Deletion of admB gene encoding a fungal ADAM affects cell wall construction in Aspergillus oryzae.

Science.gov (United States)

Kobayashi, Takuji; Maeda, Hiroshi; Takeuchi, Michio; Yamagata, Youhei

2017-05-01

Mammals possess a unique signaling system based on the proteolytic mechanism of a disintegrin and metalloproteinases (ADAMs) on the cell surface. We found two genes encoding ADAMs in Aspergillus oryzae and named them admA and admB. We produced admA and admB deletion strains to elucidate their biological function and clarify whether fungal ADAMs play a similar role as in mammals. The ∆admA∆admB and ∆admB strains were sensitive to cell wall-perturbing agents, congo red, and calcofluor white. Moreover, the two strains showed significantly increased weights of total alkali-soluble fractions from the mycelial cell wall compared to the control strain. Furthermore, ∆admB showed MpkA phosphorylation at lower concentration of congo red stimulation than the control strain. However, the MpkA phosphorylation level was not different between ∆admB and the control strain without the stimulation. The results indicated that A. oryzae AdmB involved in the cell wall integrity without going through the MpkA pathway.

Differences in glycosyltransferase family 61 accompany variation in seed coat mucilage composition in Plantago spp.

Science.gov (United States)

Phan, Jana L.; Tucker, Matthew R.; Khor, Shi Fang; Shirley, Neil; Lahnstein, Jelle; Beahan, Cherie; Bacic, Antony; Burton, Rachel A.

2016-01-01

Xylans are the most abundant non-cellulosic polysaccharide found in plant cell walls. A diverse range of xylan structures influence tissue function during growth and development. Despite the abundance of xylans in nature, details of the genes and biochemical pathways controlling their biosynthesis are lacking. In this study we have utilized natural variation within the Plantago genus to examine variation in heteroxylan composition and structure in seed coat mucilage. Compositional assays were combined with analysis of the glycosyltransferase family 61 (GT61) family during seed coat development, with the aim of identifying GT61 sequences participating in xylan backbone substitution. The results reveal natural variation in heteroxylan content and structure, particularly in P. ovata and P. cunninghamii, species which show a similar amount of heteroxylan but different backbone substitution profiles. Analysis of the GT61 family identified specific sequences co-expressed with IRREGULAR XYLEM 10 genes, which encode putative xylan synthases, revealing a close temporal association between xylan synthesis and substitution. Moreover, in P. ovata, several abundant GT61 sequences appear to lack orthologues in P. cunninghamii. Our results indicate that natural variation in Plantago species can be exploited to reveal novel details of seed coat development and polysaccharide biosynthetic pathways. PMID:27856710

Many Saccharomyces cerevisiae Cell Wall Protein Encoding Genes Are Coregulated by Mss11, but Cellular Adhesion Phenotypes Appear Only Flo Protein Dependent.

Science.gov (United States)

Bester, Michael C; Jacobson, Dan; Bauer, Florian F

2012-01-01

The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.

A conserved fungal glycosyltransferase facilitates pathogenesis of plants by enabling hyphal growth on solid surfaces.

Directory of Open Access Journals (Sweden)

Robert King

2017-10-01

Full Text Available Pathogenic fungi must extend filamentous hyphae across solid surfaces to cause diseases of plants. However, the full inventory of genes which support this is incomplete and many may be currently concealed due to their essentiality for the hyphal growth form. During a random T-DNA mutagenesis screen performed on the pleomorphic wheat (Triticum aestivum pathogen Zymoseptoria tritici, we acquired a mutant unable to extend hyphae specifically when on solid surfaces. In contrast "yeast-like" growth, and all other growth forms, were unaffected. The inability to extend surface hyphae resulted in a complete loss of virulence on plants. The affected gene encoded a predicted type 2 glycosyltransferase (ZtGT2. Analysis of >800 genomes from taxonomically diverse fungi highlighted a generally widespread, but discontinuous, distribution of ZtGT2 orthologues, and a complete absence of any similar proteins in non-filamentous ascomycete yeasts. Deletion mutants of the ZtGT2 orthologue in the taxonomically un-related fungus Fusarium graminearum were also severely impaired in hyphal growth and non-pathogenic on wheat ears. ZtGT2 expression increased during filamentous growth and electron microscopy on deletion mutants (ΔZtGT2 suggested the protein functions to maintain the outermost surface of the fungal cell wall. Despite this, adhesion to leaf surfaces was unaffected in ΔZtGT2 mutants and global RNAseq-based gene expression profiling highlighted that surface-sensing and protein secretion was also largely unaffected. However, ΔZtGT2 mutants constitutively overexpressed several transmembrane and secreted proteins, including an important LysM-domain chitin-binding virulence effector, Zt3LysM. ZtGT2 likely functions in the synthesis of a currently unknown, potentially minor but widespread, extracellular or outer cell wall polysaccharide which plays a key role in facilitating many interactions between plants and fungi by enabling hyphal growth on solid matrices.

A conserved fungal glycosyltransferase facilitates pathogenesis of plants by enabling hyphal growth on solid surfaces

Science.gov (United States)

Plummer, Amy; Halsey, Kirstie; Lovegrove, Alison; Hammond-Kosack, Kim

2017-01-01

Pathogenic fungi must extend filamentous hyphae across solid surfaces to cause diseases of plants. However, the full inventory of genes which support this is incomplete and many may be currently concealed due to their essentiality for the hyphal growth form. During a random T-DNA mutagenesis screen performed on the pleomorphic wheat (Triticum aestivum) pathogen Zymoseptoria tritici, we acquired a mutant unable to extend hyphae specifically when on solid surfaces. In contrast “yeast-like” growth, and all other growth forms, were unaffected. The inability to extend surface hyphae resulted in a complete loss of virulence on plants. The affected gene encoded a predicted type 2 glycosyltransferase (ZtGT2). Analysis of >800 genomes from taxonomically diverse fungi highlighted a generally widespread, but discontinuous, distribution of ZtGT2 orthologues, and a complete absence of any similar proteins in non-filamentous ascomycete yeasts. Deletion mutants of the ZtGT2 orthologue in the taxonomically un-related fungus Fusarium graminearum were also severely impaired in hyphal growth and non-pathogenic on wheat ears. ZtGT2 expression increased during filamentous growth and electron microscopy on deletion mutants (ΔZtGT2) suggested the protein functions to maintain the outermost surface of the fungal cell wall. Despite this, adhesion to leaf surfaces was unaffected in ΔZtGT2 mutants and global RNAseq-based gene expression profiling highlighted that surface-sensing and protein secretion was also largely unaffected. However, ΔZtGT2 mutants constitutively overexpressed several transmembrane and secreted proteins, including an important LysM-domain chitin-binding virulence effector, Zt3LysM. ZtGT2 likely functions in the synthesis of a currently unknown, potentially minor but widespread, extracellular or outer cell wall polysaccharide which plays a key role in facilitating many interactions between plants and fungi by enabling hyphal growth on solid matrices. PMID:29020037

Tomato UDP-Glucose Sterol Glycosyltransferases: A Family of Developmental and Stress Regulated Genes that Encode Cytosolic and Membrane-Associated Forms of the Enzyme

Directory of Open Access Journals (Sweden)

Karla Ramirez-Estrada

2017-06-01

Full Text Available Sterol glycosyltransferases (SGTs catalyze the glycosylation of the free hydroxyl group at C-3 position of sterols to produce sterol glycosides. Glycosylated sterols and free sterols are primarily located in cell membranes where in combination with other membrane-bound lipids play a key role in modulating their properties and functioning. In contrast to most plant species, those of the genus Solanum contain very high levels of glycosylated sterols, which in the case of tomato may account for more than 85% of the total sterol content. In this study, we report the identification and functional characterization of the four members of the tomato (Solanum lycopersicum cv. Micro-Tom SGT gene family. Expression of recombinant SlSGT proteins in E. coli cells and N. benthamiana leaves demonstrated the ability of the four enzymes to glycosylate different sterol species including cholesterol, brassicasterol, campesterol, stigmasterol, and β-sitosterol, which is consistent with the occurrence in their primary structure of the putative steroid-binding domain found in steroid UDP-glucuronosyltransferases and the UDP-sugar binding domain characteristic for a superfamily of nucleoside diphosphosugar glycosyltransferases. Subcellular localization studies based on fluorescence recovery after photobleaching and cell fractionation analyses revealed that the four tomato SGTs, like the Arabidopsis SGTs UGT80A2 and UGT80B1, localize into the cytosol and the PM, although there are clear differences in their relative distribution between these two cell fractions. The SlSGT genes have specialized but still largely overlapping expression patterns in different organs of tomato plants and throughout the different stages of fruit development and ripening. Moreover, they are differentially regulated in response to biotic and abiotic stress conditions. SlSGT4 expression increases markedly in response to osmotic, salt, and cold stress, as well as upon treatment with abscisic

Characterization of RbmD (glycosyltransferase in ribostamycin gene cluster) through neomycin production reconstituted from the engineered Streptomyces fradiae BS1.

Science.gov (United States)

Nepal, Keshav Kumar; Oh, Tae-Jin; Subba, Bimala; Yoo, Jin Cheol; Sohng, Jae Kyung

2009-01-31

Amino acid homology analysis predicted that rbmD, a putative glycosyltransferase from Streptomyces ribosidificus ATCC 21294, has the highest homology with neoD in neomycin biosynthesis. S. fradiae BS1, in which the production of neomycin was abolished, was generated by disruption of the neoD gene in the neomycin producer S. fradiae. The restoration of neomycin by self complementation suggested that there was no polar effect in the mutant. In addition, S. fradiae BS6 was created with complementation by rbmD in S. fradiae BS1, and secondary metabolite analysis by ESI/MS, LC/MS and MS/MS showed the restoration of neomycin production in S. fradiae BS6. These gene inactivation and complementation studies suggested that, like neoD, rbmD functions as a 2-N-acetlyglucosaminyltransferase and demonstrated the potential for the generation of novel aminoglycoside antibiotics using glycosyltransferases in vivo.

[Gene deletion and functional analysis of the heptyl glycosyltransferase (waaF) gene in Vibrio parahemolyticus O-antigen cluster].

Science.gov (United States)

Zhao, Feng; Meng, Songsong; Zhou, Deqing

2016-02-04

To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.

Functional Characterization of a Flavonoid Glycosyltransferase in Sweet Orange (Citrus sinensis).

Science.gov (United States)

Liu, Xiaogang; Lin, Cailing; Ma, Xiaodi; Tan, Yan; Wang, Jiuzhao; Zeng, Ming

2018-01-01

Fruits of sweet orange ( Citrus sinensis ), a popular commercial Citrus species, contain high concentrations of flavonoids beneficial to human health. These fruits predominantly accumulate O -glycosylated flavonoids, in which the disaccharides [neohesperidose (rhamnosyl-α-1,2-glucose) or rutinose (rhamnosyl-α-1,6-glucose)] are linked to the flavonoid aglycones through the 3- or 7-hydroxyl sites. The biotransformation of the flavonoid aglycones into O -rutinosides or O -neohesperidosides in the Citrus plants usually consists of two glycosylation reactions involving a series of uridine diphosphate-sugar dependent glycosyltransferases (UGTs). Although several genes encoding flavonoid UGTs have been functionally characterized in the Citrus plants, full elucidation of the flavonoid glycosylation process remains elusive. Based on the available genomic and transcriptome data, we isolated a UGT with a high expression level in the sweet orange fruits that possibly encodes a flavonoid glucosyltransferase and/or rhamnosyltransferase. Biochemical analyses revealed that a broad range of flavonoid substrates could be glucosylated at their 3- and/or 7-hydrogen sites by the recombinant enzyme, including hesperetin, naringenin, diosmetin, quercetin, and kaempferol. Furthermore, overexpression of the gene could significantly increase the accumulations of quercetin 7- O -rhamnoside, quercetin 7- O -glucoside, and kaempferol 7- O -glucoside, implying that the enzyme has flavonoid 7- O -glucosyltransferase and 7- O -rhamnosyltransferase activities in vivo .

Genome-wide analysis of cell wall-related genes in Tuber melanosporum.

Science.gov (United States)

Balestrini, Raffaella; Sillo, Fabiano; Kohler, Annegret; Schneider, Georg; Faccio, Antonella; Tisserant, Emilie; Martin, Francis; Bonfante, Paola

2012-06-01

A genome-wide inventory of proteins involved in cell wall synthesis and remodeling has been obtained by taking advantage of the recently released genome sequence of the ectomycorrhizal Tuber melanosporum black truffle. Genes that encode cell wall biosynthetic enzymes, enzymes involved in cell wall polysaccharide synthesis or modification, GPI-anchored proteins and other cell wall proteins were identified in the black truffle genome. As a second step, array data were validated and the symbiotic stage was chosen as the main focus. Quantitative RT-PCR experiments were performed on 29 selected genes to verify their expression during ectomycorrhizal formation. The results confirmed the array data, and this suggests that cell wall-related genes are required for morphogenetic transition from mycelium growth to the ectomycorrhizal branched hyphae. Labeling experiments were also performed on T. melanosporum mycelium and ectomycorrhizae to localize cell wall components.

Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

KAUST Repository

Lee, H.

2010-02-26

Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

KAUST Repository

Lee, H.; Damsz, B.; Woloshuk, C. P.; Bressan, R. A.; Narasimhan, Meena L.

2010-01-01

Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

Glycosyltransferases as marker genes for the quantitative polymerase chain reaction-based detection of circulating tumour cells from blood samples of patients with breast cancer undergoing adjuvant therapy.

Science.gov (United States)

Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich

2015-08-01

Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.

Genetic and epigenetic alterations of the blood group ABO gene in oral squamous cell carcinoma

DEFF Research Database (Denmark)

Gao, Shan; Worm, Jesper; Guldberg, Per

2004-01-01

Loss of histo-blood group A and B antigen expression is a frequent event in oral carcinomas and is associated with decreased activity of glycosyltransferases encoded by the ABO gene. We examined 30 oral squamous cell carcinomas for expression of A and B antigens and glycosyltransferases. We also....... Collectively, we have identified molecular events that may account for loss of A/B antigen expression in 67% of oral squamous cell carcinomas....

Isolation and characterization of gene sequences expressed in cotton fiber

Directory of Open Access Journals (Sweden)

Taciana de Carvalho Coutinho

2016-06-01

Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

Expression, purification, crystallization and preliminary X-ray characterization of a putative glycosyltransferase of the GT-A fold found in mycobacteria

Energy Technology Data Exchange (ETDEWEB)

Fulton, Zara [The Protein Crystallography Unit, Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Monash University, Clayton, Victoria 3800 (Australia); Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Clayton, Victoria 3800 (Australia); Crellin, Paul K.; Brammananth, Rajini [Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Clayton, Victoria 3800 (Australia); Department of Microbiology, School of Biomedical Sciences, Monash University, Clayton, Victoria 3800 (Australia); Zaker-Tabrizi, Leyla [The Protein Crystallography Unit, Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Monash University, Clayton, Victoria 3800 (Australia); Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Clayton, Victoria 3800 (Australia); Coppel, Ross L. [Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Clayton, Victoria 3800 (Australia); Department of Microbiology, School of Biomedical Sciences, Monash University, Clayton, Victoria 3800 (Australia); Rossjohn, Jamie, E-mail: jamie.rossjohn@med.monash.edu.au; Beddoe, Travis, E-mail: jamie.rossjohn@med.monash.edu.au [The Protein Crystallography Unit, Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Monash University, Clayton, Victoria 3800 (Australia); Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Clayton, Victoria 3800 (Australia)

2008-05-01

MAP2569c from M. avium subsp. paratuberculosis, a putative glycosyltransferase implicated in mycobacterial cell-wall biosynthesis, was cloned, expressed, purified and crystallized. X-ray diffraction data were collected to 1.8 Å resolution. Glycosidic bond formation is a ubiquitous enzyme-catalysed reaction. This glycosyltransferase-mediated process is responsible for the biosynthesis of innumerable oligosaccharides and glycoconjugates and is often organism- or cell-specific. However, despite the abundance of genomic information on glycosyltransferases (GTs), there is a lack of structural data for this versatile class of enzymes. Here, the cloning, expression, purification and crystallization of an essential 329-amino-acid (34.8 kDa) putative GT of the classic GT-A fold implicated in mycobacterial cell-wall biosynthesis are reported. Crystals of MAP2569c from Mycobacterium avium subsp. paratuberculosis were grown in 1.6 M monoammonium dihydrogen phosphate and 0.1 M sodium citrate pH 5.5. A complete data set was collected to 1.8 Å resolution using synchrotron radiation from a crystal belonging to space group P4{sub 1}2{sub 1}2.

Expression, purification, crystallization and preliminary X-ray characterization of a putative glycosyltransferase of the GT-A fold found in mycobacteria

International Nuclear Information System (INIS)

Fulton, Zara; Crellin, Paul K.; Brammananth, Rajini; Zaker-Tabrizi, Leyla; Coppel, Ross L.; Rossjohn, Jamie; Beddoe, Travis

2008-01-01

MAP2569c from M. avium subsp. paratuberculosis, a putative glycosyltransferase implicated in mycobacterial cell-wall biosynthesis, was cloned, expressed, purified and crystallized. X-ray diffraction data were collected to 1.8 Å resolution. Glycosidic bond formation is a ubiquitous enzyme-catalysed reaction. This glycosyltransferase-mediated process is responsible for the biosynthesis of innumerable oligosaccharides and glycoconjugates and is often organism- or cell-specific. However, despite the abundance of genomic information on glycosyltransferases (GTs), there is a lack of structural data for this versatile class of enzymes. Here, the cloning, expression, purification and crystallization of an essential 329-amino-acid (34.8 kDa) putative GT of the classic GT-A fold implicated in mycobacterial cell-wall biosynthesis are reported. Crystals of MAP2569c from Mycobacterium avium subsp. paratuberculosis were grown in 1.6 M monoammonium dihydrogen phosphate and 0.1 M sodium citrate pH 5.5. A complete data set was collected to 1.8 Å resolution using synchrotron radiation from a crystal belonging to space group P4 1 2 1 2

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

An iterative glycosyltransferase EntS catalyzes transfer and extension of O- and S-linked monosaccharide in enterocin 96.

Science.gov (United States)

Nagar, Rupa; Rao, Alka

2017-05-12

Glycosyltransferases are essential tools for in vitro-glycoengineering. Bacteria harbor an unexplored variety of protein glycosyltransferases. Here, we describe a peptide glycosyltransferase (EntS) encoded by ORF0417 of Enterococcus faecalis TX0104. EntS di-glycosylates linear peptide of enterocin 96- a known antibacterial, in vitro. It is capable of transferring as well as extending the glycan onto the peptide in an iterative sequential dissociative manner. It can catalyze multiple linkages: Glc/Gal(-O)Ser/Thr, Glc/Gal(-S)Cys and Glc/Gal(β)Glc/Gal(-O/S)Ser/Thr/Cys, in one pot. Using EntS generated glycovariants of enterocin 96 peptide, size and identity of the glycan are found to influence bioactivity of the peptide. The study identifies EntS as an enzyme worth pursuing, for in vitro peptide glycoengineering. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Glycosyltransferase family 43 is also found in early eukaryotes and has three subfamilies in Charophycean green algae.

Directory of Open Access Journals (Sweden)

Rahil Taujale

Full Text Available The glycosyltransferase family 43 (GT43 has been suggested to be involved in the synthesis of xylans in plant cell walls and proteoglycans in animals. Very recently GT43 family was also found in Charophycean green algae (CGA, the closest relatives of extant land plants. Here we present evidence that non-plant and non-animal early eukaryotes such as fungi, Haptophyceae, Choanoflagellida, Ichthyosporea and Haptophyceae also have GT43-like genes, which are phylogenetically close to animal GT43 genes. By mining RNA sequencing data (RNA-Seq of selected plants, we showed that CGA have evolved three major groups of GT43 genes, one orthologous to IRX14 (IRREGULAR XYLEM14, one orthologous to IRX9/IRX9L and the third one ancestral to all land plant GT43 genes. We confirmed that land plant GT43 has two major clades A and B, while in angiosperms, clade A further evolved into three subclades and the expression and motif pattern of A3 (containing IRX9 are fairly different from the other two clades likely due to rapid evolution. Our in-depth sequence analysis contributed to our overall understanding of the early evolution of GT43 family and could serve as an example for the study of other plant cell wall-related enzyme families.

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

Science.gov (United States)

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

Structure and Mechanism of Staphylococcus aureus TarS, the Wall Teichoic Acid β-glycosyltransferase Involved in Methicillin Resistance.

Directory of Open Access Journals (Sweden)

Solmaz Sobhanifar

2016-12-01

Full Text Available In recent years, there has been a growing interest in teichoic acids as targets for antibiotic drug design against major clinical pathogens such as Staphylococcus aureus, reflecting the disquieting increase in antibiotic resistance and the historical success of bacterial cell wall components as drug targets. It is now becoming clear that β-O-GlcNAcylation of S. aureus wall teichoic acids plays a major role in both pathogenicity and antibiotic resistance. Here we present the first structure of S. aureus TarS, the enzyme responsible for polyribitol phosphate β-O-GlcNAcylation. Using a divide and conquer strategy, we obtained crystal structures of various TarS constructs, mapping high resolution overlapping N-terminal and C-terminal structures onto a lower resolution full-length structure that resulted in a high resolution view of the entire enzyme. Using the N-terminal structure that encapsulates the catalytic domain, we furthermore captured several snapshots of TarS, including the native structure, the UDP-GlcNAc donor complex, and the UDP product complex. These structures along with structure-guided mutants allowed us to elucidate various catalytic features and identify key active site residues and catalytic loop rearrangements that provide a valuable platform for anti-MRSA drug design. We furthermore observed for the first time the presence of a trimerization domain composed of stacked carbohydrate binding modules, commonly observed in starch active enzymes, but adapted here for a poly sugar-phosphate glycosyltransferase.

Novel staphylococcal glycosyltransferases SdgA and SdgB mediate immunogenicity and protection of virulence-associated cell wall proteins.

Directory of Open Access Journals (Sweden)

Wouter L W Hazenbos

Full Text Available Infection of host tissues by Staphylococcus aureus and S. epidermidis requires an unusual family of staphylococcal adhesive proteins that contain long stretches of serine-aspartate dipeptide-repeats (SDR. The prototype member of this family is clumping factor A (ClfA, a key virulence factor that mediates adhesion to host tissues by binding to extracellular matrix proteins such as fibrinogen. However, the biological siginificance of the SDR-domain and its implication for pathogenesis remain poorly understood. Here, we identified two novel bacterial glycosyltransferases, SdgA and SdgB, which modify all SDR-proteins in these two bacterial species. Genetic and biochemical data demonstrated that these two glycosyltransferases directly bind and covalently link N-acetylglucosamine (GlcNAc moieties to the SDR-domain in a step-wise manner, with SdgB appending the sugar residues proximal to the target Ser-Asp repeats, followed by additional modification by SdgA. GlcNAc-modification of SDR-proteins by SdgB creates an immunodominant epitope for highly opsonic human antibodies, which represent up to 1% of total human IgG. Deletion of these glycosyltransferases renders SDR-proteins vulnerable to proteolysis by human neutrophil-derived cathepsin G. Thus, SdgA and SdgB glycosylate staphylococcal SDR-proteins, which protects them against host proteolytic activity, and yet generates major eptopes for the human anti-staphylococcal antibody response, which may represent an ongoing competition between host and pathogen.

