δ17O = -28.3 ± 1.8 ‰ indicating that the Earth and other planetary materials from the inner solar system are highly depleted in 16O relative to the solar wind. A mass-dependent fractionation of ~ -20%/amu in the acceleration of solar wind is required if we hypothesize that the photospheric oxygen isotope value, which represents the bulk starting composition of the solar system, is on the 16O-mixing line characteristic of refractory phase in primitive meteorites [5]. With this assumption, our preferred value for the bulk solar oxygen isotope composition is δ18O ≈ δ17O ≈ -57‰. A mechanism is required to fractionate oxygen isotopes in a non-mass-dependent manner to deplete 16O by ~6 to 7% in the rocky materials of the solar nebula. As oxygen is the third most abundant element in the solar system, and the most abundant in the terrestrial planets, this mechanism must operate on a large scale. Isotope-selective photochemistry, for example as in

  8. Using game theory to investigate the epigenetic control mechanisms of embryo development. Comment on: ;Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition; by Qian Wang et al.

    Science.gov (United States)

    Zhang, Le; Zhang, Shaoxiang

    2017-03-01

    A body of research [1-7] has already shown that epigenetic reprogramming plays a critical role in maintaining the normal development of embryos. However, the mechanistic quantitation of the epigenetic interactions between sperms and oocytes and the related impact on embryo development are still not clear [6,7]. In this study, Wang et al., [8] develop a modeling framework that addresses this question by integrating game theory and the latest discoveries of the epigenetic control of embryo development.

  9. A mathematical view for ordinary differential equation models. Comment on ;Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition; by Qian Wang et al.

    Science.gov (United States)

    Fu, Guifang

    2017-03-01

    Qian Wang et al. have written an interesting article to propose a modeling framework named epiGame in this issue of Physics of Life Reviews [1]. The epiGame framework models how the methylation state of paternal and maternal genomes regulates the embryogenesis as an ecological system in which two highly distinct and specialized gametes coordinate through either cooperation or competition, or both, to maximize the fitness of embryos. Qian Wang et al. also provide solid simulation studies and real data analysis to validate the correctness of their epiGame framework. The importance of embryo development and fertility mechanism cannot be overemphasized, hence, I think that the present review by Qian Wang et al. will stand as a useful modeling guide for practicing biologists or researchers in fertility health to quantify how sperms and oocytes interact through epigenetic process to determine embryo development. In addition, it will serve as a source of many important references to work in the reproductive biology field.

  10. SOHO reveals violent action on the quiet Sun

    Science.gov (United States)

    1996-05-01

    SOHO's scientists are impressed by the vigorous action that they see going on every day, because the Sun is in the very quietest phase of its eleven-year cycle of activity. To ground-based observatories it appears extremely calm just now. The early indications of SOHO's performance amply justify the creation of a sungazing spacecraft capable of observing ultraviolet emissions that are blotted out by the Earth's atmosphere. Apart from the imager, two ultraviolet spectrometers and an ultraviolet coronagraph (an imager for the outer atmosphere) are busy analysing the violent processes at a wide range of wavelengths. Between them, these instruments should cure long-lasting ignorance concerning the Sun, especially about why the atmosphere is so hot and what drives the solar wind that blows non-stop into the Solar System. Scientists from other experimental teams use SOHO to explore the Sun from its deep interior to the far reaches of the solar wind. They have watched the supposedly quiet Sun belching huge masses of gas into space. They have mapped a hole burnt by the solar wind in a breeze of gas coming from the stars. And they have detected currents of gas flowing just below the visible surface. SOHO is a project of international cooperation between the European Space Agency and NASA. The spacecraft was built in Europe and instrumented by scientists on both sides of the Atlantic. NASA launched SOHO on 2 December 1995, and also provides the ground stations and an operations centre near Washington. The first results are the more remarkable because SOHO arrived at its vantage point 1,500,000 kilometres out in space only in February, and formally completed its commissioning on 16 April. It has a long life ahead of it. All scientific instruments are working well. The luminosity oscillation imager belonging to the VIRGO experiment had trouble with its lens cover. When opened, the cover rebounded on its hinges and closed again. Commands were devised that gave a shorter impulse

  11. Ancient cults of the sun (German Title: Antike Sonnenkulte)

    Science.gov (United States)

    Hansen, Rahlf

    In ancient astronomy, the heliocentric system of Aristarchus of Samos did not meet universal approval. Contrary to that, the cult of the sun gained immense importance in the Roman Empire. Relics of this significance we still find e.g. in the meaning of the Sunday in the week and in the date of Christmas. The rise of the sun cults is characterised by the merging of different gods from various cultures. Already in classical Greece the god of the sun, Helios, almagated with the god of light, Apollo. The resulting entity was regarded as the harmonic guide of the visible universe, symbolized by Apoll. As well as he plays the lyre, he conducts the cosmos harmonically as the sun. Plato recommends to politicians to study musical harmonics and astronomy in order to get a feeling of the right way to rule the state. In consequence to the conquests of Alexander the Great, the Babylonian star religion was mingled with Greek cosmology and the concept of transmigration of souls. The astrology resulting therefrom spread out over the whole Hellenistic world and was very common in the Roman Empire. The calendar with its religious division of time as the days of the week, following the principle of the gods of the planets governing the hour, was well known. The god of the sun was graded up by the adoption of the calendar of the sun from Egypt by Caesar. Augustus chose Apoll as his guardian god and built with “his” sundial a symbol of the god of the sun, which was visible from a long distance. Augustus used more astral symbols as propaganda of leadership. During the competition with the Parthians, another large empire, for world domination the focus fell on an Iranian god: the Iranian god of light and contract - Mithras. Shortly before 100 A.D., a new cult of mysteries arose in the Roman Empire, called cult of Mithras, and spread quickly. It combined the attributes of a classical sun-god with a religion of salvation, guaranteed by baptism, communion and seven degrees to be passed

  12. Sun-Earth Day - Teaching Heliophysics Through Education Technology

    Science.gov (United States)

    Thieman, J.; Cline, T.; Lewis, E.

    2010-01-01

    Sun-Earth Day (SED) is an Education and Outreach program supported by the U.S, National Aeronautics and Space Administration (NASA). The intent of the program is to teach students and the general public about Heliophysics (the science of the study of the Sun, how it varies, and how solar dynamics affect the rest of the solar system, especially the Earth). The program was begun ten years ago. Each year since that time a particular day has been designated as "Sun-Earth Day ,,. Usually the day of the spring equinox (March 20 or 21) is Sun-Earth Day, but other days have been used as well. Each year a theme is chosen relating to Heliophysics and events reflecting that theme are planned not only for Sun-Earth Day, but for the entire year. From the very beginning educational technology was emphasized in the events in order to effectively reach wide audiences with the SED message. The main approach has been to have a "webcast" related to each year's theme, often from a location that supports the theme as well. For example, a webcast took place from the Mayan pyramids at Chichen Itza, Mexico to highlight the theme of "Ancient Observatories, Timeless Knowledge". Webcasts were not the only technology employed, however. Many of the themes centered on the dynamic nature of the Sun and the effects that solar storms can have on interplanetary space and in our day-to-day life on Earth. Activities for tracking when solar storms happen and how they affect the Earth were developed and brought together in an educational package called Space Weather Action Centers. This project is explained in more detail in another presentation in this session being given by Norma Teresinha Oliveira Reis. Recent Sun-Earth Days have utilized "social networking" technologies to reach widespread groups on the internet. Podcasts, Vodcasts, Facebook, Twitter, and Second Life are the types of network technologies being employed now. The NASA Distance learning Network is another method for bringing Sun

  13. Automatic Hotspot and Sun Glint Detection in UAV Multispectral Images

    Directory of Open Access Journals (Sweden)

    Damian Ortega-Terol

    2017-10-01

    Full Text Available Last advances in sensors, photogrammetry and computer vision have led to high-automation levels of 3D reconstruction processes for generating dense models and multispectral orthoimages from Unmanned Aerial Vehicle (UAV images. However, these cartographic products are sometimes blurred and degraded due to sun reflection effects which reduce the image contrast and colour fidelity in photogrammetry and the quality of radiometric values in remote sensing applications. This paper proposes an automatic approach for detecting sun reflections problems (hotspot and sun glint in multispectral images acquired with an Unmanned Aerial Vehicle (UAV, based on a photogrammetric strategy included in a flight planning and control software developed by the authors. In particular, two main consequences are derived from the approach developed: (i different areas of the images can be excluded since they contain sun reflection problems; (ii the cartographic products obtained (e.g., digital terrain model, orthoimages and the agronomical parameters computed (e.g., normalized vegetation index-NVDI are improved since radiometric defects in pixels are not considered. Finally, an accuracy assessment was performed in order to analyse the error in the detection process, getting errors around 10 pixels for a ground sample distance (GSD of 5 cm which is perfectly valid for agricultural applications. This error confirms that the precision in the detection of sun reflections can be guaranteed using this approach and the current low-cost UAV technology.

  14. A High Temperature Liquid Plasma Model of the Sun

    Directory of Open Access Journals (Sweden)

    Robitaille P.-M.

    2007-01-01

    Full Text Available In this work, a liquid model of the Sun is presented wherein the entire solar mass is viewed as a high density/high energy plasma. This model challenges our current understanding of the densities associated with the internal layers of the Sun, advocating a relatively constant density, almost independent of radial position. The incompressible nature of liquids is advanced to prevent solar collapse from gravitational forces. The liquid plasma model of the Sun is a non-equilibrium approach, where nuclear reactions occur throughout the solar mass. The primary means of addressing internal heat transfer are convection and conduction. As a result of the convective processes on the solar surface, the liquid model brings into question the established temperature of the solar photosphere by highlighting a violation of Kirchhoff’s law of thermal emission. Along these lines, the model also emphasizes that radiative emission is a surface phenomenon. Evidence that the Sun is a high density/high energy plasma is based on our knowledge of Planckian thermal emission and condensed matter, including the existence of pressure ionization and liquid metallic hydrogen at high temperatures and pressures. Prior to introducing the liquid plasma model, the historic and scientific justifications for the gaseous model of the Sun are reviewed and the gaseous equations of state are also discussed.

  15. Sun exposure patterns of urban, suburban, and rural children

    DEFF Research Database (Denmark)

    Bodekær, Mette; Petersen, Bibi; Philipsen, Peter Alshede

    2015-01-01

    BACKGROUND: Sun exposure is the main etiology of skin cancer. Differences in skin cancer incidence have been observed between rural and urban populations. OBJECTIVES: As sun exposure begins in childhood, we examined summer UVR exposure doses and sun behavior in children resident in urban, suburban......, and rural areas. METHODS: Personal, electronic UVR dosimeters and sun behavior diaries were used during a summer (3.5 months) by 150 children (4-19 years of age) resident in urban, suburban, and rural areas. RESULTS: On school/kindergarten days rural children spent more time outdoors and received higher UVR...... doses than urban and suburban children (rural: median 2.3 h per day, median 0.9 SED per day, urban: median 1.3 h per day, median 0.3 SED per day, suburban: median 1.5 h per day, median 0.4 SED per day) (p ≤ 0.007). Urban and suburban children exhibited a more intermittent sun exposure pattern than rural...

  16. Was Lepenski Vir an ancient Sun or Pleiades observatory?

    CERN Document Server

    Pankovic, Vladan; Krmar, Miodrag

    2015-01-01

    In this work we consider some old hypotheses according to which remarkable mesolithic village Lepenski Vir (9500 -- 5500 BC) at the right (nearly west) Danube riverside in the Iron gate in Serbia was an ancient (one of the oldest) Sun observatory. We use method recently suggested by A. C. Sparavigna, concretely we use "freely available software" or local Sun radiation direction simulation computer programs. In this way we obtain and discuss pictures of the sunrise in the Lepenski Vir during winter and summer solstice and spring and autumn equinox in relation to position of the mountains, especially Treskavac (Trescovat) and Kukuvija at left (nearly east) Danube riverside (in Romania). While mountain Kukuvija represents really the marker for the Sun in date of the winter solstice, mountain Treskavac, in despite to usual opinions, does not represent a real marker for the Sun in date of the summer solstice. Sun rises behind Treskavac, roughly speaking, between 22.April and 1. May. It corresponds to year period w...

  17. Automatic Hotspot and Sun Glint Detection in UAV Multispectral Images.

    Science.gov (United States)

    Ortega-Terol, Damian; Hernandez-Lopez, David; Ballesteros, Rocio; Gonzalez-Aguilera, Diego

    2017-10-15

    Last advances in sensors, photogrammetry and computer vision have led to high-automation levels of 3D reconstruction processes for generating dense models and multispectral orthoimages from Unmanned Aerial Vehicle (UAV) images. However, these cartographic products are sometimes blurred and degraded due to sun reflection effects which reduce the image contrast and colour fidelity in photogrammetry and the quality of radiometric values in remote sensing applications. This paper proposes an automatic approach for detecting sun reflections problems (hotspot and sun glint) in multispectral images acquired with an Unmanned Aerial Vehicle (UAV), based on a photogrammetric strategy included in a flight planning and control software developed by the authors. In particular, two main consequences are derived from the approach developed: (i) different areas of the images can be excluded since they contain sun reflection problems; (ii) the cartographic products obtained (e.g., digital terrain model, orthoimages) and the agronomical parameters computed (e.g., normalized vegetation index-NVDI) are improved since radiometric defects in pixels are not considered. Finally, an accuracy assessment was performed in order to analyse the error in the detection process, getting errors around 10 pixels for a ground sample distance (GSD) of 5 cm which is perfectly valid for agricultural applications. This error confirms that the precision in the detection of sun reflections can be guaranteed using this approach and the current low-cost UAV technology.

  18. Sun Protection Among New Zealand Primary School Children.

    Science.gov (United States)

    Gage, Ryan; Leung, William; Stanley, James; Reeder, Anthony; Mackay, Christina; Smith, Moira; Barr, Michelle; Chambers, Tim; Signal, Louise

    2017-12-01

    Schools are an important setting for raising skin cancer prevention awareness and encouraging sun protection. We assessed the clothes worn and shade used by 1,278 children in eight schools in the Wellington region of New Zealand. These children were photographed for the Kids'Cam project between September 2014 and March 2015 during school lunch breaks. Children's mean clothing coverage (expressed as a percentage of body area covered) was calculated. Data on school sun-safety policies were obtained via telephone. Mean total body clothing coverage was 70.3% (95% confidence interval = 66.3%, 73.8%). Body regions with the lowest mean coverage were the head (15.4% coverage), neck (36.1% coverage), lower arms (46.1% coverage), hands (5.3% coverage), and calves (30.1% coverage). Children from schools with hats as part of the school uniform were significantly more likely to wear a hat (52.2%) than children from schools without a school hat (2.7%). Most children (78.4%) were not under the cover of shade. Our findings suggest that New Zealand children are not sufficiently protected from the sun at school. Schools should consider comprehensive approaches to improve sun protection, such as the provision of school hats, sun-protective uniforms, and the construction of effective shade.

  19. Topological phase transition in the two-dimensional anisotropic Heisenberg model: A study using the Replica Exchange Wang-Landau sampling

    Science.gov (United States)

    Figueiredo, T. P.; Rocha, J. C. S.; Costa, B. V.

    2017-12-01

    Although the topological Berezinskii-Kosterlitz-Thouless transition was for the first time described by 40 years ago, it is still a matter of discussion. It has been used to explain several experiments in the most diverse physical systems. In contrast with the ordinary continuous phase transitions the BKT-transition does not break any symmetry. However, in some contexts it can easily be confused with other continuous transitions, in general due to an insufficient data analysis. The two-dimensional XY (or sometimes called planar rotator) spin model is the fruit fly model describing the BKT transition. As demonstrated by Bramwell and Holdsworth (1993) the finite-size effects are more important in two-dimensions than in others due to the logarithmic system size dependence of the properties of the system. Closely related is the anisotropic two dimensional Heisenberg model (AH). Although they have the same Hamiltonian the spin variable in the former has only two degrees of freedom while the AH has three. Many works treat the AH model as undergoing a transition in the same universality class as the XY model. However, its characterization as being in the BKT class of universality deserve some investigation. This paper has two goals. First, we describe an analytical evidence showing that the AH model is in the BKT class of universality. Second, we make an extensive simulation, using the numerical Replica Exchange Wang-Landau method that corroborate our analytical calculations. From our simulation we obtain the BKT transition temperature as TBKT = 0 . 6980(10) by monitoring the susceptibility, the two point correlation function and the helicity modulus. We discuss the misuse of the fourth order Binder's cumulant to locate the transition temperature. The specific heat is shown to have a non-critical behavior as expected in the BKT transition. An analysis of the two point correlation function at low temperature, C(r) ∝r - η(T), shows that the exponent, η, is consistent

  20. Scientists discover massive jet streams flowing inside the sun

    Science.gov (United States)

    1997-08-01

    These new findings will help them understand the famous sunspot cycle and associated increases in solar activity that can affect the Earth with power and communications disruptions. The observations are the latest made by the Solar Oscillations Investigation (SOI) group at Stanford University, CA, and they build on discoveries by the SOHO science team over the past year. "We have detected motion similar to the weather patterns in the Earth's atmosphere", said Dr. Jesper Schou of Stanford. "Moreover, in what is a completely new discovery, we have found a jet-like flow near the poles. This flow is totally inside the Sun. It is completely unexpected, and cannot be seen at the surface." "These polar streams are on a small scale, compared to the whole Sun, but they are still immense compared to atmospheric jet streams on the Earth", added Dr. Philip Scherrer, the SOI principal investigator at Stanford. "Ringing the Sun at about 75 degrees latitude, they consist of flattened oval regions about 30,000 kilometres across where material moves about ten percent (about 130 km/h) faster than its surroundings. Although these are the smallest structures yet observed inside the Sun, each is still large enough to engulf two Earths." Additionally, there are features similar to the Earth's trade winds on the surface of the Sun. The Sun rotates much faster at the equator than at the poles. However, Stanford researchers Schou and Dr. Alexander G. Kosovichev have found that there are belts in the northern and southern hemispheres where currents flow at different speeds relative to each other. Six of these gaseous bands move slightly faster than the material surrounding them. The solar belts are more than 65 thousand km across and they contain "winds" that move about 15 kilometres per hour relative to their surroundings. The first evidence of these belts was found more than a decade ago by Dr. Robert Howard of the Mount Wilson Observatory. The Stanford researchers have now shown that

  1. Sun Safety Practices Among Schools in the United States.

    Science.gov (United States)

    Everett Jones, Sherry; Guy, Gery P

    2017-05-01

    Exposure to the sun's UV radiation is a leading cause of skin cancer. Positive attitudes and beliefs about sun safety behavior, which would make sun protective behavior more likely, could be promoted and supported by school policies and practices. To identify school characteristics associated with having adopted practices that promote sun safety. School-level data from the February 3 to July 23, 2014, School Health Policies and Practices Study's Healthy and Safe School Environment questionnaire were analyzed. The School Health Policies and Practices Study uses a 2-stage sampling design to select a nationally representative sample of schools. All public, state-administered, Catholic, and non-Catholic private schools with any of the grades from kindergarten through 12 were eligible for inclusion. All analyses were conducted using weighted data. Prevalence of sun safety practices. In a nationally representative sample of 828 US schools, representatives of 577 schools (69.7%) responded. Overall, sun safety practices were not common among schools. The most frequent practice was having teachers allow time for students to apply sunscreen at school (47.6%; 95% CI, 42.4%-52.9%). Few schools made sunscreen available for students to use (13.3%; 95% CI, 10.2%-17.0%), almost always or always scheduled outdoor activities to avoid times when the sun was at peak intensity (15.0%; 95% CI, 11.4%-19.6%), or asked parents to ensure that students applied sunscreen before school (16.4%; 95% CI, 12.9%-20.6%). High schools were less likely than elementary schools and middle schools to adopt several practices: for instance, 37.5% of high schools (95% CI, 29.7%-46.0%), 51.6% of middle schools (95% CI, 43.3%-59.7%), and 49.5% of elementary schools (95% CI, 42.0%-57.0%) had teachers allow time for students to apply sunscreen at school, and 11.8% of high schools (95% CI, 7.7%-17.5%), 18.2% of middle schools (95% CI, 13.3%-24.4%), and 14.7% of elementary schools (95% CI, 9.6%-21.8%) almost

  2. The sun,the planets and life on Earth

    Science.gov (United States)

    Claudia, Tacu Cristina

    2017-04-01

    We all knowthat Earth,our planet,it's not alone in the Universe.We will discover together a few of its secrets: 0 The influence of the sun on our planet is very important.It provides us thelight ,the warnith and the enery without whice life on Earth wouldn't be possible. 0 Thank to the Sun and the endless spinning of our planet around its own axe and, at the same time around this star,we receive as a gift the day,the night,the seasons. 0In our Solar System there are other spheres appart from the Sun and planets -the asteroids ,wandering pieces of stone.It is said that many milions of years ago it they made a lot of plants and animals disappear. If I have arisen your curiosity,let's go!

  3. An Introduction to Waves and Oscillations in the Sun

    CERN Document Server

    Narayanan, A Satya

    2013-01-01

    Astrophysicists and others studying the Sun will find this expansive coverage of what we know about waves and oscillations in our nearest star an informative introduction to a hot contemporary topic. After a section summarizing the Sun's physical characteristics, the volume moves on to explore the basics of electrodynamics, which in turn facilitate a discussion of magnetohydrodynamics (MHD). The material also details the often complex nature of waves and oscillations in uniform and non-uniform media, before categorizing the observational signatures of oscillations and exploring the instabilities in fluid, dealing with a range of known forms. Lastly, a section on helioseismology explores our growing familiarity with the internal structure of the Sun. This book is a unified portal to a thorough grounding in solar waves that includes a wealth of explanatory vignettes demystifying concepts such as flux tubes, current-free and force-free magnetic fields, the prominences, and the relationship between the vorticity ...

  4. Benign "setting sun" phenomenon in full-term infants.

    Science.gov (United States)

    Yoshikawa, Hideto

    2003-06-01

    I report two normally developed infants showing benign" setting sun" phenomenon. A 2(2-12)-year-old boy and a 7-year-old boy, who were born without any complications at full term, developed brief episodes of downward gazing during sucking and crying after birth However, there were no other clinical or laboratory findings, and they developed normally. The phenomenon was not visible until 6 months and 7 months, respectively. The "setting sun" phenomenon usually indicates underlying severe brain damage and can also be seen, although rarely, in healthy full-term infants until 1 to 5 months. However, the benign "setting sun" phenomenon might exist until 6 or 7 months of age in normal infants.

  5. A low cost high temperature sun tracking solar energy collector

    Science.gov (United States)

    Perkins, G. S.

    1977-01-01

    The design and economic evaluation of a low cost high temperature two axis sun tracking solar energy collector are described. The collector design is specifically intended for solar energy use with the freedom of motion about its two control axes being limited only to the amplitude required to track the sun. An examination of the performance criteria required in order to track the sun and perform the desired solar energy conversion is used as the starting point and guide to the design. This factor, along with its general configuration and structural aspect ratios, is the significant contributor to achieving low cost. The unique mechanical design allows the control system to counter wide tolerances that will be specified for the fabrication of the azimuth frame and perform within a small tracking error.

  6. A sun protection survey of New England fishermen.

    Science.gov (United States)

    Sun, Ting

    2003-05-01

    Skin cancer is the most common form of cancer in the United States, with more than 1 million cases of nonmelanoma skin cancer diagnosed annually and an estimated 53,600 cases of melanoma and 7400 deaths expected during the year 2002. Excess exposure to UV radiation has long been linked to both melanoma and nonmelanoma skin cancers. Fishing is a popular sport in the United States, and one with excessive sun exposure. Results of a survey of recreational fishermen conducted at the 23rd Annual Eastern Fishing & Outdoor Exposition found that sun protection attitudes and practices were poor or inadequate. I recommend that a tailored sun protection intervention program should take into account age, gender, and skin type, as well as the unique obstacles faced by fishermen.

  7. Spacecraft Attitude Determination with Earth Albedo Corrected Sun Sensor Measurements

    DEFF Research Database (Denmark)

    Bhanderi, Dan

    This thesis focuses on advanced modeling of the Earth albedo experienced by satellites in Earth orbit. The model of the Earth albedo maintains directional information of the Earth albedo irradiance from each partition on the Earth surface. This allows enhanced modeling of Sun sensor current outputs...... with improved accuracy. The Earth albedo model may be applied in simulations of the space environment useful in the satellite design phase. The Earth albedo model is verified using the telemetry data of the Danish Ørsted satellite. Novel methods for incorporating the Earth albedo model into the Q......-Method, Extended Kalman Filter, and Unscented Kalman Filter algorithms are presented and the results are compared. Combining the Unscented Kalman Filter with Earth albedo and enhanced Sun sensor modeling allows for three-axis attitude determination from Sun sensor only, which previously has been perceived...

  8. The Sun as you never saw it before

    Science.gov (United States)

    1997-02-01

    The remarkable images come from SOHO's visible-light coronagraph LASCO. It masks the intense rays from the Sun's surface in order to reveal the much fainter glow of the solar atmosphere, or corona. Operated with its widest field of view, in its C3 instrument, LASCO's unprecedented sensitivity enables it to see the thin ionized gas of the solar wind out to the edges of the picture, 22 million kilometres from the Sun's surface. Many stars are brighter than the gas, and they create the background scene. The results alter human perceptions of the Sun. Nearly 30 years ago, Apollo photographs of the Earth persuaded everyone of what until then they knew only in theory, that we live on a small planet. Similarly the new imagery shows our motion in orbit around the Sun, and depicts it as one star among - yet close enough to fill the sky emanations that engulf us. For many centuries even astrologers knew that the Sun was in Sagittarius in December and drifting towards the next zodiacal constellation, Capricornus. This was a matter of calculation only, because the Sun's own brightness prevented a direct view of the starfield. The SOHO-LASCO movie makes this elementary point of astronomy a matter of direct observation for the first time. The images are achievable only from a vantage point in space, because the blue glow of the Earth's atmosphere hides the stars during the day. A spacial allocation of observing time, and of data tranmission from the SOHO spacecraft, enabled the LASCO team to obtain large numbers of images over the period 22-28 December 1996. Since then, a sustained effort in image processing, frame by frame, has achieved a result of high technical and aesthetic quality. Only now is the leader of the LASCO team, Guenter Brueckner of the US Naval Research Laboratory, satisfied with the product and ready to authorize its release. "I spend my life examining the Sun," Brueckner says, "but this movie is a special thrill. For a moment I forget the years of effort that

  9. The solar boat 'Midnight sun'; Solelbaaten 'Midnight sun'

    Energy Technology Data Exchange (ETDEWEB)

    Kohlstroem, Richard; Fiedler, Frank

    2010-12-15

    The solar boat 'Midnight sun' has during the project period been presented and demonstrated at many different events in Sweden. The focus has been on exhibitions for boats, energy and education. There was a great response from visitors but also from various media such as newspapers, radio and television which reported about the solar boat. Solar driven vehicles are a great way to create interest for solar technology. Due to the increased demand for technical improvements and financial efforts we refrained from participating at the solar boat race 'Frisian Solar Challenge' in 2010 in Holland. Instead a solar boat for tourist trade at Fraemby Udde in Falun has been designed and built. The boat will be rented to visitors during the summer period. The electrical components are designed for short trips with a travel time between 3-4 hours. The solar boat at Fraemby Udde shows that it is relatively simple to convert an existing boat to a solar driven boat. Fraemby Udde receives many visitors, so the solar boat will be shown and used by a large number of tourists from Sweden and abroad

  10. Cosmic Ray Sun Shadow in Soudan 2 Underground Muon Flux

    OpenAIRE

    Soudan 2 Collaboration

    1999-01-01

    The absorption of cosmic rays by the sun produces a shadow at the earth. The angular offset and broadening of the shadow are determined by the magnitude and structure of the interplanetary magnetic field (IPMF) in the inner solar system. We report the first measurement of the solar cosmic ray shadow by detection of deep underground muon flux in observations made during the entire ten-year interval 1989 to 1998. The sun shadow varies significantly during this time, with a $3.3\\sigma$ shadow ob...

  11. On the Euler angles for SU(N)

    Energy Technology Data Exchange (ETDEWEB)

    Cerchiai, Bianca L; Bertini, S.; Cacciatori, Sergio L.

    2005-10-20

    In this paper we reconsider the problem of the Euler parametrization for the unitary groups. After constructing the generic group element in terms of generalized angles, we compute the invariant measure on SU(N) and then we determine the full range of the parameters, using both topological and geometrical methods. In particular, we show that the given parametrization realizes the group SU(N+1) as a fibration of U(N) over the complex projective space CP{sup n}. This justifies the interpretation of the parameters as generalized Euler angles.

  12. Sun Interference Predictions for the Kompsat TT&C Station

    OpenAIRE

    Byoung-Sun Lee

    1997-01-01

    The Sun interference event predictions for the KOMPSAT TT&C station were performed to analyze the frequency of the event and the impact on the TT&C link. The KOMPSAT orbit was propagated including only J2 geopotential term for maintaining the Sun-synchronism and no other perturbations were included. Local time of ascending node of the KOMPSAT satellite was set to 10h50m00s. The TT&C station was assumed to locate in Taejon and have 9 meter antenna for S-band link. One year of simulation from 1...

  13. The Eclipse of the Sun: Sun-dials, Clocks and Natural Time in the Late Seventeenth Century.

    Science.gov (United States)

    Turner, Anthony

    2015-01-01

    The Sun, in the early seventeenth century was, as it always had been, the ultimate arbiter of time-measurement In the last quarter of the century however this role was called into question as the new precision of post-Huygenian clocks revealed that natural time and the artificial mean time of the clock were not the same. Initially the question was little understood by the general public. The paper examines some early attempts to explain why "Sun-time" in 1700 was no longer "true-time."

  14. Analysis of meiosis in SUN1 deficient mice reveals a distinct role of SUN2 in mammalian meiotic LINC complex formation and function.

