WorldWideScience

Sample records for vvmybf1 regulates flavonol

  1. Flavonols Mediate Root Phototropism and Growth through Regulation of Proliferation-to-Differentiation Transition

    OpenAIRE

    Silva, Javier; Moreno Risueño, Miguel Ángel; Manzano, Concepción; Téllez Robledo, Bárbara; Navarro Neila, Sara; Carrasco Loba, Víctor; Pollmann, Stephan; Gallego, Javier; Pozo Benito, Juan Carlos del

    2016-01-01

    Roots normally grow in darkness, but they may be exposed to light. After perceiving light, roots bend to escape from light (root light avoidance) and reduce their growth. How root light avoidance responses are regulated is not well understood. Here, we show that illumination induces the accumulation of flavonols in Arabidopsis thaliana roots. During root illumination, flavonols rapidly accumulate at the side closer to light in the transition zone. This accumulation promotes asymmetrical cell ...

  2. The Balance of Expression of Dihydroflavonol 4-reductase and Flavonol Synthase Regulates Flavonoid Biosynthesis and Red Foliage Coloration in Crabapples.

    Science.gov (United States)

    Tian, Ji; Han, Zhen-yun; Zhang, Jie; Hu, YuJing; Song, Tingting; Yao, Yuncong

    2015-07-20

    Red leaf color is an attractive trait of Malus families, including crabapple (Malus spp.); however, little is known about the molecular mechanisms that regulate the coloration. Dihydroflavonols are intermediates in the production of both colored anthocyanins and colorless flavonols, and this current study focused on the gene expression balance involved in the relative accumulation of these compounds in crabapple leaves. Levels of anthocyanins and the transcript abundances of the anthocyanin biosynthetic gene, dihydroflavonol 4-reductase (McDFR) and the flavonol biosynthetic gene, flavonol synthase (McFLS), were assessed during the leaf development in two crabapple cultivars, 'Royalty' and 'Flame'. The concentrations of anthocyanins and flavonols correlated with leaf color and we propose that the expression of McDFR and McFLS influences their accumulation. Further studies showed that overexpression of McDFR, or silencing of McFLS, increased anthocyanin production, resulting in red-leaf and red fruit peel phenotypes. Conversely, elevated flavonol production and green phenotypes in crabapple leaves and apple peel were observed when McFLS was overexpressed or McDFR was silenced. These results suggest that the relative activities of McDFR and McFLS are important determinants of the red color of crabapple leaves, via the regulation of the metabolic fate of substrates that these enzymes have in common.

  3. A R2R3-MYB transcription factor regulates the flavonol biosynthetic pathway in a traditional Chinese medicinal plant, Epimedium sagittatum

    Directory of Open Access Journals (Sweden)

    Wenjun Huang

    2016-07-01

    Full Text Available Flavonols as plant secondary metabolites with vital roles in plant development and defense against UV light, have been demonstrated to be the main bioactive components in the genus Epimedium plants, several species of which are used as materials for Herba Epimedii, an important traditional Chinese medicine. The flavonol biosynthetic pathway genes had been already isolated from E. sagittatum, but a R2R3-MYB transcription factor regulating the flavonol synthesis has not been functionally characterized so far in Epimedium plants. In this study, we isolated and characterized the R2R3-MYB transcription factor EsMYBF1 involved in regulation of the flavonol biosynthetic pathway from E. sagittatum. Sequence analysis indicated that EsMYBF1 belongs to the subgroup 7 of R2R3-MYB family which contains the flavonol-specific MYB regulators identified to date. Transient reporter assay showed that EsMYBF1 strongly activated the promoters of EsF3H (flavanone 3-hydroxylase and EsFLS (flavonol synthase, but not the promoters of EsDFRs (dihydroflavonol 4-reductase and EsANS (anthocyanidin synthase in transiently transformed Nicotiana benthamiana leaves. Both yeast two-hybrid assay and transient reporter assay validated EsMYBF1 to be independent of EsTT8, or AtTT8 bHLH regulators of the flavonoid pathway as cofactors. Ectopic expression of EsMYBF1 in transgenic tobacco resulted in the increased flavonol content and the decreased anthocyanin content in flowers. Correspondingly, the structural genes involved in flavonol synthesis were upregulated in the EsMYBF1 overexpression lines, including NtCHS (chalcone synthase, NtCHI (chalcone isomerase, NtF3H and NtFLS, whereas the late biosynthetic genes of the anthocyanin pathway (NtDFR and NtANS were remarkably downregulated, compared to the controls. These results suggest that EsMYBF1 is a flavonol-specific R2R3-MYB regulator, and involved in regulation of the biosynthesis of the flavonol-derived bioactive components in E

  4. Health effects and bioavailability of dietary flavonols

    NARCIS (Netherlands)

    Hollman, P.C.H.; Katan, M.B.

    1999-01-01

    Flavonoids are polyphenolic compounds that are ubiquitously present in foods of plant origin. Flavonoids are categorised into flavonols, flavones, catechins, flavanones, anthocyanidins, and isoflavonoids. They may have beneficial health effects because of their antioxidant properties and their

  5. Dietary Flavonols and Flavonol-rich foods intake and the risk of breast cancer

    NARCIS (Netherlands)

    Adebamowo, C.A.; Sampson, L.; Katan, M.B.; Spiegelman, D.; Willett, W.C.; Holmes, M.D.; Cho, E.

    2005-01-01

    Laboratory and animal studies suggest that dietary flavonols may reduce breast cancer risk but there are limited epidemiological studies. We computed flavonol intakes from dietary data collected by validated food frequency questionnaires in 1991 and 1995 from 90,630 women in the Nurses Health Study

  6. FURTHER FLAVONOL GLYCOSIDES OF EMBELIA SCHIMPERI ...

    African Journals Online (AJOL)

    a

    ABSTRACT. Fractionation of the methanolic extract of Embelia schimperi leaves has led to the isolation of two novel flavonol glycosides. The compounds were characterized as isorhamnetin 3-O- β-galactoysyl (1→ 4)-β-galactoside and quercetin 3-O-[α-rhamnosyl (1→2)] [α-rhamnosyl (1→ 4)]-α- rhamnoside. Also reported ...

  7. Kaempferol, a mutagenic flavonol from Helichrysum simillimum.

    Science.gov (United States)

    Elgorashi, Ee; van Heerden, Fr; van Staden, J

    2008-11-01

    Helichrysum simillimum is native to South Africa. It is used for the treatment of coughs, colds, fever, infections, headache, and menstrual pain. Extracts of this species showed mutagenic effects in the Salmonella/microsome assay. The aim of this study was to isolate and determine the mutagenic constituents of H. simillimum. Bioassay-guided fractionation of 90% aqueous methanol extracts, using Salmonella typhimurium TA98, led to the isolation of the flavonol kaempferol.

  8. Triterpenes and flavonol glucuronides from Oenothera cheiranthifolia.

    Science.gov (United States)

    Nakanishi, Tsutomu; Inatomi, Yuka; Murata, Hiroko; Ishida, Syun-Suke; Fujino, Yuri; Miura, Kanako; Yasuno, Yoshito; Inada, Akira; Lang, Frank A; Murata, Jin

    2007-02-01

    A new ursane-type triterpene, named as cheiranthic acid (1), was isolated from the MeOH extract of whole plants of Oenothera cheiranthifolia (Onagraceae) along with an isomeric pair of known oleanane- and ursane-type triterpenes (arjunolic acid and asiatic acid) and three flavonol glucuronide analogues (quercetin 3-O-glucuronide, its n-butyl ester, and myricetin 3-O-glucuronide). Their structures were elucidated based on spectroscopic evidence.

  9. Antioxidant flavonols from fruits, vegetables and beverages: measurements and bioavailability

    Directory of Open Access Journals (Sweden)

    ALAN CROZIER

    2000-01-01

    Full Text Available Flavonols are polyphenolic secondary plant metabolites that are present in varying levels in commonly consumed fruits, vegetables and beverages. Flavonols have long held an interest for nutritionists, which has increased following a Dutch study in the early 1990’s showing that dietary intake of flavonols was inversely correlated with the incidence of coronary heart disease. The main factors that have hindered workers in the field of flavonol research are (i the accurate measurement of these compounds in foods and biological samples, and (ii a dearth of information on their absorption and metabolism. This review aims to highlight the work of the authors in attempting to clarify the situation. The sensitive and selective HPLC procedure to identify and quantify common flavonols and their sugar conjugates is described. In addition, the results of an on-going screening program into the flavonol content of common produce and beverages are presented. The bioavailability of dietary flavonols is discussed with reference to an intervention study with onions, as well as pilot studies with tea, red wine and cherry tomatoes. It is concluded that flavonols are absorbable and accumulate in plasma and that consuming high flavonol-containing varieties of fruits and vegetables and particular types of beverages could increase their circulatory levels

  10. New iodine derivatives of flavonol and isoflavone

    Directory of Open Access Journals (Sweden)