Drosophila egghead encodes a beta 1,4-mannosyltransferase predicted to form the immediate precursor glycosphingolipid substrate for brainiac

DEFF Research Database (Denmark)

Wandall, Hans H; Pedersen, Johannes W; Park, Chaeho

2002-01-01

-N-acetylglucosamine:beta Man beta 1,3-N-acetylglucosaminyltransferase (beta 3GlcNAc-transferase) tentatively assigned a key role in biosynthesis of arthroseries glycosphingolipids and forming the trihexosylceramide, GlcNAc beta 1-3Man beta 1-4Glc beta 1-1Cer. In the present study we demonstrate that egghead encodes a Golgi......-located GDP-mannose:beta Glc beta 1,4-mannosyltransferase tentatively assigned a biosynthetic role to form the precursor arthroseries glycosphingolipid substrate for Brainiac, Man beta 1-4Glc beta 1-1Cer. Egghead is unique among eukaryotic glycosyltransferase genes in that homologous genes are limited...

Bacterial origin of a diverse family of UDP-glycosyltransferase genes in the Tetranychus urticae genome

NARCIS (Netherlands)

Ahn, S.J.; Dermauw, W.; Wybouw, N.; Heckel, D.G.; Van Leeuwen, T.

2014-01-01

UDP-glycosyltransferases (UGTs) catalyze the conjugation of a variety of small lipophilic molecules with uridine diphosphate (UDP) sugars, altering them into more water-soluble metabolites. Thereby, UGTs play an important role in the detoxification of xenobiotics and in the regulation of

UGT74D1 is a novel auxin glycosyltransferase from Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Shang-Hui Jin

Full Text Available Auxin is one type of phytohormones that plays important roles in nearly all aspects of plant growth and developmental processes. The glycosylation of auxins is considered to be an essential mechanism to control the level of active auxins. Thus, the identification of auxin glycosyltransferases is of great significance for further understanding the auxin regulation. In this study, we biochemically screened the group L of Arabidopsis thaliana glycosyltransferase superfamily for enzymatic activity toward auxins. UGT74D1 was identified to be a novel auxin glycosyltransferase. Through HPLC and LC-MS analysis of reaction products in vitro by testing eight substrates including auxins and other compounds, we found that UGT74D1 had a strong glucosylating activity toward indole-3-butyric acid [IBA], indole-3-propionic acid [IPA], indole-3-acetic acid [IAA] and naphthaleneacetic acid [NAA], catalyzing them to form corresponding glucose esters. Biochemical characterization showed that this enzyme had a maximum activity in HEPES buffer at pH 6.0 and 37°C. In addition, the enzymatic activity analysis of crude protein and the IBA metabolite analysis from transgenic Arabidopsis plants overexpressing UGT74D1 gene were also carried out. Experimental results indicated that over-production of the UGT74D1 in plants indeed led to increased level of the glucose conjugate of IBA. Moreover, UGT74D1 overexpression lines displayed curling leaf phenotype, suggesting a physiological role of UGT74D1 in affecting the activity of auxins. Our current data provide a new target gene for further genetic studies to understand the auxin regulation by glycosylation in plants.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Massive lateral transfer of genes encoding plant cell wall-degrading enzymes to the mycoparasitic fungus Trichoderma from its plant-associated hosts

Science.gov (United States)

Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.

2018-01-01

Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596

Evolution of glycosaminoglycans and their glycosyltransferases: Implications for the extracellular matrices of animals and the capsules of pathogenic bacteria.

Science.gov (United States)

DeAngelis, Paul L

2002-11-01

Glycosaminoglycans (linear polysaccharides with a repeating disaccharide backbone containing an amino sugar) are essential components of extracellular matrices of animals. These complex molecules play important structural, adhesion, and signaling roles in mammals. Direct detection of glycosaminoglycans has been reported in a variety of organisms, but perhaps more definitive tests for the glycosyltransferase genes should be utilized to clarify the distribution of glycosaminoglycans in metazoans. Recently, glycosyltransferases that form the hyaluronan, heparin/heparan, or chondroitin backbone were identified at the molecular level. The three types of glycosyltransferases appear to have evolved independently based on sequence comparisons and other characteristics. All metazoans appear to possess heparin/heparan. Chondroitin is found in some worms, arthropods, and higher animals. Hyaluronan is found only in two of the three main branches of chordates. The presence of several types of glycosaminoglycans in the body allows multiple communication channels and adhesion systems to operate simultaneously. Certain pathogenic bacteria produce extracellular coatings, called capsules, which are composed of glycosaminoglycans that increase their virulence during infection. The capsule helps shield the microbe from the host defenses and/or modulates host physiology. The bacterial and animal polysaccharides are chemically identical or at least very similar. Therefore, no immune response is generated, in contrast to the vast majority of capsular polymers from other bacteria. In microbial systems, it appears that in most cases functional convergent evolution of glycosaminoglycan glycosyltransferases occurred, rather than direct horizontal gene transfer from their vertebrate hosts. Copyright 2002 Wiley-Liss, Inc.

Glycosyltransferase glycosylating flavokermesic acid and/or kermesic acid

DEFF Research Database (Denmark)

2016-01-01

An isolated glycosyltransferase (GT) polypeptide capable of: (I) : conjugating glucose to flavokermesic acid (FK); and/or (II) : conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid.......An isolated glycosyltransferase (GT) polypeptide capable of: (I) : conjugating glucose to flavokermesic acid (FK); and/or (II) : conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid....

GLYCOSYLTRANSFERASE GLYCOSYLATING FLAVOKERMESIC ACID AND/OR KERMESIC ACID

DEFF Research Database (Denmark)

2015-01-01

An isolated glycosyltransferase (GT) polypeptide capable of: (I): conjugating glucose to flavokermesic acid (FK); and/or (II): conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid.......An isolated glycosyltransferase (GT) polypeptide capable of: (I): conjugating glucose to flavokermesic acid (FK); and/or (II): conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid....

Studying of the function of expected ABC transporter Rv1458c-Rv1457c-Rv1456c in mycobacteria; Studium funkcie predpokladaneho ABC transportera Rv1458c-Rv1457c-Rv1456c v mykobakteriach

Energy Technology Data Exchange (ETDEWEB)

Sarkan, M; Mikusova, K; Kordulakova, J [Univerzita Komenskeho v Bratislave, Prirodovedecka fakulta, Katedra biochemie, 84215 Bratislava (Slovakia)

2012-04-25

The bacterium Mycobacterium tuberculosis - the originator of tuberculosis in humans - is characterized by a complex cell wall, which is responsible for a high bacteria resistant to adverse external environmental conditions, as well as to the common antibiotics. The structure of the cell wall components and enzymes involved into its biosynthesis are relatively well described, but there is no information on the transfer of intermediate products of its biosynthetic across the plasmatic membrane. Orthologues of genes rv1459c-rv1458c-rv1457c-rv1456c of M. tuberculosis are in the same configuration in genomes of all previously sequenced mycobacterial strains. Rv1459c gene encodes a probable glycosyltransferases and genes rv1458c, rv1457c rv1456c code nucleotide binding and transmembrane subunits of expected ABC transporter. In our work we focused on the study of the function of expected ABC transporter Rv1458c-Rv1457c-Rv1456c, through analysis of phenotypes of strains M. Smegmatis. They have orthologues of genes encoding the transmembrane subunits of this transporter suspended by fragment encoding resistance to kanamycin. (authors)

The Fusarium oxysporum gnt2, encoding a putative N-acetylglucosamine transferase, is involved in cell wall architecture and virulence.

Directory of Open Access Journals (Sweden)

Loida López-Fernández

Full Text Available With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity.

The Fusarium oxysporum gnt2, Encoding a Putative N-Acetylglucosamine Transferase, Is Involved in Cell Wall Architecture and Virulence

Science.gov (United States)

López-Fernández, Loida; Ruiz-Roldán, Carmen; Pareja-Jaime, Yolanda; Prieto, Alicia; Khraiwesh, Husam; Roncero, M. Isabel G.

2013-01-01

With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt) in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity. PMID:24416097

Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

Science.gov (United States)

Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

2014-04-18

The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Identification of the mpl gene encoding UDP-N-acetylmuramate: L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase in Escherichia coli and its role in recycling of cell wall peptidoglycan.

Science.gov (United States)

Mengin-Lecreulx, D; van Heijenoort, J; Park, J T

1996-01-01

A gene, mpl, encoding UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelat e ligase was recognized by its amino acid sequence homology with murC as the open reading frame yjfG present at 96 min on the Escherichia coli map. The existence of such an enzymatic activity was predicted from studies indicating that reutilization of the intact tripeptide L-alanyl-gamma-D-glutamyl-meso-diaminopimelate occurred and accounted for well over 30% of new cell wall synthesis. Murein tripeptide ligase activity could be demonstrated in crude extracts, and greatly increased activity was produced when the gene was cloned and expressed under control of the trc promoter. A null mutant totally lacked activity but was viable, showing that the enzyme is not essential for growth. PMID:8808921

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Wounding coordinately induces cell wall protein, cell cycle and pectin methyl esterase genes involved in tuber closing layer and wound periderm development.

Science.gov (United States)

Neubauer, Jonathan D; Lulai, Edward C; Thompson, Asunta L; Suttle, Jeffrey C; Bolton, Melvin D

2012-04-15

Little is known about the coordinate induction of genes that may be involved in agriculturally important wound-healing events. In this study, wound-healing events were determined together with wound-induced expression profiles of selected cell cycle, cell wall protein, and pectin methyl esterase genes using two diverse potato genotypes and two harvests (NDTX4271-5R and Russet Burbank tubers; 2008 and 2009 harvests). By 5 d after wounding, the closing layer and a nascent phellogen had formed. Phellogen cell divisions generated phellem layers until cessation of cell division at 28 d after wounding for both genotypes and harvests. Cell cycle genes encoding epidermal growth factor binding protein (StEBP), cyclin-dependent kinase B (StCDKB) and cyclin-dependent kinase regulatory subunit (StCKS1At) were induced by 1 d after wounding; these expressions coordinated with related phellogen formation and the induction and cessation of phellem cell formation. Genes encoding the structural cell wall proteins extensin (StExt1) and extensin-like (StExtlk) were dramatically up-regulated by 1-5 d after wounding, suggesting involvement with closing layer and later phellem cell layer formation. Wounding up-regulated pectin methyl esterase genes (StPME and StPrePME); StPME expression increased during closing layer and phellem cell formation, whereas maximum expression of StPrePME occurred at 5-14 d after wounding, implicating involvement in later modifications for closing layer and phellem cell formation. The coordinate induction and expression profile of StTLRP, a gene encoding a cell wall strengthening "tyrosine-and lysine-rich protein," suggested a role in the formation of the closing layer followed by phellem cell generation and maturation. Collectively, the genes monitored were wound-inducible and their expression profiles markedly coordinated with closing layer formation and the index for phellogen layer meristematic activity during wound periderm development; results were more

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

The cell wall stress response in Aspergillus niger involves increased expression of the glutamine: Fructose-6-phosphate amidotransferase-encoding gene (gfaA) and increased deposition of chitin in the cell wall

NARCIS (Netherlands)

Ram, A.F.J.; Arentshorst, M.; Damveld, R.A.; Kuyk, P.A. van; Klis, F.M.; Hondel, C.A.M.J.J. van den

2004-01-01

Perturbation of cell wall synthesis in Saccharomyces cerevisiae, either by mutations in cell wall synthesis-related genes or by adding compounds that interfere with normal cell wall assembly, triggers a compensatory response to ensure cell wall integrity. This response includes an increase in chitin

Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

NARCIS (Netherlands)

Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

The Sg-1 Glycosyltransferase Locus Regulates Structural Diversity of Triterpenoid Saponins of Soybean[W][OA

Science.gov (United States)

Sayama, Takashi; Ono, Eiichiro; Takagi, Kyoko; Takada, Yoshitake; Horikawa, Manabu; Nakamoto, Yumi; Hirose, Aya; Sasama, Hiroko; Ohashi, Mihoko; Hasegawa, Hisakazu; Terakawa, Teruhiko; Kikuchi, Akio; Kato, Shin; Tatsuzaki, Nana; Tsukamoto, Chigen; Ishimoto, Masao

2012-01-01

Triterpene saponins are a diverse group of biologically functional products in plants. Saponins usually are glycosylated, which gives rise to a wide diversity of structures and functions. In the group A saponins of soybean (Glycine max), differences in the terminal sugar species located on the C-22 sugar chain of an aglycone core, soyasapogenol A, were observed to be under genetic control. Further genetic analyses and mapping revealed that the structural diversity of glycosylation was determined by multiple alleles of a single locus, Sg-1, and led to identification of a UDP-sugar–dependent glycosyltransferase gene (Glyma07g38460). Although their sequences are highly similar and both glycosylate the nonacetylated saponin A0-αg, the Sg-1a allele encodes the xylosyltransferase UGT73F4, whereas Sg-1b encodes the glucosyltransferase UGT73F2. Homology models and site-directed mutagenesis analyses showed that Ser-138 in Sg-1a and Gly-138 in Sg-1b proteins are crucial residues for their respective sugar donor specificities. Transgenic complementation tests followed by recombinant enzyme assays in vitro demonstrated that sg-10 is a loss-of-function allele of Sg-1. Considering that the terminal sugar species in the group A saponins are responsible for the strong bitterness and astringent aftertastes of soybean seeds, our findings herein provide useful tools to improve commercial properties of soybean products. PMID:22611180

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Assay and heterologous expression in Pichia pastoris of plant cell wall type-II membrane anchored glycosyltransferases

DEFF Research Database (Denmark)

Petersen, Bent; Egelund, Jack; Damager, Iben

2009-01-01

.011 to 0.013 U (1 U = 1 nmol conversion of substrate * min(-1) * microl medium(-1)) similar to those of RGXT1 and RGXT2 expressed in Baculovirus transfected insect Sf9 cells. In summary, the data presented suggest that Pichia is an attractive host candidate for expression of plant glycosyltransferases.......Two Arabidopsis xylosyltransferases, designated RGXT1 and RGXT2, were recently expressed in Baculovirus transfected insect cells and by use of the free sugar assay shown to catalyse transfer of D-xylose from UDP-alpha-D-xylose to L-fucose and derivatives hereof. We have now examined expression...

A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

NARCIS (Netherlands)

Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

2008-01-01

To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

Identification and functional characterization of a flax UDP-glycosyltransferase glucosylating secoisolariciresinol (SECO) into secoisolariciresinol monoglucoside (SMG) and diglucoside (SDG).

Science.gov (United States)

Ghose, Kaushik; Selvaraj, Kumarakurubaran; McCallum, Jason; Kirby, Chris W; Sweeney-Nixon, Marva; Cloutier, Sylvie J; Deyholos, Michael; Datla, Raju; Fofana, Bourlaye

2014-03-28

Lignans are a class of diphenolic nonsteroidal phytoestrogens often found glycosylated in planta. Flax seeds are a rich source of secoisolariciresinol diglucoside (SDG) lignans. Glycosylation is a process by which a glycosyl group is covalently attached to an aglycone substrate and is catalyzed by uridine diphosphate glycosyltransferases (UGTs). Until now, very little information was available on UGT genes that may play a role in flax SDG biosynthesis. Here we report on the identification, structural and functional characterization of 5 putative UGTs potentially involved in secoisolariciresinol (SECO) glucosylation in flax. Five UGT genes belonging to the glycosyltransferases' family 1 (EC 2.4.x.y) were cloned and characterized. They fall under four UGT families corresponding to five sub-families referred to as UGT74S1, UGT74T1, UGT89B3, UGT94H1, UGT712B1 that all display the characteristic plant secondary product glycosyltransferase (PSPG) conserved motif. However, diversity was observed within this 44 amino acid sequence, especially in the two peptide sequences WAPQV and HCGWNS known to play a key role in the recognition and binding of diverse aglycone substrates and in the sugar donor specificity. In developing flax seeds, UGT74S1 and UGT94H1 showed a coordinated gene expression with that of pinoresinol-lariciresinol reductase (PLR) and their gene expression patterns correlated with SDG biosynthesis. Enzyme assays of the five heterologously expressed UGTs identified UGT74S1 as the only one using SECO as substrate, forming SECO monoglucoside (SMG) and then SDG in a sequential manner. We have cloned and characterized five flax UGTs and provided evidence that UGT74S1 uses SECO as substrate to form SDG in vitro. This study allowed us to propose a model for the missing step in SDG lignan biosynthesis.

Expression, purification, crystallization and preliminary X-ray characterization of a putative glycosyltransferase of the GT-A fold found in mycobacteria

Energy Technology Data Exchange (ETDEWEB)

Fulton, Zara; Crellin, Paul K.; Brammananth, Rajini; Zaker-Tabrizi, Leyla; Coppel, Ross L.; Rossjohna, Jamie; Beddoe, Travis (Monash)

2008-05-28

Glycosidic bond formation is a ubiquitous enzyme-catalysed reaction. This glycosyltransferase-mediated process is responsible for the biosynthesis of innumerable oligosaccharides and glycoconjugates and is often organism- or cell-specific. However, despite the abundance of genomic information on glycosyltransferases (GTs), there is a lack of structural data for this versatile class of enzymes. Here, the cloning, expression, purification and crystallization of an essential 329-amino-acid (34.8 kDa) putative GT of the classic GT-A fold implicated in mycobacterial cell-wall biosynthesis are reported. Crystals of MAP2569c from Mycobacterium avium subsp. paratuberculosis were grown in 1.6 M monoammonium dihydrogen phosphate and 0.1 M sodium citrate pH 5.5. A complete data set was collected to 1.8 {angstrom} resolution using synchrotron radiation from a crystal belonging to space group P4{sub 1}2{sub 1}2.

A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

NARCIS (Netherlands)

Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

2008-01-01

To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning of a gene encoding glycosyltransferase from Pueraria ...

African Journals Online (AJOL)

, fusion protein migrated as a single protein band with a molecular weight of 55 kDa. A yeast expression vector pPICZA-PlUGT1 was constructed and was transformed into Pichia pastoris strain GS115. Several recombinants containing ...

Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.

Science.gov (United States)

Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

2015-09-02

Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Brittle stalk 2 encodes a putative glycosylphosphatidylinositol-anchored protein that affects mechanical strength of maize tissues by altering the composition and structure of secondary cell walls.

Science.gov (United States)

Ching, Ada; Dhugga, Kanwarpal S; Appenzeller, Laura; Meeley, Robert; Bourett, Timothy M; Howard, Richard J; Rafalski, Antoni

2006-10-01

A spontaneous maize mutant, brittle stalk-2 (bk2-ref), exhibits dramatically reduced tissue mechanical strength. Reduction in mechanical strength in the stalk tissue was highly correlated with a reduction in the amount of cellulose and an uneven deposition of secondary cell wall material in the subepidermal and perivascular sclerenchyma fibers. Cell wall accounted for two-thirds of the observed reduction in dry matter content per unit length of the mutant stalk in comparison to the wildtype stalk. Although the cell wall composition was significantly altered in the mutant in comparison to the wildtype stalks, no compensation by lignin and cell wall matrix for reduced cellulose amount was observed. We demonstrate that Bk2 encodes a Cobra-like protein that is homologous to the rice Bc1 protein. In the bk2-ref gene, a 1 kb transposon-like element is inserted in the beginning of the second exon, disrupting the open reading frame. The Bk2 gene was expressed in the stalk, husk, root, and leaf tissues, but not in the embryo, endosperm, pollen, silk, or other tissues with comparatively few or no secondary cell wall containing cells. The highest expression was in the isolated vascular bundles. In agreement with its role in secondary wall formation, the expression pattern of the Bk2 gene was very similar to that of the ZmCesA10, ZmCesA11, and ZmCesA12 genes, which are known to be involved in secondary wall formation. We have isolated an independent Mutator-tagged allele of bk2, referred to as bk2-Mu7, the phenotype of which is similar to that of the spontaneous mutant. Our results demonstrate that mutations in the Bk2 gene affect stalk strength in maize by interfering with the deposition of cellulose in the secondary cell wall in fiber cells.

Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.

Science.gov (United States)

Lowe, A M; Deresiewicz, R L

1999-01-01

Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.

Bacterial Glycosyltransferases: Challenges and opportunities of a highly diverse enzyme class toward tailoring natural products

Directory of Open Access Journals (Sweden)

Jochen eSchmid

2016-02-01

Full Text Available The enzyme subclass of glycosyltransferases (EC 2.4 currently comprises 97 families as specified by CAZy classification. One of their important roles is in the biosynthesis of disaccharides, oligosaccharides and polysaccharides by catalyzing the transfer of sugar moieties from activated donor molecules to other sugar molecules. In addition glycosyltransferases also catalyze the transfer of sugar moieties onto aglycons, which is of great relevance for the synthesis of many high value natural products. Bacterial glycosyltransferases show a higher sequence similarity in comparison to mammalian ones. Even when most glycosyltransferases are poorly explored, state of the art technologies, such as protein engineering, domain swapping or computational analysis strongly enhance our understanding and utilization of these very promising classes of proteins. This perspective article will focus on bacterial glycosyltransferases, especially on classification, screening and engineering strategies to alter substrate specificity. The future development in these fields as well as obstacles and challenges will be highlighted and discussed.

2003 Plant Cell Walls Gordon Conference

Energy Technology Data Exchange (ETDEWEB)

Daniel J. Cosgrove

2004-09-21

This conference will address recent progress in many aspects of cell wall biology. Molecular, genetic, and genomic approaches are yielding major advances in our understanding of the composition, synthesis, and architecture of plant cell walls and their dynamics during growth, and are identifying the genes that encode the machinery needed to make their biogenesis possible. This meeting will bring together international scientists from academia, industry and government labs to share the latest breakthroughs and perspectives on polysaccharide biosynthesis, wood formation, wall modification, expansion and interaction with other organisms, and genomic & evolutionary analyses of wall-related genes, as well as to discuss recent ''nanotechnological'' advances that take wall analysis to the level of a single cell.

A web-based resource for the Arabidopsis P450, cytochromes b5, NADPH-cytochrome P450 reductases, and family 1 glycosyltransferases (http://www.P450.kvl.dk).

Science.gov (United States)

Paquette, Suzanne M; Jensen, Kenneth; Bak, Søren

2009-12-01

Gene and genome duplication is a key driving force in evolution of plant diversity. This has resulted in a number of large multi-gene families. Two of the largest multi-gene families in plants are the cytochromes P450 (P450s) and family 1 glycosyltransferases (UGTs). These two families are key players in evolution, especially of plant secondary metabolism, and in adaption to abiotic and biotic stress. In the model plant Arabidopsis thaliana there are 246 and 112 cytochromes P450 and UGTs, respectively. The Arabidopsis P450, cytochromes b(5), NADPH-cytochrome P450 reductases, and family 1 glycosyltransferases website (http://www.P450.kvl.dk) is a sequence repository of manually curated sequences, multiple sequence alignments, phylogenetic trees, sequence motif logos, 3D structures, intron-exon maps, and customized BLAST datasets.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Engineering of factors determining alpha-amylase and cyclodextrin glycosyltransferase specificity in the cyclodextrin glycosyltransferase from Thermoanaerobacterium thermosulfurigenes EM1

NARCIS (Netherlands)

Wind, RD; Buitelaar, RM; Dijkhuizen, L

1998-01-01

The starch-degrading enzymes alpha-amylase and cyclodextrin glycosyltransferase (CGTase) are functionally and structurally closely related, with CGTases containing two additional domains (called D and E) compared to the three domains of alpha-amylases (A, B and C). Amino acid residue 196

Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

Science.gov (United States)

Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

2016-07-01

Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.