    Directory of Open Access Journals (Sweden)

    Jana Link

    2014-02-01

    Full Text Available LINC complexes are evolutionarily conserved nuclear envelope bridges, composed of SUN (Sad-1/UNC-84 and KASH (Klarsicht/ANC-1/Syne/homology domain proteins. They are crucial for nuclear positioning and nuclear shape determination, and also mediate nuclear envelope (NE attachment of meiotic telomeres, essential for driving homolog synapsis and recombination. In mice, SUN1 and SUN2 are the only SUN domain proteins expressed during meiosis, sharing their localization with meiosis-specific KASH5. Recent studies have shown that loss of SUN1 severely interferes with meiotic processes. Absence of SUN1 provokes defective telomere attachment and causes infertility. Here, we report that meiotic telomere attachment is not entirely lost in mice deficient for SUN1, but numerous telomeres are still attached to the NE through SUN2/KASH5-LINC complexes. In Sun1(-/- meiocytes attached telomeres retained the capacity to form bouquet-like clusters. Furthermore, we could detect significant numbers of late meiotic recombination events in Sun1(-/- mice. Together, this indicates that even in the absence of SUN1 telomere attachment and their movement within the nuclear envelope per se can be functional.

  15. The New Woman in "The Sun Also Rises"

    Science.gov (United States)

    Yu, Xiaoping

    2010-01-01

    Hemingway is a famous American writer and a spokesman of the Lost Generation. His life attitude of the characters in the novels influenced the whole world. His first masterpiece "The Sun Also Rises" contributes a lot to the rise of feminism and make the world began to be familiar with a term: The New Woman through the portrayal of Brett.…

  16. Unruly Sun Emerges from Solar Space Observatory SOHO

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 9. Unruly Sun Emerges from Solar Space Observatory SOHO. B N Dwivedi. Research News Volume 2 Issue 9 September 1997 pp 75-76. Fulltext. Click here to view fulltext PDF. Permanent link:

  17. Solar Energy Education. Reader, Part II. Sun story. [Includes glossary

    Energy Technology Data Exchange (ETDEWEB)

    1981-05-01

    Magazine articles which focus on the subject of solar energy are presented. The booklet prepared is the second of a four part series of the Solar Energy Reader. Excerpts from the magazines include the history of solar energy, mythology and tales, and selected poetry on the sun. A glossary of energy related terms is included. (BCS)

  18. SunShot Catalyst Prize Competition Fact Sheet

    Energy Technology Data Exchange (ETDEWEB)

    Solar Energy Technologies Office

    2015-04-01

    This fact sheet is an overview of the Catalyst Energy Innovation Prize, an open innovation program launched in 2014 by the U.S. Department of Energy SunShot Initiative. This program aims to catalyze the rapid creation and development of products and solutions that address near-term challenges in the U.S. solar energy marketplace.

  19. Nutrients and antinutrients composition of raw, cooked and sun ...

    African Journals Online (AJOL)

    The analysis included proximate, nutrient (ascorbic acid, carotenoids, iron and calcium) and anti-nutrient (oxalate and polyphenols) composition. The purple midrib sweet potato leaves were further analyzed for nutrient and anti-nutrient retention after cooking (with and without lemon) and open sun-drying (with and without ...

  20. DOE SunShot System Integration Program. Accomplishments and Impacts

    Energy Technology Data Exchange (ETDEWEB)

    Boynton, Shannon [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ellis, Abraham [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-02-01

    During FY15, Sandia National Laboratories executed research and development (R&D) work on a portfolio of 16 SunShot Program Systems Integration (SI) agreements, with a total FY15 budget of $13.2 million. This document summarizes the impact of the Sandia contributions based on Sandia’s direct contributions by DOE.

  1. Search for photospheric footpoints of quiet Sun transition region loops

    NARCIS (Netherlands)

    Sánchez Almeida, J.; Teriaca, L.; Sütterlin, P.; Sparado, D.; Schühle, U.; Rutten, R.J.

    2007-01-01

    Context. The footpoints of quiet Sun Transition Region (TR) loops do not seem to coincide with the photospheric magnetic structures appearing in traditional low-sensitivity magnetograms. Aims. We look for the so-far unidentified photospheric footpoints of TR loops using G-band bright points (BPs) as

  2. Rejuvenating the sun and avoiding other global catastrophes

    CERN Document Server

    Beech, Martin

    2008-01-01

    Canadian academic Martin Beech has written a text that crosses the line between science fiction and science fact. Put simply, his book details a method that just might be able to stop the Sun from losing its power and, ultimately, save humanity and the Earth itself.

  3. Sun Exposure and Reduced Risk of Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2008-09-01

    Full Text Available The association between red hair color (RHC melanocortin 1 receptor genotype, past environmental sun exposure, and risk of multiple sclerosis (MS was investigated in a population-based case-control study in Tasmania, Australia, involving 136 cases with MS and 272 controls.

  4. Tree Leaf Shadows to the Sun's Density: A Surprising Route

    Science.gov (United States)

    Mallmann, A. James

    2013-01-01

    Rays of sunlight that strike raindrops produce rainbows that provide information about the spectrum of sunlight. Rays of sunlight that strike airborne ice crystals produce halos, sun pillars, and many other patterns of light and color in the sky. Analysis of those patterns makes it possible to determine the types and orientations of the ice…

  5. Liquid Metallic Hydrogen: Building Block of a Liquid Sun

    Science.gov (United States)

    Robitaille, Pierre-Marie

    2011-04-01

    The establishment by Andrews of critical temperatures (T. Andrews, Phil. Trans. 1869, v. 159, 575-590) soon became one of the great pillars in support of the gaseous models of the Sun. Gases above these temperatures simply could not be liquefied. Given that interior of the Sun was already hypothesized in the 19th century to be at temperatures well exceeding those achievable on Earth in ordinary furnaces, it became inconceivable to think of the solar interior as anything but gaseous. Hence, the models advanced by Secchi, Faye, Stoney, Lane, and Young, could easily gain acceptance. However, modern science is beginning to demonstrate that hydrogen (which under ordinary conditions has a critical point at ˜33 K) can become pressure ionized such that its electrons enter metallic conductions bands, given sufficiently elevated pressures, as the band gap is reduced from 15 eV to ˜0.3 eV. Liquid metallic hydrogen will possess a new critical temperature well above that of ordinary hydrogen. Already, experiments suggests that it can exist at temperatures of thousands of Kelvin and millions of atmospheres (S. T. Weir et al., Phys. Rev. Let. 1996, 76, 1860). The formation of liquid metallic hydrogen brings with it a new candidate for the interior of the Sun and the stars. Its existence shatters the great pillar of the gaseous models of the Sun which the critical point of ordinary gases had erected.

  6. Moon and quiet Sun detection with Fermi-LAT observatory

    Energy Technology Data Exchange (ETDEWEB)

    Brigida, M., E-mail: monica.brigida@ba.infn.i [Dipartimento Interateneo di Fisica ' Michelangelo Merlin' , dell' Universita degli Studi e del Politecnico di Bari and INFN Sezione di Bari, Via Amendola 173, I-70126 Bari (Italy)

    2011-02-21

    The Fermi gamma-ray space telescope is an international mission supporting two science instruments, the Gamma-Ray Burst Monitor (GBM), covering the energy range from few keV to 30 MeV, and the Large Area Telescope (LAT), a pair-conversion detector operating at energies from 30 MeV to 300 GeV. The Fermi telescope was successfully launched on June 11, 2008 and has been surveying the sky in gamma rays since August 2008. During the first months of the mission, Fermi has detected high-energy gamma rays from the Moon and quiet Sun since the first weeks of data taking. This emission is produced by interactions of cosmic rays; by nucleons with the solar and lunar surface (albedo), and electrons with solar photons in the heliosphere. The heliospheric emission is produced by inverse-Compton scattering and is predicted to be extended. Both Moon and the quiet Sun was detecte d by EGRET on CGRO with low statistics, but Fermi is the only gamma-ray mission capable of detecting the Moon and the quiet Sun and monitoring it over the full 24th solar cycle. Here we present the analysis relative to the first months including the observation of the Moon and the Sun, the spectral analysis, the fluxes measurements and finally a comparison with models and previous detections.

  7. Micro digital sun sensor: system in a package

    NARCIS (Netherlands)

    Boom, C.W. de; Leijtens, J.A.P.; Duivenbode, L.M.H. van; Heiden, N. van der

    2004-01-01

    A novel micro Digital Sun Sensor (μDSS) is under development in the frame of a micro systems technology (MST) development program (Microned) from the Dutch Ministry of Economic Affairs. Use of available micro system technologies in combination with the implementation of a dedicated solarcell for

  8. Dynamics of the Sun-Earth-Moon System

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 8. Dynamics of the Sun-Earth-Moon System. S M Alladin G M Ballabh. General Article Volume 10 Issue 8 August 2005 pp 6-24. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/010/08/0006-0024 ...

  9. Applying Sun Tzu's Ancient "Art of War" to the Future

    National Research Council Canada - National Science Library

    Cook, Patricia

    1999-01-01

    The strategist, Sun Tzu, developed "The Art of War" in China around 500 B.C. His precepts of "warfare" have endured for more than 2000 years and have influenced strategic decision-making and warfare through the 20th century...

  10. Stereoscopic View of the Sun and its Activity in Sight

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 5. Stereoscopic View of the Sun and its Activity in Sight. B N Dwivedi. Research News Volume 11 ... Author Affiliations. B N Dwivedi1. Department of Applied Physics, Institute of Technology, Banaras Hindu University, Varanasi-22100S, India.

  11. SUN HUB – ENERGY HUB FOR OUTDOOR TABLES

    DEFF Research Database (Denmark)

    Poulsen, Peter Behrensdorff; Benatto, Gisele Alves dos Reis; Riedel, Nicholas

    2017-01-01

    Solar cells integrated into products are attracting more and more attention especially due to the dramatically declining cost of solar cells. Furthermore, we are getting more dependent on portable units like mobile phones, tablets and PCs which has to be charged to be of any use. Especially...... Sun Hubs to monitor the overall energy system and the consumption of each functionality in the table....

  12. On the Physical Constitution of the Sun — Part I

    Directory of Open Access Journals (Sweden)

    Faye H.

    2011-07-01

    Full Text Available Patrice Robitaille (TAV College, Montreal, Canada provides a translation of Herv ́ e August Etienne Albans Faye’s classic report Sur la constitution physique du soleil , as it appeared in February 1865 within Les Mondes ,1865, v.7, 293–306. Herv ́ e Faye (Oc- tober 1, 1814 – July 4, 1902 led a distinguished life, both in science and public ser- vice. He was widely regarded as one of the premier astronomers of his day. He had studied under the great Franc ̧ois Arago. In 1843, he became a Chevalier de la Legion d’Honneur and, in 1877, served as the French Minister of Education (Catholic Ency- clopedia, 1913. Faye’s report On the Physical Constitution of the Sun was a crucial milestone in the history of astronomy. It was through this paper, that the Sun became viewed as devoid of a distinct surface. The work was also interesting as it presented Faye’s early conception of the gaseous Sun. In addition, through its submission, Faye had sought the approbation of Father Secchi relative to claims of simultaneous discov- ery (see P.M.Robitaille. A Thermodynamic History of the Solar Constitution — I: The Journey to a Gaseous Sun. Progr. Phys. , 2011, v.3, 3–25. Faye’s work would continue to impact solar physics until the 1920s.

  13. Flipping about the Sun and Its Pattern of Apparent Motion

    Science.gov (United States)

    Betts, Crystal M.; Pattee, Allison

    2016-01-01

    Arts integration has shown to enhance student comprehension, retention, and engagement, while connecting to rich science content. The integration of the Next Generation Science Standards and the National Arts Standards into a first grade lesson illustrated how the arts enhanced the students' understandings of the sun's apparent motion during the…

  14. Proximate and organoleptic characteristics of sun and solar dried fish

    African Journals Online (AJOL)

    The sun and solar drier were evaluated for their drying effectiveness with three species of freshwater fish; Gymnarchus niloticus, Heterotis niloticus and Clarias gariepinus. The highest mean temperature that could be attained in the solar dryer was 700C at time 14.00 hour while the ambent temperature and insulation were ...

  15. Sun, Sky and Cloud: Where Light and Matter Meet

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 12. Sun, Sky and Cloud: Where Light and Matter Meet. Rajaram Nityananda. General Article Volume 20 Issue 12 December 2015 pp 1111-1127. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Mechanical Sun-Tracking Technique Implemented for Maximum ...

    African Journals Online (AJOL)

    This paper elucidates a single axis solar tracker system that automatically searches the optimum PV panel position with respect to the sun by means of a DC motor controlled by an intelligent drive unit that receives input signals from light dependent sensors. A prototype of the mechanical maximum power point tracker ...

  17. Readership of Oriwu Sun community newspaper in Ikorodu, Lagos ...

    African Journals Online (AJOL)

    Community newspapers are designed to fill the information gap created by the urban-centric nature of conventional media houses. This aim cannot be achieved without reading the disseminated messages by the target population. This study assessed the readership of Oriwu Sun community newspaper in Ikorodu area of ...

  18. The Early Years: The Earth-Sun System

    Science.gov (United States)

    Ashbrook, Peggy

    2015-01-01

    We all experience firsthand many of the phenomena caused by Earth's Place in the Universe (Next Generation Science Standard 5-ESS1; NGSS Lead States 2013) and the relative motion of the Earth, Sun, and Moon. Young children can investigate phenomena such as changes in times of sunrise and sunset (number of daylight hours), Moon phases, seasonal…

  19. Here Comes the Sun ... and I Say, "It' an Assemblage"

    Science.gov (United States)

    Skophammer, Karen

    2011-01-01

    In this article, the author discusses how she combines science lesson with a hands-on art project. She used the wonderfully creative suns shown on the Sunday edition of "The CBS Morning Show" to give the students fodder for thought. She describes how to create an assemblage. An assemblage is like a collage, but it moves past the two-dimensional…

  20. Viewing The Entire Sun With STEREO And SDO

    Science.gov (United States)

    Thompson, William T.; Gurman, J. B.; Kucera, T. A.; Howard, R. A.; Vourlidas, A.; Wuelser, J.; Pesnell, D.

    2011-05-01

    On 6 February 2011, the two Solar Terrestrial Relations Observatory (STEREO) spacecraft were at 180 degrees separation. This allowed the first-ever simultaneous view of the entire Sun. Combining the STEREO data with corresponding images from the Solar Dynamics Observatory (SDO) allows this full-Sun view to continue for the next eight years. We show how the data from the three viewpoints are combined into a single heliographic map. Processing of the STEREO beacon telemetry allows these full-Sun views to be created in near-real-time, allowing tracking of solar activity even on the far side of the Sun. This is a valuable space-weather tool, not only for anticipating activity before it rotates onto the Earth-view, but also for deep space missions in other parts of the solar system. Scientific use of the data includes the ability to continuously track the entire lifecycle of active regions, filaments, coronal holes, and other solar features. There is also a significant public outreach component to this activity. The STEREO Science Center produces products from the three viewpoints used in iPhone/iPad and Android applications, as well as time sequences for spherical projection systems used in museums, such as Science-on-a-Sphere and Magic Planet.

  1. Seismology and geodesy of the sun: Solar geodesy.

    Science.gov (United States)

    Dicke, R H

    1981-03-01

    Measurements of the elliptical figure of the sun made in 1966 are analyzed on an hourly basis. This analysis yields an improved measure of the previously found solar distortion, rotating rigidly with a sidereal period of 12.38+/-0.10 days. It also yields a set of residùals used to search for signals due to low-frequency solar oscillations.

  2. Inference of magnetic fields in the very quiet Sun

    Czech Academy of Sciences Publication Activity Database

    Martinez Gonzalez, M. J.; Pastor Yabar, A.; Lagg, A.; Asensio Ramos, A.; Collados Vera, M.; Solanki, S.K.; Balthasar, H.; Berkefeld, T.; Denker, C.; Dörr, H.P.; Feller, A.; Franz, M.; Gonzalez Manrique, S. J.; Hofmann, A.; Kneer, F.; Kuckein, C.; Louis, R.E.; von der Lühe, O.; Nicklas, H.; Orozco Suárez, D.; Rezaei, R.; Schlichenmaier, R.; Schmidt, D.; Schmidt, W.; Sigwarth, M.; Sobotka, Michal; Soltau, D.; Staude, J.; Strassmeier, K.G.; Verma, M.; Waldmann, T.A.; Volkmer, R.

    2016-01-01

    Roč. 596, December (2016), A5/1-A5/11 ISSN 0004-6361 Institutional support: RVO:67985815 Keywords : Sun * atmosphere * magnetic fields Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.378, year: 2014

  3. Cyanogen removal from cassava roots during sun-drying.

    NARCIS (Netherlands)

    Essers, A.J.; Grift, van der R.M.; Voragen, A.G.J.

    1996-01-01

    Linamarin levels in sun-drying cassava root pieces showed an exponential decrease, parallel with the moisture loss, and stabilized when moisture levels reached about 15%. Linamarin degradation in thin root segments was significantly slower and less complete than in thick ones. Disinfected

  4. Recent Progress in Understanding the Sun's Magnetic Dynamo

    Science.gov (United States)

    Hathaway, David. H.

    2004-01-01

    100 years ago we thought that the Sun and stars shone as a result of slow gravitational contraction over a few tens of millions of years - putting astronomers at odds with geologists who claimed that the Earth was much, much older. That mystery was solved in the 1920s and 30s with the discovery of nuclear energy (proving that the geologists had it right all along). Other scientific mysteries concerning the Sun have come and gone but three major mysteries remain: 1) How does the Sun produce sunspots with an 11-year cycle? 2) What produces the huge explosions that result in solar flares, prominence eruptions, and coronal mass ejections? and 3) Why is the Sun's outer atmosphere, the corona, so darned hot? Recent progress in solar astronomy reveals a single key to understanding all three of these mysteries.The 11-year time scale for the sunspot cycle indicates the presence of a magnetic dynamo within the Sun. For decades this dynamo was though to operate within the Sun's convection zone - the outmost 30% of the Sun where convective currents transport heat and advect magnetic lines of force. The two leading theories for the dynamo had very different models for the dynamics of the convection zone. Actual measurements of the dynamics using the techniques of helioseismology showed that both of these models had to be wrong some 20 years ago. A thin layer of strongly sheared flow at the base of the convection zone (now called the tachocline) was then taken to be the seat of the dynamo. Over the last 10 years it has become apparent that a weak meridional circulation within the convection zone also plays a key role in the dynamo. This meridional circulation has plasma rising up from the tachocline in the equatorial regions, spreading out toward the poles at a top speed of about 10-20 m/s at the surface, sinking back down to the tachocline in the polar regions, and then flowing back toward the equator at a top speed of about 1-2 m/s in the tachocline itself. Recent dynamo

  5. Revival of the "Sun Festival": An educational and outreach project

    Science.gov (United States)

    Montabone, Luca

    2016-10-01

    In ancient times, past civilisations used to celebrate both the winter and summer solstices, which represented key moments in the periodical cycle of seasons and agricultural activities. In 1904, the French astronomer Camille Flammarion, the engineer Gustave Eiffel, the science writer Wilfrid de Fonvielle and the Spanish astronomer Josep Comas i Solà decided to celebrate the summer solstice with a festival of science, art and astronomical observations opened to the public at the Eiffel tower in Paris. For ten consecutive years (1904-1914) on the day of the summer solstice, the "Sun Festival" (Fête du Soleil in French) included scientific and technological lectures and demostrations, celestial observations, music, poetry, danse, cinema, etc. This celebration was interrupted by the First World War, just to resume in Barcelona, Spain, between 1915 and 1937, and in Marseille, France, in the 1930s. It was the founders' dream to extend this celebration to all cities in France and elsewhere.It is only during the International Year of Astronomy in 2009, to our knowledge, that the "Sun Festival" was given another chance in France, thanks to the joint effort of several scientific and cultural centers (Centres de Culture Scientifique, Technique et Industrielle, CCSTI) and the timely support of the European Space Agency (ESA). In this occasion again, the festival was characterized by the combination of science, art and technological innovation around a common denominator: our Sun!We have recently revived the idea of celebrating the summer solstice with a "Sun Festival" dedicated to scientific education and outreach about our star and related topics. This project started last year in Aix-les-Bains, France, with the "Sun and Light Festival" (2015 was the International Year of Light), attended by about 100 people. This year's second edition was in Le Bourget-du-Lac, France. Following the COP21 event, the specific theme was the "Sun and Climate Festival", and we had about 250

  6. Ulysses reaches maximum latitude over the Sun's northern pole

    Science.gov (United States)

    1995-08-01

    All operations and science experiments continue to go well and NASA's tracking facilities near Madrid and Goldstone, California, are monitoring the spacecraft 24 hours a day as manoeuvres are performed to keep Ulysses' radio antenna pointing toward the Earth. Launched in October 1990 aboard the space shuttle Discovery, the 370-kilogram spacecraft was designed to study the heliosphere - that region of space dominated by the solar wind -at all latitudes above and below the Sun's equatorial plane. These high latitude regions have never been explored before. Named after the legendary adventurer who journeyed to the "hidden" side of the Sun, Ulysses carries nine scientific instruments provided by research institutes in Europe and the United States to make detailed studies of solar wind, magnetic fields, energetic solar and cosmic ray particles, natural radio waves, and interplanetary dust and gas. In addition, a gamma- ray burst detector helps determine the source of the brightest cosmic gamma-ray bursts. In a permanent 6-year orbit about the Sun, the spacecraft is currently travelling at about 90,000 kilometers per hour with respect to the Sun. Having made its greatest northern excursion, Ulysses is now gradually descending in latitude. On 29 September 1995, the spacecraft will complete the northern polar pass and begin to travel back out to the orbit of Jupiter, reaching Jupiter's distance of about 800 million kilometers in April, 1998. Ulysses will then head back on its high latitude trajectory toward the Sun, returning first to the south polar regions in the year 2000, followed by a second flight over the north pole in 2001. Initial results from the climb to high northern latitudes have already confirmed a number of the findings from Ulysses' southern polar pass that took place last year. As expected, once the spacecraft moved away from the equatorial regions heading north, it became permanently immersed in fast solar wind from the northern polar cap. Another

  7. Young Nearby Suns and Stellar Jitter Dependence on Age

    Science.gov (United States)

    Cabrera, Nicole; White, Russel; Delfosse, Xavier; Noah Quinn, Samuel; Latham, David W.

    2015-01-01

    Finding the nearest young planets offers the most direct way to improve our understanding of how planets form, how they migrate, and how they evolve. However, most radial velocity (RV) surveys have avoided young stars because of their problematic characteristics, including high levels of stellar activity. Recent advancements in infrared (IR) detectors as well as wavelength calibration methods have provided new ways of pursuing high-precision RV measurements of young stars. While this work has been successfully applied to many young late-K and M dwarfs, much less RV work has been done on young Sun-like stars, with the very recent exception of adolescent stars (~600 Myr) in open clusters. In order to better understand the dynamical and structural forces that shaped our own Solar system, we must begin to explore the more massive realm of Sun-like stars.We present precision optical radial velocity data of 5 young, nearby, Sun-like stars in AB Dor and assess our ability to detect young planets with current spectroscopic methods. The data were obtained with the TRES spectrograph on the 1.5-m Tillinghast Reflector at the Fred L. Whipple Observatory and with SOPHIE on the 1.95 m Telescope at the Observatoire de Haute Provence. We obtained a RV precision of ~8 m/s with TRES and ~7 m/s precision with SOPHIE; average observed dispersions are 38 m/s and 33 m/s, respectively. We combine our results with spectroscopic data of Sun-like stars spanning a broad range of youthful ages (age. The results suggest that the jitter of Sun-like stars decreases below 100 m/s for stars older than ~30 Myr, which would enable the discovery of hot Jupiters orbiting these adolescent age stars.

  8. Our Dynamic Sun (Hannes Alfvén Medal Lecture)

    Science.gov (United States)

    Priest, Eric

    2017-04-01

    The Sun, an object of worship for early civilisations, is the main source of light and life on Earth and of our space weather, with many subtle effects on our environment. The lecture will introduce you to the Sun and its dynamic phenomena, and will aim to show how our understanding of many aspects of the Sun has been revolutionized over the past few years by current spacecraft observations and models. Much of the dynamic behaviour is driven by the magnetic field since, in the outer atmosphere (or corona), it represents by far the largest source of energy. The interior of the Sun, revealed by solar seismology, possesses a strong shear layer at the base of the convection zone, where sunspot magnetic fields are generated. But a small-scale dynamo is also operating near the surface of the Sun, generating magnetic fields that thread the lowest layer of the solar atmosphere, the photosphere, in a turbulent convective state. Above the photosphere lies the highly dynamic fine-scale chromosphere and beyond that the rare corona at high temperatures exceeding one million degrees K. Magnetic mechanisms for heating the corona (an intriguing puzzle) will be described. Other puzzles include the structure of giant flux ropes, known as prominences, which have complex fine structure. Occasionally, they erupt and produce huge ejections of mass and magnetic field (coronal mass ejections), which can disrupt the space environment of the Earth. When such eruptions originate in active regions around sunspots, they are also associated with solar flares, where magnetic energy is converted to kinetic, heat and fast particle energy. A new theory will be presented for the origin of the twist that is observed in erupting prominences.

  9. SunPy 0.8 - Python for Solar Physics

    Science.gov (United States)

    Inglis, Andrew; Bobra, Monica; Christe, Steven; Hewett, Russell; Ireland, Jack; Mumford, Stuart; Martinez Oliveros, Juan Carlos; Perez-Suarez, David; Reardon, Kevin P.; Savage, Sabrina; Shih, Albert Y.; Ryan, Daniel; Sipocz, Brigitta; Freij, Nabil

    2017-08-01

    SunPy is a community-developed open-source software library for solar physics. It is written in Python, a free, cross-platform, general-purpose, high-level programming language which is being increasingly adopted throughout the scientific community. Python is one of the top ten most often used programming languages, as such it provides a wide array of software packages, such as numerical computation (NumPy, SciPy), machine learning (scikit-learn), signal processing (scikit-image, statsmodels) to visualization and plotting (matplotlib, mayavi). SunPy aims to provide the software for obtaining and analyzing solar and heliospheric data. This poster introduces a new major release of SunPy (0.8). This release includes two major new functionalities, as well as a number of bug fixes. It is based on 1120 contributions from 34 unique contributors. Fido is the new primary interface to download data. It provides a consistent and powerful search interface to all major data sources provides including VSO, JSOC, as well as individual data sources such as GOES XRS time series and and is fully pluggable to add new data sources, i.e. DKIST. In anticipation of Solar Orbiter and the Parker Solar Probe, SunPy now provides a powerful way of representing coordinates, allowing conversion between coordinate systems and viewpoints of different instruments, including preliminary reprojection capabilities. Other new features including new timeseries capabilities with better support for concatenation and metadata, updated documentation and example gallery. SunPy is distributed through pip and conda and all of its code is publicly available (sunpy.org).

  10. SOHO starts a revolution in the science of the Sun

    Science.gov (United States)

    1996-07-01

    In addition, SOHO has found clues to the forces that accelerate the solar wind of atomic particles blowing unceasingly through the Solar System. By relating the huge outbursts called coronal mass ejections to preceding magnetic changes in the Sun, SOHO scientists hope to predict such events which, in the Earth's vicinity, endanger power supplies and satellites. SOHO sees differences in the strength of the solar wind in various directions, by mapping a cavity in the cloud of interstellar hydrogen surrounding the Sun. As a bonus, SOHO secured remarkable images of Comet Hyakutake, by ultraviolet and visible light. The revolution in solar science will seem more complete when all the pieces and actions of the Sun, detected by twelve different instruments, are brought together in observations and concepts. Fundamental questions will then be open to re-examination, about the origin of the Sun's magnetism, the cause of its variations in the 11-year cycle of sunspot activity, and the consequences for the Solar System at large. SOHO is greater than the sum of its parts. "SOHO takes solar science by storm," says Roger Bonnet, the European Space Agency's Director of Science, "thanks to its combination of instruments. Unprecedented results from individual telescopes and spectrometers are impressive, of course, but what is breathtaking is SOHO's ability to explore the Sun all the way from its nuclear core to the Earth's vicinity and beyond. We can expect a completely new picture of how agitation inside the Sun, transmitted through the solar atmosphere, directly affects us on the Earth." SOHO is a project of international cooperation between the European Space Agency and NASA. The spacecraft was built in Europe and instrumented by scientists on both sides of the Atlantic. NASA launched SOHO and provides the ground stations and an operations centre at the Goddard Space Flight Center near Washington. SOHO has an uninterrupted view of the Sun from a halo orbit around Lagrangian

  11. Efficacy and adequacy of conventional transbronchial needle aspiration of IASLC stations 4R, 4L and 7 using endobronchial landmarks provided by the Wang nodal mapping system in the staging of lung cancer.

    Science.gov (United States)

    Liu, Qinghua; Han, Songyan; Arias, Sixto; Turner, J Francis; Lee, Hans; Browning, Robert; Wang, Ko-Pen

    2016-01-01

    The role of transbronchial needle aspiration (TBNA) in the diagnosis and staging of lung cancer has been well established. Recently, the efficacy of conventional TBNA in the staging of lung cancer has been enhanced by the use of endobronchial ultrasound (EBUS)-TBNA. Our study sought to evaluate the adequacy of TBNA of International Association for the Study of Lung Cancer (IASLC) stations 4R, 4L and 7 using endobronchial landmarks provided by the Wang nodal mapping system in the staging of lung cancer. We retrospectively analyzed all bronchoscopic cases with conventional TBNA punctures positive for malignancy at our institution from 1 January to 31 October 2014. The endobronchial puncture site was guided by the Wang nodal mapping system. The Wang stations were correlated with the IASLC lymph node map. No endobronchial ultrasound or rapid on-site evaluation was used. Pathological analysis included cytological and histological examination. Diagnosis by histological analysis was obtained in 115 (55.3%) out of 208 puncture sites. The metastatic lymph nodes were distributed at IASLC stations 4R (W1, 3, 5) 46.6 %, 7 (W2, 8, 10) 19.7%, 4L (W4, 6) 11.5%, 11R (W7, W9) 11.1% 11L (W11) 9.6%, 2R (high station W3) 0.5%, and the proximal portion of station 8 (station W10 beyond the middle lobe orifice) 1%. No complications were observed. IASLC station 4R (W1, 3, 5), 7 (W2, 8, 10) and 4L (W4, 6) are adequate for the staging of lung cancer.