    Mário G. de Carvalho

    2009-03-01

    Full Text Available The reaction of the flavonol 3,7,3', 4'-tetra-O-methylquercetin (1 and of the isoflavone 7,4'-di-O-methylgenistein (2 with alkaline iodine in methanol afforded four new iodine derivatives: 8-iodo-5-hydroxy-3,7,3', 4'-tetramethoxy- flavone (1a and 6-iodo-5-hydroxy-3,7,3', 4'-tetramethoxyflavone (1b from 1; 2 afforded a mixture of two compounds, identified as a racemic mixture of (±-trans-5-hydroxy-2,3,7,4'-tetramethoxy-8-iodo-isoflavanone (2a and (±-trans-5-hydroxy-2,3,7,4'-tetramethoxy-6,8-diiodo-isoflavanone (2b. The formation of these different products reveals a significant difference involving the chemical interaction between the reactive site of α, β-unsaturated ketones of flavonol and isoflavone under the tested reaction conditions (using I2/KOH/MeOH. Furthermore, the trans stereo selectivity is noteworthy in the nucleophylic addition of methanol at the isoflavone α, β-unsaturated system. The structures were identified on the basis of spectral data, mainly 1D and 2D NMR and mass spectra.A reação do flavonol 3,7,3',4'-tetra-O-metilquercetina (1 e da isoflavona 7,4'-di-O-metilgenisteina (2 com iodo/KOH em metanol forneceu como produto quatro derivados iodados: 8-iodo-5-hidroxi-3,7,3',4'-tetrametoxiflavona (1a e 6-iodo-5-hidroxi-3,7,3',4'-tetrametoxiflavona (1b a partir da iodação de 1; a partir de 2 foi obtida uma mistura racêmica composta de (±-trans-5-hidroxi-2,3,7,4'-tetrametoxi-8-iodo-isoflavanona (2a e (±-trans-5-hidroxi-2,3,7,4'-tetrametoxi-6,8-diiodo-isoflavanona (2b. A formação destes diferentes produtos revela a significante diferença envolvendo a interação química entre o sitio reativo de cetonas α, β-insaturadas de flavonol e de isoflavonas nas condições experimentais testadas (usando I2/KOH/MeOH. Além disso, ressalta-se a estereosseletividade trans na adição de metanol ao sistema α, β-insaturado da isoflavona. As estruturas foram identificadas com análise nos dados espectrométricos de RMN 1D e 2D e

  11. Fluorescence imaging of soybean flavonol isolines

    Science.gov (United States)

    Kim, Moon S.; Lee, Edward H.; Mulchi, Charles L.; McMurtrey, James E., III; Chappelle, Emmett W.; Rowland, Randy A.

    1998-07-01

    Experiments were conducted to characterize the fluorescence emission of leaves from four soybean ('Harosoy') plants containing different concentrations of flavonols (kaempferol glycosides). The investigation utilized genetically mutated soybean flavonol isolines grown in a constant environment, thus limiting factors known to affect fluorescence emission characteristics other than different kaempferol glycosides concentrations. Flavonol isolines included OX922, OX941, OX942, OX944. The first two isolines contain kaempferol (K) glycosides; K3, K6, and K9, and the latter two did not have K3, K6, and K9. A fluorescence imaging system (FIS) was used to characterize steady state florescence images of the sample leaves measured at wavelengths centered at 450, 550, 680, and 740 nm with an excitation at 360 nm. Images taken with FIS greatly complement non-imaging fluorescence measurements by characterizing the spatial variation of fluorescence within leaves. We also acquired fluorescence emission spectra to characterize spectral features of the soybean flavonol isolines. The emission spectral shape of the fluorescence emission characteristics were not significantly different between the soybeans that contain kaempferol glycosides and the ones that do not contain kaempferol glycosides. Typical emission maxima of green vegetation in the blue, green, red, and far-red bands were noticed in all four soybean isolines. However, plants containing kaempferol glycosides, OX922 and OX941 had significantly lower intensities throughout the wavelength regions. These results imply that fluorescence emission intensities in the fluorescence emission bands studied are significantly affected by the presence and absence of kaempferol glycosides concentrations (UV radiation screening compounds). Pure kaempferol glycoside dissolved in solution show minimal fluorescence emission when excited with the absorption maximum radiation at 365 nm. However, a broad band emission can be seen in the green

  12. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  13. Bioavailability and health effects of dietary flavonols in man.

    NARCIS (Netherlands)

    Hollman, P.C.H.; Katan, M.B.

    1998-01-01

    Flavonoids are polyphenolic compounds that occur ubiquitously in foods of plant origin. Over 4000 different flavonoids have been described, and they are categorized into flavonols, flavones, catechins, flavanones, anthocyanidins, and isoflavonoids. Flavonoids have a variety of biological effects in

  14. Simultaneous Determination of Flavonols and Terpene Lactones in ...

    African Journals Online (AJOL)

    Liquid Chromatography-Tandem - Mass Spectrometry: 1. ... Results: The method showed high selectivity of the flavonols and terpene ... Lower limit of quantification (LLOQ) was 1.232, 0.240, 0.200, ... flavonoid glycosides and terpene lactones.

  15. Disequilibrium of flavonol synthase and dihydroflavonol-4-reductase expression associated tightly to white versus red color flower formation in plants

    Directory of Open Access Journals (Sweden)

    Ping eLuo

    2016-01-01

    Full Text Available Flower colour is the main character throughout the plant kingdom. Though substantial information exists regarding the structural and regulatory genes involved in anthocyanin and flavonol biosynthesis, little is known that what make a diverse white versus red color flower in natural species. Here, the contents of pigments in seven species from varied phylogenetic location in plants with red and white flowers.were determined. Flavonols could be detected in red and white flowers, but anthocyanins were almost undetectable in the white cultivar. Comparisons of expression patterns of gene related to the flavonoid biosynthesis indicated that disequilibrium expression of flavonol synthase (FLS and dihydroflavonol-4-reductase (DFR genes determined the accumulation of flavonols and anothcyanins in both red and white flowers of seven species. To further investigate the role of such common regulatory patterns in determining flower color, FLS genes were isolated from Rosa rugosa (RrFLS1, Prunus persica (PpFLS and Petunia hybrida (PhFLS, and DFR genes were isolated from Rosa rugosa (RrDFR1 and Petunia hybrida (PhDFR. Heterologous expression of the FLS genes within tobacco host plants demonstrated conservation of function, with the transgenes promoting flavonol biosynthesis and inhibiting anthocyanin accumulation, so resulting in white flowers. Conversely, overexpression of DFR genes in tobacco displayed down-regulation of the endogenous NtFLS gene, and the promotion of anthocyanin synthesis. On this basis, we propose a model in which FLS and DFR gene-products compete for common substrates in order to direct the biosynthesis of flavonols and anthocyanins, respectively, thereby determining white versus red coloration of flowers.

  16. A New Flavonol Triglycoside and Other Flavonol Glycosides from Astragalus armatus Willd. (Fabaceae

    Directory of Open Access Journals (Sweden)

    Assia Khalfallah

    2014-01-01

    Full Text Available From the aerial parts of Astragalus armatus, a new acylated flavonol triglycoside, isorhamnetin-3-O-(5'''-p-hydroxybenzoyl-β-apiofuranosyl-(1→2[ α -rhamnopyranosyl-(1→6]- β -galactopyranoside (1 which we named astrarmatuside, has been isolated and structurally elucidated together with seven known flavonol glycosides: tamarixetin-3-O- α -apiofuranosyl-(1→2[ α -rhamnopyranosyl-(1→6]- β -galactopyranoside (2 (m illettias p ec oside D , isorhamnetin-3-O-β-apiofuranosyl-(1→2[α-rhamnopyranosyl-(1→6]-β-galacto-pyranoside (3, kaempferol-3-O-α-rhamnopyranosyl-(1→2[α-rhamnopyranosyl-(1→6]-β-glucopyranoside (4, kaempferol-3-O-α-rhamnopyranosyl-(1→2[α-rhamnopyranosyl-(1→6]-β-galactopyranoside (mauritianin (5, isorhamnetin-3-O-α-rhamnopyranosyl-(1→2[α-rhamnopyranosyl-(1→6]-β-galactopyranoside (6, kaempferol-3-O-α-rhamnopyranosyl-(1→6]-β-glucopyranoside (nikotiflorin (7 and isorhamnetin-3-O-α-rhamnopyranosyl-(1→6]-β-glucopyranoside (narcissin (8 . The structures of the isolated compounds were established by means of 2D NMR experiments, HPLC-DADMS, HR-MS and UV spectral analyses. Pivotal role in the structure elucidation and in particular in the determination of sugar sequence, played HSQC-TOCSY and ROESY experiments whereas those of the known compounds (2–8 were established by spectral comparison with those published in the literature.

  17. The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco.

    Science.gov (United States)

    Aharoni, A; De Vos, C H; Wein, M; Sun, Z; Greco, R; Kroon, A; Mol, J N; O'Connell, A P

    2001-11-01

    Fruit ripening is characterized by dramatic changes in gene expression, enzymatic activities and metabolism. Although the process of ripening has been studied extensively, we still lack valuable information on how the numerous metabolic pathways are regulated and co-ordinated. In this paper we describe the characterization of FaMYB1, a ripening regulated strawberry gene member of the MYB family of transcription factors. Flowers of transgenic tobacco lines overexpressing FaMYB1 showed a severe reduction in pigmentation. A reduction in the level of cyanidin 3-rutinoside (an anthocyanin) and of quercetin-glycosides (flavonols) was observed. Expression of late flavonoid biosynthesis genes and their enzyme activities were adversely affected by FaMYB1 overexpression. Two-hybrid assays in yeast showed that FaMYB1 could interact with other known anthocyanin regulators, but it does not act as a transcriptional activator. Interestingly, the C-terminus of FaMYB1 contains the motif pdLNL(D)/(E)Lxi(G)/S. This motif is contained in a region recently proposed to be involved in the repression of transcription by AtMYB4, an Arabidopsis MYB protein. Our results suggest that FaMYB1 may play a key role in regulating the biosynthesis of anthocyanins and flavonols in strawberry. It may act to repress transcription in order to balance the levels of anthocyanin pigments produced at the latter stages of strawberry fruit maturation, and/or to regulate metabolite levels in various branches of the flavonoid biosynthetic pathway.