Disruption of cell walls for enhanced lipid recovery

Science.gov (United States)

Knoshaug, Eric P; Donohoe, Bryon S; Gerken, Henri; Laurens, Lieve; Van Wychen, Stefanie Rose

2015-03-24

Presented herein are methods of using cell wall degrading enzymes for recovery of internal lipid bodies from biomass sources such as algae. Also provided are algal cells that express at least one exogenous gene encoding a cell wall degrading enzyme and methods for recovering lipids from the cells.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Recent advances on the posttranslational modifications of EXTs and their roles in plant cell walls

DEFF Research Database (Denmark)

Velasquez, Melina; Salter, Juan Salgado; Dorosz, Javier Gloazzo

2012-01-01

The genetic set up and the enzymes that define the O-glycosylation sites and transfer the activated sugars to cell wall glycoprotein Extensins (EXTs) have remained unknown for a long time. We are now beginning to see the emerging components of the molecular machinery that assembles these complex O......-glycoproteins on the plant cell wall. Genes conferring the posttranslational modifications, i.e., proline hydroxylation and subsequent O-glycosylation, of the EXTs have been recently identified. In this review we summarize the enzymes that define the O-glycosylation sites on the O-glycoproteins, i.e., the prolyl 4......-hydroxylases (P4Hs), the glycosyltransferases that transfer arabinose units (named arabinosyltransferases, AraTs), and the one responsible for transferring a single galactose (galactosyltransferase, GalT) on the protein EXT backbones. We discuss the effects of posttranslational modifications on the structure...

A temperature-sensitive allele of a putative mRNA splicing helicase down-regulates many cell wall genes and causes radial swelling in Arabidopsis thaliana.

Science.gov (United States)

Howles, Paul A; Gebbie, Leigh K; Collings, David A; Varsani, Arvind; Broad, Ronan C; Ohms, Stephen; Birch, Rosemary J; Cork, Ann H; Arioli, Tony; Williamson, Richard E

2016-05-01

The putative RNA helicase encoded by the Arabidopsis gene At1g32490 is a homolog of the yeast splicing RNA helicases Prp2 and Prp22. We isolated a temperature-sensitive allele (rsw12) of the gene in a screen for root radial swelling mutants. Plants containing this allele grown at the restrictive temperature showed weak radial swelling, were stunted with reduced root elongation, and contained reduced levels of cellulose. The role of the protein was further explored by microarray analysis. By using both fold change cutoffs and a weighted gene coexpression network analysis (WGCNA) to investigate coexpression of genes, we found that the radial swelling phenotype was not linked to genes usually associated with primary cell wall biosynthesis. Instead, the mutation has strong effects on expression of secondary cell wall related genes. Many genes potentially associated with secondary walls were present in the most significant WGCNA module, as were genes coding for arabinogalactans and proteins with GPI anchors. The proportion of up-regulated genes that possess introns in rsw12 was above that expected if splicing was unrelated to the activity of the RNA helicase, suggesting that the helicase does indeed play a role in splicing in Arabidopsis. The phenotype may be due to a change in the expression of one or more genes coding for cell wall proteins.

Patterns of expression of cell wall related genes in sugarcane

Directory of Open Access Journals (Sweden)

Lima D.U.

2001-01-01

Full Text Available Our search for genes related to cell wall metabolism in the sugarcane expressed sequence tag (SUCEST database (http://sucest.lbi.dcc.unicamp.br resulted in 3,283 reads (1% of the total reads which were grouped into 459 clusters (potential genes with an average of 7.1 reads per cluster. To more clearly display our correlation coefficients, we constructed surface maps which we used to investigate the relationship between cell wall genes and the sugarcane tissues libraries from which they came. The only significant correlations that we found between cell wall genes and/or their expression within particular libraries were neutral or synergetic. Genes related to cellulose biosynthesis were from the CesA family, and were found to be the most abundant cell wall related genes in the SUCEST database. We found that the highest number of CesA reads came from the root and stem libraries. The genes with the greatest number of reads were those involved in cell wall hydrolases (e.g. beta-1,3-glucanases, xyloglucan endo-beta-transglycosylase, beta-glucosidase and endo-beta-mannanase. Correlation analyses by surface mapping revealed that the expression of genes related to biosynthesis seems to be associated with the hydrolysis of hemicelluloses, pectin hydrolases being mainly associated with xyloglucan hydrolases. The patterns of cell wall related gene expression in sugarcane based on the number of reads per cluster reflected quite well the expected physiological characteristics of the tissues. This is the first work to provide a general view on plant cell wall metabolism through the expression of related genes in almost all the tissues of a plant at the same time. For example, developing flowers behaved similarly to both meristematic tissues and leaf-root transition zone tissues. Besides providing a basis for future research on the mechanisms of plant development which involve the cell wall, our findings will provide valuable tools for plant engineering in the

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Rare ginsenoside Ia synthesized from F1 by cloning and overexpression of the UDP-glycosyltransferase gene from Bacillus subtilis: synthesis, characterization, and in vitro melanogenesis inhibition activity in BL6B16 cells.

Science.gov (United States)

Wang, Dan-Dan; Jin, Yan; Wang, Chao; Kim, Yeon-Ju; Perez, Zuly Elizabeth Jimenez; Baek, Nam In; Mathiyalagan, Ramya; Markus, Josua; Yang, Deok-Chun

2018-01-01

Ginsenoside F1 has been described to possess skin-whitening effects on humans. We aimed to synthesize a new ginsenoside derivative from F1 and investigate its cytotoxicity and melanogenesis inhibitory activity in B16BL6 cells using recombinant glycosyltransferase enzyme. Glycosylation has the advantage of synthesizing rare chemical compounds from common compounds with great ease. UDP-glycosyltransferase (BSGT1) gene from Bacillus subtilis was selected for cloning. The recombinant glycosyltransferase enzyme was purified, characterized, and utilized to enzymatically transform F1 into its derivative. The new product was characterized by NMR techniques and evaluated by MTT, melanin count, and tyrosinase inhibition assay. The new derivative was identified as (20 S )-3 β ,6 α ,12 β ,20-tetrahydroxydammar-24-ene-20- O - β -D-glucopyranosyl-3- O - β -D-glucopyranoside (ginsenoside Ia), which possesses an additional glucose linked into the C-3 position of substrate F1. Ia had been previously reported; however, no in vitro biological activity was further examined. This study focused on the mass production of arduous ginsenoside Ia from accessible F1 and its inhibitory effect of melanogenesis in B16BL6 cells. Ia showed greater inhibition of melanin and tyrosinase at 100 μmol/L than F1 and arbutin. These results suggested that Ia decreased cellular melanin synthesis in B16BL6 cells through downregulation of tyrosinase activity. To our knowledge, this is the first study to report on the mass production of rare ginsenoside Ia from F1 using recombinant UDP-glycosyltransferase isolated from B. subtillis and its superior melanogenesis inhibitory activity in B16BL6 cells as compared to its precursor. In brief, ginsenoside Ia can be applied for further study in cosmetics.

Sterol glycosyltransferases--the enzymes that modify sterols.

Science.gov (United States)

Chaturvedi, Pankaj; Misra, Pratibha; Tuli, Rakesh

2011-09-01

Sterols are important components of cell membranes, hormones, signalling molecules and defense-related biotic and abiotic chemicals. Sterol glycosyltransferases (SGTs) are enzymes involved in sterol modifications and play an important role in metabolic plasticity during adaptive responses. The enzymes are classified as a subset of family 1 glycosyltransferases due to the presence of a signature motif in their primary sequence. These enzymes follow a compulsory order sequential mechanism forming a ternary complex. The diverse applications of sterol glycosides, like cytotoxic and apoptotic activity, anticancer activity, medicinal values, anti-stress roles and anti-insect and antibacterial properties, draws attention towards their synthesis mechanisms. Many secondary metabolites are derived from sterol pathways, which are important in defense mechanisms against pathogens. SGTs in plants are involved in changed sensitivity to stress hormones and their agrochemical analogs and changed tolerance to biotic and abiotic stresses. SGTs that glycosylate steroidal hormones, such as brassinosteroids, function as growth and development regulators in plants. In terms of metabolic roles, it can be said that SGTs occupy important position in plant metabolism and may offer future tools for crop improvement.

Cloning of a gene encoding glycosyltransferase from Pueraria lobata

African Journals Online (AJOL)

user

2011-01-03

Jan 3, 2011 ... Full Length Research Paper. Cloning ... 2Guangzhou Sugarcane Industry Research Institute, Guangzhou 510316, China. ..... min at 4°C and then washed once with deionized water after ..... Brierley RA, Davis RG, Holtz CG (1994). .... Kita M, Hirata Y, Moriguchi T, Endo-Inagaki T, Matsumoto R, Hasegawa.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Sub-cellular localisation of fukutin related protein in different cell lines and in the muscle of patients with MDC1C and LGMD2I

DEFF Research Database (Denmark)

Torelli, Silvia; Brown, Susan C; Brockington, Martin

2005-01-01

MDC1C and LGMD2I are two allelic forms of muscular dystrophies caused by mutations in the gene encoding for fukutin related protein (FKRP). FKRP encodes for a putative glycosyltransferase, the precise function of which is unknown. However, the marked reduction of alpha-dystroglycan glycosylation ...

XTH31, Encoding an in Vitro XEH/XET-Active Enzyme, Regulates Aluminum Sensitivity by Modulating in Vivo XET Action, Cell Wall Xyloglucan Content, and Aluminum Binding Capacity in Arabidopsis[W

Science.gov (United States)

Zhu, Xiao Fang; Shi, Yuan Zhi; Lei, Gui Jie; Fry, Stephen C.; Zhang, Bao Cai; Zhou, Yi Hua; Braam, Janet; Jiang, Tao; Xu, Xiao Yan; Mao, Chuan Zao; Pan, Yuan Jiang; Yang, Jian Li; Wu, Ping; Zheng, Shao Jian

2012-01-01

Xyloglucan endohydrolase (XEH) and xyloglucan endotransglucosylase (XET) activities, encoded by xyloglucan endotransglucosylase-hydrolase (XTH) genes, are involved in cell wall extension by cutting or cutting and rejoining xyloglucan chains, respectively. However, the physiological significance of this biochemical activity remains incompletely understood. Here, we find that an XTH31 T-DNA insertion mutant, xth31, is more Al resistant than the wild type. XTH31 is bound to the plasma membrane and the encoding gene is expressed in the root elongation zone and in nascent leaves, suggesting a role in cell expansion. XTH31 transcript accumulation is strongly downregulated by Al treatment. XTH31 expression in yeast yields a protein with an in vitro XEH:XET activity ratio of >5000:1. xth31 accumulates significantly less Al in the root apex and cell wall, shows remarkably lower in vivo XET action and extractable XET activity, has a lower xyloglucan content, and exhibits slower elongation. An exogenous supply of xyloglucan significantly ameliorates Al toxicity by reducing Al accumulation in the roots, owing to the formation of an Al-xyloglucan complex in the medium, as verified by an obvious change in chemical shift of 27Al-NMR. Taken together, the data indicate that XTH31 affects Al sensitivity by modulating cell wall xyloglucan content and Al binding capacity. PMID:23204407

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Association Mapping of Cell Wall Synthesis Regulatory Genes and Cell Wall Quality in Switchgrass

Energy Technology Data Exchange (ETDEWEB)

Bartley, Laura [Univ. of Oklahoma, Norman, OK (United States). Dept. of Microbiology and Plant Biology; Wu, Y. [Oklahoma State Univ., Stillwater, OK (United States); Zhu, L. [Oklahoma State Univ., Stillwater, OK (United States); Brummer, E. C. [Noble Foundation, Ardmore, OK (United States); Saha, M. [Noble Foundation, Ardmore, OK (United States)

2016-05-31

Inefficient conversion of biomass to biofuels is one of the main barriers for biofuel production from such materials. Approximately half of polysaccharides in biomass remain unused by typical biochemical conversion methods. Conversion efficiency is influenced by the composition and structure of cell walls of biomass. Grasses such as wheat, maize, and rice, as well as dedicated perennial bioenergy crops, like switchgrass, make up ~55% of biomass that can be produced in the United States. Grass cell walls have a different composition and patterning compared with dicotyledonous plants, including the well-studied model plant, Arabidopsis. This project identified genetic determinants of cell wall composition in grasses using both naturally occurring genetic variation of switchgrass and gene network reconstruction and functional assays in rice. In addition, the project linked functional data in rice and other species to switchgrass improvement efforts through curation of the most abundant class of regulators in the switchgrass genome. Characterizing natural diversity of switchgrass for variation in cell wall composition and properties, also known as quality, provides an unbiased avenue for identifying biologically viable diversity in switchgrass cell walls. To characterizing natural diversity, this project generated cell wall composition and enzymatic deconstruction data for ~450 genotypes of the Switchgrass Southern Association Collection (SSAC), a diverse collection composed of 36 switchgrass accessions from the southern U.S. distribution of switchgrass. Comparing these data with other measures of cell wall quality for the same samples demonstrated the complementary nature of the diverse characterization platforms now being used for biomass characterization. Association of the composition data with ~3.2K single nucleotide variant markers identified six significant single nucleotide variant markers co-associated with digestibility and another compositional trait. These

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

The MP65 gene is required for cell wall integrity, adherence to epithelial cells and biofilm formation in Candida albicans

Directory of Open Access Journals (Sweden)

Girolamo Antonietta

2011-05-01

Full Text Available Abstract Background The MP65 gene of Candida albicans (orf19.1779 encodes a putative β-glucanase mannoprotein of 65 kDa, which plays a main role in a host-fungus relationship, morphogenesis and pathogenicity. In this study, we performed an extensive analysis of a mp65Δ mutant to assess the role of this protein in cell wall integrity, adherence to epithelial cells and biofilm formation. Results The mp65Δ mutant showed a high sensitivity to a range of cell wall-perturbing and degrading agents, especially Congo red, which induced morphological changes such as swelling, clumping and formation of hyphae. The mp65Δ mutant showed an activation of two MAPKs (Mkc1p and Cek1p, a high level of expression of two stress-related genes (DDR48 and SOD5, and a modulated expression of β-glucan epitopes, but no gross changes in cell wall polysaccharide composition. Interestingly, the mp65Δ mutant displayed a marked reduction in adhesion to BEC and Caco-2 cells and severe defects in biofilm formation when compared to the wild type. All of the mentioned properties were totally or partially recovered in a revertant strain, demonstrating the specificity of gene deletion. Conclusions We demonstrate that the MP65 gene of Candida albicans plays a significant role in maintaining cell wall integrity, as well as in adherence to epithelia and biofilm formation, which are major virulence attributes of this fungus.

Atomistic insight into the catalytic mechanism of glycosyltransferases by combined quantum mechanics/molecular mechanics (QM/MM) methods.

Science.gov (United States)

Tvaroška, Igor

2015-02-11

Glycosyltransferases catalyze the formation of glycosidic bonds by assisting the transfer of a sugar residue from donors to specific acceptor molecules. Although structural and kinetic data have provided insight into mechanistic strategies employed by these enzymes, molecular modeling studies are essential for the understanding of glycosyltransferase catalyzed reactions at the atomistic level. For such modeling, combined quantum mechanics/molecular mechanics (QM/MM) methods have emerged as crucial. These methods allow the modeling of enzymatic reactions by using quantum mechanical methods for the calculation of the electronic structure of the active site models and treating the remaining enzyme environment by faster molecular mechanics methods. Herein, the application of QM/MM methods to glycosyltransferase catalyzed reactions is reviewed, and the insight from modeling of glycosyl transfer into the mechanisms and transition states structures of both inverting and retaining glycosyltransferases are discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.

Transfer action of cyclodextrin glycosyltransferase on starch

Energy Technology Data Exchange (ETDEWEB)

Kitahata, S; Okada, S [Osaka City Technical Research Inst. (Japan)

1975-11-01

The transglycosylation reaction of the cyclodextrin glycosyltransferase from Bacillus megaterium (No. 5 enzyme) and Bacillus macerans (BMA) were examined. No.5 enzyme was more efficient in transglycosylation reaction than BMA in the every acceptor employed in the present study. The order of the efficient acceptors for No. 5 enzyme was maltose (G2), glucose (G1), maltotriose (G3) and sucrose (GF). On the other hand, that found for BMA was G1, G2, GF and G3. The transglycosylation products to glucose formed by the action of No. 5 enzyme on starch were G2, G3, maltotetraose (G4), maltopentaose (G5), maltohexaose (G6) and maltoheptaose (G7) in the order of their quantities, while, in the case of BMA, they were G2, G3, G5, G7 = G4 and G6. The larger transglycosylation products to sucrose formed by the action of No. 5 enzyme on starch were maltosylfructose. On the other hand, that formed by the action of BMA was maltoheptaosylfructose. It was suggested that cyclodextrin glycosyltransferase could transfer the glucosyl residues to an acceptor directly from starch, as well as through cyclodextrin.

Expression analysis of cell wall assembly and remodelling-related genes in Arabidopsis roots subjected to boron stress and brassinosteroid at different developmental stages

Directory of Open Access Journals (Sweden)

Rabia İşkil

2018-04-01

Full Text Available ABSTRACT Plant cell walls are affected by many biotic and abiotic stress conditions. The aim of this study is to determine the effects of 24-Epibrassinolide (EBL on some cell wall-related genes in root tissue of five- and ten-week-old Arabidopsis thaliana plants exposed to boron (B deficiency (0 µM or toxicity (3000 µM at the transcriptional level. Expressions of the genes that encode cellulose synthase (CESA1, CESA4, CESA6 and CESA8, cellulose synthase-like (CSLB5, expansin (EXPA5, EXPA8 and EXPA14 and cell wall protein (SEB1 decreased under conditions of B deficiency and toxicity. EBL treatments, in general, led the expressions of these genes to reduce significantly. Expressions of xyloglucan endotransglucosylase/hydrolase genes (XTH21 and XTH23 changed only under conditions of B toxicity. Boron stress and/or EBL treatments caused different responses in expression of pectin methylesterase (PME2 and PME41 genes. As a result of B stress, the expression levels of investigated genes changed more in roots of five-week-old plants than in roots of ten-week-old plants. Results of the present study include new findings that support the ability of BRs to increase molecular aspects of tolerance to stress in plants.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

Directory of Open Access Journals (Sweden)

Senta Heiss-Blanquet

Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

Science.gov (United States)

Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

2017-12-01

As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Acinetobacter baumannii K27 and K44 capsular polysaccharides have the same K unit but different structures due to the presence of distinct wzy genes in otherwise closely related K gene clusters.

Science.gov (United States)

Shashkov, Alexander S; Kenyon, Johanna J; Senchenkova, Sof'ya N; Shneider, Mikhail M; Popova, Anastasiya V; Arbatsky, Nikolay P; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Hall, Ruth M; Knirel, Yuriy A

2016-05-01

Capsular polysaccharides (CPSs), from Acinetobacter baumannii isolates 1432, 4190 and NIPH 70, which have related gene content at the K locus, were examined, and the chemical structures established using 2D(1)H and(13)C NMR spectroscopy. The three isolates produce the same pentasaccharide repeat unit, which consists of 5-N-acetyl-7-N-[(S)-3-hydroxybutanoyl] (major) or 5,7-di-N-acetyl (minor) derivatives of 5,7-diamino-3,5,7,9-tetradeoxy-D-glycero-D-galacto-non-2-ulosonic (legionaminic) acid (Leg5Ac7R), D-galactose, N-acetyl-D-galactosamine and N-acetyl-D-glucosamine. However, the linkage between repeat units in NIPH 70 was different to that in 1432 and 4190, and this significantly alters the CPS structure. The KL27 gene cluster in 4190 and KL44 gene cluster in NIPH 70 are organized identically and contain lga genes for Leg5Ac7R synthesis, genes for the synthesis of the common sugars, as well as anitrA2 initiating transferase and four glycosyltransferases genes. They share high-level nucleotide sequence identity for corresponding genes, but differ in the wzy gene encoding the Wzy polymerase. The Wzy proteins, which have different lengths and share no similarity, would form the unrelated linkages in the K27 and K44 structures. The linkages formed by the four shared glycosyltransferases were predicted by comparison with gene clusters that synthesize related structures. These findings unambiguously identify the linkages formed by WzyK27 and WzyK44, and show that the presence of different wzy genes in otherwise closely related K gene clusters changes the structure of the CPS. This may affect its capacity as a protective barrier for A. baumannii. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis.

Science.gov (United States)

Cai, Zhiying; Li, Guohua; Lin, Chunhua; Shi, Tao; Zhai, Ligang; Chen, Yipeng; Huang, Guixiu

2013-07-19

To gain more insight into the molecular mechanisms of Colletotrichum gloeosporioides pathogenesis, Agrobacterium tumefaciens-mediated transformation (ATMT) was used to identify mutants of C. gloeosporioides impaired in pathogenicity. An ATMT library of 4128 C. gloeosporioides transformants was generated. Transformants were screened for defects in pathogenicity with a detached copper brown leaf assay. 32 mutants showing reproducible pathogenicity defects were obtained. Southern blot analysis showed 60.4% of the transformants had single-site T-DNA integrations. 16 Genomic sequences flanking T-DNA were recovered from mutants by thermal asymmetric interlaced PCR, and were used to isolate the tagged genes from the genome sequence of wild-type C. gloeosporioides by Basic Local Alignment Search Tool searches against the local genome database of the wild-type C. gloeosporioides. One potential pathogenicity genes encoded calcium-translocating P-type ATPase. Six potential pathogenicity genes had no known homologs in filamentous fungi and were likely to be novel fungal virulence factors. Two putative genes encoded Glycosyltransferase family 28 domain-containing protein and Mov34/MPN/PAD-1 family protein, respectively. Five potential pathogenicity genes had putative function matched with putative protein of other Colletotrichum species. Two known C. gloeosporioides pathogenicity genes were also identified, the encoding Glomerella cingulata hard-surface induced protein and C. gloeosporioides regulatory subunit of protein kinase A gene involved in cAMP-dependent PKA signal transduction pathway. Copyright © 2013 Elsevier GmbH. All rights reserved.

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Role of Glycosyltransferases Modifying Type B Flagellin of Emerging Hypervirulent Clostridium difficile Lineages and Their Impact on Motility and Biofilm Formation*

Science.gov (United States)

Valiente, Esmeralda; Bouché, Laura; Hitchen, Paul; Faulds-Pain, Alexandra; Songane, Mario; Dawson, Lisa F.; Donahue, Elizabeth; Stabler, Richard A.; Panico, Maria; Morris, Howard R.; Bajaj-Elliott, Mona; Logan, Susan M.; Dell, Anne; Wren, Brendan W.

2016-01-01

Clostridium difficile is the principal cause of nosocomial infectious diarrhea worldwide. The pathogen modifies its flagellin with either a type A or type B O-linked glycosylation system, which has a contributory role in pathogenesis. We study the functional role of glycosyltransferases modifying type B flagellin in the 023 and 027 hypervirulent C. difficile lineages by mutagenesis of five putative glycosyltransferases and biosynthetic genes. We reveal their roles in the biosynthesis of the flagellin glycan chain and demonstrate that flagellar post-translational modification affects motility and adhesion-related bacterial properties of these strains. We show that the glycosyltransferases 1 and 2 (GT1 and GT2) are responsible for the sequential addition of a GlcNAc and two rhamnoses, respectively, and that GT3 is associated with the incorporation of a novel sulfonated peptidyl-amido sugar moiety whose structure is reported in our accompanying paper (Bouché, L., Panico, M., Hitchen, P., Binet, D., Sastre, F., Faulds-Pain, A., Valiente, E., Vinogradov, E., Aubry, A., Fulton, K., Twine, S., Logan, S. M., Wren, B. W., Dell, A., and Morris, H. R. (2016) J. Biol. Chem. 291, 25439–25449). GT2 is also responsible for methylation of the rhamnoses. Whereas type B modification is not required for flagellar assembly, some mutations that result in truncation or abolition of the glycan reduce bacterial motility and promote autoaggregation and biofilm formation. The complete lack of flagellin modification also significantly reduces adhesion of C. difficile to Caco-2 intestinal epithelial cells but does not affect activation of human TLR5. Our study advances our understanding of the genes involved in flagellar glycosylation and their biological roles in emerging hypervirulent C. difficile strains. PMID:27703012

Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

Science.gov (United States)

Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

2016-01-01

The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

Science.gov (United States)

de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

2002-04-15

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

Science.gov (United States)

Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

2015-12-08

This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew.