  12. Epigenetic information in gametes: Gaming from before fertilization. Comment on ;Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition; by Qian Wang et al.

    Science.gov (United States)

    Shi, Junchao; Zhang, Xudong; Liu, Ying; Chen, Qi

    2017-03-01

    In their interesting article [1] Wang et al. proposed a mathematical model based on evolutionary game theory [2] to tackle the fundamental question in embryo development, that how sperm and egg interact with each other, through epigenetic processes, to form a zygote and direct successful embryo development. This work is based on the premise that epigenetic reprogramming (referring to the erasure and reconstruction of epigenetic marks, such as DNA methylation and histone modifications) after fertilization might be of paramount importance to maintain the normal development of embryos, a premise we fully agree, given the compelling experimental evidence reported [3]. Wang et al. have specifically chosen to employ the well-studied DNA methylation reprogramming process during mammalian early embryo development, as a basis to develop their mathematical model, namely epigenetic game theory (epiGame). They concluded that the DNA methylation pattern in mammalian early embryo could be formulated and quantified, and their model can be further used to quantify the interactions, such as competition and/or cooperation of expressed genes that maximize the fitness of embryos. The efforts by Wang et al. in quantitatively and systematically analyzing the beginning of life apparently hold value and represent a novel direction for future embryo development research from both theoretical and experimental biologists. On the other hand, we see their theory still at its infancy, because there are plenty more parameters to consider and there are spaces for debates, such as the cases of haploid embryo development [4]. Here, we briefly comment on the dynamic process of epigenetic reprogramming that goes beyond DNA methylation, a dynamic interplay that involves histone modifications, non-coding RNAs, transposable elements et al., as well as the potential input of the various types of 'hereditary' epigenetic information in the gametes - a game that has started before the fertilization.

  13. SunSmart: Evaluation of a Pilot School-Based Sun Protection Intervention in Hispanic Early Adolescents

    Science.gov (United States)

    Miller, K. A.; Langholz, B. M.; Ly, T.; Harris, S. C.; Richardson, J. L.; Peng, D. H.; Cockburn, M. G.

    2015-01-01

    The incidence of melanoma is rising among Hispanic populations in the United States. The purpose of this study is to evaluate the impact of a pilot sun safety educational intervention conducted from 2006 to 2012 on Hispanic early adolescents in a high ultraviolet environment. Nineteen schools with high Hispanic enrollment were recruited from urban…

  14. An Inexpensive High-Temporal Resolution Electronic Sun Journal for Monitoring Personal Day to Day Sun Exposure Patterns

    Directory of Open Access Journals (Sweden)

    Nathan J. Downs

    2017-11-01

    Full Text Available Exposure to natural sunlight, specifically solar ultraviolet (UV radiation contributes to lifetime risks of skin cancer, eye disease, and diseases associated with vitamin D insufficiency. Improved knowledge of personal sun exposure patterns can inform public health policy; and help target high-risk population groups. Subsequently, an extensive number of studies have been conducted to measure personal solar UV exposure in a variety of settings. Many of these studies, however, use digital or paper-based journals (self-reported volunteer recall, or employ cost prohibitive electronic UV dosimeters (that limit the size of sample populations, to estimate periods of exposure. A cost effective personal electronic sun journal (ESJ built from readily available infrared photodiodes is presented in this research. The ESJ can be used to complement traditional UV dosimeters that measure total biologically effective exposure by providing a time-stamped sun exposure record. The ESJ can be easily attached to clothing and data logged to personal devices (including fitness monitors or smartphones. The ESJ improves upon self-reported exposure recording and is a cost effective high-temporal resolution option for monitoring personal sun exposure behavior in large population studies.

  15. ULYSSES comes full circle, before revisiting the Sun's poles

    Science.gov (United States)

    1998-04-01

    From its unique perspective, Ulysses has provided scientists with the very first all-round map of the heliosphere, the huge bubble in space filled by the Sun's wind. The Earth swims deep inside the heliosphere, and gusts and shocks in the solar wind can harm satellites, power supplies and ommunications. They may also affect our planet's weather. A better grasp of the solar weather in the heliosphere is therefore one of the major aims of ESA's science programme. In a project of international cooperation between ESA and NASA, Ulysses was launched towards Jupiter in October 1990 by the US space shuttle Discovery. Arriving in February 1992, Ulysses stole energy from the giant planet in a slingshot manoeuvre and was propelled back towards the Sun in an elongated orbit almost at right angles to the ecliptic plane, where the Earth and other planets circle the Sun. "This month Ulysses returns to the point in space where its out-of-ecliptic journey began, but Jupiter isn't there," explains Richard Marsden, ESA's project scientist for Ulysses. "Following its own inexorable path around the Sun, Jupiter is far away on the opposite side of the Solar System. So Ulysses' course will not be changed a second time. The spacecraft is now in effect a man-made comet, forever bound into a 6-year polar orbit around the Sun." Ulysses now starts its second orbit. It will travel over the poles of the Sun in 2000-2001 just as the count of dark sunspots is expected to reach a maximum. With its operational life extended for the Ulysses Solar Maximum Mission, the spacecraft will find the heliosphere much stormier than during its first orbit. Discoveries so far Like its mythical namesake, Ulysses has already had an eventful voyage of discovery. Its unique trajectory has provided the scientific teams with a new perspective, from far out in space and especially in the previously unknown regions of the heliosphere over the Sun's poles. Passing within 9.8 degrees of the polar axis, the highly

  16. Using game theory to investigate the epigenetic control mechanisms of embryo development: Comment on: "Epigenetic game theory: How to compute the epigenetic control of maternal-to-zygotic transition" by Qian Wang et al.

    Science.gov (United States)

    Zhang, Le; Zhang, Shaoxiang

    2017-03-01

    A body of research [1-7] has already shown that epigenetic reprogramming plays a critical role in maintaining the normal development of embryos. However, the mechanistic quantitation of the epigenetic interactions between sperms and oocytes and the related impact on embryo development are still not clear [6,7]. In this study, Wang et al., [8] develop a modeling framework that addresses this question by integrating game theory and the latest discoveries of the epigenetic control of embryo development. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Effects of Inner Nuclear Membrane Proteins SUN1/UNC-84A and SUN2/UNC-84B on the Early Steps of HIV-1 Infection.

    Science.gov (United States)

    Schaller, Torsten; Bulli, Lorenzo; Pollpeter, Darja; Betancor, Gilberto; Kutzner, Juliane; Apolonia, Luis; Herold, Nikolas; Burk, Robin; Malim, Michael H

    2017-10-01

    Human immunodeficiency virus type 1 (HIV-1) infection of dividing and nondividing cells involves regulatory interactions with the nuclear pore complex (NPC), followed by translocation to the nucleus and preferential integration into genomic areas in proximity to the inner nuclear membrane (INM). To identify host proteins that may contribute to these processes, we performed an overexpression screen of known membrane-associated NE proteins. We found that the integral transmembrane proteins SUN1/UNC84A and SUN2/UNC84B are potent or modest inhibitors of HIV-1 infection, respectively, and that suppression corresponds to defects in the accumulation of viral cDNA in the nucleus. While laboratory strains (HIV-1 NL4.3 and HIV-1 IIIB ) are sensitive to SUN1-mediated inhibition, the transmitted founder viruses RHPA and ZM247 are largely resistant. Using chimeric viruses, we identified the HIV-1 capsid (CA) protein as a major determinant of sensitivity to SUN1, and in vitro -assembled capsid-nucleocapsid (CANC) nanotubes captured SUN1 and SUN2 from cell lysates. Finally, we generated SUN1 -/- and SUN2 -/- cells by using CRISPR/Cas9 and found that the loss of SUN1 had no effect on HIV-1 infectivity, whereas the loss of SUN2 had a modest suppressive effect. Taken together, these observations suggest that SUN1 and SUN2 may function redundantly to modulate postentry, nuclear-associated steps of HIV-1 infection. IMPORTANCE HIV-1 causes more than 1 million deaths per year. The life cycle of HIV-1 has been studied extensively, yet important steps that occur between viral capsid release into the cytoplasm and the expression of viral genes remain elusive. We propose here that the INM components SUN1 and SUN2, two members of the linker of nucleoskeleton and cytoskeleton (LINC) complex, may interact with incoming HIV-1 replication complexes and affect key steps of infection. While overexpression of these proteins reduces HIV-1 infection, disruption of the individual SUN2 and SUN1 genes

  18. Dissemination of go sun smart in outdoor recreation: effect of program exposure on sun protection of guests at high-altitude ski areas.

    Science.gov (United States)

    Walkosz, Barbara J; Buller, David B; Andersen, Peter A; Scott, Michael D; Dignan, Mark B; Cutter, Gary R; Liu, Xia; Maloy, Julie A

    2014-09-01

    Go Sun Smart is a theory-based health communication program designed to influence sun-protection behaviors of employees and guests at high-altitude ski areas to reduce skin cancer risk. The effects of Go Sun Smart, in a Phase IV dissemination randomized posttest-only trial, on sun-protection behaviors of ski area guests are reported. Program use was assessed by on-site observation and guest message exposure, and sun protection was measured in intercept surveys at ski areas. Dissemination strategy-enhanced versus basic-was not significantly related to sun safety practices. Additional analyses examined the relation between message exposure and guests' sun safety practices. Ski areas displaying at least 6 Go Sun Smart materials in guest-only areas and 9 Go Sun Smart materials throughout the area increased guests' message exposure. Higher message exposure within the high-use ski areas was associated with improved sun protection by guests but not within the low-use ski areas. The authors underscore the importance of program implementation and message exposure on the success of evidence-based health communication efforts applied industrywide.

  19. ‘My child did not like using sun protection’: practices and perceptions of child sun protection among rural black African mothers

    Directory of Open Access Journals (Sweden)

    Zamantimande Kunene

    2017-08-01

    Full Text Available Abstract Background Photodamage is partially mitigated by darker skin pigmentation, but immune suppression, photoaging and cataracts occur among individuals with all skin types. Methods To assess practices and acceptability to Black African mothers of sun protection equipment for their children living in a rural area, participants were recruited at the time of their child’s 18-month vaccinations. Mothers completed a baseline questionnaire on usual sun behaviours and sun protection practices. They were then provided with sun protection equipment and advice. A follow-up questionnaire was administered two weeks later. Results Mothers reported that during the week prior to the baseline questionnaire, children spent on average less than 1 hour of time outdoors (most often spent in the shade. Most mothers (97% liked the sun protection equipment. However, many (78 of 86 reported that their child did not like any of the sun protection equipment and two-thirds stated that the sun protection equipment was not easy to use. Conclusions Among Black Africans in rural northern South Africa, we found a mismatch between parental preferences and child acceptance for using sun protection when outdoors. A better understanding of the health risks of incidental excess sun exposure and potential benefits of sun protection is required among Black Africans.

  20. Impact of the Sun on Remote Sensing of Sea Surface Salinity from Space

    National Research Council Canada - National Science Library

    Le Vine, David M; Abraham, Saji; Wentz, F; Lagerloef, G. S

    2005-01-01

    ... to monitor soil moisture and sea surface salinity. Radiation from the sun can impact passive remote sensing systems in several ways, including line-of-sight radiation that comes directly from the sun and enters through antenna side lobes...

  1. Sun Grant Initiative : great strides toward a sustainable and more energy-independent future

    Science.gov (United States)

    2014-09-01

    The Sun Grant Initiative publication, developed by the U.S. Department of Transportation, offers a glimpse of how the Sun Grant Initiative Centers are advancing alternative fuels research. Transportation plays a significant role in biofuels research,...

  2. Skin and Sun — Safety First | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... turn Javascript on. Feature: Skin Cancer Skin and Sun – Safety First Past Issues / Summer 2013 Table of ... Institute Be sure to wear sunscreen with a sun protective factor (SPF) of 15 or higher any ...

  3. Eliminating sun glare disturbance at signalized intersections by a vehicle to infrastructure wireless communication : final report.

    Science.gov (United States)

    2016-05-01

    Due to sun glare disturbances, drivers may encounter fatal threats on roadways, particularly at signalized intersections. Many studies have attempted to develop applicable solutions, such as avoiding sun positions, road geometric redirections, and we...

  4. Sun to breathe new life into old reservoir. [Texas

    Energy Technology Data Exchange (ETDEWEB)

    Bleakley, W.B.

    1981-04-01

    The McCleskey sand reservoir, Ranger field, Eastland County, Texas, approx. 40 miles east of Abilene, has a short, frustrating early life and a disappointing maturity, but promises an exciting future. Sun Production Co. feels that application of new technologies in reservoir management, production techniques, and geologic interpretation will pave the way to recovery of a large portion of the 41 API oil remaining in place. Estimates indicate that the early productive life of the field, which yielded approx. 27 million bbl, accounted for as little as 15% of the original oil in place, and probably not more than 20%. A pilot waterflood will get underway soon, and careful monitoring of that project should provide answers to remaining questions. All signs are favorable, and Sun is optimistic about final results.

  5. Understanding Space Weather: The Sun as a Variable Star

    Science.gov (United States)

    Strong, Keith; Saba, Julia; Kucera, Therese

    2012-01-01

    The Sun is a complex system of systems and until recently, less than half of its surface was observable at any given time and then only from afar. New observational techniques and modeling capabilities are giving us a fresh perspective of the solar interior and how our Sun works as a variable star. This revolution in solar observations and modeling provides us with the exciting prospect of being able to use a vastly increased stream of solar data taken simultaneously from several different vantage points to produce more reliable and prompt space weather forecasts. Solar variations that cause identifiable space weather effects do not happen only on solar-cycle timescales from decades to centuries; there are also many shorter-term events that have their own unique space weather effects and a different set of challenges to understand and predict, such as flares, coronal mass ejections, and solar wind variations.

  6. On the Path to SunShot - Executive Summary

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2016-05-01

    The halfway mark of the SunShot Initiative’s 2020 target date is a good time to take stock: How much progress has been made? What have we learned? What barriers and opportunities must still be addressed to ensure that solar technologies achieve cost parity in 2020 and realize their full potential in the decades beyond? To answer these questions, the Solar Energy Technology Office launched the On the Path to SunShot series in early 2015 in collaboration with the National Renewable Energy Laboratory (NREL) and with contributions from Lawrence Berkeley National Laboratory (LBNL), Sandia National Laboratories (SNL), and Argonne National Laboratory (ANL). The reports focus on the areas of technology development, systems integration, and market enablers.

  7. The Extreme-ultraviolet Emission from Sun-grazing Comets

    Science.gov (United States)

    Bryans, Paul; Pesnell, William D.

    2012-01-01

    The Atmospheric Imaging Assembly (AIA) on the Solar Dynamics Observatory has observed two Sun-grazing comets as they passed through the solar atmosphere. Both passages resulted in a measurable enhancement of extreme-ultraviolet (EUV) radiance in several of the AIA bandpasses.We explain this EUV emission by considering the evolution of the cometary atmosphere as it interacts with the ambient solar atmosphere. Molecules in the comet rapidly sublimate as it approaches the Sun. They are then photodissociated by the solar radiation field to create atomic species. Subsequent ionization of these atoms produces a higher abundance of ions than normally present in the corona and results in EUV emission in the wavelength ranges of the AIA telescope passbands.

  8. Research and application of devices for synchronously tracking the sun

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Ming; Sun, Youhong; Wang, Qinghua; Wu, Xiaohan [Jilin Univ. Changchun (China). College of Construction Engineering

    2008-07-01

    This paper introduces a concept of apparent motion orbit of the sun, and put forward the theory of synchronous (linear) tracking the sun. Using solarium mechanism to trail the running path of solar hour angel, and using modified sine function framework to trace solar apparent declination path, and then connect these two mechanisms with linear transmission chain. More than 45%{proportional_to}122% electricity can be output by the synchronous tracking photovoltaic (PV) devices compare with those fixed PV ones with the same area between the spring equinox to the summer solstice. The 17m{sup 2} heat collector of synchronous tracking, its static wind-driven power consumption is less than 3.5W (0.2W/m{sup 2}), and the gale consumption is less than 7W(0.34W/m{sup 2}). The apparatus can be utilized widely in solar power, heating, lighting systems and other solar energy utilization. (orig.)

  9. SunDial: embodied informal science education using GPS

    Directory of Open Access Journals (Sweden)

    Megan K. Halpern

    2011-06-01

    Full Text Available Science centers serve a number of goals for visitors, ideally providing experiences that are educational, social, and meaningful. This paper describes SunDial, a handheld application developed for families to use at a science center. Inspired by the idea of geocaching, the high-tech treasure hunting game that utilizes GPS technologies, SunDial asks families to use a single handheld device to locate and participate in a series of learning modules around the museum. Observations of 10 families suggest that it supports rich informal science education experiences, provides insights about families’ interaction patterns around and with single handheld devices, and demonstrates the value of navigation as an educational experience. Further, using recently released guidelines for Informal Science Education (ISE experiences to inform the design process proved valuable, tying features of the technology to educational and social goals, and giving evidence that explicit reference to these guidelines can improve ISE experiences and technologies.

  10. Laboratory test of an APS-based sun sensor prototype

    Science.gov (United States)

    Rufino, Giancarlo; Perrotta, Alessandro; Grassi, Michele

    2017-11-01

    This paper deals with design and prototype development of an Active Pixel Sensor - based miniature sun sensor and a laboratory facility for its indoor test and calibration. The miniature sun sensor is described and the laboratory test facility is presented in detail. The major focus of the paper is on tests and calibration of the sensor. Two different calibration functions have been adopted. They are based, respectively, on a geometrical model, which has required least-squares optimisation of system physical parameters estimates, and on neural networks. Calibration results are presented for the above solutions, showing that accuracy in the order of 0.01° has been achieved. Neural calibration functions have attained better performance thanks to their intrinsic auto-adaptive structure.

  11. Probing the Sun with ALMA: Observations and Simulations

    Science.gov (United States)

    Loukitcheva, M.; Solanki, S. K.; White, S. M.; Carlsson, M.

    2015-12-01

    ALMA will open a new chapter in the study of the Sun by providing a leap in spatial resolution and sensitivity compared to currently available mm wavelength observations. In preparation of ALMA, we have carried out a large number of observational tests and state-of-the-art radiation MHD simulations. Here we review the best available observations of the Sun at millimeter wavelengths.Using state of the art radiation MHD simulations of the solar atmosphere we demonstrate the huge potential of ALMA observations for uncovering the nature of the solar chromosphere. We show that ALMA will not only provide a reliable probe of the thermal structure and dynamics of the chromosphere, it will also open up a powerful new diagnostic of magnetic field at chromospheric heights, a fundamentally important, but so far poorly known parameter.

  12. The Surprising History of Claims for Life on the Sun

    Science.gov (United States)

    Crowe, Michael J.

    2011-11-01

    Because astronomers are now convinced that it is impossible for life, especially intelligent life, to exist on the Sun and stars, it might be assumed that astronomers have always held this view. This paper shows that throughout most of the history of astronomy, some intellectuals, including a number of well-known astronomers, have advocated the existence of intelligent life on our Sun and thereby on stars. Among the more prominent figures discussed are Nicolas of Cusa, Giordano Bruno, William Whiston, Johann Bode, Roger Boscovich, William Herschel, Auguste Comte, Carl Gauss, Thomas Dick, John Herschel, and François Arago. One point in preparing this paper is to show differences between the astronomy of the past and that of the present.

  13. Surya Namaskar (Sun Salutation: A Path to Good Health

    Directory of Open Access Journals (Sweden)

    Amit Vaibhav

    2016-07-01

    Full Text Available Surya Namaskar (Sun Salutation is an ancient and sacred yogic technique of India for expressing gratitude to the Sun. Surya Namaskar is a set of 12 Asanas (postures, It is done preferably in the morning while facing the rising sun. There are numerous health benefits of Surya Namaskar for different system of the body specially musculoskeletal, cardiovascular, gastrointestinal, nervous system, respiratory and endocrinal. The heart, liver, intestine, stomach, chest, throat, legs and backbone are main benefited organs. By practicing Surya Namaskar each and every cell of body get revitalize and regenerated, therefore it is highly recommended by all yoga experts for healthy routine life. The regular practice of Surya Namaskar improves blood circulation throughout the body, maintains health and makes the body disease-free. Regular practice of Surya Namaskar gives strength, flexibility and vitality to the body. Sun Salutation asanas help to burn extra body fat on belly, buttocks and back by modulating endocrinal system. It also helps to regulate menstrual cycles among women and also facilitate an easy childbirth. Apart from these benefits of Surya Namaskar also help to keep the mind stress free, calm and illuminated. Thus, a regular practice of Surya Namaskar is highly recommended to keep the body and mind healthy. Though the Surya Namaskar steps are very scientific and practical science ancient time but still it needs advance modern scientific justification to spread it globally, keeping this thing into the mind the present review has been framed to revalidate sacred steps of Surya Namaskar on the basis of available evidence based studies.

  14. Searching for Chambers and Caves in Teotihuacan's Sun Pyramid

    Science.gov (United States)

    Alfaro, R.; Arrieta, E.; Barba P., L.; Becerril, A. D.; Belmont, E.; Carrillo, I.; Cabrera M., J. I.; Esquivel, O.; Grabski, V.; López R., J. M.; Manzanilla N., L.; Martínez D., A.; Menchaca R., A.; Moreno, M.; Núñez C., R.; Plascencia, J. C.; Rangel, M.; Villoro, M.

    2003-06-01

    In this work a status report of a search for caves in the Sun pyramid in Teotihuacan, México is presented. From an archeological perspective the main goal is to gather evidence to determine whether the pyramid was a state or a funerary temple. The general layout of the detector that is being built is an updated version of the one originally proposed by Alvarez et al..

  15. Chemistry, sun, energy and environment; Chimie, soleil, energie et environnement

    Energy Technology Data Exchange (ETDEWEB)

    Bouchy, M. [Ecole Nationale Superieure des Industries Chimiques (ENSIC), 54 - Villers-les-Nancy (France); Enea, O. [Poitiers Univ., 86 (France); Flamant, G. [IMP-Odeillo-CNRS (France)] (and others)

    2000-07-01

    This document provides the 35 papers presented at the 'Chemistry, Sun, Energy and Environment' meeting, held February 3-4, 2000 in Saint-Avold, France. The main studied topic was the use of solar radiation for water treatment, volatile organic compounds decomposition and in some thermochemical processes. These research subjects are tackled in a fundamental and practical point of view. (O.M.)

  16. Solar Energy Education. Reader, Part IV. Sun schooling

    Energy Technology Data Exchange (ETDEWEB)

    1981-05-01

    A collection of magazine articles which focus on solar energy is presented. This is the final book of the four part series of the Solar Energy Reader. The articles include brief discussions on energy topics such as the sun, ocean energy, methane gas from cow manure, and solar homes. Instructions for constructing a sundial and a solar stove are also included. A glossary of energy related terms is provided. (BCS)

  17. Liquid Metallic Hydrogen: A Building Block for the Liquid Sun

    OpenAIRE

    Robitaille P.-M.

    2011-01-01

    Liquid metallic hydrogen provides a compelling material for constructing a condensed matter model of the Sun and the photosphere. Like diamond, metallic hydrogen might have the potential to be a metastable substance requiring high pressures for forma- tion. Once created, it would remain stable even at lower pressures. The metallic form of hydrogen was initially conceived in 1935 by Eugene Wigner and Hillard B. Huntington who indirectly anticipated its elevated critical temper...

  18. HARPS-N OBSERVES THE SUN AS A STAR

    Energy Technology Data Exchange (ETDEWEB)

    Dumusque, Xavier; Glenday, Alex; Phillips, David F.; Charbonneau, David; Latham, David W.; Li, Chih-Hao; Sasselov, Dimitar; Szentgyorgyi, Andrew; Walsworth, Ronald [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Buchschacher, Nicolas; Lovis, Christophe; Pepe, Francesco; Udry, Stéphane [Observatoire Astronomique de l’Université de Genève, 51 Chemin des Maillettes, 1290 Sauverny (Switzerland); Cameron, Andrew Collier [SUPA, School of Physics and Astronomy, University of St. Andrews, North Haugh, St. Andrews, Fife, KY16 9SS (United Kingdom); Cecconi, Massimo; Cosentino, Rosario; Ghedina, Adriano; Lodi, Marcello; Molinari, Emilio, E-mail: xdumusque@cfa.harvard.edu [INAF—Fundación Galileo Galilei, Rambla José Ana Fernández Pérez 7, E-38712 Breña Baja (Spain)

    2015-12-01

    Radial velocity (RV) perturbations induced by stellar surface inhomogeneities including spots, plages and granules currently limit the detection of Earth-twins using Doppler spectroscopy. Such stellar noise is poorly understood for stars other than the Sun because their surface is unresolved. In particular, the effects of stellar surface inhomogeneities on observed stellar radial velocities are extremely difficult to characterize, and thus developing optimal correction techniques to extract true stellar radial velocities is extremely challenging. In this paper, we present preliminary results of a solar telescope built to feed full-disk sunlight into the HARPS-N spectrograph, which is in turn calibrated with an astro-comb. This setup enables long-term observation of the Sun as a star with state-of-the-art sensitivity to RV changes. Over seven days of observing in 2014, we show an average 50 cm s{sup −1} RV rms over a few hours of observation. After correcting observed radial velocities for spot and plage perturbations using full-disk photometry of the Sun, we lower by a factor of two the weekly RV rms to 60 cm s{sup −1}. The solar telescope is now entering routine operation, and will observe the Sun every clear day for several hours. We will use these radial velocities combined with data from solar satellites to improve our understanding of stellar noise and develop optimal correction methods. If successful, these new methods should enable the detection of Venus over the next two to three years, thus demonstrating the possibility of detecting Earth-twins around other solar-like stars using the RV technique.

  19. Activity Monitors Help Users Get Optimum Sun Exposure

    Science.gov (United States)

    2015-01-01

    Goddard scientist Shahid Aslam was investigating alternative methods for measuring extreme ultraviolet radiation on the Solar Dynamics Observatory when he hit upon semiconductors that measured wavelengths pertinent to human health. As a result, he and a partner established College Park, Maryland-based Sensor Sensor LLC and developed UVA+B SunFriend, a wrist monitor that lets people know when they've received their optimal amounts of sunlight for the day.

  20. SUN HUB – ENERGY HUB FOR OUTDOOR TABLES

    DEFF Research Database (Denmark)

    Poulsen, Peter Behrensdorff; Benatto, Gisele Alves dos Reis; Riedel, Nicholas

    2017-01-01

    Solar cells integrated into products are attracting more and more attention especially due to the dramatically declining cost of solar cells. Furthermore, we are getting more dependent on portable units like mobile phones, tablets and PCs which has to be charged to be of any use. Especially on fe...... Sun Hubs to monitor the overall energy system and the consumption of each functionality in the table....

  1. Sun Coke heat recovery coke technology at Indiana Harbor

    Energy Technology Data Exchange (ETDEWEB)

    Walker, D.N. [Sun Coke Company (USA). Operations

    1999-12-01

    Sun Coke heat recovery coke technology was fully established for the first time at Indiana Harbor Coke Company, East Chicago, Indiana (USA). The plant supplies continuous heat to waste heat boilers which provide steam for a 94 MW turbine generator whilst producing 1,350,00 NT per year of metallurgical coke. The paper briefly describes the development of the technology and discusses specific design aspects of the Indiana Harbor plant. 3 refs., 2 figs., 2 tabs.

  2. How did the Sun affect the climate when life evolved on the Earth?

    DEFF Research Database (Denmark)

    Karoff, Christoffer; Svensmark, Henrik

    2010-01-01

    Using kappa Ceti as a proxy for the young Sun we show that not only was the young Sun much more effective in protecting the Earth environment from galactic cosmic rays than the present day Sun; it also had flare and corona mass ejection rates up to three orders of magnitude larger than the presen...... the larger corona mass ejection rates of the young Sun would have had an effect on the climate with a magnitude similar to the enhanced shielding capability of the young Sun.......Using kappa Ceti as a proxy for the young Sun we show that not only was the young Sun much more effective in protecting the Earth environment from galactic cosmic rays than the present day Sun; it also had flare and corona mass ejection rates up to three orders of magnitude larger than the present...... day Sun. The reduction in the galactic cosmic ray influx caused by the young Sun's enhanced shielding capability has been suggested as a solution to what is known as the faint young Sun paradox, i.e. the fact that the luminosity of the young Sun was only around 75% of its present value when life...

  3. Sun Tzu and the Art of Business Six Strategic Principles for Managers

    CERN Document Server

    McNeilly, Mark R

    2011-01-01

    More than two millennia ago the famous Chinese general Sun Tzu wrote the classic work on military strategy, The Art of War. Now, in a new edition of Sun Tzu and the Art of Business, Mark McNeilly shows how Sun Tzu's strategic principles can be applied to

  4. Image Centroid Algorithms for Sun Sensors with Super Wide Field of View

    Directory of Open Access Journals (Sweden)

    ZHAN Yinhu

    2015-10-01

    Full Text Available Sun image centroid algorithm is one of the key technologies of celestial navigation using sun sensors, which directly determine the precision of the sensors. Due to the limitation of centroid algorithm for non-circular sun image of the sun sensor of large field of view, firstly, the ellipse fitting algorithm is proposed for solving elliptical or sub-elliptical sun images. Then the spherical circle fitting algorithm is put forward. Based on the projection model and distortion model of the camera, the spherical circle fitting algorithm is used to obtain the edge points of the sun in the object space, and then the centroid of the sun can be determined by fitting the edge points as a spherical circle. In order to estimate the precision of spherical circle fitting algorithm, the centroid of the sun should be projected back to the image space. Theoretically, the spherical circle fitting algorithm is no longer need to take into account the shape of the sun image, the algorithm is more precise. The results of practical sun images demonstrate that the ellipse fitting algorithm is more suitable for the sun image with 70°~80.3° half angle of view, and the mean precision is about 0.075 pixels; the spherical circle fitting algorithm is more suitable for the sun image with a half angle of view larger than 80.3°, and the mean precision is about 0.082 pixels.