  18. Antioxidative Flavonol Glucuronides and Anti-HBsAg Flavonol from Rotala rotundifolia

    Directory of Open Access Journals (Sweden)

    Li-Jie Zhang

    2011-10-01

    Full Text Available Two new flavonol glucuronides, quercetin 3-O-β-d-2″-acetylglucuronide (1 and quercetin 3-O-β-d-2″-acetylglucuronide methyl ester (2, along with four known flavonoids (3-6 were isolated from the whole parts of Rotala rotundifolia. The structures of 1 and 2 were elucidated by application of various spectroscopic methods, including 1D and 2D NMR techniques. Biological evaluation showed that all of isolated flavonoid compounds have potent anti-oxidative activities by DPPH and superoxide anion methods, and kaempferol (3 and quercetin (4 exhibited significant anti-HBV activity assayed by anti-HBsAg production. The HPLC fingerprint with photodiode array detection (HPLC-DAD for quality control of R. rotundifolia partitioned EtOAc layer was also established.

  19. Flavonols and flavones in foods and their relation with cancer and coronary heart disease risk

    NARCIS (Netherlands)

    Hertog, M.G.L.

    1994-01-01

    Flavonoids are polyphenolic antioxidants occurring ubiquitously in vegetable foods. Flavonols and flavones inhibit chemically induced tumors in rodents. The flavonol quercetin also inhibits LDL oxidation and platelet aggregation in vitro . We therefore decided to investigate the

  20. Three flavonol glycosides from Ricinus communis | Aqil | Bulletin of ...

    African Journals Online (AJOL)

    Bulletin of the Chemical Society of Ethiopia. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 11, No 1 (1997) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Three flavonol glycosides from Ricinus ...

  1. Flavonols and fertilization in Petunia hybrida: localization and mode of action during pollen tube growth

    NARCIS (Netherlands)

    Ylstra, B.; Busscher, J.; Franken, J.; Hollman, P.C.H.; Mol, J.N.M.; Tunen, van A.J.

    1995-01-01

    Flavonols form an important class of flavonoids which serve an essential function during plant reproduction. Flavonoid biosynthesis is initiated by the enzyme chalcone synthase (CHS). A high abundance of flavonols and chs mRNA was demonstrated in male and female reproductive organs of Petunia

  2. Fluorescence detection of flavonols in HPLC by postcolumn chelation with aluminum

    NARCIS (Netherlands)

    Hollman, Peter C H; Van Trijp, J. M P; Buysman, Michel N C P

    1996-01-01

    Flavonols are dietary antioxidants which may prevent coronary heart disease. To be able to study absorption of flavonols in humans, we developed a postcolumn derivatization with aluminum for HPLC with fluorescence detection. Variables governing postcolumn chelation, such as water content, buffer,

  3. Red wine is a poor source of bioavailable flavonols in men

    NARCIS (Netherlands)

    De Vries, Jeanne H M; Hollman, Peter C H; Van Amersfoort, Ingrid; Olthof, Margreet R.; Katan, Martijn B.

    2001-01-01

    Red wine is a source of polyphenolic antioxidants, of which flavonols such as quercetin are representatives. Red wine might therefore prevent LDL oxidation and atherosclerosis. However, data on the bioavailability of flavonols from wine are lacking. Therefore, we compared the bioavailability of

  4. A New Acylated Flavonol Glycoside from Chenopodium foliosum

    Directory of Open Access Journals (Sweden)

    Zlatina Kokanova-Nedialkova, , , , , and

    2014-07-01

    Full Text Available A new acylated flavonol glycoside, namely gomphrenol-3-O-( 5 '''-O-E-feruloyl-β-D-apiofuranosyl-(1→2[β-D-glucopyranosyl-(1→6]-β-D-glucopyranoside (1 was isolated from the aerial parts of Chenopodium foliosum Asch. The structure of 1 was determined by means of spectroscopic methods (1D and 2D NMR, UV, IR, and HRESIMS. Radical scavenging and antioxidant activities of 1 were established using DPPH and ABTS radicals, FRAP assay and inhibition of lipid peroxidation (LP in linoleic acid system by the ferric thiocyanate method. Compound 1 showed low activity (DPPH and ABTS or lack of activity (FRAP and LP. In combination with CCl 4, 1 reduced the damage caused by the hepatotoxic agent and preserved cell viability and GSH level, decreased LDH leakage and reduced lipid damage. Effects were concentration dependent, most visible at the highest concentration (100 µg/m L , and similar to those of silymarin .

  5. A new flavonol glycoside from glandless cotton seeds

    Directory of Open Access Journals (Sweden)

    Shanqin Yuan

    2012-02-01

    Full Text Available A new flavonol glycoside, namely quercetin 3-O-[α-d-apiofuranosyl(1–5-β-d-apiofuranosyl(1–2]-α-l-rhamnopyranosyl(1–6-β-d-glucopyranoside (1, was isolated from glandless cotton seeds together with the known compounds quercetin 3-O-α-l-rhamnopyranosyl(1–2-[α-l-rhamnopyranosyl(1–6]-β-d-glucopyranoside (manghaslin, 2, kaempferol 3-O-β-d-apiofruranosyl(1–2-β-d-glucopyranoside (3 and kaempferol 3-O-α-l-rhamnopyranosyl(1–6-β-d-glucopyranoside (4. It is interesting that the tetrasaccharide fragment of 1 contained both a β-apiosyl and an unusual α-apiosyl group.

  6. Four new flavonol glycosides from the leaves of Brugmansia suaveolens.

    Science.gov (United States)

    Geller, Fabiana; Murillo, Renato; Steinhauser, Lisa; Heinzmann, Berta; Albert, Klaus; Merfort, Irmgard; Laufer, Stefan

    2014-05-22

    Four new flavonol glycosides were isolated from the leaves of Brugmansia suaveolens: kaempferol 3-O-β-D-glucopyranosyl-(1'''→2'')-O-α-L-arabinopyranoside (1), kaempferol 3-O-β-D-glucopyranosyl-(1'''→2'')-O-α-L-arabinopyranoside-7-O-į-D-gluco-pyranoside (2), kaempferol 3-O-β-D-[6'''-O-(E-caffeoyl)]-glucopyranosyl-(1'''→2'')-O-α-l-arabinopyranoside-7-O-β-D-glucopyranoside (3), and kaempferol 3-O-β-D-[2'''-O-(E-caffeoyl)]-glucopyranosyl-(1'''→2'')-O-α-l-arabinopyranoside-7-O-β-D-glucopyranoside (4). The structure elucidation was performed by MS, 1D and 2D NMR analyses.

  7. Four New Flavonol Glycosides from the Leaves of Brugmansia suaveolens

    Directory of Open Access Journals (Sweden)

    Fabiana Geller

    2014-05-01

    Full Text Available Four new flavonol glycosides were isolated from the leaves of Brugmansia suaveolens: kaempferol 3-O-β-D-glucopyranosyl-(1'''→2''-O-α-L-arabinopyranoside (1, kaempferol 3-O-β-D-glucopyranosyl-(1'''→2''-O-α-L-arabinopyranoside-7-O-į-D-gluco-pyranoside (2, kaempferol 3-O-β-D-[6'''-O-(E-caffeoyl]-glucopyranosyl-(1'''→2''-O-α-l-arabinopyranoside-7-O-β-D-glucopyranoside (3, and kaempferol 3-O-β-D-[2'''-O-(E-caffeoyl]-glucopyranosyl-(1'''→2''-O-α-l-arabinopyranoside-7-O-β-D-glucopyranoside (4. The structure elucidation was performed by MS, 1D and 2D NMR analyses.

  8. Optimization of β-cyclodextrin-based flavonol extraction from apple pomace using response surface methodology.

    Science.gov (United States)

    Parmar, Indu; Sharma, Sowmya; Rupasinghe, H P Vasantha

    2015-04-01

    The present study investigated five cyclodextrins (CDs) for the extraction of flavonols from apple pomace powder and optimized β-CD based extraction of total flavonols using response surface methodology. A 2(3) central composite design with β-CD concentration (0-5 g 100 mL(-1)), extraction temperature (20-72 °C), extraction time (6-48 h) and second-order quadratic model for the total flavonol yield (mg 100 g(-1) DM) was selected to generate the response surface curves. The optimal conditions obtained were: β-CD concentration, 2.8 g 100 mL(-1); extraction temperature, 45 °C and extraction time, 25.6 h that predicted the extraction of 166.6 mg total flavonols 100 g(-1) DM. The predicted amount was comparable to the experimental amount of 151.5 mg total flavonols 100 g(-1) DM obtained from optimal β-CD based parameters, thereby giving a low absolute error and adequacy of fitted model. In addition, the results from optimized extraction conditions showed values similar to those obtained through previously established solvent based sonication assisted flavonol extraction procedure. To the best of our knowledge, this is the first study to optimize aqueous β-CD based flavonol extraction which presents an environmentally safe method for value-addition to under-utilized bio resources.

  9. Fluorescent analysis of interaction of flavonols with hemoglobin and bovine serum albumin

    Science.gov (United States)

    Sentchouk, V. V.; Bondaryuk, E. V.