Science.gov (United States)

Chowdhury, Jamil; Lück, Stefanie; Rajaraman, Jeyaraman; Douchkov, Dimitar; Shirley, Neil J; Schwerdt, Julian G; Schweizer, Patrick; Fincher, Geoffrey B; Burton, Rachel A; Little, Alan

2017-01-01

Heteroxylan has recently been identified as an important component of papillae, which are formed during powdery mildew infection of barley leaves. Deposition of heteroxylan near the sites of attempted fungal penetration in the epidermal cell wall is believed to enhance the physical resistance to the fungal penetration peg and hence to improve pre-invasion resistance. Several glycosyltransferase (GT) families are implicated in the assembly of heteroxylan in the plant cell wall, and are likely to work together in a multi-enzyme complex. Members of key GT families reported to be involved in heteroxylan biosynthesis are up-regulated in the epidermal layer of barley leaves during powdery mildew infection. Modulation of their expression leads to altered susceptibility levels, suggesting that these genes are important for penetration resistance. The highest level of resistance was achieved when a GT43 gene was co-expressed with a GT47 candidate gene, both of which have been predicted to be involved in xylan backbone biosynthesis. Altering the expression level of several candidate heteroxylan synthesis genes can significantly alter disease susceptibility. This is predicted to occur through changes in the amount and structure of heteroxylan in barley papillae.

Cephem Potentiation by Inactivation of Nonessential Genes Involved in Cell Wall Biogenesis of beta-Lactamase-Producing Escherichia coli

DEFF Research Database (Denmark)

Baker, Kristin R.; Sigurdardottir, Helga Høeg; Jana, Bimal

2017-01-01

Reversal of antimicrobial resistance is an appealing and largely unexplored strategy in drug discovery. The objective of this study was to identify potential targets for “helper” drugs reversing cephem resistance in Escherichia coli strains producing β-lactamases. A CMY-2-encoding plasmid...... was transferred by conjugation to seven isogenic deletion mutants exhibiting cephem hypersusceptibility. The effect of each mutation was evaluated by comparing the MICs in the wild type and the mutant harboring the same plasmid. Mutation of two genes encoding proteins involved in cell wall biosynthesis, dap...... for all three drugs. Individual deletion of dapF and mrcB in a clinical isolate of CTX-M-15-producing E. coli sequence type 131 (ST131) resulted in partial reversal of ceftazidime and cefepime resistance but did not reduce MICs below susceptibility breakpoints. Growth curve analysis indicated no fitness...

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

Directory of Open Access Journals (Sweden)

Alvaro Banderas

2013-08-01

Full Text Available The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS, we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process.

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

Science.gov (United States)

Banderas, Alvaro; Guiliani, Nicolas

2013-01-01

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process. PMID:23959118

[A novel M142T mutation in the B glycosyltransferase gene associated with B3 variant in Chinese].

Science.gov (United States)

Xu, Xian-guo; Hong, Xiao-zhen; Liu, Ying; Zhu, Fa-ming; Lv, Hang-jun; Yan, Li-xing

2009-06-01

To investigate the molecular genetic basis of the B3 variant of ABO blood group system with mixed-field hemagglutination in Chinese. Serological techniques were performed to characterize the erythrocyte phenotype of two discrepant samples. A sequential agglutination method and 13 short tandem repeat (STR) loci were tested to exclude the possibility of exogenous or endogenous DNA chimera. Mutations in exons 6 and 7, including partial intron of the ABO gene, were screened by polymerase chain reaction and DNA sequencing. Haplotypes of the two individuals were also analyzed by sequencing. A mixed-field hemagglutination of RBCs with anti-B and anti-AB antibodies was detected in the two unrelated individuals. Exogenous ABO-incompatible RBC transfusion and endogenous genetic chimera were excluded by sequential agglutination method and STR. The ABO phenotypes of the two individuals were classified as A1B3 according to the ABO subgroup definition. The sequence region from intron 5 to 3'-UTR of the B allele was identical to that of ABO*B101 allele, except for a T to C substitution at nucleotide position 425 in exon 7. This substitution resulted in an amino acid change of M142T in the B glycosyltransferase. A novel B allele with 425T>C substitution resulting in B3 subgroup was identified in two Chinese individuals.

Crystal Structure of a UDP-glucose-specific Glycosyltransferase from a Mycobacterium Species

Energy Technology Data Exchange (ETDEWEB)

Fulton, Zara; McAlister, Adrian; Wilce, Matthew C.J.; Brammananth, Rajini; Zaker-Tabrizi, Leyla; Perugini, Matthew A.; Bottomley, Stephen P.; Coppel, Ross L.; Crellin, Paul K.; Rossjohn, Jamie; Beddoe, Travis (Monash); (Melbourne)

2008-10-24

Glycosyltransferases (GTs) are a large and ubiquitous family of enzymes that specifically transfer sugar moieties to a range of substrates. Mycobacterium tuberculosis contains a large number of GTs, many of which are implicated in cell wall synthesis, yet the majority of these GTs remain poorly characterized. Here, we report the high resolution crystal structures of an essential GT (MAP2569c) from Mycobacterium avium subsp. paratuberculosis (a close homologue of Rv1208 from M. tuberculosis) in its apo- and ligand-bound forms. The structure adopted the GT-A fold and possessed the characteristic DXD motif that coordinated an Mn{sup 2+} ion. Atypical of most GTs characterized to date, MAP2569c exhibited specificity toward the donor substrate, UDP-glucose. The structure of this ligated complex revealed an induced fit binding mechanism and provided a basis for this unique specificity. Collectively, the structural features suggested that MAP2569c may adopt a 'retaining' enzymatic mechanism, which has implications for the classification of other GTs in this large superfamily.

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

Science.gov (United States)

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

A gene expression analysis of cell wall biosynthetic genes in Malus × domestica infected by ‘Candidatus Phytoplasma mali’

Science.gov (United States)

Guerriero, Gea; Giorno, Filomena; Ciccotti, Anna Maria; Schmidt, Silvia; Baric, Sanja

2016-01-01

Apple proliferation (AP) represents a serious threat to several fruit-growing areas and is responsible for great economic losses. Several studies have highlighted the key role played by the cell wall in response to pathogen attack. The existence of a cell wall integrity signaling pathway which senses perturbations in the cell wall architecture upon abiotic/biotic stresses and activates specific defence responses has been widely demonstrated in plants. More recently a role played by cell wall-related genes has also been reported in plants infected by phytoplasmas. With the aim of shedding light on the cell wall response to AP disease in the economically relevant fruit-tree Malus × domestica Borkh., we investigated the expression of the cellulose (CesA) and callose synthase (CalS) genes in different organs (i.e., leaves, roots and branch phloem) of healthy and infected symptomatic outdoor-grown trees, sampled over the course of two time points (i.e., spring and autumn 2011), as well as in in vitro micropropagated control and infected plantlets. A strong up-regulation in the expression of cell wall biosynthetic genes was recorded in roots from infected trees. Secondary cell wall CesAs showed up-regulation in the phloem tissue from branches of infected plants, while either a down-regulation of some genes or no major changes were observed in the leaves. Micropropagated plantlets also showed an increase in cell wall-related genes and constitute a useful system for a general assessment of gene expression analysis upon phytoplasma infection. Finally, we also report the presence of several ‘knot’-like structures along the roots of infected apple trees and discuss the occurrence of this interesting phenotype in relation to the gene expression results and the modalities of phytoplasma diffusion. PMID:23086810

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Organization of the capsule biosynthesis gene locus of the oral streptococcus Streptococcus anginosus.

Science.gov (United States)

Tsunashima, Hiroyuki; Miyake, Katsuhide; Motono, Makoto; Iijima, Shinji

2012-03-01

The capsular polysaccharide (CPS) of the important oral streptococcus Streptococcus anginosus, which causes endocarditis, and the genes for its synthesis have not been clarified. In this study, we investigated the gene locus required for CPS synthesis in S. anginosus. Southern hybridization using the cpsE gene of the well-characterized bacterium S. agalactiae revealed that there is a similar gene in the genome of S. anginosus. By using the colony hybridization technique and inverse PCR, we isolated the CPS synthesis (cps) genes of S. anginosus. This gene cluster consisted of genes containing typical regulatory genes, cpsA-D, and glycosyltransferase genes coding for glucose, rhamnose, N-acetylgalactosamine, and galactofuranose transferases. Furthermore, we confirmed that the cps locus is required for CPS synthesis using a mutant strain with a defective cpsE gene. The cps cluster was found to be located downstream the nrdG gene, which encodes ribonucleoside triphosphate reductase activator, as is the case in other oral streptococci such as S. gordonii and S. sanguinis. However, the location of the gene cluster was different from those of S. pneumonia and S. agalactiae. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A murC gene from coryneform bacteria.

Science.gov (United States)

Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

1999-02-01

The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

Transcriptome Analysis of Dendrobium officinale and its Application to the Identification of Genes Associated with Polysaccharide Synthesis

Science.gov (United States)

Zhang, Jianxia; He, Chunmei; Wu, Kunlin; Teixeira da Silva, Jaime A.; Zeng, Songjun; Zhang, Xinhua; Yu, Zhenming; Xia, Haoqiang; Duan, Jun

2016-01-01

Dendrobium officinale is one of the most important Chinese medicinal herbs. Polysaccharides are one of the main active ingredients of D. officinale. To identify the genes that maybe related to polysaccharides synthesis, two cDNA libraries were prepared from juvenile and adult D. officinale, and were named Dendrobium-1 and Dendrobium-2, respectively. Illumina sequencing for Dendrobium-1 generated 102 million high quality reads that were assembled into 93,881 unigenes with an average sequence length of 790 base pairs. The sequencing for Dendrobium-2 generated 86 million reads that were assembled into 114,098 unigenes with an average sequence length of 695 base pairs. Two transcriptome databases were integrated and assembled into a total of 145,791 unigenes. Among them, 17,281 unigenes were assigned to 126 KEGG pathways while 135 unigenes were involved in fructose and mannose metabolism. Gene Ontology analysis revealed that the majority of genes were associated with metabolic and cellular processes. Furthermore, 430 glycosyltransferase and 89 cellulose synthase genes were identified. Comparative analysis of both transcriptome databases revealed a total of 32,794 differential expression genes (DEGs), including 22,051 up-regulated and 10,743 down-regulated genes in Dendrobium-2 compared to Dendrobium-1. Furthermore, a total of 1142 and 7918 unigenes showed unique expression in Dendrobium-1 and Dendrobium-2, respectively. These DEGs were mainly correlated with metabolic pathways and the biosynthesis of secondary metabolites. In addition, 170 DEGs belonged to glycosyltransferase genes, 37 DEGs were related to cellulose synthase genes and 627 DEGs encoded transcription factors. This study substantially expands the transcriptome information for D. officinale and provides valuable clues for identifying candidate genes involved in polysaccharide biosynthesis and elucidating the mechanism of polysaccharide biosynthesis. PMID:26904032

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Identification of a Xylogalacturonan Xylosyltransferase Involved in Pectin Biosynthesis in Arabidopsis

Energy Technology Data Exchange (ETDEWEB)

Pauly, Markus; Sorensen, Susanne Oxenboll; Harholt, Jesper; Geshi, Naomi; Sakuragi, Yumiko; Moller, Isabel; Zandleven, Joris; Bernal, Adriana J.; Jensen, Niels Bjerg; Sorensen, Charlotte; Jensen, Jacob K.; Beldman, Gerrit; Willats, William G.T.; Scheller, Henrik

2009-08-19

Xylogalacturonan (XGA) is a class of pectic polysaccharide found in plant cell walls. The Arabidopsis thaliana locus At5g33290 encodes a predicted Type II membrane protein, and insertion mutants of the At5g33290 locus had decreased cell wall xylose. Immunological studies, enzymatic extraction of polysaccharides, monosaccharide linkage analysis, and oligosaccharide mass profiling were employed to identify the affected cell wall polymer. Pectic XGA was reduced to much lower levels in mutant than in wild-type leaves, indicating a role of At5g33290 in XGA biosynthesis. The mutated gene was designated xylogalacturonan deficient1 (xgd1). Transformation of the xgd1-1 mutant with the wild-type gene restored XGA to wild-type levels. XGD1 protein heterologously expressed in Nicotiana benthamiana catalyzed the transfer of xylose from UDP-xylose onto oligogalacturonides and endogenous acceptors. The products formed could be hydrolyzed with an XGA-specific hydrolase. These results confirm that the XGD1 protein is a XGA xylosyltransferase. The protein was shown by expression of a fluorescent fusion protein in N. benthamiana to be localized in the Golgi vesicles as expected for a glycosyltransferase involved in pectin biosynthesis.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

The Physiological and Biochemical Mechanisms Providing the Increased Constitutive Cold Resistance in the Potato Plants, Expressing the Yeast SUC2 Gene Encoding Apoplastic Invertase

Directory of Open Access Journals (Sweden)

A.N. Deryabin

2016-05-01

Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

KAUST Repository

Meier, Stuart; Ruzvidzo, Oziniel; Morse, Monique; Donaldson, Lara; Kwezi, Lusisizwe; Gehring, Christoph A

2010-01-01

Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

KAUST Repository

Meier, Stuart

2010-01-26

Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

The Transcriptional Repressor TupA in Aspergillus niger Is Involved in Controlling Gene Expression Related to Cell Wall Biosynthesis, Development, and Nitrogen Source Availability

DEFF Research Database (Denmark)

Schachtschabel, Doreen; Arentshorst, Mark; Nitsche, Benjamin M

2013-01-01

The Tup1-Cyc8 (Ssn6) complex is a well characterized and conserved general transcriptional repressor complex in eukaryotic cells. Here, we report the identification of the Tup1 (TupA) homolog in the filamentous fungus Aspergillus niger in a genetic screen for mutants with a constitutive expression...... of the agsA gene. The agsA gene encodes a putative alpha-glucan synthase, which is induced in response to cell wall stress in A. niger. Apart from the constitutive expression of agsA, the selected mutant was also found to produce an unknown pigment at high temperatures. Complementation analysis...

Identification of Cell Wall Synthesis Regulatory Genes Controlling Biomass Characteristics and Yield in Rice (Oryza Sativa)

Energy Technology Data Exchange (ETDEWEB)

Peng, Zhaohua PEng [Mississippi State University; Ronald, Palmela [UC-Davis; Wang, Guo-Liang [The Ohio State University

2013-04-26

This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for each gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell wall

Preliminary X-ray crystallographic analysis of the glycosyltransferase from a marine Streptomyces species

International Nuclear Information System (INIS)

Gong, Liping; Xiao, Yi; Liu, Qiang; Li, Sumei; Zhang, Changsheng; Liu, Jinsong

2010-01-01

The recombinant glycosyltransferase ElaGT from the elaiophylin-producing marine Streptomyces sp. SCSIO 01934 has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 2.9 Å resolution. ElaGT is a glycosyltransferase from a marine Streptomyces species that is involved in the biosynthesis of elaiophylin. Here, the molecular cloning, protein expression and purification, preliminary crystallization and crystallographic characterization of ElaGT are reported. The rod-shaped crystals belonged to space group P2 1 22, with unit-cell parameters a = 66.7, b = 131.7, c = 224.6 Å, α = 90, β = 90, γ = 90°. Data were collected to 2.9 Å resolution. A preliminary molecular-replacement solution implied the presence of two ElaGT molecules in the asymmetric unit

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Functional characterization of the gene FoOCH1 encoding a putative α-1,6-mannosyltransferase in Fusarium oxysporum f. sp. cubense.

Science.gov (United States)

Li, Min-Hui; Xie, Xiao-Ling; Lin, Xian-Feng; Shi, Jin-Xiu; Ding, Zhao-Jian; Ling, Jin-Feng; Xi, Ping-Gen; Zhou, Jia-Nuan; Leng, Yueqiang; Zhong, Shaobin; Jiang, Zi-De

2014-04-01

Fusarium oxysporum f. sp. cubense (FOC) is the causal agent of banana Fusarium wilt and has become one of the most destructive pathogens threatening the banana production worldwide. However, few genes related to morphogenesis and pathogenicity of this fungal pathogen have been functionally characterized. In this study, we identified and characterized the disrupted gene in a T-DNA insertional mutant (L953) of FOC with significantly reduced virulence on banana plants. The gene disrupted by T-DNA insertion in L953 harbors an open reading frame, which encodes a protein with homology to α-1,6-mannosyltransferase (OCH1) in fungi. The deletion mutants (ΔFoOCH1) of the OCH1 orthologue (FoOCH1) in FOC were impaired in fungal growth, exhibited brighter staining with fluorescein isothiocyanate (FITC)-Concanavalin A, had less cell wall proteins and secreted more proteins into liquid media than the wild type. Furthermore, the mutation or deletion of FoOCH1 led to loss of ability to penetrate cellophane membrane and decline in hyphal attachment and colonization as well as virulence to the banana host. The mutant phenotypes were fully restored by complementation with the wild type FoOCH1 gene. Our data provide a first evidence for the critical role of FoOCH1 in maintenance of cell wall integrity and virulence of F. oxysporum f. sp. cubense. Copyright © 2014 Elsevier Inc. All rights reserved.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

DEFF Research Database (Denmark)

Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

2011-01-01

have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Reassessment of acarbose as a transition state analogue inhibitor of cyclodextrin glycosyltransferase

NARCIS (Netherlands)

Mosi, Renee; Sham, Howard; Uitdehaag, Joost C.M.; Ruiterkamp, Richard; Dijkstra, Bauke W.; Withers, Stephen G.

1998-01-01

The binding of several different active site mutants of Bacillus circulans cyclodextrin,glycosyltransferase to the inhibitor acarbose has been investigated through measurement of Ki values. The mutations represent several key amino acid positions, most of which are believed to play important roles

Identifying Genes Controlling Ferulate Cross-Linking Formation in Grass Cell Walls

Energy Technology Data Exchange (ETDEWEB)

de O. Buanafina, Marcia Maria [Pennsylvania State Univ., University Park, PA (United States)

2013-10-16

This proposal focuses on cell wall feruloylation and our long term goal is to identify and isolate novel genes controlling feruloylation and to characterize the phenotype of mutants in this pathway, with a spotlight on cell wall properties.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Engineering cell wall synthesis mechanism for enhanced PHB accumulation in E. coli.

Science.gov (United States)

Zhang, Xing-Chen; Guo, Yingying; Liu, Xu; Chen, Xin-Guang; Wu, Qiong; Chen, Guo-Qiang

2018-01-01

The rigidity of bacterial cell walls synthesized by a complicated pathway limit the cell shapes as coccus, bar or ellipse or even fibers. A less rigid bacterium could be beneficial for intracellular accumulation of poly-3-hydroxybutyrate (PHB) as granular inclusion bodies. To understand how cell rigidity affects PHB accumulation, E. coli cell wall synthesis pathway was reinforced and weakened, respectively. Cell rigidity was achieved by thickening the cell walls via insertion of a constitutive gltA (encoding citrate synthase) promoter in front of a series of cell wall synthesis genes on the chromosome of several E. coli derivatives, resulting in 1.32-1.60 folds increase of Young's modulus in mechanical strength for longer E. coli cells over-expressing fission ring FtsZ protein inhibiting gene sulA. Cell rigidity was weakened by down regulating expressions of ten genes in the cell wall synthesis pathway using CRISPRi, leading to elastic cells with more spaces for PHB accumulation. The regulation on cell wall synthesis changes the cell rigidity: E. coli with thickened cell walls accumulated only 25% PHB while cell wall weakened E. coli produced 93% PHB. Manipulation on cell wall synthesis mechanism adds another possibility to morphology engineering of microorganisms. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

Science.gov (United States)

Xayarath, Bobbi; Yother, Janet

2007-05-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

The Mkk2 MAPKK Regulates Cell Wall Biogenesis in Cooperation with the Cek1-Pathway in Candida albicans

NARCIS (Netherlands)

Román, Elvira; Alonso-Monge, Rebeca; Miranda Bedate, A.; Pla, Jesús

2015-01-01

The cell wall integrity pathway (CWI) plays an important role in the biogenesis of the cell wall in Candida albicans and other fungi. In the present work, the C. albicans MKK2 gene that encodes the putative MAPKK of this pathway was deleted in different backgrounds and the phenotypes of the

An ethanolamine kinase Eki1 affects radial growth and cell wall integrity in Trichoderma reesei.

Science.gov (United States)

He, Ronglin; Guo, Wei; Zhang, Dongyuan

2015-09-01

Ethanolamine kinase (ATP:ethanolamine O-phosphotransferase, EC 2.7.1.82) catalyzes the committed step of phosphatidylethanolamine synthesis via the CDP-ethanolamine pathway. The functions of eki genes that encode ethanolamine kinase have been intensively studied in mammalian cells, fruit flies and yeast. However, the role of the eki gene has not yet been characterized in filamentous fungi. In this study, Treki1, an ortholog of Saccharomyces cerevisiae EKI1, was identified and functionally characterized using a target gene deletion strategy in Trichoderma reesei. A Treki deletion mutant was less sensitive to cell wall stressors calcofluor white and Congo red and released fewer protoplasts during cell wall digestion than the parent strain QM9414. Further transcription analysis showed that the expression levels of five genes that encode chitin synthases were drastically increased in the ΔTreki1 mutant. The chitin content was also increased in the null mutant of Treki1 comparing to the parent strain. In addition, the ΔTreki1 mutant exhibited defects in radial growth, conidiation and the accumulation of ethanolamine. The results indicate that Treki1 plays a key role in growth and development and in the maintenance of cell wall integrity in T. reesei. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Related structures of neutral capsular polysaccharides of Acinetobacter baumannii isolates that carry related capsule gene clusters KL43, KL47, and KL88.

Science.gov (United States)

Shashkov, Alexander S; Kenyon, Johanna J; Arbatsky, Nikolay P; Shneider, Mikhail M; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2016-11-29

Capsular polysaccharides were recovered from four Acinetobacter baumannii isolates, and the following related structures of oligosaccharide repeating units were established by sugar analyses along with 1D and 2D 1 H and 13 C NMR spectroscopy: NIPH 60 and LUH5544 (K43) NIPH 601 (K47) The K locus for capsule biosynthesis in the genome sequences available for NIPH 60 and LUH5544, designated KL43, was found to be related to gene clusters KL47 in NIPH 601 and KL88 in LUH5548. The three clusters share most gene content differing in only a small portion that includes an additional glycosyltransferase genes in KL47 and KL88, as well as genes encoding distinct Wzy polymerases that were found to form the same α-d-GlcpNAc-(1 → 6)-α-d-GlcpNAc linkage in K43 and K47. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification of a novel gene cluster in the upstream region of the S-layer gene sbpA involved in cell wall metabolism of Lysinibacillus sphaericus CCM 2177 and characterization of the recombinantly produced autolysin and pyruvyl transferase.