  5. Effects of 12-hour wetting of sun-dried cassava tuber meal on its ...

    African Journals Online (AJOL)

    The efficacy of wetting sun-dried cassava tuber meal as a method of reducing its hydrocyanide (HCN) content and improving its nutritive value for broilers was investigated. Cassava tubers were peeled, chopped into pieces, sun-dried and then milled. Part of the sun-dried cassava tuber meal was soaked in water at the rate ...

  6. Does the sun play a role in the aetiology of malignant melanoma ...

    African Journals Online (AJOL)

    The role of the sun in the aetiology of malignant melanoma is controversial. In 1992 Schuster1 wrote provocatively, 'Despite the lack of evidence of a causal link between sun exposure and melanoma, fear has been used shamelessly to frighten people out of the sun and into pigmented lesion clinics.' He claimed that the ...

  7. 76 FR 20992 - Sun Chemical Corp.; Filing of Color Additive Petition

    Science.gov (United States)

    2011-04-14

    ... HUMAN SERVICES Food and Drug Administration Sun Chemical Corp.; Filing of Color Additive Petition AGENCY... announcing that Sun Chemical Corp. has filed a petition proposing that the color additive regulations for D&C... been filed by Sun Chemical Corp., 5020 Spring Grove Ave., Cincinnati, OH 45232. The petition proposes...

  8. Formulation of a topical sun protection cream for people with albinism

    African Journals Online (AJOL)

    The aim of this investigation was to design and develop a sun protection product for people with albinism that is affordable, applicable to their specific skin condition, and provide them with the maximum sun protection possible. To achieve the required Sun Protection Factor value of > 20, simple creams were combined with ...

  9. Sun Tzu’s Art of War for Telecom : Telecom vs OTT from a Daoistic Perspective

    NARCIS (Netherlands)

    Stokking, H.M.; Strijkers, R.J.

    2012-01-01

    Sun Tzu's Art of War is a work of Chinese philosophy. It can be seen as a manual for warfare, but at the same time it is so much more. Sun Tzu's Art of War describes how the ultimate victory is one won without fighting. Any sector, including the telecommunications sector, may learn from Sun Tzu's

  10. Sun-glint false alarm mitigation in a maritime scenario

    Science.gov (United States)

    Rossi, Alessandro; Riccobono, Aldo; Landini, Stefano

    2014-10-01

    Airborne hyperspectral imaging can be exploited to detect anomalous objects in the maritime scenario. Due to the objects high contrast with respect to the sea surface, detection can be easily accomplished by means of local anomaly detectors, such as the well-known Reed-Xiaoli (RX) algorithm. During the development of a real-time system for the detection of anomalous pixels, it has been noticed that the performance of detection is deeply affected by the presence of sun-glint. The reflection on the sea surface of the solar radiation produces a high density of alarms, that makes challenging the task of detecting the objects of interest. In this paper, it is introduced a strategy aimed at discriminating the sun-glint false alarms from the effective alarms related to targets of potential interest. False alarms due to glint are mitigated performing a local spatio-spectral analysis on each alarm furnished by the anomaly detector. The technique has been tested on hyperspectral images collected during a measurement campaign carried out near Pisa, Italy. The Selex ES SIMGA hyperspectral sensor was mounted on board of an airplane to collect high spectral resolution images in both the VNIR and SWIR spectral channels. Several experiments were carried out, setting up scenarios with small man-made objects deployed on the sea surface, so as to simulate search and rescue operations. The results have highlighted the effectiveness of the proposed solution in terms of mitigation of false alarms due to sun-glints on the maritime scenario.

  11. The Faint Young Sun Paradox: A Simplified Thermodynamic Approach

    Directory of Open Access Journals (Sweden)

    F. Angulo-Brown

    2012-01-01

    Full Text Available Classical models of the Sun suggest that the energy output in the early stage of its evolution was 30 percent less than today. In this context, radiative balance alone between The Sun and the Earth was not sufficient to explain the early presence of liquid water on Earth’s surface. This difficulty is called the faint young Sun paradox. Many proposals have been published to solve this paradox. In the present work, we propose an oversimplified finite-time thermodynamic approach that describes the air convective cells in the Earth atmosphere. This model introduces two atmospheric modes of thermodynamic performance: a first mode consisting in the maximization of the power output of the convective cells (maximum power regime and a second mode that consists in maximizing a functional representing a good trade-off between power output and entropy production (the ecological regime. Within the assumptions of this oversimplified model, we present different scenarios of albedo and greenhouse effects that seem realistic to preserve liquid water on the Earth in the early stage of formation.

  12. Energy Input Flux in the Global Quiet-Sun Corona

    Energy Technology Data Exchange (ETDEWEB)

    Mac Cormack, Cecilia; Vásquez, Alberto M.; López Fuentes, Marcelo; Nuevo, Federico A. [Instituto de Astronomía y Física del Espacio (IAFE), CONICET-UBA, CC 67—Suc 28, (C1428ZAA) Ciudad Autónoma de Buenos Aires (Argentina); Landi, Enrico; Frazin, Richard A. [Department of Climate and Space Sciences and Engineering (CLaSP), University of Michigan, 2455 Hayward Street, Ann Arbor, MI 48109-2143 (United States)

    2017-07-01

    We present first results of a novel technique that provides, for the first time, constraints on the energy input flux at the coronal base ( r ∼ 1.025 R {sub ⊙}) of the quiet Sun at a global scale. By combining differential emission measure tomography of EUV images, with global models of the coronal magnetic field, we estimate the energy input flux at the coronal base that is required to maintain thermodynamically stable structures. The technique is described in detail and first applied to data provided by the Extreme Ultraviolet Imager instrument, on board the Solar TErrestrial RElations Observatory mission, and the Atmospheric Imaging Assembly instrument, on board the Solar Dynamics Observatory mission, for two solar rotations with different levels of activity. Our analysis indicates that the typical energy input flux at the coronal base of magnetic loops in the quiet Sun is in the range ∼0.5–2.0 × 10{sup 5} (erg s{sup −1} cm{sup −2}), depending on the structure size and level of activity. A large fraction of this energy input, or even its totality, could be accounted for by Alfvén waves, as shown by recent independent observational estimates derived from determinations of the non-thermal broadening of spectral lines in the coronal base of quiet-Sun regions. This new tomography product will be useful for the validation of coronal heating models in magnetohydrodinamic simulations of the global corona.

  13. Poynting-Robertson-like Drag at the Sun's Surface

    Science.gov (United States)

    Cunnyngham, Ian; Emilio, Marcelo; Kuhn, Jeff; Scholl, Isabelle; Bush, Rock

    2017-02-01

    The Sun's internal rotation Ω (r ,Θ ) has previously been measured using helioseismology techniques and found to be a complex function of colatitude θ and radius r . From helioseismology and observations of apparently "rooted" solar magnetic tracers, we know that the surface rotates more slowly than much of the interior. The cause of this slow-down is not understood, but it is important for understanding stellar rotation generally and any plausible theory of the solar interior. A new analysis using 5-min solar p -mode limb oscillations as a rotation "tracer" finds an even larger velocity gradient in a thin region at the top of the photosphere. This shear occurs where the solar atmosphere radiates energy and angular momentum. We suggest that the net effect of the photospheric angular momentum loss is similar to Poynting-Robertson "photon braking" on, for example, Sun-orbiting dust. The resultant photospheric torque is readily computed and, over the Sun's lifetime, is found to be comparable to the apparent angular momentum deficit in the near-surface shear layer.

  14. Carbon Dioxide Cycling, Climate, Impacts, and the Faint Young Sun

    Science.gov (United States)

    Zahnle, K. J.; Sleep, H. H.

    1999-01-01

    Evidence for relatively mild climates on ancient Earth and Mars has been a puzzle in light of the faint early sun. The geologic evidence, although far from conclusive, would appear to indicate that the surfaces of both planets were, if anything, warmer ca. 3-4 Ga than they are now. The astrophysical argument that the sun ought to have brightened approx. 30% since it reached the main sequence is hard to refute. There results a paradox between the icehouse we expect and the greenhouse we think we see. The usual fix has been to posit massive CO2 atmospheres, although reduced gases (e.g., NH3 or CH4 ) have had their partisans. Evidence against siderite in paleosols dated 2.2-2.75 Ga sets a rough upper limit of 30 PAL (present atmospheric levels) on pCO2 at that time. This is an order of magnitude short of what is needed to defeat the fainter sun. We present here an independent argument against high pCO2 on early Earth that applies not only to the Archean but yet more forcefully to the Hadean era. Additional information is contained in the original extended abstract.

  15. Data-driven Applications for the Sun-Earth System

    Science.gov (United States)

    Kondrashov, D. A.

    2016-12-01

    Advances in observational and data mining techniques allow extracting information from the large volume of Sun-Earth observational data that can be assimilated into first principles physical models. However, equations governing Sun-Earth phenomena are typically nonlinear, complex, and high-dimensional. The high computational demand of solving the full governing equations over a large range of scales precludes the use of a variety of useful assimilative tools that rely on applied mathematical and statistical techniques for quantifying uncertainty and predictability. Effective use of such tools requires the development of computationally efficient methods to facilitate fusion of data with models. This presentation will provide an overview of various existing as well as newly developed data-driven techniques adopted from atmospheric and oceanic sciences that proved to be useful for space physics applications, such as computationally efficient implementation of Kalman Filter in radiation belts modeling, solar wind gap-filling by Singular Spectrum Analysis, and low-rank procedure for assimilation of low-altitude ionospheric magnetic perturbations into the Lyon-Fedder-Mobarry (LFM) global magnetospheric model. Reduced-order non-Markovian inverse modeling and novel data-adaptive decompositions of Sun-Earth datasets will be also demonstrated.

  16. Growing tropical forage legumes in full sun and silvopastoral systems

    Directory of Open Access Journals (Sweden)

    Saulo Alberto do Carmo Araújo

    2017-02-01

    Full Text Available Growth was evaluated three tropical forage legumes in two cropping systems: silvopastoral system (SSP and full sun. A completely randomized design was adopted in factorial three legumes (estilosanthes cv. Campo Grande (Stylozanthes macrocephala x Stylozanthes capitata, tropical kudzu (Pueraria phaseoloides (Roxb. Benth and macrotiloma (Macrotyloma axillare cv. Java x two farming systems, with 4 repetitions. A eucalyptus SSP already deployed, with spatial arrangement of 12 x 2 m between trees was used. Legumes were planted in January 2014 a uniform cut being made in May 2014. The court assessment was carried out 125 days after the uniformity cut. There was difference for mass production of dry legumes (PMMSL between cultivation systems, evidencing increased productivity in the farming full sun. The macrotiloma showed higher PMSL (5.29 kg DM ha-1 cut-1, while the kudzu obtained the lowest yield (3.42 kg DM ha-1 cut-1 in the sun growing full. The cultivation of legumes in SSP increased the levels of mineral matter, crude protein and neutral detergent fiber. The shade provided by the SSP caused a reduction in the mass of dry matter production, but also altered the chemical composition of the studied legumes.

  17. Sun protection policies and practices in New Zealand primary schools.

    Science.gov (United States)

    Reeder, Anthony I; Jopson, Janet A; Gray, Andrew

    2012-02-10

    For schools with primary age students, to report the percentages meeting specific requirements of the New Zealand SunSmart Schools Accreditation Programme (SSAP). Schools were randomly selected, within geographic regions, from the Ministry of Education schools database. A questionnaire, mailed to school principals, assessed schools regarding 12 criteria for accreditation: policy, information, hats, 'play in the shade', sunscreen, clothing, role modelling, curriculum, planning, rescheduling, shade provision and review. Post-stratification weights (for achieving each criterion) were used to compensate for oversampling within some regions and differential response rates between regions, using the number of schools per region. 388 schools (representative in socioeconomic decile, size and type) participated. Less than 4% fully met accreditation criteria. Clothing (42%), curriculum delivery and shade (each 54%) requirements were met by the fewest schools. Staff role modelling (92%) was the most commonly met. Schools with uniforms tended to have more protective clothing expectations. Ongoing promotion is needed to consolidate gains and encourage comprehensive sun protection through policies, practices, environment and curriculum. Staff role modelling requirements may be strengthened by implementing existing occupational guidelines for mitigating UVR hazards. There is a need to further assist schools, particularly regarding sun protective clothing, curriculum delivery and environmental shade.

  18. The effects of sun-tracking on rooftop photovoltaic systems

    Science.gov (United States)

    Wang, D.

    2017-11-01

    Sun-tracking is an important mechanism to boost the electricity generation from photovoltaic systems by adjusting the orientation of the systems to receive more solar radiation. However, compared to the fixed-array systems, the use of the single-axis and dual-axis sun-tracking systems is usually impeded by increased cost, decreased reliability, and cumbersome maintenance. In this paper, we compare the performance of fixed-array, single-axis, and dual-axis rooftop photovoltaic systems in California using the data envelopment analysis method. For each system, an efficiency score is computed based on capacity, electricity generation, system cost, module use, solar irradiance and ambient temperature. We find the single-axis systems perform significantly better than the fixed-array and dual-axis systems. The fixed-array systems are more efficient than the dual-axis systems but the difference is not significant. The results imply the policymakers and solar installers should promote the single-axis sun-tracking and be cautious of using the dual-axis systems.

  19. Experience with on-demand physics simulations on the Sun Microsystems computing facility (SunGrid) at network.com

    Energy Technology Data Exchange (ETDEWEB)

    Lauret, J; Potekhin, M; Carcassi, G; Shamash, A; Valia, R [Brookhaven National Laboratory, Upton, NY11973 (United States); Sun Microsystems, Inc. 4150 Network Circle, Santa Clara, CA95054 (United States)], E-mail: jeromel@bnl.gov

    2008-07-15

    The simulation program of the STAR experiment at the Relativistic Heavy Ion Collider (Brookhaven National Laboratory) is growing in scope and its responsiveness to the needs of the research community. In addition, there is a significant ongoing R and D activity focused on future upgrades of the STAR detector, which also requires extensive simulations support. In addition to the local computing facility, the Open Science Grid (OSG) resources have been successfully used in STAR. However, the explosive growth of both computational needs and the available computing power, combined with distributed nature of the latter, dictate that all available options are considered - from open source to commercial grids. The computing facility of Sun Microsystems (the SunGrid) aims to deliver enterprise computing power and resources over the Internet, enabling developers, researchers, scientists and businesses to optimize performance and speed time to results without investment in IT infrastructure.

  20. The High Energy Replicated Optics to Explore the Sun (HEROES)

    Science.gov (United States)

    Christe, S.; Shih, A. Y.; Rodriguez, M.; Cramer, A.; Garcia, I.; Gaskin, J.; Chavis, K.; Smith, L.

    2012-12-01

    Set to fly in the Fall of 2013 from Ft. Sumner, NM, the High Energy Replicated Optics to Explore the Sun (HEROES) mission is a collaboration between NASA Marshall Space Flight Center and Goddard Space Flight Center to upgrade an existing payload to make unique scientific measurements of the Sun (during the day) and astrophysical targets (at night) during a single flight. HEROES will use grazing-incidence x-ray focusing optics combined with position-sensitive detectors to make new high energy (>20 keV) observations of the Sun in order to understand particle acceleration in solar flares. The HEROES science payload consists of 8 mirror modules, housing 110 grazing incidence replicated optics, mounted on a carbon-fiber-Aluminum optical bench 6 m from a matching array of focal-plane detectors (high pressure xenon gas scintillation proportional counters). The solar science objectives for HEROES are to (1) investigate electron acceleration in the non-flaring solar corona by searching for the hard X-ray signature of energetic electrons and to (2) investigate the acceleration and transport of energetic electrons in solar flares. HEROES will image the Sun with an angular resolution of 20 arcsec (FWHM) and will have a sensitivity up to ~100 times better than RHESSI at 20 keV. During 6 hours of solar observations (a minimum requirement for a typical balloon flight), HEROES has a ~75% chance of observing at least one flare with a GOES class above C1, and a ~20% chance of at least one flare above M1. HEROES is expected to observe the faint HXR emission from electrons streaming down the legs of magnetic loops or escaping along open magnetic field lines. Information from this flight will be used to design of a new balloon payload (SuperHERO) capable of capable of observing the Sun for 2-4 weeks using a Long Duration Balloon. This mission is funded by the NASA HOPE (Hands On Project Experience) Training Opportunity awarded by the NASA Academy of Program/Project and Engineering

  1. Sun Grant Initiative Regional Biomass Feedstock Partnership Competitive Grants Program

    Energy Technology Data Exchange (ETDEWEB)

    Owens, Vance [South Dakota State Univ., Brookings, SD (United States). North Central Regional Sun Grant Center

    2016-12-30

    The Sun Grant Initiative partnered with the US Department of Energy (DOE) in 2008 to create the Regional Biomass Feedstock Partnership Competitive Grants Program. The overall goal of this project was to utilize congressionally directed funds to leverage the North Central Regional Sun Grant’s Competitive Grant program at South Dakota State University (SDSU) to address key issues and research gaps related to development of the bioeconomy. Specific objectives of this program were to: 1. Identify research projects through a Regional Competitive Grants program that were relevant to the sustainable production, harvest, transport, delivery, and processing/conversion of cost-competitive, domestically grown biomass. 2. Build local expertise and capacity at the North Central Regional Sun Grant Center at SDSU through an internal selection of key bioenergy research projects. To achieve these, three nationwide Request for Applications (RFA) were developed: one each in 2008, 2009, and 2010. Internal, capacity building projects at SDSU were also selected during each one of these RFAs. In 2013 and 2015, two additional Proof of Concept RFAs were developed for internal SDSU projects. Priority areas for each RFA were 1) Biomass feedstock logistics including biomass harvesting, handling, transportation, storage, and densification; 2) Sustainable biomass feedstock production systems including biomass crop development, production, and life-cycle analysis; 3) Biomass production systems that optimize biomass feedstock yield and economic return across a diverse landscape while minimizing negative effects on the environment and food/feed production; and 4) Promotion of knowledge-based economic development in science and technology and to advance commercialization of inventions that meet the mission of the Sun Grant Initiative. A total of 33 projects were selected for funding through this program. Final reports for each of these diverse projects are included in this summary report

  2. Quest for the lost siblings of the Sun

    Science.gov (United States)

    Liu, C.; Ruchti, G.; Feltzing, S.; Martínez-Barbosa, C. A.; Bensby, T.; Brown, A. G. A.; Portegies Zwart, S. F.

    2015-03-01

    Aims: The aim of this paper is to find lost siblings of the Sun by analyzing high resolution spectra. Finding solar siblings will enable us to constrain the parameters of the parental cluster and the birth place of the Sun in the Galaxy. Methods: The solar siblings can be identified by accurate measurements of metallicity, stellar age and elemental abundances for solar neighbourhood stars. The solar siblings candidates were kinematically selected based on their proper motions, parallaxes and colours. Stellar parameters were determined through a purely spectroscopic approach and partly physical method, respectively. Comparing synthetic with observed spectra, elemental abundances were computed based on the stellar parameters obtained using a partly physical method. A chemical tagging technique was used to identify the solar siblings. Results: We present stellar parameters, stellar ages, and detailed elemental abundances for Na, Mg, Al, Si, Ca, Ti, Cr, Fe, and Ni for 32 solar sibling candidates. Our abundances analysis shows that four stars are chemically homogenous together with the Sun. Technique of chemical tagging gives us a high probability that they might be from the same open cluster. Only one candidate - HIP 40317 - which has solar metallicity and age could be a solar sibling. We performed simulations of the Sun's birth cluster in analytical Galactic model and found that most of the radial velocities of the solar siblings lie in the range -10 ≤ Vr ≤ 10 km s-1, which is smaller than the radial velocity of HIP 40317 (Vr = 34.2 km s-1), under different Galactic parameters and different initial conditions of the Sun's birth cluster. The sibling status for HIP 40317 is not directly supported by our dynamical analysis. Based on observations made with Nordic Optical Telescope at La Palma under programme 44-014. Based on observations made with ESO VLT Kueyen Telescope at the Paranal observatory under program me ID 085.C-0062(A), 087.D-0010(A), and 088.B-0820(A

  3. Increasing sun protection in winter outdoor recreation a theory-based health communication program.

    Science.gov (United States)

    Walkosz, Barbara J; Buller, David B; Andersen, Peter A; Scott, Michael D; Dignan, Mark B; Cutter, Gary R; Maloy, Julie A

    2008-06-01

    Unprotected and excessive exposure to ultraviolet radiation (UVR) is the primary risk factor for skin cancer. A pair-matched, group-randomized, pre-test/post-test, quasi-experimental design, with ski resorts as the unit of randomization, tested the effectiveness of Go Sun Smart, a multi-channel skin cancer prevention program. Independent samples of guests were taken at baseline (2001) and follow-up (2002); data were analyzed in 2006. A total of 6516 adult guests at 26 ski areas in the western U.S. and Canada were recruited, consented, and interviewed on chairlifts. This study was nested within an occupational intervention for ski area workers. Ski areas were pair-matched and randomized to receive Go Sun Smart, which consisted of print, electronic, visual, and interpersonal skin cancer prevention messages. Sun-protection behaviors, sunburning, recall of sun-protection messages, and the association of message exposure to sun protection. The difference in recall of all sun-protection messages, messages on signs and posters, and the Go Sun Smart logo was significant between the intervention and control resorts. Reported use of sun-protection practices was higher by guests at intervention ski areas using more (a higher dose of) Go Sun Smart materials. Intervention-group guests who recalled a sun-safety message were more likely to practice sun safety than intervention-group guests who did not recall a message and control-group guests. While the mere implementation of Go Sun Smart did not produce sun-safety improvements, Go Sun Smart appeared to be effective for guests who encountered and remembered it. Many factors can work against message exposure. Signage seemed to produce the greatest increase in exposure to sun-safety messages.

  4. Solar winds surfs waves in the Sun's atmosphere!

    Science.gov (United States)

    1999-07-01

    The fact that this electrified plasma speeds up to almost 3 million kilometres per hour as it leaves the Sun - twice as fast as originally predicted - has been known for years. The interpretation of how it happens is the real and surprising novelty: "The waves in the Sun's atmosphere are produced by vibrating solar magnetic field lines, which give solar wind particles a push just like an ocean wave gives a surfer a ride" said Dr John Kohl, principal investigator for the Ultraviolet Coronal Spectrometer (UVCS) - the instrument among the 12 aboard SOHO which gathered the data - and for the Spartan 201 mission. The outermost solar atmosphere, or corona, is only seen from Earth during a total eclipse of the Sun, when it appears as a shimmering, white veil surrounding the black lunar disc. The corona is an extremely tenuous, electrically charged gas, known as plasma, that flows throughout the solar system as the solar wind. The waves are formed by rapidly vibrating magnetic fields in the coronal plasma. They are called magneto - hydro - dynamic (MHD) waves and are believed to accelerate the solar wind. The solar wind is made up of electrons and ions, electrically charged atoms that have lost electrons. The electric charge of the solar wind particles forces them to travel along invisible lines of magnetic force in the corona. The particles spiral around the magnetic field lines as they rush into space. "The magnetic field acts like a violin string: when it's touched, it vibrates. When the Sun's magnetic field vibrates with a frequency equal to that of the particle spiraling around the magnetic field, it heats it up, producing a force that accelerates the particle upward and away from the Sun," says Dr. Ester Antonucci, an astronomer at the observatory of Turin, Italy, and co-investigator for SOHO's UVCS an instrument developed with considerable financial support by the Italian Space Agency, ASI. In a way this is similar to what happens if two people hold a string at

  5. Expanding occupational sun safety to an outdoor recreation industry: a translational study of the Go Sun Smart program.

    Science.gov (United States)

    Andersen, Peter A; Buller, David B; Walkosz, Barbara J; Scott, Michael D; Kane, Ilima L; Cutter, Gary R; Dignan, Mark B; Liu, Xia

    2012-03-01

    A successful occupational sun-protection program was translated to 67 ski areas where the effectiveness of two dissemination strategies was assessed. An industry professional association distributed materials to the resorts. Half of the resorts received the basic dissemination strategy (BDS) in which the materials were simply distributed to the resorts. In a randomized trial, the BDS was compared with an enhanced dissemination strategy (EDS) that added interpersonal contact with managers. Employees (n=2,228) at worksites that received the EDS had elevated program exposure (74.0% at EDS vs. 57.5% at BDS recalled a message). Exposure increased at two levels of program use: from less than four (55% exposed) to four to eight (68%) and to nine or more (82%) program items in use. More employees exposed to messages engaged in sun-safety behaviors than those unexposed. At worksites using nine or more items (versus 4-8 or <4), employees engaged in additional sun-safety behaviors. Program effects were strongly mediated by increased self-efficacy. Partnerships with industry associations facilitate dissemination of evidence-based programs. Dissemination methods are needed to maximize implementation and exposure to reduce health risk behaviors.

  6. Numerical Study of Solar Storms from the Sun to Earth

    Science.gov (United States)

    Feng, Xueshang; Jiang, Chaowei; Zhou, Yufen

    2017-04-01

    As solar storms are sweeping the Earth, adverse changes occur in geospace environment. How human can mitigate and avoid destructive damages caused by solar storms becomes an important frontier issue that we must face in the high-tech times. It is of both scientific significance to understand the dynamic process during solar storm's propagation in interplanetary space and realistic value to conduct physics-based numerical researches on the three-dimensional process of solar storms in interplanetary space with the aid of powerful computing capacity to predict the arrival times, intensities, and probable geoeffectiveness of solar storms at the Earth. So far, numerical studies based on magnetohydrodynamics (MHD) have gone through the transition from the initial qualitative principle researches to systematic quantitative studies on concrete events and numerical predictions. Numerical modeling community has a common goal to develop an end-to-end physics-based modeling system for forecasting the Sun-Earth relationship. It is hoped that the transition of these models to operational use depends on the availability of computational resources at reasonable cost and that the models' prediction capabilities may be improved by incorporating the observational findings and constraints into physics-based models, combining the observations, empirical models and MHD simulations in organic ways. In this talk, we briefly focus on our recent progress in using solar observations to produce realistic magnetic configurations of CMEs as they leave the Sun, and coupling data-driven simulations of CMEs to heliospheric simulations that then propagate the CME configuration to 1AU, and outlook the important numerical issues and their possible solutions in numerical space weather modeling from the Sun to Earth for future research.

  7. Liquid Metallic Hydrogen: A Building Block for the Liquid Sun

    Directory of Open Access Journals (Sweden)

    Robitaille P.-M.

    2011-07-01

    Full Text Available Liquid metallic hydrogen provides a compelling material for constructing a condensed matter model of the Sun and the photosphere. Like diamond, metallic hydrogen might have the potential to be a metastable substance requiring high pressures for forma- tion. Once created, it would remain stable even at lower pressures. The metallic form of hydrogen was initially conceived in 1935 by Eugene Wigner and Hillard B. Huntington who indirectly anticipated its elevated critical temperature for liquefaction (Wigner E. and Huntington H.B. On the possibility of a metallic modification of hydro- gen. J. Chem. Phys. , 1935, v.3, 764–770. At that time, solid metallic hydrogen was hypothesized to exist as a body centered cubic, although a more energetically accessible layered graphite-like lattice was also envisioned. Relative to solar emission, this struc- tural resemblance between graphite and layered metallic hydrogen should not be easily dismissed. In the laboratory, metallic hydrogen remains an elusive material. However, given the extensive observational evidence for a condensed Sun composed primarily of hydrogen, it is appropriate to consider metallic hydrogen as a solar building block. It is anticipated that solar liquid metallic hydrogen should possess at least some layered order. Since layered liquid metallic hydrogen would be essentially incompressible, its invocation as a solar constituent brings into question much of current stellar physics. The central proof of a liquid state remains the thermal spectrum of the Sun itself. Its proper understanding brings together all the great forces which shaped modern physics. Although other proofs exist for a liquid photosphere, our focus remains solidly on the generation of this light.

  8. ARCO and Sun agree to settle Iranian claims

    Energy Technology Data Exchange (ETDEWEB)

    1992-08-24

    This paper reports that ARCO and Sun Co. Inc. have agreed to separate settlements totaling almost $261 million that resolve their claims over oil field assets expropriated by Iran in 1978--80. The agreements are subject to approval by the Iran-U.S. claims tribunal at The Hague. The tribunal was set up in 1981 to resolve foreign claims to assets nationalized by the government of Ayatollah Khomeini following the fall of the Shah of Iran as a result of the 1978-79 Iranian revolution. The settlements are seen as the latest steps Iran has taken to normalize relations with the U.S., notably through petroleum related deals.

  9. Error Modeling and Calibration for Encoded Sun Sensors

    Directory of Open Access Journals (Sweden)

    Xiaoyang Li

    2013-03-01

    Full Text Available Error factors in the encoded sun sensor (ESS are analyzed and simulated. Based on the analysis results, an ESS error compensation model containing structural errors and fine-code algorithm errors is established, and the corresponding calibration method for model parameters is proposed. As external parameters, installation deviation between ESS and calibration equipment are introduced to the ESS calibration model, so that the model parameters can be calibrated accurately. The experimental results show that within plus/minus 60 degree of incident angle, the ESS measurement accuracy after compensation is three times higher on average than that before compensation.

  10. Sky type discrimination using a ground-based sun photometer

    Science.gov (United States)

    DeFelice, Thomas P.; Wylie, Bruce K.

    2001-01-01

    A 2-year feasibility study was conducted at the USGS EROS Data Center, South Dakota (43.733°N, 96.6167°W) to assess whether a four-band, ground-based, sun photometer could be used to discriminate sky types. The results indicate that unique spectral signatures do exist between sunny skies (including clear and hazy skies) and cirrus, and cirrostratus, altocumulus or fair-weather cumulus, and thin stratocumulus or altostratus, and fog/fractostratus skies. There were insufficient data points to represent other cloud types at a statistically significant level.

  11. Testing of the Burns-Milwaukee`s Sun Oven

    Energy Technology Data Exchange (ETDEWEB)

    Moss, T.A.