    2007-09-01

    We have studied the fluorescent properties of flavonols (quercetin, fisetin, morin, rutin) with the aim of studying possible interaction with hemoglobin and bovine serum albumin (BSA). We observed an increase in the intensity of intrinsic fluorescence for all the flavonols except rutin in the presence of BSA. From the changes in the fluorescence spectra, we concluded that tautomeric forms are formed on interaction with hemoglobin. We determined the interconnection between the structure of related flavonols and their fluorescent properties on interaction with proteins, and we determined the binding constants for binding with BSA and hemoglobin.

  10. The effect of growth conditions on flavonols and anthocyanins accumulation in green and red lettuce

    OpenAIRE

    Klaudia BRÜCKOVÁ; Oksana SYTAR; Marek ŢIVČÁK; Marian BRESTIC; Aleš LEBEDA

    2016-01-01

    The aim of the study was to investigate the effect of different growth conditions on anthocyanins and flavonols accumulation in leaves of green and red loose leaf lettuce (Lactuca sativa var. crispa). Lettuce plants were grown in three types of conditions, in greenhouse (I. variant), behind clear glass in field (II. variant) and in open field conditions (III. variant). Estimation of anthocyanins and flavonols content was done by non-destructive measurements with optical fluorescence sensor Mu...

  11. The effect of growth conditions on flavonols and anthocyanins accumulation in green and red lettuce

    Directory of Open Access Journals (Sweden)

    Klaudia BRÜCKOVÁ

    2016-12-01

    Full Text Available The aim of the study was to investigate the effect of different growth conditions on anthocyanins and flavonols accumulation in leaves of green and red loose leaf lettuce (Lactuca sativa var. crispa. Lettuce plants were grown in three types of conditions, in greenhouse (I. variant, behind clear glass in field (II. variant and in open field conditions (III. variant. Estimation of anthocyanins and flavonols content was done by non-destructive measurements with optical fluorescence sensor Multiplex® 3 (Force-A, France. It was estimated that green lettuce varieties had a greater flavonols content compared to red lettuce varieties in all experimental variants. The highest level of flavonols was detected in leaves of green variety Zoltán (1.218 RU and in red lettuce had the highest amount of flavonols in variety Carmesi (1.095 RU. At the same time red lettuce varieties were characterized by higher anthocyanins content. Parameter anthocyanin index is correlated with visible red coloration of leaves. The highest content of anthocyanins was detected in variety Oakly (0.867 RU. Under the open field conditions was found statistically significant higher (P < 0.05 flavonols and anthocyanins level in both green and red lettuce leaves compared to greenhouse conditions. It may be connected with intensification of flavonoids biosynthesis and accumulation which normally stimulated by sun irradiation, especially UV-B radiation.

  12. Effect of flavonol and its dimethoxy derivatives on paclitaxel-induced peripheral neuropathy in mice.

    Science.gov (United States)

    Sayeli, Vijaykumar; Nadipelly, Jagan; Kadhirvelu, Parimala; Cheriyan, Binoy Varghese; Shanmugasundaram, Jaikumar; Subramanian, Viswanathan

    2018-04-13

    Peripheral neuropathy is the dose limiting side effect of many anticancer drugs. Flavonoids exhibit good antinociceptive effect in animal models. Their efficacy against different types of nociception has been documented. The present study investigated the effect of flavonol (3-hydroxy flavone), 3',4'-dimethoxy flavonol, 6,3'-dimethoxy flavonol, 7,2'-dimethoxy flavonol and 7,3'-dimethoxy flavonol against paclitaxel-induced peripheral neuropathy in mice. A single dose of paclitaxel (10 mg/kg, i.p.) was administered to induce peripheral neuropathy in mice and the manifestations of peripheral neuropathy such as tactile allodynia, cold allodynia and thermal hyperalgesia were assessed 24 h later by employing Von Frey hair aesthesiometer test, acetone bubble test and hot water tail immersion test, respectively. The test compounds were prepared as a suspension in 0.5% carboxymethyl cellulose and were administered s.c. in various doses (25, 50, 100 and 200 mg/kg). The above behavioral responses were assessed prior to and 30 min after drug treatment. In addition, the effect of test compounds on proinflammatory cytokines like tumor necrosis factor-alpha (TNF-α), interleukin-1-beta (IL-1β) and free radicals was investigated by using suitable in vitro assays. A dose-dependent attenuation of tactile allodynia, cold allodynia and thermal hyperalgesia was evidenced in mice treated with flavonol derivatives. The test compounds inhibited TNF-α, IL-1β and free radicals in a concentration-dependent manner. These results revealed that flavonol and its dimethoxy derivatives ameliorated the manifestations of paclitaxel-induced peripheral neuropathy in mice. The inhibition of proinflammatory cytokines and free radicals could contribute to this beneficial effect.

  13. SEPARATION OF THE MINOR FLAVONOLS FROM FLOS GOSSYPII BY HIGH-SPEED COUNTERCURRENT CHROMATOGRAPHY

    Science.gov (United States)

    Yang, Yi; Zhao, Yongxin; Gu, Dongyu; Ayupbek, Amatjan; Huang, Yun; Dou, Jun; Ito, Yoichiro; Zhang, Tianyou; Aisa, Haji Akber

    2010-01-01

    An effective high-speed countercurrent chromatography (HSCCC) method was established for further separation and purification of four minor flavonols in addition to five major flavonols which were reported by our previous study from extracts of Flos Gossypii. HSCCC was performed with three two-phase solvent systems composed of n-hexane-ethyl acetate-methanol-water (7.5:15:6:7, v/v), (2.5:15:2:7, v/v) and (0:1:0:1, v/v). The separation was repeated 3 times, and 3.8 mg of 8-methoxyl-kaempferol-7-O-β-D-rhamnoside (HPLC purity 98.27%), 6.7 mg of astragalin (HPLC purity 94.18%), 3.3 mg of 4′-methoxyl-quercetin-7-O-β-D-glucoside (HPLC purity 94.30%) and 8.2 mg of hyperoside (HPLC purity 93.48%) were separated from 150 mg of the crude sample. The chemical structures of the flavonols were confirmed by MS, 1H NMR and 13C NMR. Meanwhile, the results indicated that the target compound with smaller K value (<0.5) can be separated by increasing column length of HSCCC. And four separation rules of flavonols according to the present study and references were summarized, which can be used as a useful guide for separation of flavonols by HSCCC. PMID:21494318

  14. Plasma concentrations and urinary excretion of the antioxidant flavonols quercetin and kaempferol as biomarkers for dietary intake.

    NARCIS (Netherlands)

    Vries, de J.H.M.; Hollman, P.C.H.; Meyboom, S.; Buysman, M.N.C.P.; Zock, P.L.; Staveren, van W.A.; Katan, M.B.

    1998-01-01

    Flavonols are antioxidants that may reduce the risk of heart disease. Two major flavonols in the diet are quercetin and kaempferol, and their main sources in The Netherlands are tea and onions. We investigated whether plasma concentrations and urinary excretion of quercetin and kaempferol in humans

  15. Isolation of Flavonols from the Stems of Malaysian Uncaria Cordata Var. Ferruginea (Blume) Ridsd

    International Nuclear Information System (INIS)

    Nur Hakimah Abdullah; Fatimah Salim; Fatimah Salim; Rohaya Ahmad; Rohaya Ahmad

    2016-01-01

    Continuing our interest in the genus, a phytochemical investigation on Uncaria cordata var. ferruginea collected from Hutan Pasir Raja, Malaysia has been carried out. Two flavonols known as quercetin and kaempferol were isolated from the methanolic stem extract of this plant along with other phenolic compounds and terpenes. The two flavonols are reported for the first time from this species. The structure of the compounds were elucidated on the basis of spectroscopic data, mostly 1D-NMR, 2D-NMR as well as comparison with literature. (author)

  16. Heterologous expression of AtMYB12 in kale (Brassica oleracea var. acephala) leads to high flavonol accumulation.

    Science.gov (United States)

    Lännenpää, Mika

    2014-08-01

    Overexpression of Arabidopsis AtMYB12 transcription factor greatly increases the total phenolic and flavonol content in transgenic kale leaves. Flavonoids are a diverse group of plant secondary metabolites exhibiting a number of health-promoting effects. There has been a growing interest to develop biotechnological methods for the enhanced production of flavonoids in crop plants. AtMYB12 is an Arabidopsis transcription factor which specifically activates flavonol synthesis and its overexpression has led to increased flavonol accumulation in several transgenic plants. In the present study, AtMYB12 was overexpressed in a commercial cultivar of kale and the transgenic plants were tested both in in vitro and in semi-field conditions in cages under natural light. Using this method, a severalfold increase in both total phenolics content and flavonol accumulation was achieved. This study provides a reliable and efficient transformation protocol for kale and suggests the potential of this flavonol-enriched vegetable for the production of kaempferol.

  17. A new flavonol glycoside and other flavonoids from the aerial parts of Taverniera aegyptiaca

    DEFF Research Database (Denmark)

    Hassan, Ahmed R.; Amer, Khadiga F.; El-Toumy, Sayed A.

    2018-01-01

    Isolation of flavonoids from the aerial parts of Taverniera aegyptiaca Bioss. (Fabaceae) led to identification of one new flavonol glycoside, isorhamnetin-3-O-α-l-rhamnopyranosyl-(1→2)-α-l-arabinopyranoside (1), along with eleven compounds, which previously have not been isolated from this plant...

  18. Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols

    NARCIS (Netherlands)

    Muir, S.R.; Collins, G.J.; Robinson, S.; Hughes, S.G.; Bovy, A.G.; Vos, de C.H.R.; Tunen, van A.J.; Verhoeven, M.E.