Science.gov (United States)

Pleschberger, Magdalena; Hildner, Florian; Rünzler, Dominik; Gelbmann, Nicola; Mayer, Harald F; Sleytr, Uwe B; Egelseer, Eva M

2013-05-01

The S-layer protein SbpA of Lysinibacillus sphaericus CCM 2177 assembles into a square (p4) lattice structure and recognizes a pyruvylated secondary cell wall polymer (SCWP) as the proper anchoring structure to the rigid cell wall layer. Sequencing of 8,004 bp in the 5'-upstream region of the S-layer gene sbpA led to five ORFs-encoding proteins involved in cell wall metabolism. After cloning and heterologous expression of ORF1 and ORF5 in Escherichia coli, the recombinant autolysin rAbpA and the recombinant pyruvyl transferase rCsaB were isolated, purified, and correct folding was confirmed by circular dichroism. Although rAbpA encoded by ORF1 showed amidase activity, it could attack whole cells of Ly. sphaericus CCM 2177 only after complete extraction of the S-layer lattice. Despite the presence of three S-layer-homology motifs on the N-terminal part, rAbpA did not show detectable affinity to peptidoglycan-containing sacculi, nor to isolated SCWP. As the molecular mass of the autolysin lies above the molecular exclusion limit of the S-layer, AbpA is obviously trapped within the rigid cell wall layer by the isoporous protein lattice. Immunogold-labeling of ultrathin-sectioned whole cells of Ly. sphaericus CCM 2177 with a polyclonal rabbit antiserum raised against rCsaB encoded by ORF5, and cell fractionation experiments demonstrated that the pyruvyl transferase was located in the cytoplasm, but not associated with cell envelope components including the plasma membrane. In enzymatic assays, rCsaB clearly showed pyruvyl transferase activity. By using RT-PCR, specific transcripts for each ORF could be detected. Cotranscription could be confirmed for ORF2 and ORF3.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

KRE5 Suppression Induces Cell Wall Stress and Alternative ER Stress Response Required for Maintaining Cell Wall Integrity in Candida glabrata

Science.gov (United States)

Sasaki, Masato; Ito, Fumie; Aoyama, Toshio; Sato-Okamoto, Michiyo; Takahashi-Nakaguchi, Azusa; Chibana, Hiroji; Shibata, Nobuyuki

2016-01-01

The maintenance of cell wall integrity in fungi is required for normal cell growth, division, hyphae formation, and antifungal tolerance. We observed that endoplasmic reticulum stress regulated cell wall integrity in Candida glabrata, which possesses uniquely evolved mechanisms for unfolded protein response mechanisms. Tetracycline-mediated suppression of KRE5, which encodes a predicted UDP-glucose:glycoprotein glucosyltransferase localized in the endoplasmic reticulum, significantly increased cell wall chitin content and decreased cell wall β-1,6-glucan content. KRE5 repression induced endoplasmic reticulum stress-related gene expression and MAP kinase pathway activation, including Slt2p and Hog1p phosphorylation, through the cell wall integrity signaling pathway. Moreover, the calcineurin pathway negatively regulated cell wall integrity, but not the reduction of β-1,6-glucan content. These results indicate that KRE5 is required for maintaining both endoplasmic reticulum homeostasis and cell wall integrity, and that the calcineurin pathway acts as a regulator of chitin-glucan balance in the cell wall and as an alternative mediator of endoplasmic reticulum stress in C. glabrata. PMID:27548283

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Gene co-expression analysis identifies gene clusters associated with isotropic and polarized growth in Aspergillus fumigatus conidia.

Science.gov (United States)

Baltussen, Tim J H; Coolen, Jordy P M; Zoll, Jan; Verweij, Paul E; Melchers, Willem J G

2018-04-26

Aspergillus fumigatus is a saprophytic fungus that extensively produces conidia. These microscopic asexually reproductive structures are small enough to reach the lungs. Germination of conidia followed by hyphal growth inside human lungs is a key step in the establishment of infection in immunocompromised patients. RNA-Seq was used to analyze the transcriptome of dormant and germinating A. fumigatus conidia. Construction of a gene co-expression network revealed four gene clusters (modules) correlated with a growth phase (dormant, isotropic growth, polarized growth). Transcripts levels of genes encoding for secondary metabolites were high in dormant conidia. During isotropic growth, transcript levels of genes involved in cell wall modifications increased. Two modules encoding for growth and cell cycle/DNA processing were associated with polarized growth. In addition, the co-expression network was used to identify highly connected intermodular hub genes. These genes may have a pivotal role in the respective module and could therefore be compelling therapeutic targets. Generally, cell wall remodeling is an important process during isotropic and polarized growth, characterized by an increase of transcripts coding for hyphal growth and cell cycle/DNA processing when polarized growth is initiated. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Downregulation of the UDP-arabinomutase gene in switchgrass (Panicum virgatum L. results in increased cell wall lignin while reducing arabinose-glycans

Directory of Open Access Journals (Sweden)

Jonathan Duran Willis

2016-10-01

Full Text Available Switchgrass (Panicum virgatum L. is a C4 perennial prairie grass and a lignocellulosic biofuels feedstock. Saccharification and biofuel yields are inhibited by the plant cell wall’s natural recalcitrance against enzymatic degradation. Plant hemicellulose polysaccharides such as arabinoxylans structurally support and crosslink other cell wall polymers. Grasses have predominately Type II cell walls that are abundant in arabinoxylan, which comprise nearly 25% of aboveground biomass. A primary component of arabinoxylan synthesis is uridine diphosphate (UDP linked to arabinofuranose (Araf. A family of UDP-arabinopyranose mutase/reversible glycosylated polypeptides (UAM/RGPs catalyze the interconversion between UDP-arabinopyranose (UDP-Arap and UDP-Araf. In switchgrass we knocked down expression of the endogenous PvUAM1 gene via RNAi to investigate its role in cell wall recalcitrance in the feedstock. PvUAM1 encodes a switchgrass homolog of UDP-arabinose mutase, which converts UDP-Arap to UDP-Araf. Each transgenic line contained between one to at least seven T-DNA insertions, resulting in some cases, a 95% reduction of native PvUAM1 transcript in stem internodes. Transgenic plants had increased pigmentation in vascular tissues at nodes, but were otherwise morphologically similar to non-transgenics. There was decreased cell wall-associated arabinose in leaves and stems by over 50%, but there was an increase in cellulose in these organs. In addition, there was a commensurate change in arabinose side chain extension. Cell wall lignin composition was altered with a concurrent increase in lignin content and transcript abundance of lignin biosynthetic genes in mature tillers. Enzymatic saccharification efficiency was unchanged in the transgenic plants relative to the control, but had increased glucose in cell walls. The increased glucose detected in stems and leaves indicates that attenuation of PvUAM1 expression might have downstream effects on starch

Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

NARCIS (Netherlands)

Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

2017-01-01

BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

The role of SDG8i from the resurrection grass Sporobolus stapfianus in ectopic expression system of Arabidopsis

OpenAIRE

Islam, Sharmin

2017-01-01

Isolation of gene transcripts from desiccated leaf tissue of the resurrection grass Sporobolus stapfianus Gandoger, resulted in the identification of the gene, SDG8i, encoding a Group 1 glycosyltransferase (UGT). Glycolsyltransferases transfer a sugar to a number of acceptor molecules, including hormones and secondary metabolites, changing the solubility, stability and biological activity of these compounds. Functional analysis of the SDG8i was undertaken in Arabidopsis thaliana because no pr...

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Classification, Naming and Evolutionary History of Glycosyltransferases from Sequenced Green and Red Algal Genomes

DEFF Research Database (Denmark)

Ulvskov, Peter; Paiva, Dionisio Soares; Domozych, David

2013-01-01

. In order to elucidate possible evolutionary links between the three advanced lineages in Archaeplastida, a genomic analysis was initiated. Fully sequenced genomes from the Rhodophyta and Virideplantae and the well-defined CAZy database on glycosyltransferases were included in the analysis. The number...

The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 gene encodes an aldehyde dehydrogenase involved in ferulic acid and sinapic acid biosynthesis.

Science.gov (United States)

Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint

2004-02-01

Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.

Metatranscriptome Sequencing Reveals Insights into the Gene Expression and Functional Potential of Rumen Wall Bacteria

Directory of Open Access Journals (Sweden)

Evelyne Mann

2018-01-01

Full Text Available Microbiota of the rumen wall constitute an important niche of rumen microbial ecology and their composition has been elucidated in different ruminants during the last years. However, the knowledge about the function of rumen wall microbes is still limited. Rumen wall biopsies were taken from three fistulated dairy cows under a standard forage-based diet and after 4 weeks of high concentrate feeding inducing a subacute rumen acidosis (SARA. Extracted RNA was used for metatranscriptome sequencing using Illumina HiSeq sequencing technology. The gene expression of the rumen wall microbial community was analyzed by mapping 35 million sequences against the Kyoto Encyclopedia for Genes and Genomes (KEGG database and determining differentially expressed genes. A total of 1,607 functional features were assigned with high expression of genes involved in central metabolism, galactose, starch and sucrose metabolism. The glycogen phosphorylase (EC:2.4.1.1 which degrades (1->4-alpha-D-glucans was among the highest expressed genes being transcribed by 115 bacterial genera. Energy metabolism genes were also highly expressed, including the pyruvate orthophosphate dikinase (EC:2.7.9.1 involved in pyruvate metabolism, which was covered by 177 genera. Nitrogen metabolism genes, in particular glutamate dehydrogenase (EC:1.4.1.4, glutamine synthetase (EC:6.3.1.2 and glutamate synthase (EC:1.4.1.13, EC:1.4.1.14 were also found to be highly expressed and prove rumen wall microbiota to be actively involved in providing host-relevant metabolites for exchange across the rumen wall. In addition, we found all four urease subunits (EC:3.5.1.5 transcribed by members of the genera Flavobacterium, Corynebacterium, Helicobacter, Clostridium, and Bacillus, and the dissimilatory sulfate reductase (EC 1.8.99.5 dsrABC, which is responsible for the reduction of sulfite to sulfide. We also provide in situ evidence for cellulose and cellobiose degradation, a key step in fiber-rich feed

The cell wall-targeting antibiotic stimulon of Enterococcus faecalis.

Directory of Open Access Journals (Sweden)

Jacqueline Abranches

Full Text Available Enterococcus faecalis is an opportunistic nosocomial pathogen that is highly resistant to a variety of environmental insults, including an intrinsic tolerance to antimicrobials that target the cell wall (CW. With the goal of determining the CW-stress stimulon of E. faecalis, the global transcriptional profile of E. faecalis OG1RF exposed to ampicillin, bacitracin, cephalotin or vancomycin was obtained via microarrays. Exposure to the β-lactams ampicillin and cephalotin resulted in the fewest transcriptional changes with 50 and 192 genes differentially expressed 60 min after treatment, respectively. On the other hand, treatment with bacitracin or vancomycin for 60 min affected the expression of, respectively, 377 and 297 genes. Despite the differences in the total number of genes affected, all antibiotics induced a very similar gene expression pattern with an overrepresentation of genes encoding hypothetical proteins, followed by genes encoding proteins associated with cell envelope metabolism as well as transport and binding proteins. In particular, all drug treatments, most notably bacitracin and vancomycin, resulted in an apparent metabolic downshift based on the repression of genes involved in translation, energy metabolism, transport and binding. Only 19 genes were up-regulated by all conditions at both the 30 and 60 min time points. Among those 19 genes, 4 genes encoding hypothetical proteins (EF0026, EF0797, EF1533 and EF3245 were inactivated and the respective mutant strains characterized in relation to antibiotic tolerance and virulence in the Galleria mellonella model. The phenotypes obtained for two of these mutants, ΔEF1533 and ΔEF3245, support further characterization of these genes as potential candidates for the development of novel preventive or therapeutic approaches.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

Directory of Open Access Journals (Sweden)

Kang Zhang

2018-05-01

Full Text Available A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO, was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO were similar to those of the wild-type (WT strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP and mitogen-activated protein kinase (MAPK signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea.

The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

Science.gov (United States)

Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

2018-01-01

A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

Three novel rice genes closely related to the Arabidopsis IRX9, IRX9L, and IRX14 genes and their roles in xylan biosynthesis

Directory of Open Access Journals (Sweden)

Dawn eChiniquy

2013-04-01

Full Text Available Xylan is the second most abundant polysaccharide on Earth, and represents a major component of both dicot wood and the cell walls of grasses. Much knowledge has been gained from studies of xylan biosynthesis in the model plant, Arabidopsis. In particular, the irregular xylem (irx mutants, named for their collapsed xylem cells, have been essential in gaining a greater understanding of the genes involved in xylan biosynthesis. In contrast, xylan biosynthesis in grass cell walls is poorly understood. We identified three rice genes Os07g49370 (OsIRX9, Os01g48440 (OsIRX9L, and Os06g47340 (OsIRX14, from glycosyltransferase family 43 as putative orthologs to the putative β-1,4-xylan backbone elongating Arabidopsis IRX9, IRX9L, and IRX14 genes, respectively. We demonstrate that the overexpression of the closely related rice genes, in full or partly complement the two well-characterized Arabidopsis irregular xylem (irx mutants: irx9 and irx14. Complementation was assessed by measuring dwarfed phenotypes, irregular xylem cells in stem cross sections, xylose content of stems, xylosyltransferase activity of stems, and stem strength. The expression of OsIRX9 in the irx9 mutant resulted in xylosyltransferase activity of stems that was over double that of wild type plants, and the stem strength of this line increased to 124% above that of wild type. Taken together, our results suggest that OsIRX9/OsIRX9L, and OsIRX14, have similar functions to the Arabidopsis IRX9 and IRX14 genes, respectively. Furthermore, our expression data indicate that OsIRX9 and OsIRX9L may function in building the xylan backbone in the secondary and primary cell walls, respectively. Our results provide insight into xylan biosynthesis in rice and how expression of a xylan synthesis gene may be modified to increase stem strength.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Four Novel Cellulose Synthase (CESA Genes from Birch (Betula platyphylla Suk. Involved in Primary and Secondary Cell Wall Biosynthesis

Directory of Open Access Journals (Sweden)

Xuemei Liu

2012-09-01

Full Text Available Cellulose synthase (CESA, which is an essential catalyst for the generation of plant cell wall biomass, is mainly encoded by the CesA gene family that contains ten or more members. In this study; four full-length cDNAs encoding CESA were isolated from Betula platyphylla Suk., which is an important timber species, using RT-PCR combined with the RACE method and were named as BplCesA3, −4, −7 and −8. These deduced CESAs contained the same typical domains and regions as their Arabidopsis homologs. The cDNA lengths differed among these four genes, as did the locations of the various protein domains inferred from the deduced amino acid sequences, which shared amino acid sequence identities ranging from only 63.8% to 70.5%. Real-time RT-PCR showed that all four BplCesAs were expressed at different levels in diverse tissues. Results indicated that BplCESA8 might be involved in secondary cell wall biosynthesis and floral development. BplCESA3 appeared in a unique expression pattern and was possibly involved in primary cell wall biosynthesis and seed development; it might also be related to the homogalacturonan synthesis. BplCESA7 and BplCESA4 may be related to the formation of a cellulose synthase complex and participate mainly in secondary cell wall biosynthesis. The extremely low expression abundance of the four BplCESAs in mature pollen suggested very little involvement of them in mature pollen formation in Betula. The distinct expression pattern of the four BplCesAs suggested they might participate in developments of various tissues and that they are possibly controlled by distinct mechanisms in Betula.

In vivo expression of a Cicer arietinum B-galactosidase in potato tubers leads to a reduction of the Galactan side-chains in cell wall pectin

NARCIS (Netherlands)

Martin, I.; Dopico, B.; Munoz, F.J.; Esteban, R.; Oomen, R.J.F.J.; Driouich, A.; Vincken, J.P.; Visser, R.G.F.; Labrador, E.

2005-01-01

We report the generation of Solanum tuberosum transformants expressing Cicer arietinum ßIII-Gal. ßIII-Gal is a ß-galactosidase able to degrade cell wall pectins during cell wall loosening that occurs prior to cell elongation. cDNA corresponding to the gene encoding this protein was identified among

The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis

DEFF Research Database (Denmark)

Schwientek, Tilo; Keck, Birgit; Levery, Steven B

2002-01-01

-linked mannose as well as beta-linked galactose as acceptor sugars. The inner disaccharide core structures of glycosphingolipids in mammals (Galbeta1-4Glcbeta1-Cer) and insects (Manbeta1-4Glcbeta1-Cer) are different. Both disaccharide glycolipids served as substrates for brainiac, but glycolipids of insect cells...... have so far only been found to be based on the GlcNAcbeta1-3Manbeta1-4Glcbeta1-Cer core structure. Infection of High Five(TM) cells with baculovirus containing full coding brainiac cDNA markedly increased the ratio of GlcNAcbeta1-3Manbeta1-4Glcbeta1-Cer glycolipids compared with Galbeta1-4Manbeta1......-4Glcbeta1-Cer found in wild type cells. We suggest that brainiac exerts its biological functions by regulating biosynthesis of glycosphingolipids....

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Defective Pollen Wall 2 ( DPW2 ) Encodes an Acyl Transferase Required for Rice Pollen Development

Energy Technology Data Exchange (ETDEWEB)

Xu, Dawei [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Shi, Jianxin [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Rautengarten, Carsten [Univ. of Melbourne (Australia). ARC Centre of Excellence in Plant Cell Walls; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint BioEnergy Inst. and Biological Systems and Engineering Division; Yang, Li [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Qian, Xiaoling [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Uzair, Muhammad [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Zhu, Lu [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Luo, Qian [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; An, Gynheung [Kyung Hee Univ., Yongin (Korea). Crop Biotech Inst.; Waßmann, Fritz [Univ. of Bonn (Germany). Inst. of Cellular and Molecular Botany; Schreiber, Lukas [Univ. of Bonn (Germany). Inst. of Cellular and Molecular Botany; Heazlewood, Joshua L. [Univ. of Melbourne (Australia). ARC Centre of Excellence in Plant Cell Walls; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint BioEnergy Inst. and Biological Systems and Engineering Division; Scheller, Henrik Vibe [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Joint BioEnergy Inst. and Biological Systems and Engineering Division; Univ. of California, Berkeley, CA (United States). Dept. of Plant and Microbial Biology; Hu, Jianping [Michigan State Univ., East Lansing, MI (United States). Dept. of Energy Plant Research Lab.; Zhang, Dabing [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences; Univ. of Adelaide, SA (Australia). School of Agriculture, Food and Wine; Liang, Wanqi [Shanghai Jiao Tong Univ. (China). Joint International Research Lab. of Metabolic and Developmental Sciences

2016-05-31

Aliphatic and aromatic lipids are both essential structural components of the plant cuticle, an important interface between the plant and environment. Although cross links between aromatic and aliphatic or other moieties are known to be associated with the formation of leaf cutin and root and seed suberin, the contribution of aromatic lipids to the biosynthesis of anther cuticles and pollen walls remains elusive. In this study, we characterized the rice (Oryza sativa) male sterile mutant, defective pollen wall 2 (dpw2), which showed an abnormal anther cuticle, a defective pollen wall, and complete male sterility. Compared with the wild type, dpw2 anthers have increased amounts of cutin and waxes and decreased levels of lipidic and phenolic compounds. DPW2 encodes a cytoplasmically localized BAHD acyltransferase. In vitro assays demonstrated that recombinant DPW2 specifically transfers hydroxycinnamic acid moieties, using v-hydroxy fatty acids as acyl acceptors and hydroxycinnamoyl-CoAs as acyl donors. Thus, The cytoplasmic hydroxycinnamoyl-CoA:v-hydroxy fatty acid transferase DPW2 plays a fundamental role in male reproduction via the biosynthesis of key components of the anther cuticle and pollen wall.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

Science.gov (United States)

Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

2014-07-01

Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Effect of cell wall integrity stress and RlmA transcription factor on asexual development and autolysis in Aspergillus nidulans.

Science.gov (United States)

Kovács, Zsuzsanna; Szarka, Máté; Kovács, Szilvia; Boczonádi, Imre; Emri, Tamás; Abe, Keietsu; Pócsi, István; Pusztahelyi, Tünde

2013-05-01

The cell wall integrity (CWI) signaling pathway is responsible for cell wall remodeling and reinforcement upon cell wall stress, which is proposed to be universal in fungal cultures. In Aspergillus nidulans, both the deletion of rlmA encoding the RlmA transcription factor in CWI signaling and low concentrations of the cell wall polymer intercalating agent Congo Red caused significant physiological changes. The gene deletion mutant ΔrlmA strain showed decreased CWI and oxidative stress resistances, which indicated the connection between the CWI pathway and the oxidative stress response system. The Congo Red stress resulted in alterations in the cell wall polymer composition in submerged cultures due to the induction of the biosynthesis of the alkali soluble fraction as well as the hydrolysis of cell wall biopolymers. Both RlmA and RlmA-independent factors induced by Congo Red stress regulated the expression of glucanase (ANID_00245, engA) and chitinase (chiB, chiA) genes, which promoted the autolysis of the cultures and also modulated the pellet sizes. CWI stress and rlmA deletion affected the expression of brlA encoding the early conidiophore development regulator transcription factor BrlA and, as a consequence, the formation of conidiophores was significantly changed in submerged cultures. Interestingly, the number of conidiospores increased in surface cultures of the ΔrlmA strain. The in silico analysis of genes putatively regulated by RlmA and the CWI transcription factors AnSwi4/AnSwi6 in the SBF complex revealed only a few jointly regulated genes, including ugmA and srrA coding for UgmA UDP-galactopyranose mutase and SrrA stress response regulator, respectively. Copyright © 2013 Elsevier Inc. All rights reserved.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Evidence for a Saponin Biosynthesis Pathway in the Body Wall of the Commercially Significant Sea Cucumber Holothuria scabra.

Science.gov (United States)

Mitu, Shahida Akter; Bose, Utpal; Suwansa-Ard, Saowaros; Turner, Luke H; Zhao, Min; Elizur, Abigail; Ogbourne, Steven M; Shaw, Paul Nicholas; Cummins, Scott F

2017-11-07

The sea cucumber (phylum Echinodermata) body wall is the first line of defense and is well known for its production of secondary metabolites; including vitamins and triterpenoid glycoside saponins that have important ecological functions and potential benefits to human health. The genes involved in the various biosynthetic pathways are unknown. To gain insight into these pathways in an echinoderm, we performed a comparative transcriptome analysis and functional annotation of the body wall and the radial nerve of the sea cucumber Holothuria scabra ; to define genes associated with body wall metabolic functioning and secondary metabolite biosynthesis. We show that genes related to signal transduction mechanisms were more highly represented in the H. scabra body wall, including genes encoding enzymes involved in energy production. Eight of the core triterpenoid biosynthesis enzymes were found, however, the identity of the saponin specific biosynthetic pathway enzymes remains unknown. We confirm the body wall release of at least three different triterpenoid saponins using solid phase extraction followed by ultra-high-pressure liquid chromatography-quadrupole time of flight-mass spectrometry. The resource we have established will help to guide future research to explore secondary metabolite biosynthesis in the sea cucumber.

Evidence for a Saponin Biosynthesis Pathway in the Body Wall of the Commercially Significant Sea Cucumber Holothuria scabra

Directory of Open Access Journals (Sweden)

Shahida Akter Mitu

2017-11-01

Full Text Available The sea cucumber (phylum Echinodermata body wall is the first line of defense and is well known for its production of secondary metabolites; including vitamins and triterpenoid glycoside saponins that have important ecological functions and potential benefits to human health. The genes involved in the various biosynthetic pathways are unknown. To gain insight into these pathways in an echinoderm, we performed a comparative transcriptome analysis and functional annotation of the body wall and the radial nerve of the sea cucumber Holothuria scabra; to define genes associated with body wall metabolic functioning and secondary metabolite biosynthesis. We show that genes related to signal transduction mechanisms were more highly represented in the H. scabra body wall, including genes encoding enzymes involved in energy production. Eight of the core triterpenoid biosynthesis enzymes were found, however, the identity of the saponin specific biosynthetic pathway enzymes remains unknown. We confirm the body wall release of at least three different triterpenoid saponins using solid phase extraction followed by ultra-high-pressure liquid chromatography-quadrupole time of flight-mass spectrometry. The resource we have established will help to guide future research to explore secondary metabolite biosynthesis in the sea cucumber.