    1997-03-01

    A Burns-Milwaukee Sun Oven was tested at Sandia`s Solar Thermal Test Facility. It was instrumented with five type K thermocouples to determine warm-up rates when empty and when a pot containing two liters of water was placed inside. It reached inside air temperatures above 160{degrees}C (320{degrees}F). It heated two liters of water from room temperatures to 80{degrees}C, (175{degrees}F), in 75 minutes. Observations were also made on the cooling and reheating rates during a cloud passage. The adverse effects of wind on operation of the solar oven was also noted.

  12. Feynman's lost lecture the motion of planet's around the sun

    CERN Document Server

    Goodstein, David L

    1997-01-01

    On 14 March 1964 Richard Feynman, one of the greatest scientific thinkers of the 20th Century, delivered a lecture entitled 'The Motion of the Planets Around the Sun'. For thirty years this remarkable lecture was believed to be lost. But now Feynman's work has been reconstructed and explained in meticulous, accessible detail, together with a history of ideas of the planets' motions. The result is a vital and absorbing account of one of the fundamental puzzles of science, and an invaluable insight into Feynman's charismatic brilliance.

  13. [Preliminary study on Professor SUN Liu-he's academic thought].

    Science.gov (United States)

    Sun, Guo-Sheng; Zhang, Jing-Feng

    2005-07-01

    Professor SUN Liu-he has been engaged in scientific research, clinical and teaching works for tens years and he is a meticulous scholar with great learning, rich clinical experience and great theoretical attainments. In clinical practice of many years, he summarizes and develops Kangai Plaster, Kangai Fushui Plaster, Ai tong Ling Plaster, and so on for acupoint sticking to treat tumors, and establishes Nu-needle hot-reinforcing method and Ti-Yun reducing method, enriching contents of needling methods, and he is good at application of specific points, established points and channel acupoints to treat refractory diseases with good results.

  14. The dark matter density at the Sun's location

    OpenAIRE

    Salucci, P.; Nesti, F.; Gentile, G.; Frigerio Martins, C.

    2010-01-01

    Aims. We derive the value of the dark matter density at the Sun's location (rho(circle dot)) without fully modeling the mass distribution in the Galaxy. Methods. The proposed method relies on the local equation of centrifugal equilibrium and is independent of i) the shape of the dark matter density profile, ii) knowledge of the rotation curve from the galaxy center out to the virial radius, and iii) the uncertainties and the non-uniqueness of the bulge/disk/dark halo mass decomposition. ...

  15. Blanching, salting and sun drying of different pumpkin fruit slices

    OpenAIRE

    Workneh, T. S.; Zinash, A.; Woldetsadik, K.

    2012-01-01

    The study was aimed at assessing the quality of pumpkin (Cucuribita Spp.) slices that were subjected to pre-drying treatments and drying using two drying methods (uncontrolled sun and oven) fruit accessions. Pre-drying had significant (P ≤ 0.05) effect on the quality of dried pumpkin slices. 10 % salt solution dipped pumpkin fruit slices had good chemical quality. The two-way interaction between drying methods and pre-drying treatments had significant (P ≤ 0.05) effect on chemical qualities. ...

  16. Retraction: Mohamaden W, Wang H, Guan H, Li J. Effect of potassium oxalate on liver function and kidney tissue of dogs (beagles. Arch biol sci. 2013;65(4:1363-70. DOI: 10.2298/ABS1304363M

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: Effect of potassium oxalate on liver function and kidney tissue of dogs (beagles, published in the Archives of Biological Sciences in 2013, Vol. 65, Issue 4. The Editor-in-Chief has been informed that this paper is a duplicate of an earlier paper: Mohamaden W, Wang H, Guan H, Meng X, Li J. Effect of potassium oxalate injection on serum and kidney tissue of beagle dogs. Life Sci J. 2013;10(2:1537-42. This claim is correct and the results have already been presented in the article published earlier. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize for this error. Link to the retracted article 10.2298/ABS1304363M

  17. Retraction: "Activated K-Ras and INK4a/Arf Deficiency Promote Aggressiveness of Pancreatic Cancer by Induction of EMT Consistent With Cancer Stem Cell Phenotype" by Wang et al.

    Science.gov (United States)

    2016-10-01

    The above article, published online on November 23, 2012 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figure 4B and C to be inappropriately manipulated and re-labeled. Literature Cited Wang Z, Ali S, Banerjee S, Bao B, Li Y, Azmi AS, Korc M, Sarkar FH. 2013. Activated K-Ras and INK4a/Arf deficiency promote aggressiveness of pancreatic cancer by induction of EMT consistent with cancer stem cell phenotype. J Cell Physiol 228:556-562; doi: 10.1002/jcp.24162. © 2016 Wiley Periodicals, Inc.

  18. Retraction: "Identification of Novel Biomarkers for Pancreatic Cancer Using Integrated Transcriptomics With Functional Pathways Analysis" by Zhang, X., Tong, P., Chen, J., Pei, Z., Zhang, X., Chen, W., Xu, J. and Wang, J.

    Science.gov (United States)

    2017-11-01

    The above article from the Journal of Cellular Physiology, published online on 10 March 2016 in Wiley Online Library as Early View (http://onlinelibrary.wiley.com/enhanced/doi/10.1002/jcp.25353/), has been retracted by agreement between Gary Stein, the journal's Editor-in-Chief, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation at the University of Texas, MD Anderson Cancer Center, which confirmed that the article was submitted and approved for publication by Dr. Jin Wang without acknowledgement of NIH funding received or the consent and authorship of Dr. Ann Killary and Dr. Subrata Sen, with whom the manuscript was originally drafted. © 2016 Wiley Periodicals, Inc.

  19. Retraction: "Down-regulation of Notch-1 and Jagged-1 inhibits prostate cancer cell growth, migration and invasion, and induces apoptosis via inactivation of Akt, mTOR, and NF-κB signaling pathways" by Wang et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on January 5, 2010 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figure 5A to be inappropriately manipulated. REFERENCE Wang Z, Li Y, Banerjee S, Kong D, Ahmad A, Nogueira V, Hay N, Sarkar FH. 2010. Down-regulation of Notch-1 and Jagged-1 inhibits prostate cancer cell growth, migration and invasion, and induces apoptosis via inactivation of Akt, mTOR, and NF-κB signaling pathways. J Cell Biochem 109:726-736; doi: 10.1002/jcb.22451. © 2016 Wiley Periodicals, Inc.

  20. Retraction: "Down-regulation of Notch-1 is associated with Akt and FoxM1 in inducing cell growth inhibition and apoptosis in prostate cancer cells" by Wang et al.

    Science.gov (United States)

    2016-08-01

    The above article, published online on July 23, 2010 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor in Chief, Gary S. Stein, and Wiley Periodicals, Inc. The retraction has been agreed following an investigation from Wayne State University involving the first author and the corresponding author that found Figures 1B and 3A to be inappropriately manipulated. REFERENCE Wang Z, Li Y, Ahmad A, Banerjee S, Azmi AS, Kong D, Wojewoda C, Miele L, Sarkar FH. 2011. Down-regulation of Notch-1 is associated with Akt and FoxM1 in inducing cell growth inhibition and apoptosis in prostate cancer cells. J Cell Biochem 112:78-88; doi: 10.1002/jcb.22770. © 2016 Wiley Periodicals, Inc.

  1. Temperature and water relations for sun and shade leaves of a desert broadleaf, Hyptis emoryi

    Energy Technology Data Exchange (ETDEWEB)

    Smith, W.K.; Nobel, P.S.

    1977-02-01

    The temperature and water relations of sun versus shade leaves of Hyptis emoryi Torr. were evaluated from field measurements made in late summer. Throughout most of the day sun leaves had higher temperatures and higher resistances to water vapor diffusion, but lower transpiration rates and lower stem water potentials, than did shade leaves. Leaf absorptivity to solar irradiation was less for 1.5-cm-long sun leaves (0.44) than for 4.0-cm shade leaves (0.56). For both leaf types the stomatal resistance increased as the water vapor concentration drop from the leaf to the air increased. Energy balance equations were used together with the measured temperature dependence of photosynthesis to predict the effect of variations in leaf absorptivity, length, and resistance on net photosynthesis. The influence of leaf dimorphism on whole plants was determined by calculating daily photosynthesis and transpiration for plants with various percentages of sun and shade leaves. A hypothetical plant with all sun leaves in the sun had about twice the photosynthesis and half the transpiration ratio as did plants with sun leaves in the shade or shade leaves in the sun or shade. Plants with both sun and shade leaves had the highest predicted photosynthesis per unit ground area. The possible adaptive significance of the seasonal variation in sun and shade leaf percentages observed for individual H. emoryi bushes is discussed in terms of water economy and photosynthesis.

  2. The impact of education on adolescents' sun behavior: experiences from Serbia.

    Science.gov (United States)

    Miljković, Suzana; Baljozović, Djordje; Krajnović, Dusanka; Tasić, Ljiljana; Sbutega-Milosević, Gorica

    2014-01-01

    In Serbia, there have been no broad campaigns or educational programs focused on adolescents' sun protection. The aim of the study was to assess whether an educational program would have impact on changes of attitudes and sun-protective behaviors of high school students. More specific aim was to examine whether sex and age differences in sun behavior exists. Educational program was designed to provoke changes in attitudes towards sun protection and sun behavior. The investigation was carried out in Belgrade, Serbia in two educational cycles, during spring 2007 and 2008. Sixteen- and 17-year old high schools students were targeted and assessed before and after the educational intervention by means of self-report questionnaire designed for this study (about skin types and sun behavior). The students' attitudes towards sun protection and sun behavior before and after the educational intervention were compared and analyzed by the Pearson's chi-square test and logistic regression analyses. In the second educational cycle (2008) age and gender differences in sun behavior were analyzed. Overall 3205 students in 2007, and 2155 students in 2008 year from 11 high schools participated. A statistically significant behavior change was observed for the use of sunglasses in 2007--the number of students using them increased from 41.6% to 45.6% (p Educational program had an impact, but broader activities involving schools, local communities and media are needed for significant changes in sun behavior and attitude.

  3. Factors Associated With Occupational Sun-Protection Policies in Local Government Organizations in Colorado.

    Science.gov (United States)

    Walkosz, Barbara J; Buller, David B; Andersen, Peter A; Wallis, Allan; Buller, Mary Klein; Scott, Michael D

    2015-09-01

    Skin cancer prevention remains a national priority. Reducing chronic UV radiation exposure for outdoor workers through sun-safety practices is an important step to help reduce the incidence of skin cancer. To determine the presence of occupational sun-safety policies at local government organizations in a single state. Of 571 potentially eligible local government organizations of Colorado cities, counties, and special tax districts, we enrolled 98 in a randomized pretest-posttest controlled experiment starting August 15, 2010, that evaluated an intervention to promote the adoption of sun-safety policies. We used a policy-coding protocol to evaluate personal sun-protection practices, environmental and administrative controls, and policy directives for sun safety starting February 10, 2011. We report the baseline assessment of the occupational sun-protection policies of these organizations. The presence of an occupational sun-safety policy. Overall, 85 local government organizations (87%) had policies that required personal sun-protection practices, including the use of eyewear, hats, and protective clothing. However, of the 98 responding organizations, only 8 hat policies (8%), 10 eyewear policies (10%), and 7 clothing policies (7%) mentioned sun protection as the intent of the policy. Only cosmopoliteness, operationalized as proximity to an urban area, was associated with the presence of a sun-safety policy (odds ratio, 0.99 [95% CI, 0.98-1.00]; P = .02). Outdoor workers are at increased risk for skin cancer because of long-term exposure to solar UV radiation. Although organizational policies have the potential to increase sun protection in occupational settings, occupational sun-safety policies were uncommon among local governments. Opportunities exist for dermatologists and other physicians to influence occupational sun-safety practices and policies, which are consistent with other safety procedures and could easily be integrated into existing workplace

  4. Sun protection provided by regulation school uniforms in Australian schools: an opportunity to improve personal sun protection during childhood.

    Science.gov (United States)

    Turner, Denise; Harrison, Simone L

    2014-01-01

    Childhood sun exposure is linked to excessive pigmented mole development and melanoma risk. Clothing provides a physical barrier, protecting skin from ultraviolet radiation (UVR). Extending sleeves to elbow length and shorts to knee length has been shown to significantly reduce mole acquisition in preschoolers from tropical Queensland. We used publicly available uniform images and guidelines from primary schools in Townsville (latitude 19.25°S, n = 43 schools), Cairns (16.87°S, n = 46) and the Atherton Tablelands (17.26°S, n = 23) in tropical Australia to objectively determine the body surface proportion covered by regulation school uniforms. Uniforms of nongovernment, large (≥800 students), urban, educationally advantaged schools with comprehensive sun protection policies covered more skin than those of government schools (63.2% vs 62.0%; P schools (63.4% vs 62.3%; P = 0.009), rural (62.7% vs 61.9%; P = 0.002) and educationally disadvantaged schools (62.8% vs 62.3%; P school uniforms covered identical body surface proportions (62.4%, P = 0.084). Although wearing regulation school uniforms is mandatory at most Australian primary schools, this opportunity to improve children's sun protection is largely overlooked. Recent evidence suggests that even encouraging minor alterations to school uniforms (e.g. slightly longer sleeves/dresses/skirts/shorts) to increase skin coverage may reduce mole acquisition and melanoma risk, especially in high-risk populations. © 2014 The American Society of Photobiology.

  5. Rotovibrational states of the water molecule on the sun.

    Science.gov (United States)

    Leite, Bruno S; Bastos, Cristiano C; Pavão, Antonio C

    2016-12-01

    The infrared spectrum of water observed in sunspots is complex and dense, with bands separated by approximately 0.01 cm-1. For top asymmetrical molecules, there is no theoretical approach that allows for the calculation of rotovibrational energy with such precision. Experimentally derived rotovibracional energy levels of water at high temperatures combined with variational calculations have been used for the band assignments. These energy levels are employed to refine the analysis of a small portion of the infrared absorption spectrum. Such procedure has allowed for the identification of additional 55 bands to the 70 already identified as rotovibrational transitions of the water molecule. Our new assignments, which include pure and cross transitions, offer additional evidence of the existence of water on the sun, but above all they illustrate the complexity of the solar spectrum that involves states with higher levels of rotational excitation. Given the conditions on the sun, more molecules of water would occur in excited electronic states, which include apolar and paramagnetic states, generating intense bands in the spectrum. Since there is an analytical solution for the rotovibrational transitions of linear molecules, we were able to identify 16 bands relative to the excited electronic states 1B2 and 3A1 in the sunspot spectrum. Density functional B3LYP/AUG-cc-pVTZ calculations of the electric and magnetic dipole are employed to discuss some consequences of the presence of excited states of water in the dynamics of sunspots and solar magnetic field.

  6. Sounds of space: listening to the Sun-Earth connection

    Science.gov (United States)

    Craig, N.; Mendez, B.; Luhmann, J.; Sircar, I.

    2003-04-01

    NASA's STEREO/IMPACT Mission includes an Education and Public Outreach component that seeks to offer national programs for broad audiences highlighting the mission's solar and geo-space research. In an effort to make observations of the Sun more accessible and exciting for a general audience, we look for alternative ways to represent the data. Scientists most often represent data visually in images, graphs, and movies. However, any data can also be represented as sound audible to the human ear, a process known as sonification. We will present our plans for an exciting prototype program that converts the science results of solar energetic particle data to sound. We plan to make sounds, imagery, and data available to the public through the World Wide Web where they may create their own sonifications, as well as integrate this effort to a science museum kiosk format. The kiosk station would include information on the STEREO mission and monitors showing images of the Sun from each of STEREO's two satellites. Our goal is to incorporate 3D goggles and a headset into the kiosk, allowing visitors to see the current or archived images in 3D and hear stereo sounds resulting from sonification of the corresponding data. Ultimately, we hope to collaborate with composers and create musical works inspired by these sounds and related solar images.

  7. NURSING STUDENTSPERCEPTIONS ABOUTRELATIONSHIP BETWEEN SUN EXPOSURE AND SKIN CANCER

    Directory of Open Access Journals (Sweden)

    Andréa de Azevedo Morégula

    2016-02-01

    Full Text Available The aim of this study was to determine the behavioral profile and the level of knowledge that nursing students have about sun exposure and protective measures that prevent skin cancer and damage due to R-UV. A descriptive quantitative study was conducted from the answers of a questionnaire applied to 72 students, undergraduate nursing course of the State University of Santa Cruz. The issues considered include the perception of students about a tanned body, the use of sunscreen and use of other protective measures and knowledge about UVIndex. Most reported using sunscreen (94.3% with SPF higher than 15 (87.5%, however, do not use correctly these protectors. As for other protective measures, the most adopted by these students was sunglasses (43.1%. Regarding the perception of the appearance of a tanned body, 55.6% considered it beautiful and 26.4% considered it beautiful and healthy, about the know l edge about UV Index, 51.4% declared to know the meaning, however, there is no information about the level of know l edge. Therefore, this study reveals that the level of knowledge and the adoption of protective measures against skin cancer and other the harmful effects of the sun are still low. It shows the necessity to include this issue in courses of undergraduate nursing programs.

  8. A Note on the Constitution of the Sun

    Directory of Open Access Journals (Sweden)

    Magnus H. G.

    2011-07-01

    Full Text Available Patrice Robitaille (TAV College, Montreal, Canada provides a translation of Heinrich Gustav Magnus’ classic work Notiz ̈uber die Beschaffenheit der Sonne , as it appeared in March 1864 within Poggendorff’s Annalen der Physik und Chemie ,1864, v.131, 510– 512. The article had previously been translated into French: Notice sur la constitution du soleil. Archives des science physique et naturelles (Gen`eve , 1864, v.20, 171–175. This work formed the basis of the present translation. Heinrich Gustav Magnus (May 2, 1802 – April 4, 1870 was a professor at the University of Berlin and had studied in Paris under Joseph Louis Gay-Lussac. He would count amongst his students Wil- helm Beetz, Hermann Helmholtz, Gustav Wiedemann, John Tyndall, Rudolph Weber, and Adolph W ̈ ullner (Heinrich Gustav Magnus, Platinum Metals Review , 1976, v.20(1, 21–24. In his Notiz , Magnus demonstrated that the addition of sodium hydroxide to the gaseous flame resulted in a tremendous increase in luminosity. Magnus’ work would inspire Father Secchi to propose that the Sun was a gaseous globe whose photosphere contained condensed particulate matter (Secchi A. Sulla Struttura della Fotosfera So- lare. Bulletino Meteorologico dell’ Osservatorio del Collegio Romano , 1864, v.3(11, 1–3; English translation in Progr. Phys. , 2011, v.3, 30–32. Magnus’ report on the constitution of the Sun would continue to impact solar physics for two generations.

  9. Bird communities in sun and shade coffee farms in Kenya

    Directory of Open Access Journals (Sweden)

    C. Smith

    2015-07-01

    Full Text Available Agricultural expansion to meet rising crop demand is one of the greatest threats to terrestrial biodiversity. Coffee, one of the most valuable trade items in tropical countries, can provide both economic livelihood and wildlife habitat. Previous work, conducted primarily on Neotropical coffee farms, indicates that birds are generally more abundant and diverse in farms with a canopy of shade trees, though regional variation exists. To date, few studies have examined birds on coffee farms in Africa, which contains 20% of the world’s coffee acreage. We studied differences in the bird communities between sun and shade monoculture coffee in central Kenya, and we examined effects of vegetation on bird abundance and diversity. Sun coffee had higher species richness and abundances of all major guilds (omnivores, insectivores, and granivores, and showed low community similarity to shade. Unlike findings from the Neotropics, canopy cover appeared to have a negative influence on all guilds, while understory volume of weeds increased bird abundance and species richness with a similar magnitude as canopy cover. These differences highlight the need for further studies in the general East Africa region with a wider variety of shade coffee systems.

  10. Ocean Colour at Low Sun and High Waves

    Science.gov (United States)

    Hieronymi, Martin

    2015-12-01

    Many space-borne sensors are deployed to image the ocean in the visible portion of the spectrum. The colour of the sea, or more precisely the spectral water-leaving radiance, gives us information about the concentration of water constituents, e.g., chlorophyll, coloured dissolved organic matter, or suspended mineral matter. The bidirectional nature of the upwelling radiance just beneath the water surface and the interaction of this radiance with the air- sea interface depend on the viewing- and sun-geometry and surface waves. If we consider wave elevation and wave shadowing effects, perceptible deviations of the transmittance and reflectance of the air-water interface occur at low Sun (zenith angle of more than 60°) in comparison with wind-depending wave slope statistics. The inclusion of appropriate wind and wave data, i.e., wave heights and periods, can help to reduce uncertainties related to the Fresnel-reflecting ocean surface - in particular for large solar zenith angles. This especially regards remote sensing of ocean colour at high latitudes and atmospheric correction.

  11. The Sun as a Hot Liquid Plasma: More Evidence

    Science.gov (United States)

    Robitaille, Pierre-Marie

    2004-10-01

    The photosphere is currently considered to be a hot gaseous plasma. However, ample evidence exists that the photosphere is in fact condensed matter. The primary evidence is based on the Planckian appearance of the solar spectrum. The existence of such a spectrum directly implies the presence of a lattice (i.e. condensed matter). In fact, it is impossible for a gaseous structure to ever produce a Planckian spectrum outside the confines of Kirchhoff's perfectly absorbing enclosure. Therefore, the photosphere and interior of the Sun simply cannot be made of gaseous plasma. In addition, in this talk, the flow of material on the surface of the Sun and in the corona will be reviewed. Specifically, it will be highlighted that in the corona, matter moves primarily in a radial direction. However, within the photosphere, solar matter is displaced across the solar disk as manifested by sunspots and other solar activity. As a result, there is a clear phase transition at the photosphere which is revealed by the motion of matter itself. Other evidence supporting a photosphere comprised of condensed matter will also be discussed.

  12. Testing the Sun-climate Connection with Paleoclimate Data

    Science.gov (United States)

    Crowley, Thomas J.; Howard, Matthew K.

    1990-01-01

    If there is a significant sun-climate connection, it should be detectable in high-resolution paleoclimate records. Of particular interest is the last few thousand years, where we have both indices of solar variability (C-14 and Be-10) and climate variations (alpine glaciers, tree rings, ice cores, corals, etc.). Although there are a few exceptions, statistical analyses of solar and climate records generally indicates a flickering relationship between the two -- sometimes it seems to be present, sometimes not. The most repeatable solar climate periods occur at approx. 120 and approx. 56 yrs, although there is also evidence for approx. 420 and approx. 200 yrs. power in some records. However, coherence between solar and climate spectra is usually low, and occurrence of solar spectra in climate records is sometimes dependent on choice of analysis program. These results suggest in general a relatively weak sun-climate link on time scales of decades to centuries. This conclusion is consistent with previous studies and with the observation that inferred climate fluctuations of 1.0 to 1.5 C on this time scale would require solar constant variations of approximately 0.5 to 1.0 percent. This change in forcing is almost an order of magnitude greater than observed changes over the last solar cycle and appears to be on the far-outer limit of acceptable changes for a Maunder Minimum-type event.

  13. Aerosol sun photometry throughout five years in Japan

    Science.gov (United States)

    Sano, I.; Mukai, S.; Holben, B.

    Japan locates in an interesting region for aerosol study Most of natural and anthropogenic aerosols can be measured Some of natural aerosols are the oceanic type aerosols provided from the ocean e g West Pacific Ocean Sea of Japan and East China Sea and the other is Asian dust what one calls Yellow sand coming from Gobi and Taklamakan desert area in China It should be enhanced that most of these natural aerosols especially dust aerosols are mixed with the anthropogenic e g nitrate and sulfate aerosols during long distance transportation Two automatic sun sky radiometers have been set for the worldwide aerosol sun photometer network AERONET One is facing to Pacific Ocean Shirahama for taking continuous measurements of background aerosols of Japan and the other is set at megalopolis city Osaka This work intends to show the temporary and or spatially change of aerosol properties e g aerosol optical thickness at 0 44 0 67 and 0 87 microns size distribution and single scattering albedo For instance the regional difference between city and remote area is examined and time variation involves long time change over five years and also seasonal change

  14. Blanching, salting and sun drying of different pumpkin fruit slices.

    Science.gov (United States)

    Workneh, T S; Zinash, A; Woldetsadik, K

    2014-11-01

    The study was aimed at assessing the quality of pumpkin (Cucuribita Spp.) slices that were subjected to pre-drying treatments and drying using two drying methods (uncontrolled sun and oven) fruit accessions. Pre-drying had significant (P ≤ 0.05) effect on the quality of dried pumpkin slices. 10 % salt solution dipped pumpkin fruit slices had good chemical quality. The two-way interaction between drying methods and pre-drying treatments had significant (P ≤ 0.05) effect on chemical qualities. Pumpkin subjected to salt solution dipping treatment and oven dried had higher chemical concentrations. Among the pumpkin fruit accessions, pumpkin accession 8007 had the superior TSS, total sugar and sugar to acid ratio after drying. Among the three pre-drying treatment, salt solution dipping treatment had significant (P ≤ 0.05) effect and the most efficient pre-drying treatment to retain the quality of dried pumpkin fruits without significant chemical quality deterioration. Salt dipping treatment combined with low temperature (60 °C) oven air circulation drying is recommended to maintain quality of dried pumpkin slices. However, since direct sun drying needs extended drying time due to fluctuation in temperature, it is recommended to develop or select best successful solar dryer for use in combination with pre-drying salt dipping or blanching treatments.

  15. [Solar retinopathy acquired after gazing at the sun during prayers].

    Science.gov (United States)

    Mwanza, J C; Kayembe, D L; Kaimbo, D K; Kabasele, P M; Ngoy, D K

    2000-01-01

    The authors present the results of a study based on six persons who developed retinopathy after gazing at the sun during prayers. Risk factors were studied and the prognosis evaluated. The mean follow-up time was 82 days. Risk factors were present in all patients. The visual acuity was reduced in all patients at first presentation and total improvement was noted in four of them. Of all six patients, only one had his ocular fundus normalized. Amsler's grid testing revealed in all patients bilateral central scotomas which persisted in four of them. Fluorescein retinal angiography, which was found to be abnormal in all cases, became normal in only one case. However, all patients continued to complain of visual disability because of the persistence of photophobia, meta-morphopsia and scotomas. In conclusion, the prognosis of solar retinopathy is variable and the recovery of visual acuity does not necessarily imply the improvement of vision. Appropriate eye protection such as solar filters must be used when gazing at the sun to protect from retinal damage.

  16. Hot Young Solution to Faint Sun and Supernova Problems

    Science.gov (United States)

    Riofrio, Louise

    2008-04-01

    Results from three independent experiments involving the speed of light are presented. Luminosity of Type Ia supernovae depend upon constant fundamental parameters. Accurate measurements of c provide a valuable check on ``dark energy'' theories. One Theory states that scale R of Space/Time is related to age t by R = ct. Gravitation then requires that GM=tc^3. These expressions provide a simple solution to Einstein-Friedmann equations with k=0. Predicted change in c provides a close fit to observations of Type Ia supernova redshifts. The ``Faint Young Sun'' has been a paradox of astrophysics. According to standard models, when Earth was forming solar luminosity was only 75% of today's value. Geology and the fossil record contradict this prediction. Because the Sun turns fuel to energy according to E=mc^2, change in c precisely accounts for the difference. If c had not changed in the amounts predicted, life would not have evolved on Earth. The Lunar Laser Ranging Experiment from 1969 measures the Moon's recession at 3.82 cm/yr, anomalously high. Geological evidence states that average recession is only 2.9 cm/yr. Change in c precisely accounts for the anomaly, indicating that c changes to this day. Corroborating evidence from three truly independent experiments distinguishes Theory from other DE models. Since M = R = t (Planck Units) leads to predictions not epicycles, Theory should be considered as an alternative to more cumbersome ideas.

  17. Iris Freckles a Potential Biomarker for Chronic Sun Damage.

    Science.gov (United States)

    Schwab, Christoph; Mayer, Christoph; Zalaudek, Iris; Riedl, Regina; Richtig, Markus; Wackernagel, Werner; Hofmann-Wellenhof, Rainer; Richtig, Georg; Langmann, Gerald; Tarmann, Lisa; Wedrich, Andreas; Richtig, Erika

    2017-05-01

    To investigate the role of sunlight exposure in iris freckles formation. We prospectively examined volunteers attending a skin cancer screening program conducted by ophthalmologists and dermatologists. Frequency and topographical variability of iris freckles were noted and associated with behavioral and dermatologic characteristics indicating high sun exposure. Six hundred thirty-two participants (n = 360; 57% female) were examined. Mean age of all participants was 38.4 ± 18.4 years (range, 4-84 years). Of all individuals, 76.1% (n = 481) exhibited at least one iris freckle. Most freckles were observed in the inferior temporal quadrant. The presence of iris freckles was associated with higher age (participants with iris freckles: 41.8 ± 16.8 years versus participants without iris freckles: 27.6 ± 19.2 years), a high number of sunburns during lifetime (>10: 31% vs. 19%), sunlight-damaged skin (26% vs. 11%), presence of actinic lentigines (72% vs. 45%), and a high total nevus body count (>10; 78% vs. 67%). The association of iris freckles, behavioral factors, and dermatologic findings, as well as the topographical distribution, indicate that sunlight exposure may trigger the formation of iris freckles. The evaluation of iris freckles offers an easily accessible potential biomarker, which might be helpful in indicating sun damage on the skin associated with cutaneous malignancies. Furthermore, the evaluation of iris freckles could also be helpful in understanding the role of sunlight in several ophthalmologic diseases.

  18. Toroidal convection rolls in the sun a challenge to theory

    Science.gov (United States)

    Ribes, E.; Laclare, F.

    A large-scale circulation in the form of azimuthal (east-west oriented) rolls has been discovered in the convection zone of the Sun (Ribes et al.0, 1985; Ribes, 1986). The characteristics of the global circulation (for example orientation, number, lifetime and so forth) are quite different from those of meridional cells (oriented parallel to the solar axis) which has been predicted by theory (e.g. Glatzmaier, 1985). This raises the important question as to whether or not the newly-discovered azimuthal rolls contribute to the transport of heat from the deep interior of the Sun to its surface. Here we report new results that exhibit the convective nature of the azimuthal rolls. These are based on 22 years of observation of the roll pattern (Ribes, 1986), a 11 year sequence of solar diameter measurements (Laclare, 1987), and four years of luminosity measurements (Willson et al., 1981). The first indication is provided by the distribution of solar activity, which frames the roll pattern rather than being superimposed on it. The second hint comes from a temporal association that exists between the onset of new rolls and the luminosity and diameter oscillations with a period of 980 days.