    2001-01-01

    Tomatoes are an excellent source of the carotenoid lycopene, a compound that is thought to be protective against prostate cancer. They also contain small amounts of flavonoids in their peel (|[sim]|5–10 mg/kg fresh weight), mainly naringenin chalcone and the flavonol rutin, a quercetin glycoside.

  19. Addition of milk does not affect the absorption of flavonols from tea in man

    NARCIS (Netherlands)

    Hollman, P.C.H.; Hof, van het K.H.; Tijburg, L.B.M.; Katan, M.B.

    2001-01-01

    Tea is a major source of flavonols, a subclass of antioxidant flavonoids present in plant foods which potentially are beneficial to human health. Milk added to tea, a frequent habit in the United Kingdom, could inhibit absorption of tea flavonoids, because proteins can bind flavonoids effectively.

  20. Flower color changes in three Japanese hibiscus species: further quantitative variation of anthocyanin and flavonols.

    Science.gov (United States)

    Shimokawa, Satoshi; Iwashina, Tsukasa; Murakami, Noriaki

    2015-03-01

    One anthocyanin and four flavonols were detected from the petals of Hibiscus hamabo, H. tiliaceus and H. glaber. They were identified as cyanidin 3-0- sambubioside, gossypetin 3-O-glucuronide-8-O-glucoside, quercetin 7-O-rutinoside, gossypetin 3-O-glucoside and gossypetin 8-O-glucuronide by UV spectra, LC-MS, acid hydrolysis and HPLC. The flavonoid composition was essentially the same among the petals ofH. hamabo, H. tiliaceus and H. glaber, and there was little quantitative variation, except for cyanidin 3-O-sambubioside, the content of which in the petals ofH. tiliaceus and H. glaber was much higher than in that of H. hamabo. Flower colors of H. tiliaceus and H. glaber change from yellow to red, and that of H. hamabo changes from yellow to orange. These changes were caused by contents of anthocyanin and flavonols, which increased after flowering of H. hamabo, H. tiliaceus and H. glaber.

  1. Two new acylated flavonol glycosides from Mimosa pigra L. leaves sub-family Mimosoideae

    Directory of Open Access Journals (Sweden)

    Chinedu J. Okonkwo

    2016-12-01

    Conclusion: Myricetin, quercetin and their glycoside derivatives are strong antioxidants; and elicit cytotoxic effect on human cancer cell lines among other pharmacological activities. The isolation of acylated flavonoids in M. pigra provided an important insight on the evolutionary trend of the medicinal plant. While the dominance of flavonols, may account for the various ethnomedicinal uses of the herb and the mechanism and mode of its confirmed pharmacological actions.

  2. Flavonols Protect Against UV Radiation-Induced Thymine Dimer Formation in an Artificial Skin Mimic.

    Science.gov (United States)

    Maini, Sabia; Fahlman, Brian M; Krol, Ed S

    2015-01-01

    Exposure of skin to ultraviolet light has been shown to have a number of deleterious effects including photoaging, photoimmunosuppression and photoinduced DNA damage which can lead to the development of skin cancer. In this paper we present a study on the ability of three flavonols to protect EpiDerm™, an artificial skin mimic, against UV-induced damage. EpiDerm™ samples were treated with flavonol in acetone and exposed to UVA (100 kJ/m(2) at 365 nm) and UVB (9000 J/m(2) at 310 nm) radiation. Secretion of matrix metalloproteinase-1 (MMP-1) and tumor necrosis factor-α (TNF-a) were determined by ELISA, cyclobutane pyrimidine dimers were quantified using LC-APCI-MS. EpiDerm™ treated topically with quercetin significantly decreased MMP-1 secretion induced by UVA (100 µM) or UVB (200 µM) and TNF-a secretion was significantly reduced at 100 µM quercetin for both UVA and UVB radiation. In addition, topically applied quercetin was found to be photostable over the duration of the experiment. EpiDerm™ samples were treated topically with quercetin, kaempferol or galangin (52 µM) immediately prior to UVA or UVB exposure, and the cyclobutane thymine dimers (T-T (CPD)) were quantified using an HPLC-APCI MS/MS method. All three flavonols significantly decreased T-T (CPD) formation in UVB irradiated EpiDerm™, however no effect could be observed for the UVA irradiation experiments as thymine dimer formation was below the limit of quantitation. Our results suggest that flavonols can provide protection against UV radiation-induced skin damage through both antioxidant activity and direct photo-absorption. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.

  3. Flavonols, alkaloids, and antioxidant capacity of edible wild berberis species from patagonia.

    Science.gov (United States)

    Ruiz, Antonieta; Zapata, Moises; Sabando, Constanza; Bustamante, Luis; von Baer, Dietrich; Vergara, Carola; Mardones, Claudia

    2014-12-24

    There are 20 species of the Berberidaceae family described in Chile, whose fruits are edible and show high anthocyanin and hydroxycinnamic acid levels. Berberis microphylla G. Forst, commonly known as calafate, is the most extensively distributed. Flavonols and alkaloids in seed, pulp, skin, and whole calafate berry extracts and other Berberis were studied using HPLC-DAD-ESI-MS/MS and HPLC with fluorescence detector. Berry samples from different locations in Chilean Patagonia, including different phenological stages, were systematically addressed. Results were compared with other organs of the plant and with other Berberis species. Total flavonol concentration in calafate (n = 65) was 1.33 ± 0.54 μmol/g. Glycosyl metabolites of quercetin and isorhamnetin were the most abundant. Similar profiles were observed in calafate from distinct locations, but important differences were observed for the other edible Berberis species. Calafate pulp and skin have higher flavonol concentrations than seeds, and the maturation process reduced its levels. TEACCUPRAC and TEACABTS of whole calafate extracts and fractions are also explored. Finally, only berberine was detected in the fruit (0.001%), mainly in seeds. Results contribute to the promotion of this berry as a superfruit from Patagonia.

  4. New flavonol glycosides from the leaves of Triantha japonica and Tofieldia nuda.

    Science.gov (United States)

    Iwashina, Tsukasa; Tamura, Minoru N; Murai, Yoshinori; Kitajima, Junichi

    2013-09-01

    Two new flavonol glycosides were isolated from the leaves of Triantha japonica, together with eight known flavonols, kaempferol 3-O-sophoroside, kaempferol 3-O-sambubioside, kaempferol 3-O-glucosyl-(1 --> 2)-[glucosyl-(1 --> 6)-glucoside], quercetin 3-O-sophoroside, quercetin 3-O-sambubioside, isorhamnetin 3-O-glucoside, isorhamnetin 3-O-sophoroside and isorhamnetin 3-O-sambubioside. The new compounds were identified as kaempferol 3-O-beta-xylopyranosyl-(1 --> 2)-[beta-glucopyranosyl-(1 --> 6)-beta-glucopyranoside] (1) and isorhamnetin 3-O-beta-xylopyranosyl-(1 --> 2)-[beta-glucopyranosyl-(1 --> 6)-beta-glucopyranoside] (3) by UV, LC-MS, acid hydrolysis, and 1H and 13C NMR spectroscopy. Another two new flavonol glycosides were isolated from theleaves of Tofieldia nuda, and identified as kaempferol 3-O-beta-glucopyranosyl-(1 --> 2)-[beta-glucopyranosyl-(1 --> 6)-beta-galactopyranoside] (4) and quercetin 3-O-beta-glucopyranosyl-(1 --> 2)-[beta-glucopyranosyl-(1 --> 6)-beta-galactopyranoside] (5). Though the genera Triantha and Tofieldia were treated as Tofieldia sensu lato, they were recently divided into two genera. It was shown by this survey that their flavonoid composition were also different to each other.

  5. Synthesis of flavonol 3-O-glycoside by UGT78D1.

    Science.gov (United States)

    Ren, Guangxiang; Hou, Jingli; Fang, Qinghong; Sun, Hong; Liu, Xiaoyan; Zhang, Lianwen; Wang, Peng George

    2012-08-01

    Glycosylation is an important method for the structural modification of various flavonols, resulting in the glycosides with increased solubility, stability and bioavailability compared with the corresponding aglycone. From the physiological point of view, glycosylation of plant flavonoids is of importance and interest. However, it is notoriously complicated that flavonols such as quercetin, kaempferol and myricetin, are glucosylated regioselectively at the specific position by chemical method. Compared to the chemical method, enzymatic synthesis present several advantages, such as mild reaction condition, high stereo or region selectivity, no protection/deprotection and high yield. UGT78D1 is a flavonol-specific glycosyltransferase, responsible for transferring rhamnose or glucose to the 3-OH position in vitro. In this study, the activity of UGT78D1 was tested against 28 flavonoids acceptors using UDP-glucose as donor nucleoside in vitro, and 5 acceptors, quercetin, myricetin, kaempferol, fisetin and isorhamnetin, were discovered to be glucosylated at 3-OH position. Herein, the small-scale 3-O-glucosylated quercetin, kaempferol and myricetin were synthesized by UGT78D1 and their chemical structures were confirmed by (1)H and (13)C nuclear magnetic resonance (NMR) and high resolution mass spectrometry (HRMS).