Water deficit modulates gene expression in growing zones of soybean seedlings. Analysis of differentially expressed cDNAs, a new beta-tubulin gene, and expression of genes encoding cell wall proteins.

Science.gov (United States)

Creelman, R A; Mullet, J E

1991-10-01

Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

ONOS

2010-01-25

Jan 25, 2010 ... intron. It had a high homology to previously cloned cell wall acid invertase genes in other plants by sequence .... Japan) in a final volume of 50 µl. The programs for ... The first strand of cDNA was synthesized by using SYBR ...

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

α-Xylosidase plays essential roles in xyloglucan remodelling, maintenance of cell wall integrity, and seed germination in Arabidopsis thaliana.

Science.gov (United States)

Shigeyama, Takuma; Watanabe, Asuka; Tokuchi, Konatsu; Toh, Shigeo; Sakurai, Naoki; Shibuya, Naoto; Kawakami, Naoto

2016-10-01

Regulation and maintenance of cell wall physical properties are crucial for plant growth and environmental response. In the germination process, hypocotyl cell expansion and endosperm weakening are prerequisites for dicot seeds to complete germination. We have identified the Arabidopsis mutant thermoinhibition-resistant germination 1 (trg1), which has reduced seed dormancy and insensitivity to unfavourable conditions for germination owing to a loss-of-function mutation of TRG1/XYL1, which encodes an α-xylosidase. Compared to those of wild type, the elongating stem of trg1 showed significantly lower viscoelasticity, and the fruit epidermal cells were longitudinally shorter and horizontally enlarged. Actively growing tissues of trg1 over-accumulated free xyloglucan oligosaccharides (XGOs), and the seed cell wall had xyloglucan with a greatly reduced molecular weight. These observations suggest that XGOs reduce xyloglucan size by serving as an acceptor in transglycosylation and eventually enhancing cell wall loosening. TRG1/XYL1 gene expression was abundant in growing wild-type organs and tissues but relatively low in cells at most actively elongating part of the tissues, suggesting that α-xylosidase contributes to maintaining the mechanical integrity of the primary cell wall in the growing and pre-growing tissues. In germinating seeds of trg1, expression of genes encoding specific abscisic acid and gibberellin metabolism enzymes was altered in accordance with the aberrant germination phenotype. Thus, cell wall integrity could affect seed germination not only directly through the physical properties of the cell wall but also indirectly through the regulation of hormone gene expression. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Strain-encoded cardiac MRI as an adjunct for dobutamine stress testing: incremental value to conventional wall motion analysis.

Science.gov (United States)

Korosoglou, Grigorios; Lossnitzer, Dirk; Schellberg, Dieter; Lewien, Antje; Wochele, Angela; Schaeufele, Tim; Neizel, Mirja; Steen, Henning; Giannitsis, Evangelos; Katus, Hugo A; Osman, Nael F

2009-03-01

High-dose dobutamine stress MRI is safe and feasible for the diagnosis of coronary artery disease (CAD) in humans. However, the assessment of cine scans relies on the visual interpretation of regional wall motion, which is subjective. Recently, strain-encoded MRI (SENC) has been proposed for the direct color-coded visualization of myocardial strain. The purpose of our study was to compare the diagnostic value of SENC with that provided by conventional wall motion analysis for the detection of inducible ischemia during dobutamine stress MRI. Stress-induced ischemia was assessed by wall motion analysis and by SENC in 101 patients with suspected or known CAD and in 17 healthy volunteers who underwent dobutamine stress MRI in a clinical 1.5-T scanner. Quantitative coronary angiography deemed as the standard reference for the presence or absence of significant CAD (> or =50% diameter stenosis). On a coronary vessel level, SENC detected inducible ischemia in 86 of 101 versus 71 of 101 diseased coronary vessels (P or =50% stenosis (area under the curve, 0.96; SE, 0.01; 95% CI, 0.94 to 0.98; P<0.001). The direct color-coded visualization of strain on MR images is a useful adjunct for dobutamine stress MRI, which provides incremental value for the detection of CAD compared with conventional wall motion readings on cine images.

Calpain-Mediated positional information directs cell wall orientation to sustain plant stem cell activity, growth and development

Science.gov (United States)

Eukaryotic development and stem cell control depend on the integration of cell positional sensing with cell cycle control and cell wall positioning, yet few factors that directly link these events are known. The DEFECTIVE KERNEL1 (DEK1) gene encoding the unique plant calpain protein is fundamental f...

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

The three transglycosylation reactions catalyzed by cyclodextrin glycosyltransferase from Bacillus circulans (strain 251) proceed via different kinetic mechanisms

NARCIS (Netherlands)

Veen, Bart A. van der; Alebeek, Gert-Jan W.M. van; Uitdehaag, Joost C.M.; Dijkstra, Bauke W.; Dijkhuizen, Lubbert

Cyclodextrin glycosyltransferase (CGTase) catalyzes three transglycosylation reactions via a double displacement mechanism involving a covalent enzyme-intermediate complex (substituted-enzyme intermediate). Characterization of the three transglycosylation reactions, however, revealed that they

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Down-Regulation of Glycosyl Transferase Genes in Streptococcus Mutans by Punica Granatum L. Flower and Rhus Coriaria L. Fruit Water Extracts.

Science.gov (United States)

Vahid-Dastjerdi, Elahe; Monadi, Elham; Khalighi, Hamid Reza; Torshabi, Maryam

2016-01-01

In our previous studies, we showed the inhibitory effects of Punica granatum L. flower and Rhus coriaria L. fruit water extracts on dental plaque accumulation by several bacteria, especially Streptococcus mutans (S. mutans), on orthodontic wire by in-vitro assays. In this study, the anti-cariogenic properties of the extracts were evaluated by assessing their effects on expression of glycosyltransferase (gtf) genes, which are responsible for initial biofilm formation by S. mutans. In this study, the effect of herbal extracts on expression of gtfB, C (encoding enzymes that produce water-insoluble glucans) and D (encoding enzymes that produce water-soluble glucans) genes in S. mutans growing in planktonic state was evaluated quantitatively by real-time polymerase chain reaction (PCR) method. The minimum biofilm inhibitory concentration (MBIC) of understudied herbal water extracts significantly suppressed gtfB, C and D gene expression by 85.3 ± 7.5%, 33.3 ± 6.4% and 25 ± 14%, respectively for Punica granatum L. extract and 73.4 ± 7.3%, 93.8 ± 2.7% and 59.3 ± 9.8%, respectively for Rhus coriaria L. extract compared to the non-treated control group (P Punica granatum L. extract. These findings suggest that Punica granatum L. and especially Rhus coriaria L. maybe used as novel, natural antiplaque agents since they inhibit specific genes associated with bacterial biofilm formation without necessarily affecting the growth of oral bacteria.

Glycosyltransferases and non-alcoholic fatty liver disease

Science.gov (United States)

Zhan, Yu-Tao; Su, Hai-Ying; An, Wei

2016-01-01

Non-alcoholic fatty liver disease (NAFLD) is the most common form of chronic liver disease and its incidence is increasing worldwide. However, the underlying mechanisms leading to the development of NAFLD are still not fully understood. Glycosyltransferases (GTs) are a diverse class of enzymes involved in catalyzing the transfer of one or multiple sugar residues to a wide range of acceptor molecules. GTs mediate a wide range of functions from structure and storage to signaling, and play a key role in many fundamental biological processes. Therefore, it is anticipated that GTs have a role in the pathogenesis of NAFLD. In this article, we present an overview of the basic information on NAFLD, particularly GTs and glycosylation modification of certain molecules and their association with NAFLD pathogenesis. In addition, the effects and mechanisms of some GTs in the development of NAFLD are summarized. PMID:26937136

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Understanding plant cell-wall remodelling during the symbiotic interaction between Tuber melanosporum and Corylus avellana using a carbohydrate microarray.

Science.gov (United States)

Sillo, Fabiano; Fangel, Jonatan U; Henrissat, Bernard; Faccio, Antonella; Bonfante, Paola; Martin, Francis; Willats, William G T; Balestrini, Raffaella

2016-08-01

A combined approach, using a carbohydrate microarray as a support for genomic data, has revealed subtle plant cell-wall remodelling during Tuber melanosporum and Corylus avellana interaction. Cell walls are involved, to a great extent, in mediating plant-microbe interactions. An important feature of these interactions concerns changes in the cell-wall composition during interaction with other organisms. In ectomycorrhizae, plant and fungal cell walls come into direct contact, and represent the interface between the two partners. However, very little information is available on the re-arrangement that could occur within the plant and fungal cell walls during ectomycorrhizal symbiosis. Taking advantage of the Comprehensive Microarray Polymer Profiling (CoMPP) technology, the current study has had the aim of monitoring the changes that take place in the plant cell wall in Corylus avellana roots during colonization by the ascomycetous ectomycorrhizal fungus T. melanosporum. Additionally, genes encoding putative plant cell-wall degrading enzymes (PCWDEs) have been identified in the T. melanosporum genome, and RT-qPCRs have been performed to verify the expression of selected genes in fully developed C. avellana/T. melanosporum ectomycorrhizae. A localized degradation of pectin seems to occur during fungal colonization, in agreement with the growth of the ectomycorrhizal fungus through the middle lamella and with the fungal gene expression of genes acting on these polysaccharides.

New genes and new biological roles for expansins

Science.gov (United States)

Cosgrove, D. J.

2000-01-01

Expansins are extracellular proteins that loosen plant cell walls in novel ways. They are thought to function in cell enlargement, pollen tube invasion of the stigma (in grasses), wall disassembly during fruit ripening, abscission and other cell separation events. Expansins are encoded by two multigene families and each gene is often expressed in highly specific locations and cell types. Structural analysis indicates that one expansin region resembles the catalytic domain of family-45 endoglucanases but glucanase activity has not been detected. The genome projects have revealed numerous expansin-related sequences but their putative wall-loosening functions remain to be assessed.

[BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

Science.gov (United States)

Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

2015-01-01

A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

Expression of cbsA encoding the collagen-binding S-protein of Lactobacillus crispatus JCM5810 in Lactobacillus casei ATCC 393T

NARCIS (Netherlands)

Martínez, B.; Sillanpää, J.; Smit, E.; Korhonen, T.K.; Pouwels, P.H.

2000-01-01

The cbsA gene encoding the collagen-binding S-layer protein of Lactobacillus crispatus JCM5810 was expressed in L. casei ATCC 393T. The S-protein was not retained on the surface of the recombinant bacteria but was secreted into the medium. By translational fusion of CbsA to the cell wall sorting

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Identification, Characterization and Expression Analysis of Cell Wall Related Genes in Sorghum bicolor (L. Moench, a Food, Fodder and Biofuel Crop

Directory of Open Access Journals (Sweden)

KRISHAN MOHAN RAI

2016-08-01

Full Text Available Biomass based alternative fuels offer a solution to the world’s ever-increasing energy demand. With the ability to produce high biomass in marginal lands with low inputs, sorghum has a great potential to meet second-generation biofuel needs. Despite the sorghum crop importance in biofuel and fodder industry, there is no comprehensive information available on the cell wall related genes and gene families (biosynthetic and modification. It is important to identify the cell wall related genes to understand the cell wall biosynthetic process as well as to facilitate biomass manipulation. Genome-wide analysis using gene family specific Hidden Markov Model of conserved domains identified 520 genes distributed among 20 gene families related to biosynthesis/modification of various cell wall polymers such as cellulose, hemicellulose, pectin and lignin. Chromosomal localization analysis of these genes revealed that about 65% of cell wall related genes were confined to four chromosomes (Chr. 1-4. Further, 53 tandem duplication events involving 146 genes were identified in these gene families which could be associated with expansion of genes within families in sorghum. Additionally, we also identified 137 Simple Sequence Repeats related to 112 genes and target sites for 10 miRNAs in some important families such as cellulose synthase, cellulose synthase-like and laccases, etc. To gain further insight into potential functional roles, expression analysis of these gene families was performed using publicly available data sets in various tissues and under abiotic stress conditions. Expression analysis showed tissue specificity as well as differential expression under abiotic stress conditions. Overall, our study provides a comprehensive information on cell wall related genes families in sorghum which offers a valuable resource to develop strategies for altering biomass composition by plant breeding and genetic engineering approaches.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

The plant secretory pathway seen through the lens of the cell wall.

Science.gov (United States)

van de Meene, A M L; Doblin, M S; Bacic, Antony

2017-01-01

Secretion in plant cells is often studied by looking at well-characterised, evolutionarily conserved membrane proteins associated with particular endomembrane compartments. Studies using live cell microscopy and fluorescent proteins have illuminated the highly dynamic nature of trafficking, and electron microscopy studies have resolved the ultrastructure of many compartments. Biochemical and molecular analyses have further informed about the function of particular proteins and endomembrane compartments. In plants, there are over 40 cell types, each with highly specialised functions, and hence potential variations in cell biological processes and cell wall structure. As the primary function of secretion in plant cells is for the biosynthesis of cell wall polysaccharides and apoplastic transport complexes, it follows that utilising our knowledge of cell wall glycosyltransferases (GTs) and their polysaccharide products will inform us about secretion. Indeed, this knowledge has led to novel insights into the secretory pathway, including previously unseen post-TGN secretory compartments. Conversely, our knowledge of trafficking routes of secretion will inform us about polarised and localised deposition of cell walls and their constituent polysaccharides/glycoproteins. In this review, we look at what is known about cell wall biosynthesis and the secretory pathway and how the different approaches can be used in a complementary manner to study secretion and provide novel insights into these processes.

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

A mariner transposon vector adapted for mutagenesis in oral streptococci

DEFF Research Database (Denmark)

Nilsson, Martin; Christiansen, Natalia; Høiby, Niels

2014-01-01

This article describes the construction and characterization of a mariner-based transposon vector designed for use in oral streptococci, but with a potential use in other Gram-positive bacteria. The new transposon vector, termed pMN100, contains the temperature-sensitive origin of replication rep...... 5000 mutants was used in a screen to identify genes involved in the production of sucrose-dependent extracellular matrix components. Mutants with transposon inserts in genes encoding glycosyltransferases and the competence-related secretory locus were predominantly found in this screen....

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

The Arabidopsis UDP-glycosyltransferases UGT79B2 and UGT79B3, contribute to cold, salt and drought stress tolerance via modulating anthocyanin accumulation.

Science.gov (United States)

Li, Pan; Li, Yan-Jie; Zhang, Feng-Ju; Zhang, Gui-Zhi; Jiang, Xiao-Yi; Yu, Hui-Min; Hou, Bing-Kai

2017-01-01

The plant family 1 UDP-glycosyltransferases (UGTs) are the biggest GT family in plants, which are responsible for transferring sugar moieties onto a variety of small molecules, and control many metabolic processes; however, their physiological significance in planta is largely unknown. Here, we revealed that two Arabidopsis glycosyltransferase genes, UGT79B2 and UGT79B3, could be strongly induced by various abiotic stresses, including cold, salt and drought stresses. Overexpression of UGT79B2/B3 significantly enhanced plant tolerance to low temperatures as well as drought and salt stresses, whereas the ugt79b2/b3 double mutants generated by RNAi (RNA interference) and CRISPR-Cas9 strategies were more susceptible to adverse conditions. Interestingly, the expression of UGT79B2 and UGT79B3 is directly controlled by CBF1 (CRT/DRE-binding factor 1, also named DREB1B) in response to low temperatures. Furthermore, we identified the enzyme activities of UGT79B2/B3 in adding UDP-rhamnose to cyanidin and cyanidin 3-O-glucoside. Ectopic expression of UGT79B2/B3 significantly increased the anthocyanin accumulation, and enhanced the antioxidant activity in coping with abiotic stresses, whereas the ugt79b2/b3 double mutants showed reduced anthocyanin levels. When overexpressing UGT79B2/B3 in tt18 (transparent testa 18), a mutant that cannot synthesize anthocyanins, both genes fail to improve plant adaptation to stress. Taken together, we demonstrate that UGT79B2 and UGT79B3, identified as anthocyanin rhamnosyltransferases, are regulated by CBF1 and confer abiotic stress tolerance via modulating anthocyanin accumulation. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

The Arabidopsis Family GT43 Glycosyltransferases Form Two Functionally Nonredundant Groups Essential for the Elongation of Glucuronoxylan Backbone

Science.gov (United States)

There exist four members of family GT43 glycosyltransferases in the Arabidopsis (Arabidopsis thaliana) genome, and mutations of two of them, IRX9 and IRX14, have previously been shown to cause a defect in glucuronoxylan (GX) biosynthesis. However, it is currently unknown whether ...

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Mutations in Biosynthetic Enzymes for the Protein Linker Region of Chondroitin/Dermatan/Heparan Sulfate Cause Skeletal and Skin Dysplasias

Directory of Open Access Journals (Sweden)

Shuji Mizumoto

2015-01-01

Full Text Available Glycosaminoglycans, including chondroitin, dermatan, and heparan sulfate, have various roles in a wide range of biological events such as cell signaling, cell proliferation, tissue morphogenesis, and interactions with various growth factors. Their polysaccharides covalently attach to the serine residues on specific core proteins through the common linker region tetrasaccharide, -xylose-galactose-galactose-glucuronic acid, which is produced through the stepwise addition of respective monosaccharides by four distinct glycosyltransferases. Mutations in the human genes encoding the glycosyltransferases responsible for the biosynthesis of the linker region tetrasaccharide cause a number of genetic disorders, called glycosaminoglycan linkeropathies, including Desbuquois dysplasia type 2, spondyloepimetaphyseal dysplasia, Ehlers-Danlos syndrome, and Larsen syndrome. This review focused on recent studies on genetic diseases caused by defects in the biosynthesis of the common linker region tetrasaccharide.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Rare Variants in Genes Encoding MuRF1 and MuRF2 Are Modifiers of Hypertrophic Cardiomyopathy

Directory of Open Access Journals (Sweden)

Ming Su

2014-05-01

Full Text Available Modifier genes contribute to the diverse clinical manifestations of hypertrophic cardiomyopathy (HCM, but are still largely unknown. Muscle ring finger (MuRF proteins are a class of muscle-specific ubiquitin E3-ligases that appear to modulate cardiac mass and function by regulating the ubiquitin-proteasome system. In this study we screened all the three members of the MuRF family, MuRF1, MuRF2 and MuRF3, in 594 unrelated HCM patients and 307 healthy controls by targeted resequencing. Identified rare variants were confirmed by capillary Sanger sequencing. The prevalence of rare variants in both MuRF1 and MuRF2 in HCM patients was higher than that in control subjects (MuRF1 13/594 (2.2% vs. 1/307 (0.3%, p = 0.04; MuRF2 22/594 (3.7% vs. 2/307 (0.7%; p = 0.007. Patients with rare variants in MuRF1 or MuRF2 were younger (p = 0.04 and had greater maximum left ventricular wall thickness (p = 0.006 than those without such variants. Mutations in genes encoding sarcomere proteins were present in 19 (55.9% of the 34 HCM patients with rare variants in MuRF1 and MuRF2. These data strongly supported that rare variants in MuRF1 and MuRF2 are associated with higher penetrance and more severe clinical manifestations of HCM. The findings suggest that dysregulation of the ubiquitin-proteasome system contributes to the pathogenesis of HCM.

A combination of dopamine genes predicts success by professional Wall Street traders.

Science.gov (United States)

Sapra, Steve; Beavin, Laura E; Zak, Paul J

2012-01-01

What determines success on Wall Street? This study examined if genes affecting dopamine levels of professional traders were associated with their career tenure. Sixty professional Wall Street traders were genotyped and compared to a control group who did not trade stocks. We found that distinct alleles of the dopamine receptor 4 promoter (DRD4P) and catecholamine-O-methyltransferase (COMT) that affect synaptic dopamine were predominant in traders. These alleles are associated with moderate, rather than very high or very low, levels of synaptic dopamine. The activity of these alleles correlated positively with years spent trading stocks on Wall Street. Differences in personality and trading behavior were also correlated with allelic variants. This evidence suggests there may be a genetic basis for the traits that make one a successful trader.

Discovery of novel cell wall-active compounds using P ywaC, a sensitive reporter of cell wall stress, in the model gram-positive bacterium Bacillus subtilis.

Science.gov (United States)

Czarny, T L; Perri, A L; French, S; Brown, E D

2014-06-01

The emergence of antibiotic resistance in recent years has radically reduced the clinical efficacy of many antibacterial treatments and now poses a significant threat to public health. One of the earliest studied well-validated targets for antimicrobial discovery is the bacterial cell wall. The essential nature of this pathway, its conservation among bacterial pathogens, and its absence in human biology have made cell wall synthesis an attractive pathway for new antibiotic drug discovery. Herein, we describe a highly sensitive screening methodology for identifying chemical agents that perturb cell wall synthesis, using the model of the Gram-positive bacterium Bacillus subtilis. We report on a cell-based pilot screen of 26,000 small molecules to look for cell wall-active chemicals in real time using an autonomous luminescence gene cluster driven by the promoter of ywaC, which encodes a guanosine tetra(penta)phosphate synthetase that is expressed under cell wall stress. The promoter-reporter system was generally much more sensitive than growth inhibition testing and responded almost exclusively to cell wall-active antibiotics. Follow-up testing of the compounds from the pilot screen with secondary assays to verify the mechanism of action led to the discovery of 9 novel cell wall-active compounds. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

Identification of differentially expressed genes from Trichoderma harzianum during growth on cell wall of Fusarium solani as a tool for biotechnological application.

Science.gov (United States)

Vieira, Pabline Marinho; Coelho, Alexandre Siqueira Guedes; Steindorff, Andrei Stecca; de Siqueira, Saulo José Linhares; Silva, Roberto do Nascimento; Ulhoa, Cirano José

2013-03-15

The species of T. harzianum are well known for their biocontrol activity against many plant pathogens. However, there is a lack of studies concerning its use as a biological control agent against F. solani, a pathogen involved in several crop diseases. In this study, we have used subtractive library hybridization (SSH) and quantitative real-time PCR (RT-qPCR) techniques in order to explore changes in T. harzianum genes expression during growth on cell wall of F. solani (FSCW) or glucose. RT-qPCR was also used to examine the regulation of 18 genes, potentially involved in biocontrol, during confrontation between T. harzianum and F. solani. Data obtained from two subtractive libraries were compared after annotation using the Blast2GO suite. A total of 417 and 78 readable EST sequence were annotated in the FSCW and glucose libraries, respectively. Functional annotation of these genes identified diverse biological processes and molecular functions required during T. harzianum growth on FSCW or glucose. We identified various genes of biotechnological value encoding to proteins which function such as transporters, hydrolytic activity, adherence, appressorium development and pathogenesis. Fifteen genes were up-regulated and sixteen were down-regulated at least at one-time point during growth of T. harzianum in FSCW. During the confrontation assay most of the genes were up-regulated, mainly after contact, when the interaction has been established. This study demonstrates that T. harzianum expressed different genes when grown on FSCW compared to glucose. It provides insights into the mechanisms of gene expression involved in mycoparasitism of T. harzianum against F. solani. The identification and evaluation of these genes may contribute to the development of an efficient biological control agent.

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

Directory of Open Access Journals (Sweden)

Bo Liu

Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

Rapid evolution of the sequences and gene repertoires of secreted proteins in bacteria.