  19. Effect of pregnancy in myopia progression: the SUN cohort.

    Science.gov (United States)

    Fernández-Montero, A; Bes-Rastrollo, M; Moreno-Montañés, J; Moreno-Galarraga, L; Martínez-González, M Á

    2017-07-01

    PurposePrevious studies have suggested that pregnancy may induce myopia progression. However, no longitudinal study with a large sample size and long-term follow-up has assessed this association. Our objective was to investigate whether pregnancy was related to mid- or long-term myopic refraction changes.Patients and methodsA prospective study was conducted in a Mediterranean cohort. The study included 10 401 women (20-50 years old) from the SUN Project. SUN project is a multipurpose, prospective, and dynamic cohort of university graduates conducted in Spain. The recruitment of participants started in 1999 and it is permanently open. All participants in this cohort had university studies. Participants were followed up for a period of up to 14 years, and pregnancy and refractive changes were assessed through baseline and biennial questionnaires. Pregnancies and myopia were repeatedly assessed in each biennial follow-up questionnaire during a total of 14 years of follow-up.ResultsPregnancy was inversely associated with the risk of myopia development or progression during each of the 2 years periods, with fully adjusted hazard ratio=0.61; (95% confidence interval=0.49-0.75) after adjusting for known potential confounders.ConclusionTo our knowledge this is the first large-longitudinal assessment in young adult women, showing that pregnancy is inversely associated with myopia development or progression. Further studies are needed to confirm these epidemiological findings.

  20. Sun-to-Earth Analysis of a Major Solar Eruption

    Science.gov (United States)

    Patsourakos, Spiros

    During the interval of 7-10 March 2012, Earth's space environment experienced a barrage of space weather phenomena. Early during 7 March 2012, the biggest proton event of 2012 took place, while on 8 March 2012, an interplanetary shock and coronal mass ejection (CME) arrived at 1 AU. This sequence trigerred the biggest geomagnetic storm of cycle 24 so far. The solar source of these activities was a pair of homologous, eruptive X-class flares associated with two ultra-fast CMEs. The two eruptions originated from NOAA active region 11429 during the early hours of 7 March 2012 and within an hour from each other. Using satellite data from a flotilla of solar, heliospheric and magnetospheric missions and monitors, we perform a synergistic Sun-to-Earth study of various observational aspects of the event sequences. We will present an attempt to formulate a cohesive scenario which couples the eruption initiation, interplanetary propagation, and geospace consequences. Our main focus is on building a framework that starting from solar and near-Sun estimates of the magnetic and dynamic content and properties of the Earth-directed CME assess in advance the subsequent geomagnetic response expected, once the associated interplanetary CME reaches 1 AU. This research has been co-financed by the European Union (European Social Fund - ESF) and Greek national funds through the Operational Program "Education and Lifelong Learning" of the National Strategic Reference Framework (NSRF) - Research Funding Program: Thales. Investing in knowledge society through the European Social Fund.

  1. Genetic Analysis of Mps3 SUN Domain Mutants in Saccharomyces cerevisiae Reveals an Interaction with the SUN-Like Protein Slp1

    Science.gov (United States)

    Friederichs, Jennifer M.; Gardner, Jennifer M.; Smoyer, Christine J.; Whetstine, Christine R.; Gogol, Madelaine; Slaughter, Brian D.; Jaspersen, Sue L.

    2012-01-01

    In virtually all eukaryotic cells, protein bridges formed by the conserved inner nuclear membrane SUN (for Sad1-UNC-84) domain-containing proteins and their outer nuclear membrane binding partners span the nuclear envelope (NE) to connect the nucleoplasm and cytoplasm. These linkages are important for chromosome movements within the nucleus during meiotic prophase and are essential for nuclear migration and centrosome attachment to the NE. In Saccharomyces cerevisiae, MPS3 encodes the sole SUN protein. Deletion of MPS3 or the conserved SUN domain is lethal in three different genetic backgrounds. Mutations in the SUN domain result in defects in duplication of the spindle pole body, the yeast centrosome-equivalent organelle. A genome-wide screen for mutants that exhibited synthetic fitness defects in combination with mps3 SUN domain mutants yielded a large number of hits in components of the spindle apparatus and the spindle checkpoint. Mutants in lipid metabolic processes and membrane organization also exacerbated the growth defects of mps3 SUN domain mutants, pointing to a role for Mps3 in nuclear membrane organization. Deletion of SLP1 or YER140W/EMP65 (for ER membrane protein of 65 kDa) aggravated growth of mps3 SUN domain mutants. Slp1 and Emp65 form an ER-membrane associated protein complex that is not required directly for spindle pole body duplication or spindle assembly. Rather, Slp1 is involved in Mps3 localization to the NE. PMID:23275891

  2. Dissemination of Go Sun Smart in Outdoor Recreation: Effect of Program Exposure on Sun Protection of Guests at High Altitude Ski Areas

    Science.gov (United States)

    WALKOSZ, BARBARA J.; BULLER, DAVID B.; ANDERSEN, PETER A.; SCOTT, MICHAEL D.; DIGNAN, MARK B.; CUTTER, GARY R.; LIU, XIA; MALOY, JULIE A.

    2014-01-01

    Go Sun Smart (GSS) is a theory-based health communication program designed to influence sun protection behaviors of employees and guests at high altitude ski areas to reduce skin cancer risk. The effects of GSS, in a Phase IV dissemination randomized posttest-only trial, upon sun protection behaviors of ski area guests are reported. Program use was assessed by on-site observation and guest message exposure and sun protection was measured in intercept surveys at ski areas. Dissemination strategy, enhanced versus basic, was not significantly related to sun safety practices. Additional analyses examined the relationship of message exposure to guests’ sun safety practices. Ski areas displaying at least 6 GSS materials in guest-only areas and 9 GSS materials throughout the area increased guests’ message exposure. Higher message exposure within the high-use ski areas was associated with improved sun protection by guests but not in the low-use ski areas. The importance of program implementation and message exposure on the success of evidence-based health communication efforts applied industry-wide are underscored. PMID:24617350

  3. Sun behaviour and personal UVR exposure among Europeans on short term holidays

    DEFF Research Database (Denmark)

    Petersen, Bibi; Triguero-Mas, Margarita; Maier, Bernhard

    2015-01-01

    Solar ultraviolet radiation (UVR) is known to be the main cause of skin cancer, the incidence of which is rising with national differences across Europe. With this observation study we aimed to determine the impact of nationality on sun behaviour and personal UVR exposure on sun and ski holidays....... 25 Danish and 20 Spanish sun-seekers were observed during a sun holiday in Spain, and 26 Danish and 27 Austrian skiers were observed during a ski holiday in Austria. The participants recorded their location and clothing in diaries. Personal time-logged UVR data were recorded as standard erythema...... doses (SEDs) by an electronic UVR dosimeter worn on the wrist. Danish sun-seekers were outdoors for significantly longer, received significant higher percentages of ambient UVR, and received greater accumulated UVR doses than Spanish sun-seekers. Danish skiers were also outdoors for significantly longer...

  4. SOHO reveals how sunspots take a stranglehold on the Sun

    Science.gov (United States)

    2001-11-01

    Bernhard Fleck, ESA's project scientist for SOHO, comments, "The origin and stability of sunspots has been one of the long-standing mysteries in solar physics. I am delighted to see that with SOHO we are beginning to crack this problem." The gas flows around and beneath a sunspot have been detected by a team of scientists in the USA, using the Michelsen Doppler Imager (MDI) on SOHO. The instrument explores the solar interior by detecting natural sound waves at a million points on the Sun's surface. "After many years of contradictory theories about sunspots, MDI on SOHO is at last telling us what really happens," comments Junwei Zhao of Stanford University, California, lead author of a report published in the Astrophysical Journal. Inflows and downflows similar to those now detected with SOHO were envisaged in 1974 by Friedrich Meyer of Germany's Max-Planck- Institut für Physik und Astrophysik, and his colleagues. A similar expectation figured in a theory of sunspots advanced in 1979 by Eugene Parker of Chicago. "Our observation seems to provide strong evidence for both predictions," Zhao says. Sunspots have fascinated scientists since Galileo's time, 400 years ago, when they shattered a belief that the Sun was divinely free of any blemish. As symptoms of intense magnetic activity, sunspots are often associated with solar flares and mass ejections that affect space weather and the Earth itself. The Sun's activity peaks roughly every 11 years, and the latest maximum in the sunspot count occurred in 2000. Even with huge advances in helioseismology, which deduces layers and flows inside the Sun by analysis of sound waves that travel through it and agitate the surface, seeing behind the scenes in sunspots was never going to be easy. The MDI team refined a method of measuring the travel time of sound waves, invented in 1993 by Thomas Duvall of NASA Goddard, called solar tomography. It is like deducing what obstacles cross-country runners have faced, just by seeing in

  5. Island of the Sun: Elite and Non-Elite Observations of the June Solstice

    Science.gov (United States)

    Dearborn, David S. P.; Bauer, Brian S.

    In Inca times (AD 1400-1532), two small islands in Lake Titicaca had temples dedicated to the sun and the moon. Colonial documents indicate that the islands were the focus of large-scale pilgrimages. Recent archaeoastronomical work suggests that rituals, attended by both elites and commoners, were held on the Island of the Sun to observe the setting sun on the June solstice.

  6. Software Displays Data on Active Regions of the Sun

    Science.gov (United States)

    Golightly, Mike; Weyland, Mark; Raben, Vern

    2011-01-01

    The Solar Active Region Display System is a computer program that generates, in near real time, a graphical display of parameters indicative of the spatial and temporal variations of activity on the Sun. These parameters include histories and distributions of solar flares, active region growth, coronal mass ejections, size, and magnetic configuration. By presenting solar-activity data in graphical form, this program accelerates, facilitates, and partly automates what had previously been a time-consuming mental process of interpretation of solar-activity data presented in tabular and textual formats. Intended for original use in predicting space weather in order to minimize the exposure of astronauts to ionizing radiation, the program might also be useful on Earth for predicting solar-wind-induced ionospheric effects, electric currents, and potentials that could affect radio-communication systems, navigation systems, pipelines, and long electric-power lines. Raw data for the display are obtained automatically from the Space Environment Center (SEC) of the National Oceanic and Atmospheric Administration (NOAA). Other data must be obtained from the NOAA SEC by verbal communication and entered manually. The Solar Active Region Display System automatically accounts for the latitude dependence of the rate of rotation of the Sun, by use of a mathematical model that is corrected with NOAA SEC active-region position data once every 24 hours. The display includes the date, time, and an image of the Sun in H light overlaid with latitude and longitude coordinate lines, dots that mark locations of active regions identified by NOAA, identifying numbers assigned by NOAA to such regions, and solar-region visual summary (SRVS) indicators associated with some of the active regions. Each SRVS indicator is a small pie chart containing five equal sectors, each of which is color-coded to provide a semiquantitative indication of the degree of hazard posed by one aspect of the activity at

  7. Canonical transformations and loop formulation of SU(N) lattice gauge theories

    Science.gov (United States)

    Mathur, Manu; Sreeraj, T. P.

    2015-12-01

    We construct canonical transformations to reformulate SU(N) Kogut-Susskind lattice gauge theory in terms of a set of fundamental loop and string flux operators along with their canonically conjugate loop and string electric fields. The canonical relations between the initial SU(N) link operators and the final SU(N) loop and string operators, consistent with SU(N) gauge transformations, are explicitly constructed over the entire lattice. We show that as a consequence of SU(N) Gauss laws all SU(N) string degrees of freedom become cyclic and decouple from the physical Hilbert space Hp. The Kogut-Susskind Hamiltonian rewritten in terms of the fundamental physical loop operators has global SU(N) invariance. There are no gauge fields. We further show that the (1 /g2 ) magnetic field terms on plaquettes create and annihilate the fundamental plaquette loop fluxes while the (g2 ) electric field terms describe all their interactions. In the weak coupling (g2→0 ) continuum limit the SU(N) loop dynamics is described by SU(N) spin Hamiltonian with nearest neighbor interactions. In the simplest SU(2) case, where the canonical transformations map the SU(2) loop Hilbert space into the Hilbert spaces of hydrogen atoms, we analyze the special role of the hydrogen atom dynamical symmetry group S O (4 ,2 ) in the loop dynamics and the spectrum. A simple tensor network ansatz in the SU(2) gauge invariant hydrogen atom loop basis is discussed.

  8. Radial migration of the Sun in the Milky Way: a statistical study

    Science.gov (United States)

    Martínez-Barbosa, C. A.; Brown, A. G. A.; Portegies Zwart, S.

    2015-01-01

    The determination of the birth radius of the Sun is important to understand the evolution and consequent disruption of the Sun's birth cluster in the Galaxy. Motivated by this fact, we study the motion of the Sun in the Milky Way during the last 4.6 Gyr in order to find its birth radius. We carried out orbit integrations backward in time using an analytical model of the Galaxy which includes the contribution of spiral arms and a central bar. We took into account the uncertainty in the parameters of the Milky Way potential as well as the uncertainty in the present-day position and velocity of the Sun. We find that in general, the Sun has not migrated from its birth place to its current position in the Galaxy (R⊙). However, significant radial migration of the Sun is possible (1) when the 2: 1 outer Lindblad resonance of the bar is separated from the corotation resonance of spiral arms by a distance ˜1 kpc, and (2) when these two resonances are at the same Galactocentric position and further than the solar radius. In both cases, the migration of the Sun is from outer regions of the Galactic disc to R⊙, placing the Sun's birth radius at around 11 kpc. We find that in general, it is unlikely that the Sun has migrated significantly from the inner regions of the Galactic disc to R⊙.

  9. Investigation of Digital Sun Sensor Technology with an N-Shaped Slit Mask

    Directory of Open Access Journals (Sweden)

    Zheng You

    2011-10-01

    Full Text Available Nowadays sun sensors are being more widely used in satellites to determine the sunray orientation, thus development of a new version of sun sensor with lighter mass, lower power consumption and smaller size it of considerable interest. This paper introduces such a novel digital sun sensor, which is composed of a micro-electro-mechanical system (MEMS mask with an N-shaped slit as well as a single linear array charge-coupled device (CCD. The sun sensor can achieve the measurement of two-axis sunray angles according to the three sun spot images on the CCD formed by sun light illumination through the mask. Given the CCD glass layer, an iterative algorithm is established to correct the refraction error. Thus, system resolution, update rate and other characteristics are improved based on the model simulation and system design. The test of sun sensor prototype is carried out on a three-axis rotating platform with a sun simulator. The test results show that the field of view (FOV is ±60° × ±60° and the accuracy is 0.08 degrees of arc (3σ in the whole FOV. Since the power consumption of the prototype is only 300 mW and the update rate is 14 Hz, the novel digital sun sensor can be applied broadly in micro/nano-satellites, even pico-satellites.

  10. Environmental variables associated with vacationers' sun protection at warm weather resorts in North America.

    Science.gov (United States)

    Andersen, Peter A; Buller, David B; Walkosz, Barbara J; Scott, Michael D; Beck, Larry; Liu, Xia; Abbott, Allison; Eye, Rachel

    2016-04-01

    Vacationing at sunny, warm weather locations is a risk factor for excessive solar ultraviolet (UV) radiation exposure and skin cancer. This study examined the association of environmental variables related to UV levels with vacationers' sun protection. Vacationers at 41 summer resorts in 17 states and 1 Canadian Province were interviewed (n=3531) and observed (N=4347) during 2012 and 2013. Clothing coverage, sunglasses, and shade use were observed. Use of sunscreen and sunburns were self-reported. Environmental information was recorded by research staff or acquired from ground stations and the weather service. Temperature was positively associated with sun protection behaviors; however clothing coverage was negatively associated with temperature. Cloud cover was negatively associated with sun protection, with the exception of clothing coverage which was positively associated with it. Elevation showed a mixed pattern of associations with vacationer's sun protection. Latitude of a resort was negatively associated with most sun protection behaviors, such that sun protection increased at more southerly resorts. Similarly, the farther south a vacationer traveled to the resort, the less sun protection they employed. The UV index showed a weak, positive relationship with some sun protection behaviors even when controlling for temperature. Vacationers appeared aware that UV is higher at southern latitudes and may learn UV is intense when living in southern regions. However, many used temperature, an unreliable cue, to judge UV intensity and seemed to adjust clothing for warmth not UV protection. Efforts are needed to help individuals make more accurate sun safety decisions. Copyright © 2016. Published by Elsevier Inc.

  11. Multiple levels of influence in the adoption of sun protection policies in elementary schools in Massachusetts.

    Science.gov (United States)

    Geller, Alan C; Zwirn, Jodie; Rutsch, Linda; Gorham, Sue A; Viswanath, Vish; Emmons, Karen M

    2008-04-01

    To understand the factors that may influence sun protection policy development if the Centers for Disease Control and Prevention guidelines are to be realized. Qualitative research methodology incorporating a socioecological framework using individual or small-group interviews, surveys, and environmental assessments with school superintendents, elementary school principals, elementary school nurses, and parent-teacher organization presidents and co-chairs as well as coding of school documents. Elementary schools in Massachusetts. Nine school superintendents, 18 elementary school principals, 18 elementary school nurses, and 16 parent-teacher organization presidents or co-chairs. Presence of school sun protection policies, sun protection curriculum, and communication portals for sun protection information to parents. None of the schools in the 9 districts had a sun protection policy, and only 1 had any type of sun protection curriculum. However, nearly all principals were receptive to developing sun protection policies and to making structural changes to increase the amount of accessible shade if funding were available. The schools' communication infrastructure could provide a key portal for disseminating sun protection information to parents. Although there are other resources that could be brought to bear, many challenges must be surmounted to develop effective sun protection policies.

  12. Mass media barriers to social marketing interventions: the example of sun protection in the UK.

    Science.gov (United States)

    Kemp, Gillian Ann; Eagle, Lynne; Verne, Julia

    2011-03-01

    The role of the mass media in communicating health-related information to the wider population is the focus of this paper. Using the example of sun protection within the UK, we highlight some of the major challenges to raising awareness of steadily increasing melanoma rates and of effective sun protection strategies. The implications of potential barriers to official sun protection messages via conflicting messages in the media are discussed in terms of editorial on sun protection and in the way in which television programme content portrays the issues. Implications for public policy and future research conclude the paper.

  13. A novel adaptive sun tracker for spacecraft solar panel based on hybrid unsymmetric composite laminates

    Science.gov (United States)

    Wu, Zhangming; Li, Hao

    2017-11-01

    This paper proposes a novel adaptive sun tracker which is constructed by hybrid unsymmetric composite laminates. The adaptive sun tracker could be applied on spacecraft solar panels to increase their energy efficiency through decreasing the inclined angle between the sunlight and the solar panel normal. The sun tracker possesses a large rotation freedom and its rotation angle depends on the laminate temperature, which is affected by the light condition in the orbit. Both analytical model and finite element model (FEM) are developed for the sun tracker to predict its rotation angle in different light conditions. In this work, the light condition of the geosynchronous orbit on winter solstice is considered in the numerical prediction of the temperatures of the hybrid laminates. The final inclined angle between the sunlight and the solar panel normal during a solar day is computed using the finite element model. Parametric study of the adaptive sun tracker is conducted to improve its capacity and effectiveness of sun tracking. The improved adaptive sun tracker is lightweight and has a state-of-the-art design. In addition, the adaptive sun tracker does not consume any power of the solar panel, since it has no electrical driving devices. The proposed adaptive sun tracker provides a potential alternative to replace the traditional sophisticated electrical driving mechanisms for spacecraft solar panels.

  14. Spies - Spectral Polarimetric Imager For The Energetic Sun

    Science.gov (United States)

    Lin, Haosheng; Jaeggli, S.

    2012-05-01

    Spectropolarimetric observation with uncompromised spatial, spectral, and temporal resolution simulatneously over a substantial 2D field and multiple spectral lines is the key to the resolution of many important questions in modern solar physics. While 2D imaging spectroscopy based on fiber optics integral field unit and image slicer has a long history nighttime astronomy, adaptation for solar observation occured only recently. This paper will present preliminary results of magnetic field observation in the HeI 1083 nm and FeI 1565 nm lines obtained with SPIES --- a true imaging spectropolarimeter based on a large format (64 x 32 fibers input array) fiber-optic array optimized for the study of evolution of magnetic and thermodynamic properties of energetic and dynamic phenomena of the sun. We will also discuss considerations for the use of fiber-optic array for solar spectropolarimetric applications, as well as the design of SPIES.

  15. Solar sketching a comprehensive guide to drawing the sun

    CERN Document Server

    Rix, Erika; Russell, Sally; Handy, Richard

    2015-01-01

    From the authors of Sketching the Moon comes a comprehensive guide filled with richly illustrated, detailed drawing tutorials that cover a variety of solar phenomena. Time-honored, traditional methods and media are described in tandem with innovative techniques developed and shared by contemporary astronomical sketchers. Explanations of what to expect visually from white light, Hydrogen-alpha and Calcium K filters are provided for those new to solar observing, along with essential tips on equipment, observing techniques and the practicalities of drawing at the eyepiece. For the technically minded, detailed descriptions are given on how to use image manipulation software to bring your sketches to life through animation.   The Sun is the most visually dynamic object in our solar system and offers compelling, spectacular views. Knotted magnetic field lines give rise to powerful eruptions and form the intricate sunspots and arching prominences that make our nearest star one of the most exciting, yet challenging,...

  16. New Views of the Sun: STEREO and Hinode

    Science.gov (United States)

    Luhmann, Janet G.; Tsuneta, Saku; Bougeret, J.-L.; Galvin, Antoinette; Howard, R. A.; Kaiser, Michael; Thompson, W. T.

    The twin-spacecraft STEREO mission has now been in orbit for 1.5 years. Although the main scientific objective of STEREO is the origin and evolution of Coronal Mass Ejections (CMEs) and their heliospheric consequences, the slow decline of the previous solar cycle has provided an extraordinary opportunity for close scrutiny of the quiet corona and solar wind, including suprathermal and energetic particles. However, STEREO has also captured a few late cycle CMEs that have given us a taste of the observations and analyses to come. Images from the SECCHI investigation afforded by STEREO's separated perspectives and the heliospheric imager have already allowed us to visibly witness the origins of the slow solar wind and the Sun-to-1 AU transit of ICMEs. The SWAVES investigation has monitored the transit of interplanetary shocks in 3D while the PLASTIC and IMPACT in-situ measurements provide the 'ground truth' of what is remotely sensed. New prospects for space weather forecasting have been demonstrated with the STEREO behind spacecraft, a successful proof-of-concept test for future space weather mission designs. The data sets for the STEREO investigations are openly available through a STEREO Science Center web interface that also provides supporting information for potential users from all communities. Comet observers and astronomers, interplanetary dust researchers and planetary scientists have already made use of this resource. The potential for detailed Sun-to-Earth CME/ICME interpretations with sophisticated modeling efforts are an upcoming STEREO-Hinode partnering activity whose success we can only anticipate at this time. Since its launch in September 2006, Hinode has sent back solar images of unprecedented clarity every day. The primary purpose of this mission is a systems approach to understanding the generation, transport and ultimate dissipation of solar magnetic fields with a well-coordinated set of advanced telescopes. Hinode is equipped with three

  17. SynLight - the world's largest artificial sun

    Science.gov (United States)

    Wieghardt, Kai; Funken, Karl-Heinz; Dibowski, Gerd; Hoffschmidt, Bernhard; Laaber, Dmitrij; Hilger, Patrick; Eßer, Kai-Peter

    2016-05-01

    High-flux solar simulators, providing predictable and reproducible solar radiation, have emerged to indispensable tools for efficient development of CSP components or solar chemical processes. In the last decade, a number of such facilities have been erected, however significantly below the typical scale of pilot plants. DLR started the construction of a large solar simulator in Jülich near its solar power tower. The facilities' modular design is novel and characterized by 149 individually controllable 7kW Xenon short-arc lamps. Solar radiant powers of up to 280kW and 2 x 220kW are expected to be available in three separately useable radiation chambers. In 2017, the large artificial sun shall be available for the global CSP and solar chemical community within cooperative research projects.

  18. Sun pipeline`s tensioned cover system saves storage costs

    Energy Technology Data Exchange (ETDEWEB)

    Blaisdell, J.R. [Sun Pipe Line Co., Detroit, MI (United States); Lydick, L. [National Seal Co., Aurora, IL (United States)

    1996-02-01

    Sun Pipe Line chose the Columbia tensioned floating cover (TFC) system from Columbia Geosystems for several reasons. First, capital costs for the TFC system are considerably lower than those for structural metal or concrete systems. Installation requires less time than fixed structures, and construction costs are about one-tenth as much. A second reason for the choice is its patented tower/tension cover design which easily accommodates fluctuating fluid levels in brine ponds, even in a rapid drawdown. When brine is pumped into the storage chambers, changes in brine ponds can be as great as ten feet. The tensioned design maintains folds of extra material on the outer perimeter of the cover above fluid level. As fluid levels fall, the curtain unfolds and adequate reservoir coverage is maintained.

  19. [Introduction and calibration of the Chinese sun hazemeter network].

    Science.gov (United States)

    Xin, Jin-yuan; Wang, Yue-si; Li, Zhan-qing; Wang, Pu-cai; Wang, Shi-gong; Wen, Tian-xue; Sun, Yang

    2006-09-01

    Much of the current uncertainty in the quantitative assessment of the climate and environment change is due to our lack of knowledge of the aerosol, for which the large-scale sun hazemeter ground-based network directly provides basic data. The data also can revise the results of the satellite remote sensing. Depending on the stations of CERN, the standard network was first built in China. The accurate and reliable hazemeter (LEDs) was uniformly used in the network. The hazemeters were calibrated by Langley plot method and transfer calibration and were uniformly checked. The AODs, which were synchronously retrieved from hazemeters (RSD < 3%) and CEMIL (RSD < 5%), were coherent and comparable. The stability and reliability of the hazemeters and the network was approved.

  20. Thermoelectric transport through a SU(N ) Kondo impurity

    Science.gov (United States)

    Karki, D. B.; Kiselev, Mikhail N.

    2017-09-01

    We investigate thermoelectric transport through a SU(N ) quantum impurity in the Kondo regime. The strong-coupling fixed-point theory is described by the local Fermi-liquid paradigm. Using Keldysh technique we analyze the electric current through the quantum impurity at both finite bias voltage and finite temperature drop across it. The theory of a steady state at zero current provides a complete description of the Seebeck effect. We find pronounced nonlinear effects in temperature drop at low temperatures. We illustrate the significance of the nonlinearities for enhancement of thermopower by two examples of SU(4) symmetric regimes characterized by a filling factor m : (i) particle-hole symmetric at m =2 and (ii) particle-hole nonsymmetric at m =1 . We analyze the effects of potential scattering and coupling asymmetry on the transport coefficients. We discuss connections between the theory and transport experiments with coupled quantum dots and carbon nanotubes.

  1. PROGRESS: Fusion of forecasts from the Sun to the Earth

    Science.gov (United States)

    Walker, Simon; Balikhin, Michael; Wintoft, Peter; Arber, Tony; Krasnoselskikh, Volodya; Ganushkina, Natalia; Liemohn, Michael; Shprits, Yuri; Boynton, Richard

    2017-04-01

    The particle environment of the inner magnetosphere is strongly coupled to variations in the solar wind. The introduction of large fluxes of electrons into the radiation belts and their subsequent acceleration to high energies can result in the internal and surface charging of space assets, possibly leading to disruption and even cessation of essential services. Reliable forecast of the fluences of these electrons can assist in the mitigation of undesirable effects on spacecraft. PROGRESS, an EU Horizon 2020 funded project, aims to provide forecasts of the evolution of the geospace environment beginning from the surface of the sun to the radiation belts. We review the current status of the projects and the challenges that still lie ahead.

  2. Seismology and geodesy of the sun: Low-frequency oscillations.

    Science.gov (United States)

    Dicke, R H

    1981-04-01

    The hourly averages of the solar ellipticity measured from June 13 to Sept. 17, 1966, are analyzed for indications of solar oscillations with periods in excess of 2 hr nu 0.1 hr(-1) but for lower frequencies the power spectrum shows a very complex structure containing about 20 strong narrow peaks. The complexity is illusionary. The signal apparently consists of only two frequencies. The complexity is due to aliasing by the window function with its basic 24-hr period, with many observational days missing, and with different numbers of hourly averages for the various observational days. Both signal frequencies are apparently due to odd-degree spherical harmonic oscillations of the sun.

  3. Development of algorithm for single axis sun tracking system

    Science.gov (United States)

    Yi, Lim Zi; Singh, Balbir Singh Mahinder; Ching, Dennis Ling Chuan; Jin, Calvin Low Eu

    2016-11-01

    The output power from a solar panel depends on the amount of sunlight that is intercepted by the photovoltaic (PV) solar panel. The value of solar irradiance varies due to the change of position of sun and the local meteorological conditions. This causes the output power of a PV based solar electricity generating system (SEGS) to fluctuate as well. In this paper, the focus is on the integration of solar tracking system with performance analyzer system through the development of an algorithm for optimizing the performance of SEGS. The proposed algorithm displays real-time processed data that would enable users to understand the trend of the SEGS output for maintenance prediction and optimization purposes.

  4. The network management expert system prototype for Sun Workstations

    Science.gov (United States)

    Leigh, Albert

    1990-01-01

    Networking has become one of the fastest growing areas in the computer industry. The emergence of distributed workstations make networking more popular because they need to have connectivity between themselves as well as with other computer systems to share information and system resources. Making the networks more efficient and expandable by selecting network services and devices that fit to one's need is vital to achieve reliability and fast throughput. Networks are dynamically changing and growing at a rate that outpaces the available human resources. Therefore, there is a need to multiply the expertise rapidly rather than employing more network managers. In addition, setting up and maintaining networks by following the manuals can be tedious and cumbersome even for an experienced network manager. This prototype expert system was developed to experiment on Sun Workstations to assist system and network managers in selecting and configurating network services.