  6. Genetic Variation of Flavonols Quercetin, Myricetin, and Kaempferol in the Sri Lankan Tea (Camellia sinensis L. and Their Health-Promoting Aspects

    Directory of Open Access Journals (Sweden)

    Brasathe Jeganathan

    2016-01-01

    Full Text Available Flavonol glycosides in tea leaves have been quantified as aglycones, quercetin, myricetin, and kaempferol. Occurrence of the said compounds was reported in fruits and vegetable for a long time in association with the antioxidant potential. However, data on flavonols in tea were scanty and, hence, this study aims to envisage the flavonol content in a representative pool of accessions present in the Sri Lankan tea germplasm. Significant amounts of myricetin, quercetin, and kaempferol have been detected in the beverage type tea accessions of the Sri Lankan tea germplasm. This study also revealed that tea is a good source of flavonol glycosides. The Camellia sinensis var. sinensis showed higher content of myricetin, quercetin, and total flavonols than var. assamica and ssp. lasiocalyx. Therefore flavonols and their glycosides can potentially be used in chemotaxonomic studies of tea germplasm. The nonbeverage type cultivars, especially Camellia rosaflora and Camellia japonica Red along with the exotic accessions resembling China type, could be useful in future germplasm studies because they are rich sources of flavonols, namely, quercetin and kaempferol, which are potent antioxidants. The flavonol profiles can be effectively used in choosing parents in tea breeding programmes to generate progenies with a wide range of flavonol glycosides.

  7. Profiling of primary metabolites and flavonols in leaves of two table grape varieties collected from semiarid and temperate regions.

    Science.gov (United States)

    Harb, Jamil; Alseekh, Saleh; Tohge, Takayuki; Fernie, Alisdair R

    2015-09-01

    Cultivation of grapes in West Bank - Palestine is very old and a large number of grape varieties exist as a result of continuous domestication over thousands of years. This rich biodiversity has highly influenced the consumer behavior of local people, who consume both grape berries and leaves. However, studies that address the contents of health-promoting metabolites in leaves are scarce. Accordingly the aim of this study is to assess metabolite levels in leaves of two grape varieties that were collected from semiarid and temperate regions. Metabolic profiling was conducted using GC-MS and LC-MS. The obtained results show that abiotic stresses in the semiarid region led to clear changes in primary metabolites, in particular in amino acids, which exist at very high levels. By contrast, qualitative and genotype-dependent differences in secondary metabolites were observed, whereas abiotic stresses appear to have negligible effect on the content of these metabolites. The qualitative difference in the flavonol profiles between the two genotypes is most probably related to differential expression of specific genes, in particular flavonol 3-O-rhamnosyltransferase, flavonol-3-O-glycoside pentosyltransferases and flavonol-3-O-d-glucosidel-rhamnosyltransferase by 'Beituni' grape leaves, which led to much higher levels of flavonols with rutinoside, pentoside, and rhamnoside moieties with this genotype. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Flavonols and Carotenoids in Yellow Petals of Rose Cultivar ( Rosa 'Sun City'): A Possible Rich Source of Bioactive Compounds.

    Science.gov (United States)

    Wan, Huihua; Yu, Chao; Han, Yu; Guo, Xuelian; Ahmad, Sagheer; Tang, Aoying; Wang, Jia; Cheng, Tangren; Pan, Huitang; Zhang, Qixiang

    2018-04-25

    Rose flowers have received increasing interest as rich sources of bioactive compounds. The composition of flavonols and carotenoids in yellow petals of Rosa 'Sun City' was determined by high-performance liquid chromatography coupled with photodiode array and mass spectrometric detectors (HPLC-PDA-MS). In total, 19 flavonols and 16 carotenoids were identified, some of which were first discovered in rose petals. Significant changes were observed in their profiles during seven blooming stages. Total flavonol contents showed the highest levels at stage 2 (S2; 1152.29 μg/g, FW). Kaempferol 7- O-glucoside and kaempferol 3- O-rhamnoside were the predominant individual flavonols. Total carotenoid concentration was highest at S4 (142.71 μg/g, FW). Violaxanthins with different geometrical configurations appeared as the major carotenoids across all blooming stages. These results indicated that 'Sun City' petals are rich sources of flavonols and carotenoids. Moreover, it is important to choose the appropriate harvest time on the basis of the targeted compounds.

  9. Metal and flavonol contents of Moringa oleifera grown in South Africa

    Directory of Open Access Journals (Sweden)

    Vusumzi Pakade

    2013-03-01

    Full Text Available Moringa (Moringa oleifera is a plant that is commonly consumed as a nutritional supplement by some communities in South Africa. Contamination of moringa with toxic heavy metals could be deadly for consumers. However, some metal elements are essential for consumers in trace amounts. We therefore investigated the concentrations of heavy metals, including major and trace nutrient elements, in the soil and in the leaves and flowers of moringa grown on two farms in South Africa. After total digestion in the microwave, the concentrations of metals were determined using inductively coupled plasma optical emission spectroscopy. No toxic heavy metals were detected in the leaves and flowers of moringa. On average, moringa contained higher concentrations of Ca (18 500 mg/kg and Mg (5500 mg/kg than selected vegetables (spinach, cabbage, cauliflower, broccoli and peas. The concentrations of other major nutrients in moringa were similar to those of the vegetables. Based on reports of antioxidant activity, we also investigated the concentrations of flavonols (myricetin, quercetin, kaempferol in moringa leaves and flowers in comparison with the selected vegetables. A high concentration of flavonols is related to antioxidant activity. Plant and vegetable materials were extracted under reflux using an acidified methanol (1% HCl solution and the flavonols were identified and quantified using reverse-phased high-performance liquid chromatography with UV detection. Moringa leaves had higher concentrations of myricetin (1296.6 mg/kg, quercetin (1362.6 mg/kg and kaempferol (1933.7 mg/kg than vegetables (spinach: myricetin 620.0 mg/kg, quercetin 17.9 mg/kg, kaempferol 215.3 mg/kg. No major differences were found between the plants growing on the two farms. Moringa is thus nutritionally valuable and safe to consume.

  10. A new flavonol glucoside from the aerial parts of Sida glutinosa.

    Science.gov (United States)

    Das, Niranjan; Achari, Basudev; Harigaya, Yoshihiro; Dinda, Biswanath

    2011-10-01

    Phytochemical investigation on the dried aerial parts of Sida glutinosa has led to the isolation of a new flavonol glucoside, glutinoside (1), along with seven known compounds, 24(28)-dehydromakisterone A (2), 1,2,3,9-tetrahydropyrrolo[2,1-b]-quinazolin-3-amine (3), docosanoic acid, 1-triacontanol, campesterol, stigmasterol, and β-sitosterol. The structures of these compounds were elucidated by means of extensive spectroscopic techniques as well as GC/MS analysis (for sterols) and comparison with the literature data. All these seven known compounds are reported from this plant for the first time.

  11. Kaempferol 3-O-rhamnoside-7-O-rhamnoside is an endogenous flavonol inhibitor of polar auxin transport in Arabidopsis shoots

    Czech Academy of Sciences Publication Activity Database

    Yin, R.H.; Han, K.; Heller, W.; Albert, A.; Dobrev, Petre; Zažímalová, Eva; Schaffner, A.R.

    2014-01-01

    Roč. 201, č. 2 (2014), s. 466-475 ISSN 1469-8137 R&D Projects: GA ČR(CZ) GAP305/11/0797 Institutional support: RVO:61389030 Keywords : Arabidopsis thaliana * flavonol biosynthesis * flavonol glycoside Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.545, year: 2013

  12. Effect of flavonols on wine astringency and their interaction with human saliva.

    Science.gov (United States)

    Ferrer-Gallego, Raúl; Brás, Natércia F; García-Estévez, Ignacio; Mateus, Nuno; Rivas-Gonzalo, Julián C; de Freitas, Victor; Escribano-Bailón, M Teresa

    2016-10-15

    The addition of external phenolic compounds to wines in order to improve their sensory quality is an established winemaking practice. This study was aimed at evaluating the effect of the addition of quercetin 3-O-glucoside on the astringency and bitterness of wines. Sensory results showed that the addition of this flavonol to wines results in an increase in astringency and bitterness. Additionally, flavonol-human salivary protein interactions were studied using fluorescence spectroscopy, dynamic light scattering and molecular dynamic simulations (MD). The apparent Stern-Volmer (KsvApp) and the apparent bimolecular quenching constants (kqApp) were calculated from fluorescence spectra. The KsvApp was 12620±390M(-1), and the apparent biomolecular constant was 3.94×10(12)M(-1)s(-1), which suggests that a complex was formed between the human salivary proteins and quercetin 3-O-glucoside. MD simulations showed that the quercetin 3-O-glucoside molecules have the ability to bind to the IB937 model peptide. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Protective effects of red wine flavonols on 4-hydroxynonenal-induced apoptosis in PC12 cells.

    Science.gov (United States)

    Jang, Young Jin; Kang, Nam Joo; Lee, Ki Won; Lee, Hyong Joo

    2009-08-01

    There is accumulating evidence that a moderate consumption of red wine has health benefits, such as the inhibition of neurodegenerative diseases. Although this is generally attributed to resveratrol, the protective mechanisms and the active substance(s) remain unclear. We examined whether and how red wine extract (RWE) and red wine flavonols quercetin and myricetin inhibited 4-hydroxynonenal (HNE)-induced apoptosis of rat pheochromocytoma PC12 cells. RWE attenuated HNE-induced PC12 cell death in a dose-dependent manner. HNE induced cleavage of poly(ADP-ribose) polymerase, which is involved in DNA repair in the nucleus, and this was inhibited by RWE treatment. Treatment with RWE also inhibited HNE-induced nuclear condensation in PC12 cells. Data of 2',7'-dichlorofluorescin diacetate showed that RWE protected against apoptosis of PC12 cells by attenuating intracellular reactive oxygen species. The cytoprotective effects on HNE-induced cell death were stronger for quercetin and myricetin than for resveratrol. HNE-induced nuclear condensation was attenuated by quercetin and myricetin. These results suggest that the neuroprotective potential of red wine is attributable to flavonols rather than to resveratrol.