Directory of Open Access Journals (Sweden)

Teresa Nogueira

Full Text Available Proteins secreted to the extracellular environment or to the periphery of the cell envelope, the secretome, play essential roles in foraging, antagonistic and mutualistic interactions. We hypothesize that arms races, genetic conflicts and varying selective pressures should lead to the rapid change of sequences and gene repertoires of the secretome. The analysis of 42 bacterial pan-genomes shows that secreted, and especially extracellular proteins, are predominantly encoded in the accessory genome, i.e. among genes not ubiquitous within the clade. Genes encoding outer membrane proteins might engage more frequently in intra-chromosomal gene conversion because they are more often in multi-genic families. The gene sequences encoding the secretome evolve faster than the rest of the genome and in particular at non-synonymous positions. Cell wall proteins in Firmicutes evolve particularly fast when compared with outer membrane proteins of Proteobacteria. Virulence factors are over-represented in the secretome, notably in outer membrane proteins, but cell localization explains more of the variance in substitution rates and gene repertoires than sequence homology to known virulence factors. Accordingly, the repertoires and sequences of the genes encoding the secretome change fast in the clades of obligatory and facultative pathogens and also in the clades of mutualists and free-living bacteria. Our study shows that cell localization shapes genome evolution. In agreement with our hypothesis, the repertoires and the sequences of genes encoding secreted proteins evolve fast. The particularly rapid change of extracellular proteins suggests that these public goods are key players in bacterial adaptation.

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Murine cell glycolipids customization by modular expression of glycosyltransferases.

Science.gov (United States)

Cid, Emili; Yamamoto, Miyako; Buschbeck, Marcus; Yamamoto, Fumiichiro

2013-01-01

Functional analysis of glycolipids has been hampered by their complex nature and combinatorial expression in cells and tissues. We report an efficient and easy method to generate cells with specific glycolipids. In our proof of principle experiments we have demonstrated the customized expression of two relevant glycosphingolipids on murine fibroblasts, stage-specific embryonic antigen 3 (SSEA-3), a marker for stem cells, and Forssman glycolipid, a xenoantigen. Sets of genes encoding glycosyltansferases were transduced by viral infection followed by multi-color cell sorting based on coupled expression of fluorescent proteins.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Shifted Golgi targeting of glycosyltransferases and α-mannosidase IA from giantin to GM130-GRASP65 results in formation of high mannose N-glycans in aggressive prostate cancer cells.

Science.gov (United States)

Bhat, Ganapati; Hothpet, Vishwanath-Reddy; Lin, Ming-Fong; Cheng, Pi-Wan

2017-11-01

There is a pressing need for biomarkers that can distinguish indolent from aggressive prostate cancer to prevent over-treatment of patients with indolent tumor. Golgi targeting of glycosyltransferases was characterized by confocal microscopy after knockdown of GM130, giantin, or both. N-glycans on a trans-Golgi enzyme β4galactosyltransferase-1 isolated by immunoprecipitation from androgen-sensitive and independent prostate cancer cells were determined by matrix-assisted laser desorption-time of flight-mass spectrometry. In situ proximity ligation assay was employed to determine co-localization of (a) α-mannosidase IA, an enzyme required for processing Man 8 GlcNAc 2 down to Man 5 GlcNAc 2 to enable synthesis of complex-type N-glycans, with giantin, GM130, and GRASP65, and (b) trans-Golgi glycosyltransferases with high mannose N-glycans terminated with α3-mannose. Defective giantin in androgen-independent prostate cancer cells results in a shift of Golgi targeting of glycosyltransferases and α-mannosidase IA from giantin to GM130-GRASP65. Consequently, trans-Golgi enzymes and cell surface glycoproteins acquire high mannose N-glycans, which are absent in cells with functional giantin. In situ proximity ligation assays of co-localization of α-mannosidase IA with GM130 and GRASP65, and trans-Golgi glycosyltransferases with high mannose N-glycans are negative in androgen-sensitive LNCaP C-33 cells but positive in androgen-independent LNCaP C-81 and DU145 cells, and LNCaP C-33 cells devoid of giantin. In situ proximity ligation assays of Golgi localization of α-mannosidase IA at giantin versus GM130-GRASP65 site, and absence or presence of N-glycans terminated with α3-mannose on trans-Golgi glycosyltransferases may be useful for distinguishing indolent from aggressive prostate cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

Structures of three different neutral polysaccharides of Acinetobacter baumannii, NIPH190, NIPH201, and NIPH615, assigned to K30, K45, and K48 capsule types, respectively, based on capsule biosynthesis gene clusters.

Science.gov (United States)

Shashkov, Alexander S; Kenyon, Johanna J; Arbatsky, Nikolay P; Shneider, Mikhail M; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

2015-11-19

Neutral capsular polysaccharides (CPSs) were isolated from Acinetobacter baumannii NIPH190, NIPH201, and NIPH615. The CPSs were found to contain common monosaccharides only and to be branched with a side-chain 1→3-linked β-d-glucopyranose residue. Structures of the oligosaccharide repeat units (K units) of the CPSs were elucidated by 1D and 2D (1)H and (13)C NMR spectroscopy. Novel CPS biosynthesis gene clusters, designated KL30, KL45, and KL48, were found at the K locus in the genome sequences of NIPH190, NIPH201, and NIPH615, respectively. The genetic content of each gene cluster correlated with the structure of the CPS unit established, and therefore, the capsular types of the strains studied were designated as K30, K45, and K48, respectively. The initiating sugar of each K unit was predicted, and glycosyltransferases encoded by each gene cluster were assigned to the formation of the linkages between sugars in the corresponding K unit. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Molecular characterization of UGT94F2 and UGT86C4, two glycosyltransferases from Picrorhiza kurrooa: comparative structural insight and evaluation of substrate recognition.

Directory of Open Access Journals (Sweden)

Wajid Waheed Bhat

Full Text Available Uridine diphosphate glycosyltransferases (UGTs are pivotal in the process of glycosylation for decorating natural products with sugars. It is one of the versatile mechanisms in determining chemical complexity and diversity for the production of suite of pharmacologically active plant natural products. Picrorhiza kurrooa is a highly reputed medicinal herb known for its hepato-protective properties which are attributed to a novel group of iridoid glycosides known as picrosides. Although the plant is well studied in terms of its pharmacological properties, very little is known about the biosynthesis of these important secondary metabolites. In this study, we identified two family-1 glucosyltransferases from P. kurrooa. The full length cDNAs of UGT94F4 and UGT86C4 contained open reading frames of 1455 and 1422 nucleotides, encoding polypeptides of 484 and 473 amino acids respectively. UGT94F2 and UGT86C4 showed differential expression pattern in leaves, rhizomes and inflorescence. To elucidate whether the differential expression pattern of the two Picrorhiza UGTs correlate with transcriptional regulation via their promoters and to identify elements that could be recognized by known iridoid-specific transcription factors, upstream regions of each gene were isolated and scanned for putative cis-regulatory elements. Interestingly, the presence of cis-regulatory elements within the promoter regions of each gene correlated positively with their expression profiles in response to different phytohormones. HPLC analysis of picrosides extracted from different tissues and elicitor-treated samples showed a significant increase in picroside levels, corroborating well with the expression profile of UGT94F2 possibly indicating its implication in picroside biosynthesis. Using homology modeling and molecular docking studies, we provide an insight into the donor and acceptor specificities of both UGTs identified in this study. UGT94F2 was predicted to be an iridoid

Saccharomyces cerevisiae gene expression changes during rotating wall vessel suspension culture

Science.gov (United States)

Johanson, Kelly; Allen, Patricia L.; Lewis, Fawn; Cubano, Luis A.; Hyman, Linda E.; Hammond, Timothy G.

2002-01-01

This study utilizes Saccharomyces cerevisiae to study genetic responses to suspension culture. The suspension culture system used in this study is the high-aspect-ratio vessel, one type of the rotating wall vessel, that provides a high rate of gas exchange necessary for rapidly dividing cells. Cells were grown in the high-aspect-ratio vessel, and DNA microarray and metabolic analyses were used to determine the resulting changes in yeast gene expression. A significant number of genes were found to be up- or downregulated by at least twofold as a result of rotational growth. By using Gibbs promoter alignment, clusters of genes were examined for promoter elements mediating these genetic changes. Candidate binding motifs similar to the Rap1p binding site and the stress-responsive element were identified in the promoter regions of differentially regulated genes. This study shows that, as in higher order organisms, S. cerevisiae changes gene expression in response to rotational culture and also provides clues for investigations into the signaling pathways involved in gravitational response.

Human Genetic Disorders and Knockout Mice Deficient in Glycosaminoglycan

Directory of Open Access Journals (Sweden)

Shuji Mizumoto

2014-01-01

Full Text Available Glycosaminoglycans (GAGs are constructed through the stepwise addition of respective monosaccharides by various glycosyltransferases and maturated by epimerases and sulfotransferases. The structural diversity of GAG polysaccharides, including their sulfation patterns and sequential arrangements, is essential for a wide range of biological activities such as cell signaling, cell proliferation, tissue morphogenesis, and interactions with various growth factors. Studies using knockout mice of enzymes responsible for the biosynthesis of the GAG side chains of proteoglycans have revealed their physiological functions. Furthermore, mutations in the human genes encoding glycosyltransferases, sulfotransferases, and related enzymes responsible for the biosynthesis of GAGs cause a number of genetic disorders including chondrodysplasia, spondyloepiphyseal dysplasia, and Ehlers-Danlos syndromes. This review focused on the increasing number of glycobiological studies on knockout mice and genetic diseases caused by disturbances in the biosynthetic enzymes for GAGs.

Exploring the Role of Cell Wall-Related Genes and Polysaccharides during Plant Development.

Science.gov (United States)

Tucker, Matthew R; Lou, Haoyu; Aubert, Matthew K; Wilkinson, Laura G; Little, Alan; Houston, Kelly; Pinto, Sara C; Shirley, Neil J

2018-05-31

The majority of organs in plants are not established until after germination, when pluripotent stem cells in the growing apices give rise to daughter cells that proliferate and subsequently differentiate into new tissues and organ primordia. This remarkable capacity is not only restricted to the meristem, since maturing cells in many organs can also rapidly alter their identity depending on the cues they receive. One general feature of plant cell differentiation is a change in cell wall composition at the cell surface. Historically, this has been viewed as a downstream response to primary cues controlling differentiation, but a closer inspection of the wall suggests that it may play a much more active role. Specific polymers within the wall can act as substrates for modifications that impact receptor binding, signal mobility, and cell flexibility. Therefore, far from being a static barrier, the cell wall and its constituent polysaccharides can dictate signal transmission and perception, and directly contribute to a cell's capacity to differentiate. In this review, we re-visit the role of plant cell wall-related genes and polysaccharides during various stages of development, with a particular focus on how changes in cell wall machinery accompany the exit of cells from the stem cell niche.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Expression and Purification of Glycosyltransferases in Pichia Pastoris: Towards Improving the Migration of Stem Cells by Enhancing Surface Expression of Sialyl Lewis X

KAUST Repository

Al-Amoodi, Asma S.

2017-01-01

Recruitment of circulating cells towards target sites is primarily dependent on E-selectin receptor/ligand adhesive interactions. Glycosyltransferase (GTs) are involved in the creation of E-selectin ligands. A sialofucosylated terminal

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw.

Science.gov (United States)

Jose, V Lyju; Appoothy, Thulasi; More, Ravi P; Arun, A Sha

2017-12-01

The rumen is a unique natural habitat, exhibiting an unparalleled genetic resource of fibrolytic enzymes of microbial origin that degrade plant polysaccharides. The objectives of this study were to identify the principal plant cell wall-degrading enzymes and the taxonomic profile of rumen microbial communities that are associated with it. The cattle rumen microflora and the carbohydrate-active enzymes were functionally classified through a whole metagenomic sequencing approach. Analysis of the assembled sequences by the Carbohydrate-active enzyme analysis Toolkit identified the candidate genes encoding fibrolytic enzymes belonging to different classes of glycoside hydrolases(11,010 contigs), glycosyltransferases (6366 contigs), carbohydrate esterases (4945 contigs), carbohydrate-binding modules (1975 contigs), polysaccharide lyases (480 contigs), and auxiliary activities (115 contigs). Phylogenetic analysis of CAZyme encoding contigs revealed that a significant proportion of CAZymes were contributed by bacteria belonging to genera Prevotella, Bacteroides, Fibrobacter, Clostridium, and Ruminococcus. The results indicated that the cattle rumen microbiome and the CAZymes are highly complex, structurally similar but compositionally distinct from other ruminants. The unique characteristics of rumen microbiota and the enzymes produced by resident microbes provide opportunities to improve the feed conversion efficiency in ruminants and serve as a reservoir of industrially important enzymes for cellulosic biofuel production.

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Sorghum Brown midrib 2 (Bmr2) gene encodes the major 4-coumarate Coenzyme A ligase involved in lignin synthesis

Science.gov (United States)

Successful modification of plant cell wall composition without compromising plant integrity is dependent on being able to modify the expression of specific genes, but can be very challenging when the target genes are members of multigene families. 4-Coumarate:CoA ligase (4CL) catalyzes the formatio...

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

Directory of Open Access Journals (Sweden)

William P. Bewg

2017-12-01

Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.)

DEFF Research Database (Denmark)

Chen, Yongsheng; Zein, Imad; Brenner, Everton A

2010-01-01

Background Reduced lignin content leads to higher cell wall digestibility and, therefore, better forage quality and increased conversion of lignocellulosic biomass into ethanol. However, reduced lignin content might lead to weaker stalks, lodging, and reduced biomass yield. Genes encoding enzymes...

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Stiff mutant genes of Phycomyces target turgor pressure and wall mechanical properties to regulate elongation growth rate

Directory of Open Access Journals (Sweden)

Joseph K. E. Ortega

2012-05-01

Full Text Available Regulation of cell growth is paramount to all living organisms. In plants, algae and fungi, regulation of expansive growth of cells is required for development and morphogenesis. Also, many sensory responses of stage IVb sporangiophores of Phycomyces blakesleeanus are produced by regulating elongation growth rate (growth responses and differential elongation growth rate (tropic responses. Stiff mutant sporangiophores exhibit diminished tropic responses and are found to be defective in at least four genes; madD, madE, madF and madG. Prior experimental research suggests that the defective genes affect growth regulation, but this was not verified. All the growth of the single-celled stalk of the stage IVb sporangiophore occurs in a short region termed the growth zone. Prior experimental and theoretical research indicates that elongation growth rate of the stage IVb sporangiophore can be regulated by controlling the cell wall mechanical properties within the growth zone and the magnitude of the turgor pressure. A quantitative biophysical model for elongation growth rate is required to elucidate the relationship between wall mechanical properties and turgor pressure during growth regulation. In this study, it is hypothesized that the mechanical properties of the wall within the growth zone of stiff mutant sporangiophores are different compared to wild type. A biophysical equation for elongation growth rate is derived for fungal and plant cells with a growth zone. Two strains of stiff mutants are studied, C149 madD120 (- and C216 geo- (-. Experimental results demonstrate that turgor pressure is larger but irreversible deformation rates of the wall within the growth zone and growth zone length are smaller for stiff mutant sporangiophores compared to wild type. These findings explain the diminished tropic responses of the stiff mutant sporangiophores and suggest that the defective genes affect the amount of wall-building material delivered to the inner

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

Grass cell wall feruloylation: distribution of bound ferulate and candidate gene expression in Brachypodium distachyon

Directory of Open Access Journals (Sweden)

Hugo Bruno Correa Molinari

2013-03-01

Full Text Available The cell walls of grasses such as wheat, maize, rice and sugar cane, contain large amounts of ferulate that is ester-linked to the cell wall polysaccharide glucuronoarabinoxylan (GAX. This ferulate is considered to limit the digestibility of polysaccharide in grass biomass as it forms covalent linkages between polysaccharide and lignin components. Candidate genes within a grass-specific clade of the BAHD acyl-coA transferase superfamily have been identified as being responsible for the ester linkage of ferulate to GAX. Manipulation of these BAHD genes may therefore be a biotechnological target for increasing efficiency of conversion of grass biomass into biofuel. Here, we describe the expression of these candidate genes and amounts of bound ferulate from various tissues and developmental stages of the model grass Brachypodium distachyon. BAHD candidate transcripts and significant amounts of bound ferulate were present in every tissue and developmental stage. We hypothesise that BAHD candidate genes similar to the recently described rice OsPMT gene (PMT sub-clade are principally responsible for the bound coumaric acid (pCA, and that other BAHD candidates (non-PMT sub-clade are responsible for bound ferulic acid (FA. There were some similarities with between the ratio of expression non-PMT / PMT genes and the ratio of bound FA / pCA between tissue types, compatible with this hypothesis. However, much further work to modify BAHD genes in grasses and to characterise the heterologously expressed proteins is required to demonstrate their function.

Analysis of the transcriptome of Panax notoginseng root uncovers putative triterpene saponin-biosynthetic genes and genetic markers

Science.gov (United States)

2011-01-01

Background Panax notoginseng (Burk) F.H. Chen is important medicinal plant of the Araliacease family. Triterpene saponins are the bioactive constituents in P. notoginseng. However, available genomic information regarding this plant is limited. Moreover, details of triterpene saponin biosynthesis in the Panax species are largely unknown. Results Using the 454 pyrosequencing technology, a one-quarter GS FLX titanium run resulted in 188,185 reads with an average length of 410 bases for P. notoginseng root. These reads were processed and assembled by 454 GS De Novo Assembler software into 30,852 unique sequences. A total of 70.2% of unique sequences were annotated by Basic Local Alignment Search Tool (BLAST) similarity searches against public sequence databases. The Kyoto Encyclopedia of Genes and Genomes (KEGG) assignment discovered 41 unique sequences representing 11 genes involved in triterpene saponin backbone biosynthesis in the 454-EST dataset. In particular, the transcript encoding dammarenediol synthase (DS), which is the first committed enzyme in the biosynthetic pathway of major triterpene saponins, is highly expressed in the root of four-year-old P. notoginseng. It is worth emphasizing that the candidate cytochrome P450 (Pn02132 and Pn00158) and UDP-glycosyltransferase (Pn00082) gene most likely to be involved in hydroxylation or glycosylation of aglycones for triterpene saponin biosynthesis were discovered from 174 cytochrome P450s and 242 glycosyltransferases by phylogenetic analysis, respectively. Putative transcription factors were detected in 906 unique sequences, including Myb, homeobox, WRKY, basic helix-loop-helix (bHLH), and other family proteins. Additionally, a total of 2,772 simple sequence repeat (SSR) were identified from 2,361 unique sequences, of which, di-nucleotide motifs were the most abundant motif. Conclusion This study is the first to present a large-scale EST dataset for P. notoginseng root acquired by next-generation sequencing (NGS

Analysis of the transcriptome of Panax notoginseng root uncovers putative triterpene saponin-biosynthetic genes and genetic markers

Directory of Open Access Journals (Sweden)

Luo Hongmei

2011-12-01

Full Text Available Abstract Background Panax notoginseng (Burk F.H. Chen is important medicinal plant of the Araliacease family. Triterpene saponins are the bioactive constituents in P. notoginseng. However, available genomic information regarding this plant is limited. Moreover, details of triterpene saponin biosynthesis in the Panax species are largely unknown. Results Using the 454 pyrosequencing technology, a one-quarter GS FLX titanium run resulted in 188,185 reads with an average length of 410 bases for P. notoginseng root. These reads were processed and assembled by 454 GS De Novo Assembler software into 30,852 unique sequences. A total of 70.2% of unique sequences were annotated by Basic Local Alignment Search Tool (BLAST similarity searches against public sequence databases. The Kyoto Encyclopedia of Genes and Genomes (KEGG assignment discovered 41 unique sequences representing 11 genes involved in triterpene saponin backbone biosynthesis in the 454-EST dataset. In particular, the transcript encoding dammarenediol synthase (DS, which is the first committed enzyme in the biosynthetic pathway of major triterpene saponins, is highly expressed in the root of four-year-old P. notoginseng. It is worth emphasizing that the candidate cytochrome P450 (Pn02132 and Pn00158 and UDP-glycosyltransferase (Pn00082 gene most likely to be involved in hydroxylation or glycosylation of aglycones for triterpene saponin biosynthesis were discovered from 174 cytochrome P450s and 242 glycosyltransferases by phylogenetic analysis, respectively. Putative transcription factors were detected in 906 unique sequences, including Myb, homeobox, WRKY, basic helix-loop-helix (bHLH, and other family proteins. Additionally, a total of 2,772 simple sequence repeat (SSR were identified from 2,361 unique sequences, of which, di-nucleotide motifs were the most abundant motif. Conclusion This study is the first to present a large-scale EST dataset for P. notoginseng root acquired by next

Impairment of Cellulose Synthases Required for Arabidopsis Secondary Cell Wall Formation Enhances Disease Resistance[W

Science.gov (United States)

Hernández-Blanco, Camilo; Feng, Dong Xin; Hu, Jian; Sánchez-Vallet, Andrea; Deslandes, Laurent; Llorente, Francisco; Berrocal-Lobo, Marta; Keller, Harald; Barlet, Xavier; Sánchez-Rodríguez, Clara; Anderson, Lisa K.; Somerville, Shauna; Marco, Yves; Molina, Antonio

2007-01-01

Cellulose is synthesized by cellulose synthases (CESAs) contained in plasma membrane–localized complexes. In Arabidopsis thaliana, three types of CESA subunits (CESA4/IRREGULAR XYLEM5 [IRX5], CESA7/IRX3, and CESA8/IRX1) are required for secondary cell wall formation. We report that mutations in these proteins conferred enhanced resistance to the soil-borne bacterium Ralstonia solanacearum and the necrotrophic fungus Plectosphaerella cucumerina. By contrast, susceptibility to these pathogens was not altered in cell wall mutants of primary wall CESA subunits (CESA1, CESA3/ISOXABEN RESISTANT1 [IXR1], and CESA6/IXR2) or POWDERY MILDEW–RESISTANT5 (PMR5) and PMR6 genes. Double mutants indicated that irx-mediated resistance was independent of salicylic acid, ethylene, and jasmonate signaling. Comparative transcriptomic analyses identified a set of common irx upregulated genes, including a number of abscisic acid (ABA)–responsive, defense-related genes encoding antibiotic peptides and enzymes involved in the synthesis and activation of antimicrobial secondary metabolites. These data as well as the increased susceptibility of ABA mutants (abi1-1, abi2-1, and aba1-6) to R. solanacearum support a direct role of ABA in resistance to this pathogen. Our results also indicate that alteration of secondary cell wall integrity by inhibiting cellulose synthesis leads to specific activation of novel defense pathways that contribute to the generation of an antimicrobial-enriched environment hostile to pathogens. PMID:17351116

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

The genetic interaction network of CCW12, a Saccharomyces cerevisiae gene required for cell wall integrity during budding and formation of mating projections

Science.gov (United States)

2011-01-01

Background Mannoproteins construct the outer cover of the fungal cell wall. The covalently linked cell wall protein Ccw12p is an abundant mannoprotein. It is considered as crucial structural cell wall component since in baker's yeast the lack of CCW12 results in severe cell wall damage and reduced mating efficiency. Results In order to explore the function of CCW12, we performed a Synthetic Genetic Analysis (SGA) and identified genes that are essential in the absence of CCW12. The resulting interaction network identified 21 genes involved in cell wall integrity, chitin synthesis, cell polarity, vesicular transport and endocytosis. Among those are PFD1, WHI3, SRN2, PAC10, FEN1 and YDR417C, which have not been related to cell wall integrity before. We correlated our results with genetic interaction networks of genes involved in glucan and chitin synthesis. A core of genes essential to maintain cell integrity in response to cell wall stress was identified. In addition, we performed a large-scale transcriptional analysis and compared the transcriptional changes observed in mutant ccw12Δ with transcriptomes from studies investigating responses to constitutive or acute cell wall damage. We identified a set of genes that are highly induced in the majority of the mutants/conditions and are directly related to the cell wall integrity pathway and cell wall compensatory responses. Among those are BCK1, CHS3, EDE1, PFD1, SLT2 and SLA1 that were also identified in the SGA. In contrast, a specific feature of mutant ccw12Δ is the transcriptional repression of genes involved in mating. Physiological experiments substantiate this finding. Further, we demonstrate that Ccw12p is present at the cell periphery and highly concentrated at the presumptive budding site, around the bud, at the septum and at the tip of the mating projection. Conclusions The combination of high throughput screenings, phenotypic analyses and localization studies provides new insight into the function of Ccw

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Interaction and modulation of two antagonistic cell wall enzymes of mycobacteria.