  5. Fundamental composite 2HDM: SU(N) with 4 flavours

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Teng [Department of Physics, Tsinghua University,Beijing, 100084 (China); Center for High Energy Physics, Tsinghua University,Beijing, 100084 (China); Cacciapaglia, Giacomo [University Lyon, Université Claude Bernard Lyon 1,43 Boulevard du 11 Novembre, F-69100 Villeurbanne (France); Institut de Physique Nucléaire de Lyon (UMR5822), CNRS/IN2P3,4 rue Enrico Fermi, F-69622 Villeurbanne Cedex (France)

    2016-03-31

    We present a new model of composite Higgs based on a gauged SU(N) group with 4 Dirac fermions in the fundamental representation. At low energy, the model has a global symmetry SU(4)×SU(4) broken to the diagonal SU(4), containing 2 Higgs doublets in the coset. We study in detail the issue of the vacuum alignment. In particular, we prove that, without loss of generality, the vacuum can always be aligned with one doublet. Under certain conditions on the top pre-Yukawas, the second doublet, together with the additional triplets, is stable and can thus play the role of Dark Matter. This model can therefore be an example of composite inert-2HDM model.

  6. The Solar-Stellar Connection: Our New Sun

    Science.gov (United States)

    Priest, Eric R.

    2009-02-01

    Our view of the Sun has changed dramatically over the past 10 years due mainly to a series of space satellites such as Yohkoh, SoHO and TRACE. This state of ferment will continue with the coming onto line last year of two other satellites, Hinode and STEREO, and next year SDO. Here we give a brief overview of the progress made in answering fundamental questions about the nature of the Sun which may have profound implications for other stars. In the interior, helioseismology has revealed the internal rotation structure and suggested that the main solar dynamo responsible for active regions is located at the tachocline, although the details are highly uncertain and there may be a second dynamo responsible for generating small-scale ephemeral regions. In the photosphere, flux is mainly concentrated at the edges of supergranule cells, but recent high-resolution observations have suggested that extra flux is also located at granulation boundaries and Hinode has discovered much horizontal flux. The solar corona is likely to be heated in myriads of tiny current sheets by reconnection, according to the Coronal Tectonics Model. Observations suggest that all the coronal field lines reconnect every 1.5 hours. Theory has shown that reconnection in 3D has many features that are completely different from the standard 2D picture. The solar wind is highly dynamic and complex and its acceleration mechanism may possibly be high-frequency ion-cyclotron waves. Many new features of solar flares and coronal mass ejections have been discovered, but it is not known whether the cause of the eruption is an instability or a lack of equilibrium.

  7. Sun Ginseng Protects Endothelial Progenitor Cells From Senescence Associated Apoptosis

    Science.gov (United States)

    Im, Wooseok; Chung, Jin-Young; Bhan, Jaejun; Lim, Jiyeon; Lee, Soon-Tae; Chu, Kon; Kim, Manho

    2012-01-01

    Endothelial progenitor cells (EPC) are a population of cells that circulate in the blood stream. They play a role in angiogenesis and, therefore, can be prognostic markers of vascular repair. Ginsenoside Rg3 prevents endothelial cell apoptosis through the inhibition of the mitochondrial caspase pathway. It also affects estrogen activity, which reduces EPC senescence. Sun ginseng (SG), which is heat-processed ginseng, has a high content of ginsenosides. The purpose of this study was to investigate the protective effects of SG on senescence-associated apoptosis in EPCs. In order to isolate EPCs, mononuclear cells of human blood buffy coats were cultured and characterized by their uptake of acetylated low-density lipoprotein (acLDL) and their binding of Ulex europaeus agglutinin I (ulex-lectin). Flow cytometry with annexin-V staining was performed in order to assess early and late apoptosis. Senescence was determined by β-galactosidase (β-gal) staining. Staining with 4′-6-Diamidino-2-phenylindole verified that most adherent cells (93±2.7%) were acLDL-positive and ulex-lectin-positive. The percentage of β-gal-positive EPCs was decreased from 93.8±2.0% to 62.5±3.6% by SG treatment. A fluorescence-activated cell sorter (FACS) analysis showed that 4.9% of EPCs were late apoptotic in controls. Sun ginseng decreased the apoptotic cell population by 39% in the late stage of apoptosis from control baseline levels. In conclusion, these results show antisenescent and antiapoptotic effects of SG in human-derived EPCs, indicating that SG can enhance EPC-mediated repair mechanisms. PMID:23717107

  8. Space/Time, Supernovae and the Faint Young Sun

    Science.gov (United States)

    Riofrio, L. M.

    2006-08-01

    EVIDENCE from Supernovae, the CMB, and the geological record supports a Unified Space/Time. Theory provides a simple explanation for problems of current cosmology. In review, a simple principle states that Space and Time are one phenomenon, related by factor c the "speed of light". Scale R of the Universe is related to its age t by R = ct. Relativity and gravitation then require that c be related to t by GM = tc^3. Together these expressions form a solution to Einstein-Friedmann equations with stable density (Omega) = 1. Scale, horizon, density and redshift data may be predicted without hypothetical energies. The cosmic microwave background provides a first test of theory. First acoustic peak indicates a density (Omega) = 1 as predicted. Uniformity in the CMB indicates a much higher primordial speed of light. Lack of large-scale fluctuations appears to rule out inflationary models. In contrast, Theory's predicted spectrum is a close fit with both WMAP and COBE data. Observations of Type Ia supernovae provide a second test. Low redshifts increase linearly, again indicating that (Omega)=1. Higher Z data appears to curve upward, leading to speculation about acceleration and repulsive energies. Alternately, the data shows that c has changed exactly as predicted. Theory's predicted curve fits the data more closely than any other model, without conjuring invisible energies. To distinguish "c change" from accelerating Universe models, corroborating data is required. The standard solar model predicts that during formation the Sun was only 70% as luminous and early Earth would have frozen solid. Geology and the fossil record contradict this prediction. Since the Sun converts fuel to energy according to E=mc^2, higher c in the past means that the solar luminosity has been nearly constant over 4 billion years. Combined with supernova data, evidence indicates that c has changed at precisely the rate predicted. Since Space/Time predicts results not epicycles, Theory should be

  9. Integration of an on-axis general sun-tracking formula in the algorithm of an open-loop sun-tracking system.

    Science.gov (United States)

    Chong, Kok-Keong; Wong, Chee-Woon; Siaw, Fei-Lu; Yew, Tiong-Keat; Ng, See-Seng; Liang, Meng-Suan; Lim, Yun-Seng; Lau, Sing-Liong

    2009-01-01

    A novel on-axis general sun-tracking formula has been integrated in the algorithm of an open-loop sun-tracking system in order to track the sun accurately and cost effectively. Sun-tracking errors due to installation defects of the 25 m(2) prototype solar concentrator have been analyzed from recorded solar images with the use of a CCD camera. With the recorded data, misaligned angles from ideal azimuth-elevation axes have been determined and corrected by a straightforward changing of the parameters' values in the general formula of the tracking algorithm to improve the tracking accuracy to 2.99 mrad, which falls below the encoder resolution limit of 4.13 mrad.

  10. Integration of an On-Axis General Sun-Tracking Formula in the Algorithm of an Open-Loop Sun-Tracking System

    Directory of Open Access Journals (Sweden)

    Yun-Seng Lim

    2009-09-01

    Full Text Available A novel on-axis general sun-tracking formula has been integrated in the algorithm of an open-loop sun-tracking system in order to track the sun accurately and cost effectively. Sun-tracking errors due to installation defects of the 25 m2 prototype solar concentrator have been analyzed from recorded solar images with the use of a CCD camera. With the recorded data, misaligned angles from ideal azimuth-elevation axes have been determined and corrected by a straightforward changing of the parameters’ values in the general formula of the tracking algorithm to improve the tracking accuracy to 2.99 mrad, which falls below the encoder resolution limit of 4.13 mrad.

  11. Evaluation of the new ESR network software for the retrieval of direct sun products from CIMEL CE318 and PREDE POM01 sun-sky radiometers

    Directory of Open Access Journals (Sweden)

    V. Estellés

    2012-12-01

    Full Text Available The European Skynet Radiometers network (EuroSkyRad or ESR has been recently established as a research network of European PREDE sun-sky radiometers. Moreover, ESR is federated with SKYNET, an international network of PREDE sun-sky radiometers mostly present in East Asia. In contrast to SKYNET, the European network also integrates users of the CIMEL CE318 sky–sun photometer. Keeping instrumental duality in mind, a set of open source algorithms has been developed consisting of two modules for (1 the retrieval of direct sun products (aerosol optical depth, wavelength exponent and water vapor from the sun extinction measurements; and (2 the inversion of the sky radiance to derive other aerosol optical properties such as size distribution, single scattering albedo or refractive index. In this study we evaluate the ESR direct sun products in comparison with the AERosol RObotic NETwork (AERONET products. Specifically, we have applied the ESR algorithm to a CIMEL CE318 and PREDE POM simultaneously for a 4-yr database measured at the Burjassot site (Valencia, Spain, and compared the resultant products with the AERONET direct sun measurements obtained with the same CIMEL CE318 sky–sun photometer. The comparison shows that aerosol optical depth differences are mostly within the nominal uncertainty of 0.003 for a standard calibration instrument, and fall within the nominal AERONET uncertainty of 0.01–0.02 for a field instrument in the spectral range 340 to 1020 nm. In the cases of the Ångström exponent and the columnar water vapor, the differences are lower than 0.02 and 0.15 cm, respectively. Therefore, we present an open source code program that can be used with both CIMEL and PREDE sky radiometers and whose results are equivalent to AERONET and SKYNET retrievals.

  12. Sun-Earth Connections: How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    Science.gov (United States)

    Ladbury, Raymond L.

    2014-01-01

    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  13. The First Focused Hard X-Ray Images of the Sun With NuSTAR

    DEFF Research Database (Denmark)

    Grefenstette, Brian W.; Glesener, Lindsay; Krucker, Sam

    2016-01-01

    We present results from the the first campaign of dedicated solar observations undertaken by the Nuclear Spectroscopic Telescope ARray (NuSTAR) hard X-ray (HXR) telescope. Designed as an astrophysics mission, NuSTAR nonetheless has the capability of directly imaging the Sun at HXR energies (>3 ke......, and full-disk HXR images of the Sun....

  14. THE SUN AS A CALIBRATION SIGNAL SOURCE FOR L- AND S-BAND TELEMETRY

    Science.gov (United States)

    performance at all times. The sun provides sufficient signal strength in these bands, and its subtended angle of 0.5 deg from the earth is small enough to...communications link the sun could be used as a signal source for calibration purposes. Characteristics of solar emission are reviewed briefly, and the methods of determining receiving system noise temperature are developed.

  15. Removing sun glint from optical remote sensing images of shallow rivers

    Science.gov (United States)

    Overstreet, Brandon T.; Legleiter, Carl

    2017-01-01

    Sun glint is the specular reflection of light from the water surface, which often causes unusually bright pixel values that can dominate fluvial remote sensing imagery and obscure the water-leaving radiance signal of interest for mapping bathymetry, bottom type, or water column optical characteristics. Although sun glint is ubiquitous in fluvial remote sensing imagery, river-specific methods for removing sun glint are not yet available. We show that existing sun glint-removal methods developed for multispectral images of marine shallow water environments over-correct shallow portions of fluvial remote sensing imagery resulting in regions of unreliable data along channel margins. We build on existing marine glint-removal methods to develop a river-specific technique that removes sun glint from shallow areas of the channel without overcorrection by accounting for non-negligible water-leaving near-infrared radiance. This new sun glint-removal method can improve the accuracy of spectrally-based depth retrieval in cases where sun glint dominates the at-sensor radiance. For an example image of the gravel-bed Snake River, Wyoming, USA, observed-vs.-predicted R2 values for depth retrieval improved from 0.66 to 0.76 following sun glint removal. The methodology presented here is straightforward to implement and could be incorporated into image processing workflows for multispectral images that include a near-infrared band.

  16. Evidence for LINC1-SUN associations at the plant nuclear periphery.

    Science.gov (United States)

    Graumann, Katja

    2014-01-01

    Sad1/UNC84 (SUN) domain proteins are a highly conserved family of inner nuclear membrane localised proteins in eukaryotes. One of their main functions is as key components of nucleo-cytoskeletal bridging complexes, in which SUN proteins associate with nucleoskeletal elements. In metazoans these are the lamins, which form a supportive structural network termed the lamina. Plants lack sequence homologs of lamins but have a similar nucleoplasmic structural network to support the plant NE. Putative components of this plant lamina-like structure are Little Nuclei (LINC) proteins, which bear structural resemblance to lamins and fulfil similar functions. This work explores the associations between AtLINC1, AtSUN1 and AtSUN2. AtLINC1 is recruited to the NE by SUN proteins and is immobilised therein. This recruitment and the immobile properties are likely due to AtSUN1/2-AtLINC1 protein interactions occurring in planta. In addition, the SUN N-terminus appears to play an important role in mediating these interactions. The associations between AtLINC1 and plant SUN proteins are a first indicator of how the nucleoskeleton may be anchored to the nuclear membrane in plants. Building on the previous characterisation of Klarsicht/Anc1/Syne1 homology (KASH) like proteins in plants, this study advances the identification and characterisation of nucleo-cytoskeletal bridging complexes in plants.

  17. 77 FR 36272 - SunShot Prize: America's Most Affordable Rooftop

    Science.gov (United States)

    2012-06-18

    ...The Department of Energy (DOE) announces in this notice the release of the SunShot Prize: America's Most Affordable Rooftop Solar for public comment. Interested persons are encouraged to learn about the SunShot Prize: America's Most Affordable Rooftop rules at eere.energy.gov/solar/sunshot/prize.html.

  18. Seismic imaging of the Sun's far hemisphere and its applications in space weather forecasting.

    Science.gov (United States)

    Lindsey, Charles; Braun, Douglas

    2017-06-01

    The interior of the Sun is filled acoustic waves with periods of about 5 min. These waves, called " p modes," are understood to be excited by convection in a thin layer beneath the Sun's surface. The p modes cause seismic ripples, which we call "the solar oscillations." Helioseismic observatories use Doppler observations to map these oscillations, both spatially and temporally. The p modes propagate freely throughout the solar interior, reverberating between the near and far hemispheres. They also interact strongly with active regions at the surfaces of both hemispheres, carrying the signatures of said interactions with them. Computational analysis of the solar oscillations mapped in the Sun's near hemisphere, applying basic principles of wave optics to model the implied p modes propagating through the solar interior, gives us seismic maps of large active regions in the Sun's far hemisphere. These seismic maps are useful for space weather forecasting. For the past decade, NASA's twin STEREO spacecraft have given us full coverage of the Sun's far hemisphere in electromagnetic (EUV) radiation from the far side of Earth's orbit about the Sun. We are now approaching a decade during which the STEREO spacecraft will lose their farside vantage. There will occur significant periods from thence during which electromagnetic coverage of the Sun's far hemisphere will be incomplete or nil. Solar seismology will make it possible to continue our monitor of large active regions in the Sun's far hemisphere for the needs of space weather forecasters during these otherwise blind periods.

  19. SCR neon and argon in Kapoeta feldspar: Evidence for an active ancient Sun

    Science.gov (United States)

    Rao, M. N.; Garrison, D. H.; Bogard, D. D.

    1993-01-01

    From etched feldspar size-fractions of Kapoeta, we determine a significant excess of cosmogenic Ne-21 and Ar-38 over that produced by galactic cosmic rays. This excess component is attributed to early production by energetic solar protons and suggest that the energetic proton flux from the ancient Sun was several hundred times more intense than that of the contemporary Sun.

  20. 76 FR 12957 - SunZia Transmission, LLC; Notice of Petition for Declaratory Order

    Science.gov (United States)

    2011-03-09

    ... SunZia Southwest Transmission Project (Project) equal to its pro rata share of investment in the Project,\\1\\ (ii) SWPG, ECP SunZia, and SWE may allocate up to 50 percent of their pro rata shares of the... rata shares of the Project into their transmission systems and provide service pursuant to their...

  1. 75 FR 7473 - SunZia Transmission, LLC; Notice of Filing

    Science.gov (United States)

    2010-02-19

    ... rights representing 100% of the sponsor's pro rata investment in the transmission capacity of the SunZia..., may use up to 100% of their pro rata share of capacity on the project to serve affiliated generators; and (iii) SWPG and ECP SunZia may prescribe up to 100% of their 80% pro rata share of the project...

  2. Response of container-grown flowering dogwood cultivars to sun/shade production regime, 2015

    Science.gov (United States)

    Flowering dogwood, Cornus florida, ‘Cherokee Brave™’ and ‘Cherokee Princess’ were grown in #5 nursery containers in an amended 100% bark substrate. Treatments were assigned based on exposure time to a full sun/shade condition during the growing season: 1) plants grown in full sun, 2) plants grown in...

  3. Mycoflora of sun-dried sweet potato ( Ipomoea batatas L .) slices in ...

    African Journals Online (AJOL)

    A study was carried out to isolate and quantify the fungi present in sun-dried sweet potato slices in Benin City, Nigeria. Potato tubers were peeled, washed, sliced and sun-dried for 30 days. Oven-dried slices served as control. Meteorological data were obtained for the period of study. Fungal colonies on slices were counted ...

  4. Tracing the journey of the sun and the solar siblings through the Milky Way

    NARCIS (Netherlands)

    Martinez, Barbosa C.A.

    2016-01-01

    This thesis is focused on studying the motion of the Sun and the Solar siblings through the Galaxy. The Solar siblings are stars that were born with the Sun in the same molecular cloud 4.6 Gyr ago. In the first part of the thesis, we present an efficient method to calculate the evolution of small

  5. Science 101: How Does the Motion of the Earth Affect Our View of the Sun?

    Science.gov (United States)

    Robertson, Bill

    2014-01-01

    The question examined in this "Science 101" column was inspired by "Find Your School's Analemma" (in this issue). What causes the Sun's apparent position in the sky to trace a figure-eight pattern throughout one year? The analemma, or figure eight pattern that the Sun makes throughout the year, is due to two major…

  6. Evaluation of sun-dried cassava fufu meal as a source of dietary ...

    African Journals Online (AJOL)

    Sun-drying of cassava fufu was investigated as a method of processing cassava to eliminate its cyanide content and dusty nature so as to enhance its nutritive value as a source of energy in starter broiler diets. Cassava tubers were prepared in the traditional way into fufu and dried in the sun by flattening in bits on ...

  7. Effects of pricking, sun-drying and sieving on Ginger (Zingiber ...

    African Journals Online (AJOL)

    The effect of pricking, sun drying and sieving on the color retention of Nigerian yellow bark ginger were investigated. The exterior and interior surface of fresh, pricked and sun dried medium sized Nigerian ginger rhizomes (Tafin giwa) were analysed for colour variation. The colour values of the exterior surface of fresh ginger ...

  8. Forward modeling of the corona of the sun and solarlike stars

    DEFF Research Database (Denmark)

    Hardi, Peter; Gudiksen, Boris V.; Nordlund, Å.

    2006-01-01

    Transition Region Lines, AB-Initio Approach; Nonequilibrium Inozation; Doppler Shifts; Emission-Lines; Quiet-Sun; Sumer Telescope; Atomic Database; Magnetic-Field; Thin Plasmas......Transition Region Lines, AB-Initio Approach; Nonequilibrium Inozation; Doppler Shifts; Emission-Lines; Quiet-Sun; Sumer Telescope; Atomic Database; Magnetic-Field; Thin Plasmas...

  9. Imputating missing values in diary records of sun-exposure study

    DEFF Research Database (Denmark)

    Have, Anna Szynkowiak; Philipsen, Peter Alshede; Larsen, Jan

    2001-01-01

    In a sun-exposure study, questionnaires concerning sun-habits were collected from 195 subjects. This paper focuses on the general problem of missing data values, which occurs when some, or even all of the questions have not been answered in a questionnaire. Here, only missing values of low...

  10. Are sun- and shade-type anatomy required for the acclimation of Neoregelia cruenta?

    Directory of Open Access Journals (Sweden)

    FERNANDA REINERT

    2013-06-01

    Full Text Available Sun and shade plants are often discriminated by a number of sun- and shade-type anatomies. Nonetheless, we propose that among tank-bromeliads, changes in rosette architecture satisfy the requirements for coping with contrasting light levels. The tank-bromeliad Neoregelia cruenta naturally colonises sub-habitats ranging from full exposure to direct sunlight, to shaded environments in sand ridge plains. We quantified anatomical and morphological traits of leaves and rosettes of N. cruenta grown under sun and shade conditions. Cells with undulated lateral walls within the water parenchyma are for the first time described for the family. Under high light, leaf blades were wider, shorter, and yellowish. The rosette diameter of sun plants was less than half that of shade plants. Sun leaves overlapped with neighbouring leaves for most of their length, forming a cylindrical rosette where water accumulates. Shade leaves only overlapped in the centre of the rosette. Most anatomical traits were similar under both growth conditions. Stomata were absent from the base of sun leaves, which is probably explained by limited gas exchange at the base of the tight sun-type rosette. Data suggest that the ability of N. cruenta to acclimate to sun and shade is better explained by changes in rosette architecture than by leaf anatomy.

  11. A randomized trial of the Hawaii SunSmart program's impact on outdoor recreation staff.

    Science.gov (United States)

    Glanz, K; Maddock, J E; Lew, R A; Murakami-Akatsuka, L

    2001-06-01

    Skin cancer is the most common form of cancer in the United States and one of the most preventable. Prevention programs for children at outdoor recreation sites may influence not only the youth, but the staff, or caregivers, as well. By teaching children about sun protection, staff may also change their sun protection behaviors. We report on the impact of a childhood skin cancer prevention program (SunSmart) on staff at outdoor recreation sites where a child-focused intervention was conducted. The intervention included staff training, on-site activities delivered by staff, distribution of sunscreen, and the promotion of sun-safe environments. It was hypothesized that by teaching children about sun protection, staff would change their sun protection behaviors. A randomized trial at 14 recreation sites (n = 176 staff) in Hawaii tested the efficacy of education only, and education plus environmental changes, compared with a control condition. Results showed significant positive changes in knowledge, sun protection habits, norms, and sun protection policies. The education plus environment group was not superior to education alone. Changes in staff behavior and attitudes are important for their own health, as positive role models, and for the dissemination of skin cancer control programs.

  12. Relationships of sun-protection habit strength with sunscreen use during outdoor sport and physical activity.

    Science.gov (United States)

    Lawler, Sheleigh; McDermott, Liane; O'Riordan, David; Spathonis, Kym; Eakin, Elizabeth; Leslie, Evie; Gallois, Cindy; Berndt, Nadine; Owen, Neville

    2012-03-01

    The objective of this cross-sectional questionnaire study was to assess associations of a self-report index of sun protection habit strength with sunscreen use in sporting environments and outdoor physical activity. Participants (n = 234) in field hockey, soccer, tennis and surf sports in Queensland, Australia, completed a self-administered survey on sun protection during organized sport, and during general outdoor physical activity during 2005/2006. The sun protection habit strength index was dichotomized into two categories. Multinomial logistic regression analyses assessed the associations of low versus high sun protection habit strength with three categories of sunscreen use (no or rare use; inadequate use; and adequate use). Compared to participants with low sun protection habit strength, those with high sun protection habit strength had significantly greater odds of any sunscreen use during organized sport and during general outdoor physical activity. This association was strongest for adequate sunscreen use in both settings. In conclusion, this study suggests that the measure of sun protection habit strength is a potentially useful assessment tool for future sun protection studies.

  13. Contribution of oblateness of the sun to radar sounding according to ...

    African Journals Online (AJOL)

    The Newtonian theory of radar sounding in the gravitational field of a spherical sun is well known [1]. It is now well established that most of the astronomical bodies including the sun are spheroidal (proplate or oblate) in shape [5,11,12]. The Newtonian mechanics has been used to resolve satisfactorily the radar sounding ...

  14. Sunwatchers Across Time: Sun-Earth Day from Ancient and Modern Solar Observatories

    Science.gov (United States)

    Hawkins, I.; Vondrak, R.

    Humans across all cultures have venerated, observed, and studied the Sun for thousands of years. The Sun, our nearest star, provides heat and energy, is the cause of the seasons, and causes space weather effects that influence our technology-dependent society. The Sun is also part of indigenous tradition and culture. The Inca believed that the Sun had the power to make things grow, and it does, providing us with the heat and energy that are essential to our survival. From a NASA perspective, Sun-Earth Connection research investigates the effects of our active Sun on the Earth and other planets, namely, the interaction of the solar wind and other dynamic space weather phenomena with the solar system. We present plans for Sun-Earth Day 2005, a yearly celebration of the Sun-Earth Connection sponsored by the NASA Sun-Earth Connection Education Forum (SECEF). SECEF is one of four national centers of space science education and public outreach funded by NASA Office of Space Science. Sun-Earth Day involves an international audience of schools, science museums, and the general public in activities and events related to learning about the Sun-Earth Connection. During the year 2005, the program will highlight cultural and historical perspectives, as well as NASA science, through educational and public outreach events intended to involve diverse communities. Sun-Earth Day 2005 will include a series of webcasts from solar observatories produced by SECEF in partnership with the San Francisco Exploratorium. Webcasts from Chaco Culture National Historical Park in New Mexico, USA, and from Chichen Itza, Mexico, will be accessed by schools and the public. Sun-Earth Day will also feature NASA Sun-Earth Connection research, missions, and the people who make it possible. One of the goals of this talk is to inform and engage COSPAR participants in these upcoming public events sponsored by NASA. Another goal is to share best practices in public event programming, and present impact

  15. THE INTERSTELLAR MAGNETIC FIELD CLOSE TO THE SUN. II

    Energy Technology Data Exchange (ETDEWEB)

    Frisch, P. C. [Department of Astronomy and Astrophysics, University of Chicago, Chicago, IL 60637 (United States); Andersson, B-G [SOFIA Science Center, Universities Space Research Association, NASA Ames Research Center, M.S. N232-12 Moffett Field, CA 94035 (United States); Berdyugin, A.; Piirola, V. [Finnish Centre for Astronomy with ESO, University of Turku (Finland); DeMajistre, R. [The Johns Hopkins University Applied Physics Laboratory, Laurel, MD (United States); Funsten, H. O. [Los Alamos National Laboratory, Los Alamos, NM (United States); Magalhaes, A. M.; Seriacopi, D. B. [Inst. de Astronomia, Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo (Brazil); McComas, D. J. [Southwest Research Institute, San Antonio, TX (United States); Schwadron, N. A. [Space Science Center, University of New Hampshire, Durham, NH (United States); Slavin, J. D. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States); Wiktorowicz, S. J. [Department of Astronomy, University of California at Santa Cruz, Santa Cruz, CA (United States)

    2012-12-01

    The magnetic field in the local interstellar medium (ISM) provides a key indicator of the galactic environment of the Sun and influences the shape of the heliosphere. We have studied the interstellar magnetic field (ISMF) in the solar vicinity using polarized starlight for stars within 40 pc of the Sun and 90 Degree-Sign of the heliosphere nose. In Frisch et al. (Paper I), we developed a method for determining the local ISMF direction by finding the best match to a group of interstellar polarization position angles obtained toward nearby stars, based on the assumption that the polarization is parallel to the ISMF. In this paper, we extend the analysis by utilizing weighted fits to the position angles and by including new observations acquired for this study. We find that the local ISMF is pointed toward the galactic coordinates l, b =47 Degree-Sign {+-} 20 Degree-Sign , 25 Degree-Sign {+-} 20 Degree-Sign . This direction is close to the direction of the ISMF that shapes the heliosphere, l, b =33 Degree-Sign {+-} 4 Degree-Sign , 55 Degree-Sign {+-} 4 Degree-Sign , as traced by the center of the 'Ribbon' of energetic neutral atoms discovered by the Interstellar Boundary Explorer (IBEX) mission. Both the magnetic field direction and the kinematics of the local ISM are consistent with a scenario where the local ISM is a fragment of the Loop I superbubble. A nearby ordered component of the local ISMF has been identified in the region l Almost-Equal-To 0 Degree-Sign {yields} 80 Degree-Sign and b Almost-Equal-To 0 Degree-Sign {yields} 30 Degree-Sign , where PlanetPol data show a distance-dependent increase of polarization strength. The ordered component extends to within 8 pc of the Sun and implies a weak curvature in the nearby ISMF of {approx}0.{sup 0}25 pc{sup -1}. This conclusion is conditioned on the small sample of stars available for defining this rotation. Variations from the ordered component suggest a turbulent component of {approx}23 Degree-Sign . The

  16. A Holistic Team Approach to Sun-Climate Research

    Science.gov (United States)

    Nathan, T. R.

    2006-12-01

    There are several scientific challenges surrounding the effects of the 11-year solar cycle (SC) on climate. Among these challenges are identifying pathways by which a small decadal change in solar irradiance can be amplified beyond what current models imply to produce a significant response in the climate system, and distinguishing the SC signal from other climate signals that arise from human activities and natural causes. Adding to the challenges is the fact that these climate forcing mechanisms are subtle, nonlinearly interacting, and modulated by internal atmospheric variability. Moreover, drawing definitive conclusions from a paucity of SC data - only about four SCs of meteorological data are currently available for statistical analysis poses additional challenges. To meet these challenges, NASA's Living with a Star Targeted Research and Technology (LWS TR&T) Program formed a Sun-Climate Focus Team (FST) in 2005. The main objective of the FST is to provide improved understanding of sun-climate feedback mechanisms and to provide more accurate climate simulations involving the SC. To address this objective, the FST has mapped out a comprehensive research plan that addresses how changes in SC irradiance and solar proton events (SPEs) alter the communication at and between "phenomenological interfaces." These interfaces include: solar irradiance-middle atmosphere chemistry; middle atmosphere chemistry-atmospheric dynamics; QBO-planetary waves; tropical upwelling- planetary waves; mesosphere-lower thermosphere; and troposphere-stratosphere. A unique aspect of the FST's research plan is its holistic approach to synthesizing these various phenomenological interfaces. In most previous sun-climate research studies these interfaces have been considered in isolation and aligned along four broad avenues. The first avenue is based on observational data that suggests a portion of the SC signal is communicated globally via the modulation of the equatorial QBO. The second

  17. Development of Ultra-Light 2-Axes Sun Sensor for Small Satellite

    Directory of Open Access Journals (Sweden)

    Su-jeoung Kim

    2005-03-01

    Full Text Available This paper addresses development of the ultra-light analog sun sensors for small satellite applications. The sun sensor is suitable for attitude determination for small satellite because of its small, light, low-cost, and low power consumption characteristics. The sun sensor is designed, manufactured and characteristic-tested with the target requirements of ±60° FOV (Field of View and pointing accuracy of ±2°. Since the sun sensor has nonlinear characteristics between output measurement voltage and incident angle of sunlight, a higher order calibration equation is required for error correction. The error was calculated by using a polynomial calibration equation that was computed by the least square method obtained from the measured voltages vs. angles characteristics. Finally, the accuracies of 1-axis and 2-axes sun sensors, which consist of 2 detectors, are compared.