  14. Genetic effects of the flavonols quercetin, kaempferol, and galangin on Chinese hamster ovary cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Carver, J.H. (Lawrence Livermore National Lab., Livermore, CA); Carrano, A.V.; MacGregor, J.T.

    1983-01-01

    The genotoxicity of selected flavonols was evaluated by multiple endpoints in Chinese hamster ovary (CHO) cells. Chromosomal aberrations, sister-chromatid exchange (SCE), and forward mutation at 4 gene loci were measured in a single population of cells exposed to quercetin, kaempferol, or galangin for 15 h with and without metabolic activation. The incidence of chromosomal aberrations was significantly increased by quercetin in the absence of activation and by kaempferol and galangin with and without activation. Flavanol treatment affected SCE and mutation at the hgprt, aprt, or Na/sup +//K/sup +/-ATPase loci only marginally, but significantly increased mutation frequencies at the tk locus. The response at the tk locus suggests that the CHO cells may behave similarly to L5178Y cells, in which the tk locus is thought to reflect chromosomal lesions in addition to point mutation. These results indicate that, at least under the conditions examined, flavonols induce chromosomal aberrations in CHO cells, but have little effect on point mutation or SCE.

  15. The study of the oxidation of the natural flavonol fisetin confirmed quercetin oxidation mechanism

    International Nuclear Information System (INIS)

    Ramešová, Šárka; Sokolová, Romana; Degano, Ilaria

    2015-01-01

    Highlights: • The oxidation mechanisms of fisetin and quercetin were compared. • The oxidation product of fisetin was identified even if it was not stable. • A benzofuranon derivative is the common oxidation product of flavonols. • Fisetin decomposes in solution during minutes handled in the presence of air. - Abstract: Oxidation of the bioactive flavonoid fisetin was studied under inert atmosphere and under ambient conditions. The presence of fast subsequent chemical reactions following the electron transfer was supported by in situ spectroelectrochemistry and identification of products by HPLC-DAD and HPLC–ESI-MS/MS. In the absence of oxygen, 2,6-dihydroxy-2-(3′,4′-dihydroxybenzoyl)-benzofuran-3(2H)-one was identified as the only oxidation product of fisetin. This product was found also as the main oxidation product in the presence of oxygen. The oxidation pathway leading to formation of a benzofuranone derivative can be considered as common for flavonols containing C2-C3 double bond, C3-OH group and dihydroxy-substituted phenyl moiety in its structure. This product was not stable and decomposed further even in contact with oxygen coming from eluents during chromatography. Two oxidation pathways occur under ambient conditions. DFT calculations support the result.

  16. Multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts: differential role of hydroxycinnamic acids, flavonols and stilbenes on endothelial inflammatory gene expression.

    Science.gov (United States)

    Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata

    2016-03-01

    The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.

  17. The dominant allele Aft induces a shift from flavonol to anthocyanin production in response to UV-B radiation in tomato fruit.

    Science.gov (United States)

    Catola, Stefano; Castagna, Antonella; Santin, Marco; Calvenzani, Valentina; Petroni, Katia; Mazzucato, Andrea; Ranieri, Annamaria

    2017-08-01

    The introgression of the A ft allele into domesticated tomato induced a shift from flavonol to anthocyanin production in response to UV-B radiation, while the hp - 1 allele negatively influenced the response of flavonoid biosynthesis to UV-B. Introgression of the dominant allele Anthocyanin fruit (Aft) from Solanum chilense induces anthocyanin accumulation in the peel of tomato (Solanum lycopersicum L.) fruit. UV-B radiation can influence plant secondary metabolism regulating the expression of several genes, among which those involved in flavonoid biosynthesis. Here, we investigated whether post-harvest UV-B treatment could up-regulate flavonoid production in tomato fruits and whether the Aft allele could affect flavonoid biosynthesis under UV-B radiation. Mature green fruits of an anthocyanin-rich tomato mutant line (SA206) and of its wild-type reference, cv. Roma, were daily subjected to post-harvest UV-B treatment until full ripening. Up-regulation of CHS and CHI transcription by UV-B treatment induced flavonoid accumulation in the peel of cv. Roma. Conversely, UV-B decreased the total flavonoid content and CHS transcript levels in the SA206 peel. SA206 being a double mutant containing also hp-1 allele, we investigated also the behavior of hp-1 fruit. The decreased peel flavonoid accumulation and gene transcription in response to UV-B suggest that hp-1 allele is involved in the marked down-regulation of the flavonoid biosynthesis observed in SA206 fruit. Interestingly, in SA206, UV-B radiation promoted the synthesis of delphinidin, petunidin, and malvidin by increasing F3'5'H and DFR transcription, but it decreased rutin production, suggesting a switch from flavonols to anthocyanins. Finally, although UV-B radiation does not reach the inner fruit tissues, it down-regulated flavonoid biosynthesis in the flesh of both genotypes. This study provides, for the first time, evidence that the presence of the functional Aft allele, under UV-B radiation, redirects

  18. High-Flavonol Tomatoes Through Heterologous Expression of the Maize Transcription Factor Genes LC and C1

    NARCIS (Netherlands)

    Bovy, A.; Vos, de R.; Kemper, M.; Schijlen, E.; Almenar Pertejo, M.; Muir, S.; Collins, G.; Robinson, S.; Verhoeyen, M.; Hughes, S.; Santos-Buelga, C.; Tunen, van A.

    2002-01-01

    Flavonoids are a group of polyphenolic plant secondary metabolites important for plant biology and human nutrition. In particular flavonols are potent antioxidants, and their dietary intake is correlated with a reduced risk of cardiovascular diseases. Tomato fruit contain only in their peel small

  19. A general approach to quantification of hydroxycinnamic acid derivatives and flavones, flavonols, and their glycosides by UV spectrophotometry

    Science.gov (United States)

    A general method was developed for the quantification of hydroxycinnamic acid derivatives and flavones, flavonols, and their glycosides based on the UV molar relative response factors (MRRF) of the standards. Each of these phenolic compounds contains a cinnamoyl structure and has a maximum absorban...

  20. Calyx diversity of flavonols and fatty acids in Roselle (Hibiscus sabdariffa) for use as a potential nutraceutical crop.

    Science.gov (United States)

    Flavonols and fatty acids in plants has potential to be used as an antioxidant, lowering of cholesterol, and for cancer prevention. Roselle is a photoperiod and frost-sensitive species requiring greenhouse production in the Griffin, GA environment. Six accessions of roselle calyces were evaluated fo...

  1. Photosynthetic response of mountain grassland species to drought stress is affected by UV-induced accumulation of epidermal flavonols

    Czech Academy of Sciences Publication Activity Database

    Rapantová, Barbora; Klem, Karel; Holub, Petr; Novotná, Kateřina; Urban, Otmar

    2016-01-01

    Roč. 9, 1-2 (2016), s. 31-40 ISSN 1803-2451 R&D Projects: GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 Keywords : Agrostis capillaris * CO2 assimilation * drought stress * flavonols * grassland * Holcus mollis * Hypericum maculatum * precipitation * Rumex obtusifolius * UV radiation Subject RIV: EH - Ecology, Behaviour

  2. The flavonol epicatechin reverses the suppressive effects of a stressor on long-term memory formation.

    Science.gov (United States)

    Knezevic, Bogdan; Lukowiak, Ken

    2014-11-15

    Learning and subsequent memory formation are influenced by both environmental and lifestyle factors, such as stress and diet. Epicatechin, a plant flavonol found in cocoa, red wine and green tea enhances long-term memory (LTM) formation in Lymnaea. By contrast, an ecologically relevant stressor, low-calcium pond water, suppresses LTM formation. We tested the hypothesis that epicatechin overcomes the suppressive effects of the stressor on LTM formation in the continued presence of the stressor. Snails trained in low-calcium pond water exhibit learning but not LTM. Epicatechin (15 mg l(-1)) in control pond water enhances LTM formation. When epicatechin was added to the low-calcium pond water an enhanced LTM similar to that seen in control pond water was observed. Thus, a naturally occurring bioactive plant compound was able to overcome the suppressive effects of an ecologically relevant stressor on LTM formation. © 2014. Published by The Company of Biologists Ltd.

  3. New flavonol glycoside from Scabiosa prolifera L. aerial parts with in vitro antioxidant and cytotoxic activities.

    Science.gov (United States)

    Al-Qudah, Mahmoud A; Otoom, Noor K; Al-Jaber, Hala I; Saleh, Ayman M; Abu Zarga, Musa H; Afifi, Fatma U; Abu Orabi, Sultan T

    2017-12-01

    Phytochemical investigation of the chemical constituents of the aerial parts of Scabiosa prolifera L. led to the isolation of one new flavonol glycoside, kaempferol-3-O-(4″,6″-di-E-p-coumaroyl)-β-D-galactopyranoside (1), along with ten other known compounds including luteolin-7-O-(2″-O-ethyl-β-glucopyranoside), β-sitosterol, β-sitosterylglucoside, ursolic acid, corosolic acid, ursolic acid 3-O-β-D-arabinopyranoside, apigenin, methyl-α-D-glucopyranoside, luteolin-7-O-β-glucopyranoside and isoorientin. The structures of all isolated compounds were established using chemical methods and spectroscopic methods including IR, UV, NMR (1D and 2D) and HRESIMS. All compounds were isolated for the first time from the plant. The antioxidant and cytotoxic activities of compounds 1 and 2 were also investigated.