Directory of Open Access Journals (Sweden)

Erik C Hett

2010-07-01

Full Text Available Bacterial cell growth and division require coordinated cell wall hydrolysis and synthesis, allowing for the removal and expansion of cell wall material. Without proper coordination, unchecked hydrolysis can result in cell lysis. How these opposing activities are simultaneously regulated is poorly understood. In Mycobacterium tuberculosis, the resuscitation-promoting factor B (RpfB, a lytic transglycosylase, interacts and synergizes with Rpf-interacting protein A (RipA, an endopeptidase, to hydrolyze peptidoglycan. However, it remains unclear what governs this synergy and how it is coordinated with cell wall synthesis. Here we identify the bifunctional peptidoglycan-synthesizing enzyme, penicillin binding protein 1 (PBP1, as a RipA-interacting protein. PBP1, like RipA, localizes both at the poles and septa of dividing cells. Depletion of the ponA1 gene, encoding PBP1 in M. smegmatis, results in a severe growth defect and abnormally shaped cells, indicating that PBP1 is necessary for viability and cell wall stability. Finally, PBP1 inhibits the synergistic hydrolysis of peptidoglycan by the RipA-RpfB complex in vitro. These data reveal a post-translational mechanism for regulating cell wall hydrolysis and synthesis through protein-protein interactions between enzymes with antagonistic functions.

Suppression of 9-cis-epoxycarotenoid dioxygenase, which encodes a key enzyme in abscisic acid biosynthesis, alters fruit texture in transgenic tomato.

Science.gov (United States)

Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping

2012-01-01

Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp).

The Mkk2 MAPKK Regulates Cell Wall Biogenesis in Cooperation with the Cek1-Pathway in Candida albicans.

Directory of Open Access Journals (Sweden)

Elvira Román

Full Text Available The cell wall integrity pathway (CWI plays an important role in the biogenesis of the cell wall in Candida albicans and other fungi. In the present work, the C. albicans MKK2 gene that encodes the putative MAPKK of this pathway was deleted in different backgrounds and the phenotypes of the resultant mutants were characterised. We show here that Mkk2 mediates the phosphorylation of the Mkc1 MAPK in response to cell wall assembly interfering agents such as zymolyase or tunicamycin and also to oxidative stress. Remarkably, mkk2 and mkc1 mutants display related but distinguishable- cell wall associated phenotypes and differ in the pattern of MAPK phosphorylation under different stress conditions. mkk2 and mkc1 mutants display an altered expression of GSC1, CEK1 and CRH11 genes at different temperatures. Combined deletion of MKK2 with HST7 supports a cooperative role for the Cek1-mediated and CWI pathways in regulating cell wall architecture under vegetative growth. However, and in contrast to Mkc1, Mkk2 does not seem to play a role in the virulence of C. albicans in the mouse systemic model or the Galleria mellonella model of infection.

Multi-omics analysis identifies genes mediating the extension of cell walls in the Arabidopsis thaliana root elongation zone

DEFF Research Database (Denmark)

Wilson, Michael H; Holman, Tara J; Sørensen, Iben

2015-01-01

Plant cell wall composition is important for regulating growth rates, especially in roots. However, neither analyses of cell wall composition nor transcriptomes on their own can comprehensively reveal which genes and processes are mediating growth and cell elongation rates. This study reveals...... the benefits of carrying out multiple analyses in combination. Sections of roots from five anatomically and functionally defined zones in Arabidopsis thaliana were prepared and divided into three biological replicates. We used glycan microarrays and antibodies to identify the major classes of glycans......)cellular localization of many epitopes. Extensins were localized in epidermal and cortex cell walls, while AGP glycans were specific to different tissues from root-hair cells to the stele. The transcriptome analysis found several gene families peaking in the REZ. These included a large family of peroxidases (which...

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Gravity resistance, another graviresponse in plants - role of microtubule-membrane-cell wall continuum

Science.gov (United States)

Hoson, T.; Saito, Y.; Usui, S.; Soga, K.; Wakabayashi, K.

Resistance to the gravitational force has been a serious problem for plants to survive on land, after they first went ashore more than 400 million years ago. Thus, gravity resistance is the principal graviresponse in plants comparable to gravitropism. Nevertheless, only limited information has been obtained for this second gravity response. We have examined the mechanism of gravity resistance using hypergravity conditions produced by centrifugation. The results led a hypothesis on the mechanism of plant resistance to the gravitational force that the plant constructs a tough body by increasing the cell wall rigidity, which are brought about by modification of the cell wall metabolism and cell wall environment, especially pH. The hypothesis was further supported by space experiments during the Space Shuttle STS-95 mission. On the other hand, we have shown that gravity signal may be perceived by mechanoreceptors (mechanosensitive ion channels) on the plasma membrane and amyloplast sedimentation in statocytes is not involved in gravity resistance. Moreover, hypergravity treatment increased the expression levels of genes encoding alpha-tubulin, a component of microtubules and 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGR), which catalyzes a reaction producing mevalonic acid, a key precursor of terpenoids such as membrane sterols. The expression of HMGR and alpha- and beta-tubulin genes increased within several hours after hypergravity treatment, depending on the magnitude of gravity. The determination of levels of gene products as well as the analysis with knockout mutants of these genes by T-DNA insertions in Arabidopsis supports the involvement of both membrane sterols and microtubules in gravity resistance. These results suggest that structural or physiological continuum of microtubule-cell membrane-cell wall is responsible for plant resistance to the gravitational force.

Isolation of a novel cell wall architecture mutant of rice with defective Arabidopsis COBL4 ortholog BC1 required for regulated deposition of secondary cell wall components.

Science.gov (United States)

Sato, Kanna; Suzuki, Ryu; Nishikubo, Nobuyuki; Takenouchi, Sachi; Ito, Sachiko; Nakano, Yoshimi; Nakaba, Satoshi; Sano, Yuzou; Funada, Ryo; Kajita, Shinya; Kitano, Hidemi; Katayama, Yoshihiro

2010-06-01

The plant secondary cell wall is a highly ordered structure composed of various polysaccharides, phenolic components and proteins. Its coordinated regulation of a number of complex metabolic pathways and assembly has not been resolved. To understand the molecular mechanisms that regulate secondary cell wall synthesis, we isolated a novel rice mutant, cell wall architecture1 (cwa1), that exhibits an irregular thickening pattern in the secondary cell wall of sclerenchyma, as well as culm brittleness and reduced cellulose content in mature internodes. Light and transmission electron microscopy revealed that the cwa1 mutant plant has regions of local aggregation in the secondary cell walls of the cortical fibers in its internodes, showing uneven thickness. Ultraviolet microscopic observation indicated that localization of cell wall phenolic components was perturbed and that these components abundantly deposited at the aggregated cell wall regions in sclerenchyma. Therefore, regulation of deposition and assembly of secondary cell wall materials, i.e. phenolic components, appear to be disturbed by mutation of the cwa1 gene. Genetic analysis showed that cwa1 is allelic to brittle culm1 (bc1), which encodes the glycosylphosphatidylinositol-anchored COBRA-like protein specifically in plants. BC1 is known as a regulator that controls the culm mechanical strength and cellulose content in the secondary cell walls of sclerenchyma, but the precise function of BC1 has not been resolved. Our results suggest that CWA1/BC1 has an essential role in assembling cell wall constituents at their appropriate sites, thereby enabling synthesis of solid and flexible internodes in rice.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

Novel drug targets in cell wall biosynthesis exploited by gene disruption in Pseudomonas aeruginosa.

Science.gov (United States)

Elamin, Ayssar A; Steinicke, Susanne; Oehlmann, Wulf; Braun, Yvonne; Wanas, Hanaa; Shuralev, Eduard A; Huck, Carmen; Maringer, Marko; Rohde, Manfred; Singh, Mahavir

2017-01-01

For clinicians, Pseudomonas aeruginosa is a nightmare pathogen that is one of the top three causes of opportunistic human infections. Therapy of P. aeruginosa infections is complicated due to its natural high intrinsic resistance to antibiotics. Active efflux and decreased uptake of drugs due to cell wall/membrane permeability appear to be important issues in the acquired antibiotic tolerance mechanisms. Bacterial cell wall biosynthesis enzymes have been shown to be essential for pathogenicity of Gram-negative bacteria. However, the role of these targets in virulence has not been identified in P. aeruginosa. Here, we report knockout (k.o) mutants of six cell wall biosynthesis targets (murA, PA4450; murD, PA4414; murF, PA4416; ppiB, PA1793; rmlA, PA5163; waaA, PA4988) in P. aeruginosa PAO1, and characterized these in order to find out whether these genes and their products contribute to pathogenicity and virulence of P. aeruginosa. Except waaA k.o, deletion of cell wall biosynthesis targets significantly reduced growth rate in minimal medium compared to the parent strain. The k.o mutants showed exciting changes in cell morphology and colonial architectures. Remarkably, ΔmurF cells became grossly enlarged. Moreover, the mutants were also attenuated in vivo in a mouse infection model except ΔmurF and ΔwaaA and proved to be more sensitive to macrophage-mediated killing than the wild-type strain. Interestingly, the deletion of the murA gene resulted in loss of virulence activity in mice, and the virulence was restored in a plant model by unknown mechanism. This study demonstrates that cell wall targets contribute significantly to intracellular survival, in vivo growth, and pathogenesis of P. aeruginosa. In conclusion, these findings establish a link between cell wall targets and virulence of P. aeruginosa and thus may lead to development of novel drugs for the treatment of P. aeruginosa infection.

Changes in cell wall properties coincide with overexpression of extensin fusion proteins in suspension cultured tobacco cells.

Science.gov (United States)

Tan, Li; Pu, Yunqiao; Pattathil, Sivakumar; Avci, Utku; Qian, Jin; Arter, Allison; Chen, Liwei; Hahn, Michael G; Ragauskas, Arthur J; Kieliszewski, Marcia J

2014-01-01

Extensins are one subfamily of the cell wall hydroxyproline-rich glycoproteins, containing characteristic SerHyp4 glycosylation motifs and intermolecular cross-linking motifs such as the TyrXaaTyr sequence. Extensins are believed to form a cross-linked network in the plant cell wall through the tyrosine-derivatives isodityrosine, pulcherosine, and di-isodityrosine. Overexpression of three synthetic genes encoding different elastin-arabinogalactan protein-extensin hybrids in tobacco suspension cultured cells yielded novel cross-linking glycoproteins that shared features of the extensins, arabinogalactan proteins and elastin. The cell wall properties of the three transgenic cell lines were all changed, but in different ways. One transgenic cell line showed decreased cellulose crystallinity and increased wall xyloglucan content; the second transgenic cell line contained dramatically increased hydration capacity and notably increased cell wall biomass, increased di-isodityrosine, and increased protein content; the third transgenic cell line displayed wall phenotypes similar to wild type cells, except changed xyloglucan epitope extractability. These data indicate that overexpression of modified extensins may be a route to engineer plants for bioenergy and biomaterial production.

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

Science.gov (United States)

Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

2014-01-01

Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

OpenAIRE

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

Wall morphology, blood flow and wall shear stress: MR findings in patients with peripheral artery disease

Energy Technology Data Exchange (ETDEWEB)

Galizia, Mauricio S.; Barker, Alex; Collins, Jeremy; Carr, James [Northwestern University, Department of Radiology, Feinberg School of Medicine, Chicago, IL (United States); Liao, Yihua [Northwestern University' s Feinberg School of Medicine, Department of Preventive Medicine, Chicago, IL (United States); McDermott, Mary M. [Northwestern University' s Feinberg School of Medicine, Department of Preventive Medicine, Chicago, IL (United States); Northwestern University' s Feinberg School of Medicine, Department of Medicine, Chicago, IL (United States); Markl, Michael [Northwestern University, Department of Radiology, Feinberg School of Medicine, Chicago, IL (United States); Northwestern University, Department Biomedical Engineering, McCormick School of Engineering, Chicago, IL (United States)

2014-04-15

To investigate the influence of atherosclerotic plaques on femoral haemodynamics assessed by two-dimensional (2D) phase-contrast (PC) magnetic resonance imaging (MRI) with three-directional velocity encoding. During 1 year, patients with peripheral artery disease and an ankle brachial index <1.00 were enrolled. After institutional review board approval and written informed consent, 44 patients (age, 70 ± 12 years) underwent common femoral artery MRI. Patients with contra-indications for MRI were excluded. Sequences included 2D time-of-flight, proton-density, T1-weighted and T2-weighted MRI. Electrocardiogram (ECG)-gated 2D PC-MRI with 3D velocity encoding was acquired. A radiologist classified images in five categories. Blood flow, velocity and wall shear stress (WSS) along the vessel circumference were quantified from the PC-MRI data. The acquired images were of good quality for interpretation. There were no image quality problems related to poor ECG-gating or slice positioning. Velocities, oscillatory shear stress and total flow were similar between patients with normal arteries and wall thickening/plaque. Patients with plaques demonstrated regionally increased peak systolic WSS and enhanced WSS eccentricity. Combined multi-contrast morphological imaging of the peripheral arterial wall with PC-MRI with three-directional velocity encoding is a feasible technique. Further study is needed to determine whether flow is an appropriate marker for altered endothelial cell function, vascular remodelling and plaque progression. (orig.)

Plant glycosylphosphatidylinositol (GPI) anchored proteins at the plasma membrane-cell wall nexus.

Science.gov (United States)

Yeats, Trevor H; Bacic, Antony; Johnson, Kim L

2018-04-18

Approximately 1% of plant proteins are predicted to be post-translationally modified with a glycosylphosphatidylinositol (GPI) anchor that tethers the polypeptide to the outer leaflet of the plasma membrane. While the synthesis and structure of GPI anchors is largely conserved across eukaryotes, the repertoire of functional domains present in the GPI-anchored proteome has diverged substantially. In plants, this includes a large fraction of the GPI-anchored proteome being further modified with plant-specific arabinogalactan (AG) O-glycans. The importance of the GPI-anchored proteome to plant development is underscored by the fact that GPI biosynthetic null mutants exhibit embryo lethality. Mutations in genes encoding specific GPI-anchored proteins (GAPs) further supports their contribution to diverse biological processes occurring at the interface of the plasma membrane and cell wall, including signaling, cell wall metabolism, cell wall polymer cross-linking, and plasmodesmatal transport. Here, we review the literature concerning plant GPI-anchored proteins in the context of their potential to act as molecular hubs that mediate interactions between the plasma membrane and the cell wall and their potential to transduce the signal into the protoplast and thereby activate signal transduction pathways. This article is protected by copyright. All rights reserved.

Mutational analysis of the glycosylphosphatidylinositol (GPI) anchor pathway demonstrates that GPI-anchored proteins are required for cell wall biogenesis and normal hyphal growth in Neurospora crassa.

Science.gov (United States)

Bowman, Shaun M; Piwowar, Amy; Al Dabbous, Mash'el; Vierula, John; Free, Stephen J

2006-03-01

Using mutational and proteomic approaches, we have demonstrated the importance of the glycosylphosphatidylinositol (GPI) anchor pathway for cell wall synthesis and integrity and for the overall morphology of the filamentous fungus Neurospora crassa. Mutants affected in the gpig-1, gpip-1, gpip-2, gpip-3, and gpit-1 genes, which encode components of the N. crassa GPI anchor biosynthetic pathway, have been characterized. GPI anchor mutants exhibit colonial morphologies, significantly reduced rates of growth, altered hyphal growth patterns, considerable cellular lysis, and an abnormal "cell-within-a-cell" phenotype. The mutants are deficient in the production of GPI-anchored proteins, verifying the requirement of each altered gene for the process of GPI-anchoring. The mutant cell walls are abnormally weak, contain reduced amounts of protein, and have an altered carbohydrate composition. The mutant cell walls lack a number of GPI-anchored proteins, putatively involved in cell wall biogenesis and remodeling. From these studies, we conclude that the GPI anchor pathway is critical for proper cell wall structure and function in N. crassa.

Structural characterization of O- and C-glycosylating variants of the landomycin glycosyltransferase LanGT2.

Science.gov (United States)

Tam, Heng Keat; Härle, Johannes; Gerhardt, Stefan; Rohr, Jürgen; Wang, Guojun; Thorson, Jon S; Bigot, Aurélien; Lutterbeck, Monika; Seiche, Wolfgang; Breit, Bernhard; Bechthold, Andreas; Einsle, Oliver

2015-02-23

The structures of the O-glycosyltransferase LanGT2 and the engineered, C-C bond-forming variant LanGT2S8Ac show how the replacement of a single loop can change the functionality of the enzyme. Crystal structures of the enzymes in complex with a nonhydrolyzable nucleotide-sugar analogue revealed that there is a conformational transition to create the binding sites for the aglycon substrate. This induced-fit transition was explored by molecular docking experiments with various aglycon substrates. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fungi unearthed: transcripts encoding lignocellulolytic and chitinolytic enzymes in forest soil.

Directory of Open Access Journals (Sweden)

Harald Kellner

Full Text Available BACKGROUND: Fungi are the main organisms responsible for the degradation of biopolymers such as lignin, cellulose, hemicellulose, and chitin in forest ecosystems. Soil surveys largely target fungal diversity, paying less attention to fungal activity. METHODOLOGY/PRINCIPAL FINDINGS: Here we have focused on the organic horizon of a hardwood forest dominated by sugar maple that spreads widely across Eastern North America. The sampling site included three plots receiving normal atmospheric nitrogen deposition and three that received an extra 3 g nitrogen m(2 y(1 in form of sodium nitrate pellets since 1994, which led to increased accumulation of organic matter in the soil. Our aim was to assess, in samples taken from all six plots, transcript-level expression of fungal genes encoding lignocellulolytic and chitinolytic enzymes. For this we collected RNA from the forest soil, reverse-transcribed it, and amplified cDNAs of interest, using both published primer pairs as well as 23 newly developed ones. We thus detected transcript-level expression of 234 genes putatively encoding 26 different groups of fungal enzymes, notably major ligninolytic and diverse aromatic-oxidizing enzymes, various cellulose- and hemicellulose-degrading glycoside hydrolases and carbohydrate esterases, enzymes involved in chitin breakdown, N-acetylglucosamine metabolism, and cell wall degradation. Among the genes identified, 125 are homologous to known ascomycete genes and 105 to basidiomycete genes. Transcripts corresponding to all 26 enzyme groups were detected in both control and nitrogen-supplemented plots. CONCLUSIONS/SIGNIFICANCE: Many of these enzyme groups are known to be important in soil turnover processes, but the contribution of some is probably underestimated. Our data highlight the importance of ascomycetes, as well as basidiomycetes, in important biogeochemical cycles. In the nitrogen-supplemented plots, we have detected no transcript-level gap likely to explain

Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

Directory of Open Access Journals (Sweden)

Riley Laura M

2012-03-01

Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Gene stacking of multiple traits for high yield of fermentable sugars in plant biomass

DEFF Research Database (Denmark)

Aznar, Aude; Chalvin, Camille; Shih, Patrick M.

2018-01-01

the ratio of C6 to C5 sugars in the cell wall and decreasing the lignin content are two important targets in engineering of plants that are more suitable for downstream processing for second-generation biofuel production.Results: We have studied the basic mechanisms of cell wall biosynthesis and identified...... genes involved in biosynthesis of pectic galactan, including the GALS1 galactan synthase and the UDP-galactose/UDP-rhamnose transporter URGT1. We have engineered plants with a more suitable biomass composition by applying these findings, in conjunction with synthetic biology and gene stacking tools...... to vessels where this polysaccharide is essential. Finally, the high galactan and low xylan traits were stacked with the low lignin trait obtained by expressing the QsuB gene encoding dehydroshikimate dehydratase in lignifying cells.Conclusion: The results show that approaches to increasing C6 sugar content...

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

DEFF Research Database (Denmark)

Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

2014-01-01

The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

Multi-walled carbon nanotube-induced gene expression in the mouse lung: Association with lung pathology

International Nuclear Information System (INIS)

Pacurari, M.; Qian, Y.; Porter, D.W.; Wolfarth, M.; Wan, Y.; Luo, D.; Ding, M.; Castranova, V.; Guo, N.L.

2011-01-01

Due to the fibrous shape and durability of multi-walled carbon nanotubes (MWCNT), concerns regarding their potential for producing environmental and human health risks, including carcinogenesis, have been raised. This study sought to investigate how previously identified lung cancer prognostic biomarkers and the related cancer signaling pathways are affected in the mouse lung following pharyngeal aspiration of well-dispersed MWCNT. A total of 63 identified lung cancer prognostic biomarker genes and major signaling biomarker genes were analyzed in mouse lungs (n = 80) exposed to 0, 10, 20, 40, or 80 μg of MWCNT by pharyngeal aspiration at 7 and 56 days post-exposure using quantitative PCR assays. At 7 and 56 days post-exposure, a set of 7 genes and a set of 11 genes, respectively, showed differential expression in the lungs of mice exposed to MWCNT vs. the control group. Additionally, these significant genes could separate the control group from the treated group over the time series in a hierarchical gene clustering analysis. Furthermore, 4 genes from these two sets of significant genes, coiled-coil domain containing-99 (Ccdc99), muscle segment homeobox gene-2 (Msx2), nitric oxide synthase-2 (Nos2), and wingless-type inhibitory factor-1 (Wif1), showed significant mRNA expression perturbations at both time points. It was also found that the expression changes of these 4 overlapping genes at 7 days post-exposure were attenuated at 56 days post-exposure. Ingenuity Pathway Analysis (IPA) found that several carcinogenic-related signaling pathways and carcinogenesis itself were associated with both the 7 and 11 gene signatures. Taken together, this study identifies that MWCNT exposure affects a subset of lung cancer biomarkers in mouse lungs. - Research highlights: → Multi-Walled Carbon Nanotubes affect lung cancer biomarkers in mouse lungs. → The results suggest potentially harmful effects of MWCNT exposure on human lungs. → The results could potentially be used

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

Science.gov (United States)

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Identification of circular RNAs from the parental genes involved in multiple aspects of cellular metabolism in barley

DEFF Research Database (Denmark)

Shirvanehdeh, Behrooz Darbani; Noeparvar, Shahin; Borg, Søren

2016-01-01

circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular...... protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes...... and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs’ functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear...

Null mutants of individual RABA genes impact the proportion of different cell wall components in stem tissue of Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Daniel Lunn

Full Text Available In Arabidopsis, and other plants, the RABA GTPases (orthologous to the Rab11a of mammals have expanded in number and diversity and have been shown to belong to eight sub clades, some of which have been implicated in controlling vesicles that traffic cell wall polymers and enzymes that synthesise or modify them to the cell wall. In order to investigate this, we have investigated whether T-DNA insertion knockouts of individual RABA genes belonging to different sub clades, impact on the composition of the plant cell wall. Single gene knockouts of the RABA1, RABA2 and RABA4 sub clades primarily affected the percentage composition of pectin, cellulose and hemicellulose within the cell wall, respectively, despite having no obvious phenotype in the whole plant. We hypothesise that vesicles carrying specific types of cargoes from the Golgi to the cell surface may be regulated by particular sub types of RABA proteins, a finding that could have wider implications for how trafficking systems work and could be a useful tool in cell wall research and other fields of plant biology.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.