  18. 15 million degrees a journey to the centre of the Sun

    CERN Document Server

    Green, Lucie

    2016-01-01

    Light takes eight minutes to reach Earth from the surface of the Sun. But its journey within the Sun takes hundreds of thousands of years. What is going on in there? What are light and heat? How does the Sun produce them and how on earth did scientists discover this? In this astonishing and enlightening adventure, you'll travel millions of miles from inside the Sun to its surface and to Earth, where the light at the end of its journey is allowing you to read right now. You'll discover how the Sun works (including what it sounds like), the latest research in solar physics and how a solar storm could threaten everything we know. And you'll meet the groundbreaking scientists, including the author, who pieced this extraordinary story together.

  19. Sun protection use behaviour among University students from 25 low, middle income and emerging economy countries.

    Science.gov (United States)

    Pengpid, Supa; Peltzer, Karl

    2015-01-01

    The aim of this study was to investigate the sun protection use behaviour among university students from 25 low, middle income and emerging economy countries. Using anonymous questionnaires, data were collected from 18,687 undergraduate university students aged 18-30 years (mean age 20.8, SD=2.8) from 26 universities in 25 countries across Asia, Africa and the Americas. Overall, 57.2% of university students reported liking to sunbathe and of those only 48.1% used sun protection when sunbathing. In multivariate logistic regression, younger age, being female, coming from a wealthy or quite well off economic family background, living in an upper middle or high income country, lighter skin tone, and other health behaviours were found to be associated with sun protection use behaviour. Low sun protection use calls for health promotion programmes to prevent unprotected sun exposure.

  20. What the Sun Has Taught Us About Basic Properties of Matter

    Energy Technology Data Exchange (ETDEWEB)

    Basu, Sarbani [Yale University

    2012-03-07

    The Sun is an immensely large object formed out of many tons of gas. Yet the Sun can help us learn about some of the basic properties of matter. The structure of the Sun is governed not only by macrophysics such as hydrostatic equilibrium, convective and radiative heat transport, but also by microphysics such as nuclear reaction rates and the equation of state of the material that forms the Sun. Knowledge of the detailed structure of the Sun can therefore help us constrain the basic properties of matter. Helioseismology, the study of solar pulsations, has given us the means to get a detailed picture of the solar interior. In this talk I shall discuss how helioseismology has allowed us to determine details of solar structure, and in turn allowing us to study basic properties of matter.

  1. Thermal comfort in sun spaces: To what extend can energy collectors and seasonal energy storages provide thermal comfort in sun space?

    Directory of Open Access Journals (Sweden)

    Christian Wiegel

    2017-10-01

    Full Text Available Preparation for fossil fuel substitution in the building sector persists as an essential subject in architectural engineering. Since the building sector still remains as one of the three major global end energy consumer – climate change is closely related to construction and design. We have developed the archetype sun space to what it is today : a simple but effective predominant naturally ventilated sun trap and as well as living space enlargement. With the invention of industrial glass orangery’s more and more changed from frost protecting envelopes to living spaces from which we meantime expect thermal comfort in high quality. But what level of thermal comfort provide sun spaces? And to what extend may sun spaces manage autarkic operation profiting from passive solar gains and, beyond that, surplus energy generation for energy neutral conditioning of aligned spaces? We deliver detailed information for this detected gap of knowledge. We know about limited thermal comfort in sun spaces winter times. This reasons the inspection of manifold collector technologies, which enable to be embedded in facades and specifically in sun space envelopes. Nonetheless, effective façade integrated collectors are ineffective in seasons with poor irradiation. Hence, the mismatch of offer and demand we have experienced with renewable energies ignites thinking about appropriate seasonal energy storages, which enlarges the research scope of this work. This PhD thesis project investigates on both, a yearly empirical test set up analysis and a virtual simulation of different oriented and located sun spaces abroad Germany. Both empirical and theoretical evaluation result in a holistic research focusing on a preferred occupation time in terms of cumulative frequencies of operational temperature and decided local discomfort, of potential autarkic sun space operation and prospective surplus exergy for alternative heating of aligned buildings. The results are mapped

  2. Mass Ejection from Old and Young Stars and the Sun

    Science.gov (United States)

    Jatenco-Pereira, V.; Opher, R.

    1990-11-01

    RESUMEN. Para poder explicar: 1) la enorme cantidad de perdida de masa y la baja velocidad asint5tica de las estrellas gigantes de o, y 2) los flujos de masa observados en protoestrellas, se sugiere un modelo para Ia perdida de masa, en donde se usa un flujo de ondas de Alfvencomo un mecanismo de aceleraci6n para los vientos de estrellas de tipo y vientos en protoestrellas. Se estudian los mecanismos de disipaci5n de las ondas de Alfven: los amortiguamientos no lineal, de superficie reso- nante y turbulento. En nuestro modelo se usa una divergente A(r) = A(R0) (r/r0)5 (donde A(r) es el area a una distancia radial r, y (A(r)/r2)max/(A(ro)/r02 - 10). Tambien se sugiere un modelo para una de hoyo coronal en el Sol. Se muestra que para satisfacer los datos observacionales en el Sol, tomando en cuenta la deposici6n del momento de las ondas de Alfven sobre el viento, se necesita: (a) una divergencia lenta en un hoyo coronal hasta una altura de 0.01 - 0.1 R seguido de (b) una divergencia rap ida de hasta una altura aproximada de 1 R . ABSTRACT: In order to explain (1) a large mass-loss rate and a small asymptotic flow speed of late-type giant stars and (2) the observed protostellar mass outflows, we suggest a model for mass loss, where we use a flux of Alfven waves as a mechanism of acceleration for late-type giant star winds and protostellar winds. We study the Alfven wave dissipation mechanisms: nonlinear damping, resonant surface damping, and turbulent damping. In our model we use a diverging geometry A(r) = A(r0) (r I r )S (where A(r) is the cross sectional area of the geometry at a radial distance r, and(A(r) I r2)max/(A(r0)/r02) = 10). We also suggest a model for a coronal hole geometry in the sun. We show that in order to satisfy the observational data of the sun, taking into account Alfven wave momentum deposition in the wind, we need: (a) a slow divergence in a coronal hole up t6 a height of 0.01 - 0.1 followed by (b) a rapid divergence up to a height of

  3. The impact of education on adolescents’ sun behavior: Experiences from Serbia

    Directory of Open Access Journals (Sweden)

    Miljković Suzana

    2014-01-01

    Full Text Available Introduction. In Serbia, there have been no broad campaigns or educational programs focused on adolescents’ sun protection. Objective. The aim of the study was to assess whether an educational program would have impact on changes of attitudes and sun-protective behaviors of high school students. More specific aim was to examine whether sex and age differences in sun behavior exists. Methods. Educational program was designed to provoke changes in attitudes towards sun protection and sun behavior. The investigation was carried out in Belgrade, Serbia in two educational cycles, during spring 2007 and 2008. Sixteen- and 17-year old high schools students were targeted and assessed before and after the educational intervention by means of self-report questionnaire designed for this study (about skin types and sun behavior. The students’ attitudes towards sun protection and sun behavior before and after the educational intervention were compared and analyzed by the Pearson's chi-square test and logistic regression analyses. In the second educational cycle (2008 age and gender differences in sun behavior were analyzed. Results. Overall 3205 students in 2007, and 2155 students in 2008 year from 11 high schools participated. A statistically significant behavior change was observed for the use of sunglasses in 2007 - the number of students using them increased from 41.6 % to 45.6% (p<0.05. There were no significant changes in other ways of protection i.e. sunscreen use, protective clothes or staying in shade. Conclusion. Educational program had an impact, but broader activities involving schools, local communities and media are needed for significant changes in sun behavior and attitude.

  4. SUN family proteins Sun4p, Uth1p and Sim1p are secreted from Saccharomyces cerevisiae and produced dependently on oxygen level.

    Science.gov (United States)

    Kuznetsov, Evgeny; Kučerová, Helena; Váchová, Libuše; Palková, Zdena

    2013-01-01

    The SUN family is comprised of proteins that are conserved among various yeasts and fungi, but that are absent in mammals and plants. Although the function(s) of these proteins are mostly unknown, they have been linked to various, often unrelated cellular processes such as those connected to mitochondrial and cell wall functions. Here we show that three of the four Saccharomyces cerevisiae SUN family proteins, Uth1p, Sim1p and Sun4p, are efficiently secreted out of the cells in different growth phases and their production is affected by the level of oxygen. The Uth1p, Sim1p, Sun4p and Nca3p are mostly synthesized during the growth phase of both yeast liquid cultures and colonies. Culture transition to slow-growing or stationary phases is linked with a decreased cellular concentration of Sim1p and Sun4p and with their efficient release from the cells. In contrast, Uth1p is released mainly from growing cells. The synthesis of Uth1p and Sim1p, but not of Sun4p, is repressed by anoxia. All four proteins confer cell sensitivity to zymolyase. In addition, Uth1p affects cell sensitivity to compounds influencing cell wall composition and integrity (such as Calcofluor white and Congo red) differently when growing on fermentative versus respiratory carbon sources. In contrast, Uth1p is essential for cell resistance to boric acids irrespective of carbon source. In summary, our novel findings support the hypothesis that SUN family proteins are involved in the remodeling of the yeast cell wall during the various phases of yeast culture development and under various environmental conditions. The finding that Uth1p is involved in cell sensitivity to boric acid, i.e. to a compound that is commonly used as an important antifungal in mycoses, opens up new possibilities of investigating the mechanisms of boric acid's action.

  5. Numerical modell for the lower overshoot layer of the Sun

    Science.gov (United States)

    Marik, Daniel

    2001-02-01

    The lower overshooting layer, which plays an important role in the dynamo mechanism, is one of the least known regions of the Sun. The most promising way to model this region is the Reynolds-stress method. In this paper we determine the radial distribution of the turbulent kinetic energy k, the mean square relative temperature fluctuation q, the normalized energy flux J, and the energy dissipation rate epsilon. We present solutions using various Delta-nabla distributions (temperature stratifications). We use a diffusive approximation for the nonlocal fluxes (``Xiong's closure''), considering the cases of both strong and weak non-locality. The resulting profiles of k and epsilon are found to be approximately linear and the profiles of the turbulent length and time scales l and tau are also similar for different cases. The shapes of these profiles thus seem to be robust properties of the solution, with little sensitivity to the particular parameter values and background stratification assumed. In contrast, we find that the penetration depth depends rather sensitively on the slope of the Delta-nabla curve and on the strength of nonlocality assumed.

  6. Where were you when the sun went out?

    Science.gov (United States)

    1999-11-01

    The total solar eclipse of 1999 will no doubt have left an impression on millions of people. Members of the Editorial Board for Physics Education share some of their feelings and memories of the event. Simon Carson writes: My children and I were at home in Driffield, East Yorkshire, on said day. Out we went in the back garden with our big refracting telescope and eight-year-old James's Early Learning Centre telescope (plastic, cheap and jolly good for the price!) and our special glasses. Come the witching hour, we trained our telescopes, with white card behind them, on the Sun. Gradually we saw the Moon's shadow edge across the Sun. As James said, `It went cold and dark and the picture on the card looked like a thin glowing line'. It was surprisingly impressive given the distance from totality. The most remarkable effect was the drop in temperature and the fact that our bright sunny mid-morning in August became more like a chilly autumn dusk. Katharine, age 6, remembers performing cartwheels in the dark! Bob Kibble writes: My partner Jean, and I, holidayed in Trier, Germany, just outside the path of totality. On the big day we awoke to rain and clouds, as did most of central Europe. The trusty motorbike, laden with a picnic and photographic gear, took us south into France. We stopped just outside Metz at a service station along with dozens of like-minded but damp and dismal onlookers. Cloud cover was layered with darker rain-bearing cloud drifting at the lowest level. Mobile phone links confirmed that it was raining in Paris, Dijon and Munich. We decided to settle for the event - at least there was a shop and `facilities'. We were joined by a group of bikers, two of whom had travelled 480 km from Denmark that very morning. The shifting cloud cover offered tantalising glimpses of the partial phase as the light level fell. There was nothing we could do but put our faith in the weather. Now you see it, now you don't. As darkness fell and the temperature likewise the

  7. SPIES: the spectropolarimetric imager for the energetic sun

    Science.gov (United States)

    Lin, Haosheng

    2012-09-01

    The SpectroPolarimetric Imager for the Energetic Sun (SPIES) is a project to develop a new class of spectropolarimetric instrument for the study of highly dynamic solar phenomena. Understanding the physics of dynamic solar phenomena requires detailed information about the magnetic, thermal, and dynamic properties of the solar atmosphere at every stage of their evolution. Although these properties can be obtained with existing highperformance spectropolarimeters such as the SpectroPolarimeter onboard the Hinode space solar observatory or the Facility IR Spectropolarimeter of the Dunn Solar Telescope, these instruments cannot observe the required field of view with temporal resolution that can resolve the dynamic timescale of these energetic events. SPIES-2K is an experimental true-imaging spectropolarimeter developed under this program to address this deficiency in our observing capability. It is based on a fiber-optic integral field unit containing 2,048 standard multimode fused silica fibers, and is capable of observing a 64 x 32 pixels field simultaneously with high spatial and spectral resolution. Moreover, it can obtain the full Stokes spectra of the field with a maximum temporal resolution of a few seconds. This paper presents the design and characteristics of the instrument, as well as preliminary results obtained at Fe I 1565 nm wavelength. Additionally, this paper also reports on recent studies of the polarization maintenance optical fiber ribbon constructed from rectangular element fibers for the Birefringence Fiber-Optic Image Slicer, and discusses its application to future generation of SPIES and other astronomical spectropolarimetry projects.

  8. Polarimetry of Cool Atmospheres: From the Sun to Exoplanets

    Science.gov (United States)

    Berdyugina, S. V.

    2011-04-01

    This is a review of a decades-long effort to develop novel tools for exploring magnetism in cold astrophysical media and to establish a new field of molecular spectropolarimetry since Berdyugina et al. (2000). It is most directly applicable to the Sun, cool stars, substellar objects, planets and other minor bodies as well as interstellar and circumstellar matter. It is close to being a mature field with developed theoretical tools poised to uncover new insights into the magnetic structures in cooler environments. Here I attempt a broad description of the literature and present some recent exciting results. In particular, following my programmatic review at SPW3, I discuss advances in molecular magnetic diagnostics which are based on the modeling of about a dozen diatomic molecules with various electronic transitions and states, including the most challenging - FeH. The applications stretch from sunspots to starspots, small-scale and turbulent solar magnetic fields, red and white dwarfs, and spin-offs such as polarimetry of protoplanetary disks and exoplanets.

  9. Vitamin D -- the sun hormone. Life in environmental mismatch.

    Science.gov (United States)

    Göring, H; Koshuchowa, S

    2015-01-01

    While some representatives of the animal kingdom were improving their biological mechanisms and properties for adapting to ever-changing life conditions, the genus Homo was developing backward: human individuals were losing their adaptation to life areas conquered earlier. Losing step-by-step their useful traits including the body hair cover, the primitive genus Homo retained his viability only under very favorable conditions of the equatorial Africa. Protection from UV radiation danger was provided only by pigmentation of skin, hair, and eyes. However, "impoverished" individuals of this genus gained the ability to walk upright. Their hands became free from participation in movement and became fine tools for producing useful instruments, from the stone knife to the computer. The major consequence of upright movement and hand development became the powerful development of the brain. A modern human, Homo sapiens, appeared capable of conquering very diverse new habitats. The human's expansion on the Earth occurred somewhat limited by his dependence on vitamin D. His expansion into new areas with lower Sun activity was partially associated with the loss of skin pigmentation. But there is an open question, whether under these new conditions he is satisfactorily provided with vitamin D. This paper discusses the following problems: how can we ensure a sufficient intake of vitamin D, how much does an individual require for his existence and optimal life, what will be consequences of vitamin D deficiency, and what are the prospects for better provision with vitamin D?

  10. DEMAID - A DESIGN MANAGER'S AID FOR INTELLIGENT DECOMPOSITION (SUN VERSION)

    Science.gov (United States)

    Rogers, J. L.

    1994-01-01

    effects of an output with respect to a change in a particular input. The second method traces backward to determine what modules must be re-executed if the output of a module must be recomputed. DeMAID is available in three machine versions: a Macintosh version which is written in Symantec's Think C 3.01, a Sun version, and an SGI IRIS version, both of which are written in C language. The Macintosh version requires system software 6.0.2 or later and CLIPS 4.3. The source code for the Macintosh version will not compile under version 4.0 of Think C; however, a sample executable is provided on the distribution media. QuickDraw is required for plotting. The Sun version requires GKS 4.1 graphics libraries, OpenWindows 3, and CLIPS 4.3. The SGI IRIS version requires CLIPS 4.3. Since DeMAID is not compatible with CLIPS 5.0 or later, the source code for CLIPS 4.3 is included on the distribution media; however, the documentation for CLIPS 4.3 is not included in the documentation package for DeMAID. It is available from COSMIC separately as the documentation for MSC-21208. The standard distribution medium for the Macintosh version of DeMAID is a set of four 3.5 inch 800K Macintosh format diskettes. The standard distribution medium for the Sun version of DeMAID is a .25 inch streaming magnetic tape cartridge (QIC-24) in UNIX tar format. The standard distribution medium for the IRIS version is a .25 inch IRIX compatible streaming magnetic tape cartridge in UNIX tar format. All versions include sample input. DeMAID was originally developed for use on VAX VMS computers in 1989. The Macintosh version of DeMAID was released in 1991 and updated in 1992. The Sun version of DeMAID was released in 1992 and updated in 1993. The SGI IRIS version was released in 1993.

  11. Nutritional Rickets among Children in a Sun Rich Country

    Directory of Open Access Journals (Sweden)

    Bener Abdulbari

    2010-09-01

    Full Text Available Objective. This study describes the magnitude and characteristics of nutritional rickets and associated risk factors among children in Qatar. Subjects. A consecutive sample of 730 healthy subjects who visited the primay health care clinics were approached and 540 (73.9% subjects gave consent. Mehods. Nutritional rickets diagnosis was based on clinical radiologic and biochemical parameters and normalization of alkaline phosphatase level after 6 weeks course of daily vitamin D therapy. Results. The study revealed that 23.9% of the studied children had nutritional rickets. The mean SD age of those with rickets (3.76 years 1.51 was slightly higher than those without rickets (3.57 years 1.45. Family history of vitamin D deficiency (44.2%; P = .001 and diabetes mellitus (53.5%; P = .002 were significantly higher in rachitic children than in nonrachitic children. The children with rickets spent a significantly shorter average duration (26.86 minutes 19.94 under the sun than those without rickets (30.59 minutes 15.72; . A significantly larger proportion of rachitic children was afflicted with vitamin D deficiency (75.2% versus 62.2%; , secondary hypothyroidism (100% versus 7.5%; P = .009 and muscular weakness (56.6% versus 26.3%; . Conclusion. The most important risk factors were low vitamin D and calcium intakes, lack of exposure to sunlight, prolonged breast feeding without supplementation of vitamin D.

  12. Sizing procedures for sun-tracking PV system with batteries

    Directory of Open Access Journals (Sweden)

    Gerek Ömer Nezih

    2017-01-01

    Full Text Available Deciding optimum number of PV panels, wind turbines and batteries (i.e. a complete renewable energy system for minimum cost and complete energy balance is a challenging and interesting problem. In the literature, some rough data models or limited recorded data together with low resolution hourly averaged meteorological values are used to test the sizing strategies. In this study, active sun tracking and fixed PV solar power generation values of ready-to-serve commercial products are recorded throughout 2015–2016. Simultaneously several outdoor parameters (solar radiation, temperature, humidity, wind speed/direction, pressure are recorded with high resolution. The hourly energy consumption values of a standard 4-person household, which is constructed in our campus in Eskisehir, Turkey, are also recorded for the same period. During sizing, novel parametric random process models for wind speed, temperature, solar radiation, energy demand and electricity generation curves are achieved and it is observed that these models provide sizing results with lower LLP through Monte Carlo experiments that consider average and minimum performance cases. Furthermore, another novel cost optimization strategy is adopted to show that solar tracking PV panels provide lower costs by enabling reduced number of installed batteries. Results are verified over real recorded data.

  13. Sun protection and Vitamin D: three dimensions of obfuscation.

    Science.gov (United States)

    Gilchrest, Barbara A

    2007-03-01

    Ultraviolet (UV) radiation is a proven carcinogen, responsible for more than half of all human malignancies. It also compromises skin appearance and function. Since the UV action spectra for DNA damage, skin cancer and Vitamin D(3) (vit D) photosynthesis are identical and vit D is readily available from oral supplements, why has sun protection become controversial, now that some data suggest conventionally "sufficient" levels of vit D may be less than optimal for at least some population groups? First, the media and apparently some researchers are hungry for a new message. Nevertheless, after 50 years, UV exposure is still a major avoidable health hazard. Second, the controversy is fueled by a powerful special interest group: the indoor tanning industry. They target not the frail elderly or inner-city ethnic minorities, groups for whom evidence of vit D insufficiency is strongest, but rather fair-skinned teenagers and young adults, those at highest risk of UV photodamage. Third, evolution does not keep pace with civilization. When nature gave man the appealing capacity for vit D photosynthesis, the expected lifespan was far less than 40 years. Long-term photodamage was not a concern, and vit D was not available at the corner store. The medical community should avoid sensationalism and instead rigorously explore possible cause-and-effect relationships between vit D status and specific diseases while advocating the safest possible means of assuring vit D sufficiency.

  14. Sizing procedures for sun-tracking PV system with batteries

    Science.gov (United States)

    Nezih Gerek, Ömer; Başaran Filik, Ümmühan; Filik, Tansu

    2017-11-01

    Deciding optimum number of PV panels, wind turbines and batteries (i.e. a complete renewable energy system) for minimum cost and complete energy balance is a challenging and interesting problem. In the literature, some rough data models or limited recorded data together with low resolution hourly averaged meteorological values are used to test the sizing strategies. In this study, active sun tracking and fixed PV solar power generation values of ready-to-serve commercial products are recorded throughout 2015-2016. Simultaneously several outdoor parameters (solar radiation, temperature, humidity, wind speed/direction, pressure) are recorded with high resolution. The hourly energy consumption values of a standard 4-person household, which is constructed in our campus in Eskisehir, Turkey, are also recorded for the same period. During sizing, novel parametric random process models for wind speed, temperature, solar radiation, energy demand and electricity generation curves are achieved and it is observed that these models provide sizing results with lower LLP through Monte Carlo experiments that consider average and minimum performance cases. Furthermore, another novel cost optimization strategy is adopted to show that solar tracking PV panels provide lower costs by enabling reduced number of installed batteries. Results are verified over real recorded data.

  15. SELF-CANCELLATION OF EPHEMERAL REGIONS IN THE QUIET SUN

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Shuhong; Zhang, Jun; Li, Ting [Key Laboratory of Solar Activity, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China); Liu, Yang, E-mail: shuhongyang@nao.cas.cn, E-mail: zjun@nao.cas.cn, E-mail: liting@nao.cas.cn, E-mail: yliu@sun.stanford.edu [W.W. Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305-4085 (United States)

    2012-06-20

    With the observations from the Helioseismic and Magnetic Imager aboard the Solar Dynamics Observatory, we statistically investigate the ephemeral regions (ERs) in the quiet Sun. We find that there are two types of ERs: normal ERs (NERs) and self-canceled ERs (SERs). Each NER emerges and grows with separation of its opposite polarity patches which will cancel or coalesce with other surrounding magnetic flux. Each SER also emerges and grows and its dipolar patches separate at first, but a part of the magnetic flux of the SER will move together and cancel gradually, which is described with the term 'self-cancellation' by us. We identify 2988 ERs, among which there are 190 SERs, about 6.4% of the ERs. The mean value of self-cancellation fraction of SERs is 62.5%, and the total self-canceled flux of SERs is 9.8% of the total ER flux. Our results also reveal that the higher the ER magnetic flux is, (1) the easier the performance of ER self-cancellation is, (2) the smaller the self-cancellation fraction is, and (3) the more the self-canceled flux is. We think that the self-cancellation of SERs is caused by the submergence of magnetic loops connecting the dipolar patches, without magnetic energy release.

  16. Thermal aspects of open sun drying of various crops

    Energy Technology Data Exchange (ETDEWEB)

    Jain, D.; Tiwari, G.N. [Indian Inst. of Technology, Center for Energy Studies, New Delhi (India)

    2003-01-01

    Open sun drying (OSD) is the most common method of crop drying in developing countries. Despite several disadvantages, it is widely practiced because it is a simple way of drying. Crop temperature, temperature around the crop, solar temperature, and rate of moisture evaporation are the important parameters in OSD. The thermal behavior of OSD of green chillies, green pea, white gram (kabuli chana), onions, potatoes, and cauliflower was studied. The heat transfer analysis which is mainly dependent on the rate of moisture transfer has also been extended during drying process. A mathematical model has been developed to predict the crop temperature, rate of moisture removal, and solar temperature for a steady state condition. The rate of moisture transfer for potato slices and cauliflower was significantly higher than that in other crops. A fair agreement was observed between predicted and experimental results with coefficient of correlations ranging from 0.8936 to 0.7520, 0.9792-0.4172, and 0.9986-0.9942 for crop temperature, temperature above the crop surface, and rate of the moisture removal during drying, respectively except potato slices. (Author)

  17. Lip sun protection factor of a lipstick sunscreen.

    Science.gov (United States)

    Gabard, B; Ademola, J

    2001-01-01

    There is a well-documented need for effective human UVA and UVB photoprotection. Since there are important anatomical variations, the sun protection factor (SPF) of a lipstick sunscreen was measured on the anatomical site intended for use. The SPF tests were performed according to Federal US and European COLIPA guidelines. Prior to performing a test on the lip, the minimal erythemal dose (MED) of the unprotected back skin was determined. Subsequently, the sunscreen SPF was measured on the anatomical target site (lip). The evaluator was blinded with respect to scoring the SPF of each sunscreen treatment. Individual test sites were assigned to one of the following treatment conditions: (1) no treatment (MED of unprotected skin); (2) test formulation; (3) reference standard. The MED on unprotected back skin was found to be 25% lower than on unprotected lip skin. The SPF of the lipstick sunscreen was measured 2 units lower than the SPF determined in the classical way on the back skin. It was hypothesized that the higher MED of the lower lip compared with back skin was due to the adaptation of this tissue to the continuous exposure to UV radiation. Copyright 2001 S. Karger AG, Basel

  18. High-energy particles very near the sun

    Science.gov (United States)

    Goldstein, B. E.

    1988-01-01

    NASA's long range plans include a Solar Probe (Star Probe) mission in which a spacecraft is placed in an eccentric orbit with perihelion at four solar radii. As part of the study effort for this mission, a Solar Probe Environment Workshop was sponsored by JPL. The report of this committee was issued in September 1978 as JPL Publication 78-64. A brief abstract of this document is given. There are considerable uncertainties in the models of solar energetic particle release and transport. The committee addressed this problem by using different modelling techniques when possible to provide a cross-check on the estimates. These models were used to extrapolate observation at 1 AU to the vicinity of the Sun. Additionally, the occurrence of a flare of a given magnitude must be estimated on a statistical basis. Therefore, it is possible to state a likelihood that the fluxes and fluences will be less than a certain magnitude, but in the event of an extremely large solar flare (occurrence of perhaps once a decade, e.g., August 4, 1972) it is likely that the hazard would be insurmountable. A brief first look indicates that the near-solar particle environment is not a worse hazard than Jupiter.

  19. Dose dependent sun protective effect of topical melatonin

    DEFF Research Database (Denmark)

    Scheuer, Cecilie; Pommergaard, Hans-Christian; Rosenberg, Jacob

    2016-01-01

    BACKGROUND: Ultraviolet radiation (UVR) by sunlight results in an increasing number of skin conditions. Earlier studies have suggested a protective effect of topical treatment with the pineal hormone melatonin. However, this protective effect has never been evaluated in natural sunlight, and the ......BACKGROUND: Ultraviolet radiation (UVR) by sunlight results in an increasing number of skin conditions. Earlier studies have suggested a protective effect of topical treatment with the pineal hormone melatonin. However, this protective effect has never been evaluated in natural sunlight...... to 2:02 PM local time and UV-index was 9. Primary outcome was reduction in erythema evaluated by chromatography after sun exposure, when treated with topical melatonin cream (0.5%, 2.5%, 12.5%) versus placebo and no treatment. The erythema reaction was evaluated with chromatography and visual scoring...... at baseline, one, four, eight and 24h after exposure. RESULTS: Significant difference in erythema formation was found between areas treated with melatonin cream 12.5% and areas receiving placebo or no treatment (repeated measures ANOVA p=0.001). No differences were found between placebo and the 0.5% and 2...

  20. Gender Determination using Fingertip Features | Wang | Internet ...

    African Journals Online (AJOL)

    Several previous studies have investigated the gender difference of the fingerprint features. However, regarding to the statistical significance of such differences, inconsistent results have been obtained. To resolve this problem and to develop a method for gender determination, this work proposes and tests three fingertip ...