  4. New phenylpropanoid-substituted flavan-3-ols and flavonols from the leaves of Uncaria rhynchophylla.

    Science.gov (United States)

    Li, Ruxin; Cheng, Jintang; Jiao, Mengjiao; Li, Li; Guo, Cong; Chen, Sha; Liu, An

    2017-01-01

    Uncariols A (1) and B (2), two new phenylpropanoid-substituted flavan-3-ols, and (±)-uncariols C (3a/3b) and D (4a/4b), two pairs of new phenylpropanoid-substituted flavonol enantiomers, together with nine known compounds (5-13), were isolated from the leaves of Uncaria rhynchophylla. The structures of 1-4 were established primarily by NMR and HRESIMS experiments. The absolute configurations of the new ones were deduced via the circular dichroism (CD) and quantum chemical calculations of the electronic circular dichroic (ECD) spectra. In addition, all of the isolated compounds showed potent antioxidant activity in the DPPH radical scavenging test. Copyright © 2016. Published by Elsevier B.V.

  5. Complementary action of jasmonic acid on salicylic acid in mediating fungal elicitor-induced flavonol glycoside accumulation of Ginkgo biloba cells.

    Science.gov (United States)

    Xu, Maojun; Dong, Jufang; Wang, Huizhong; Huang, Luqi

    2009-08-01

    The antagonistic action between jasmonic acid (JA) and salicylic acid (SA) in plant defence responses has been well documented. However, their relationship in secondary metabolite production is largely unknown. Here, we report that PB90, a protein elicitor from Phytophthora boehmeriae, triggers JA generation, SA accumulation and flavonol glycoside production of Ginkgo biloba cells. JA inhibitors suppress not only PB90-triggered JA generation, but also the elicitor-induced flavonol glycoside production. However, the elicitor can still enhance flavonol glycoside production even though the JA generation is totally inhibited. Over-expression of SA hydrolase gene NahG not only abolishes SA accumulation, but also suppresses the elicitor-induced flavonol glycoside production when JA signalling is inhibited. Interestingly, expression of NahG does not inhibit the elicitor-induced flavonol glycoside accumulation in the absence of JA inhibitors. Moreover, JA levels are significantly enhanced when SA accumulation is impaired in the transgenic cells. Together, the data suggest that both JA and SA are involved in PB90-induced flavonol glycoside production. Furthermore, we demonstrate that JA signalling might be enhanced to substitute for SA to mediate the elicitor-induced flavonol glycoside accumulation when SA signalling is impaired, which reveals an unusual complementary relationship between JA and SA in mediating plant secondary metabolite production.

  6. Structural investigations of flavonol glycosides from sea buckthorn (Hippophaë rhamnoides) pomace by NMR spectroscopy and HPLC-ESI-MS(n).

    Science.gov (United States)

    Rösch, Daniel; Krumbein, Angelika; Mügge, Clemens; Kroh, Lothar W

    2004-06-30

    Four flavonol glycosides were isolated from an extract of sea buckthorn pomace (Hippophaë rhamnoides) by Sephadex LH-20 gel chromatography and semipreparative HPLC. Their structures were elucidated by hydrolysis studies, ESI-MS(n), UV, and (1)H and (13)C NMR spectroscopy. The occurrence of the major flavonol glycoside kaempferol 3-O-beta-sophoroside-7-O-alpha-rhamnoside in sea buckthorn is described here for the first time. A further 21 flavonol glycosides of Sephadex LH-20 fractions of sea buckthorn pomace were characterized by HPLC-DAD-ESI-MS. The characteristic MS-MS and MS(3) fragmentation pattern of flavonol glycosides previously identified in sea buckthorn juice and of flavonol glycosides identified by NMR spectroscopy gave valuable indications for their identification. The results demonstrate that loss of the sugar moiety from C-7 of the aglycon is more favored than fission of the glycosidic linkage at the C-3 position. Thus, most of the compounds identified were 7-rhamnosides of isorhamnetin, kaempferol, and quercetin, which exhibit different substitution patterns at the C-3 position, mainly glucosides, rutinosides, and sophorosides. In addition, numerous flavonol glycosides were detected lacking a sugar moiety at C-7. Finally, eight flavonol derivatives were identified that are acylated by hydroxybenzoic or hydoxycinnamic acids.

  7. Dietary Flavonols Intake and Risk of Esophageal and Gastric Cancer: A Meta-Analysis of Epidemiological Studies

    Directory of Open Access Journals (Sweden)

    Yan Xie

    2016-02-01

    Full Text Available Background: Esophageal cancer (EC and gastric cancer (GC are common cancers and leading causes of cancer deaths worldwide. Many studies have investigated the association between dietary flavonols intake and the risk of EC and GC, but the results are inconsistent. Hence, we conducted a systematic analysis of relevant population-based studies to assess the association and derive a more precise estimation. Methods: The Cochrane, PubMed and Embase databases were searched to identify articles published through January 2016 that met the predetermined inclusion criterion. Twelve studies involving 4593 patients and 519,378 controls were included. Results: The summary odds ratios (ORs of EC, GC and the two combined were respectively 0.88 (95% CI: 0.73–1.08, 0.80 (95% CI: 0.70–0.91 and 0.83 (95% CI: 0.74–0.92 for the highest category of dietary flavonols intake compared with the lowest. No significant heterogeneities were observed in these studies. Further analysis showed that the pooled ORs of EC and GC for cohort, population-based case-control and hospital-based case-control studies were 0.90 (95% CI: 0.61–1.34, 0.92 (95% CI: 0.72–1.18, 0.68 (95% CI: 0.38–1.24 and 0.83 (95% CI: 0.65–1.06, 0.84 (95% CI: 0.45–1.59, 0.70 (95% CI: 0.56–0.88. The subgroup analyses revealed a significant association of flavonol intake with a reduced risk of noncardia gastric adenocarcinoma but not gastric cardia adenocarcinoma. Moreover, significant inverse associations of flavonol intake with GC risk were observed in women but not in men, in smokers but not in nonsmokers, in European populations but not in American populations. Similarly, a significant inverse association of flavonols intake with EC risk was also observed in smokers but not in nonsmokers. Conclusion: High intake of dietary flavonols is significantly related to a reduced risk of GC, especially in women and smokers.

  8. An Apoplastic β-Glucosidase is Essential for the Degradation of Flavonol 3-O-β-Glucoside-7-O-α-Rhamnosides in Arabidopsis.

    Science.gov (United States)

    Roepke, Jonathon; Gordon, Harley O W; Neil, Kevin J A; Gidda, Satinder; Mullen, Robert T; Freixas Coutin, José A; Bray-Stone, Delaney; Bozzo, Gale G

    2017-06-01

    Flavonol bisglycosides accumulate in plant vegetative tissues in response to abiotic stress, including simultaneous environmental perturbations (i.e. nitrogen deficiency and low temperature, NDLT), but disappear with recovery from NDLT. Previously, we determined that a recombinant Arabidopsis β-glucosidase (BGLU), BGLU15, hydrolyzes flavonol 3-O-β-glucoside-7-O-α-rhamnosides and flavonol 3-O-β-glucosides, forming flavonol 7-O-α-rhamnosides and flavonol aglycones, respectively. In this study, the transient expression of a BGLU15-Cherry fusion protein in onion epidermal cells demonstrated that BGLU15 was localized to the apoplast. Analysis of BGLU15 T-DNA insertional inactivation lines (bglu15-1 and bglu15-2) revealed negligible levels of BGLU15 transcripts, whereas its paralogs BGLU12 and BGLU16 were expressed in wild-type and bglu15 plants. The recombinant BGLU16 did not hydrolyze quercetin 3-O-β-glucoside-7-O-α-rhamnoside or rhamnosylated flavonols, but was active with the synthetic substrate, p-nitrophenyl-β-d-glucoside. In addition, shoots of both bglu15 mutants contained negligible flavonol 3-O-β-glucoside-7-O-α-rhamnoside hydrolase activity, whereas this activity increased by 223% within 2 d of NDLT recovery in wild-type plants. The levels of flavonol 3-O-β-glucoside-7-O-α-rhamnosides and quercetin 3-O-β-glucoside were high and relatively unchanged in shoots of bglu15 mutants during recovery from NDLT, whereas rapid losses were apparent in wild-type shoots. Moreover, losses of two flavonol 3-O-β-neohesperidoside-7-O-α-rhamnosides and kaempferol 3-O-α-rhamnoside-7-O-α-rhamnoside were evident during recovery from NDLT, regardless of whether BGLU15 was present. A spike in a kaempferol 7-O-α-rhamnoside occurred with stress recovery, regardless of germplasm, suggesting a contribution from hydrolysis of kaempferol 3-O-β-neohesperidoside-7-O-α-rhamnosides and/or kaempferol 3-O-α-rhamnoside-7-O-α-rhamnoside by hitherto unknown mechanisms. Thus

  9. Dietary Intakes of Individual Flavanols and Flavonols Are Inversely Associated with Incident Type 2 Diabetes in European Populations123

    DEFF Research Database (Denmark)

    Zamora-Ros, Raul; Forouhi, Nita G.; Sharp, Stephen J.

    2014-01-01

    Dietary flavanols and flavonols, flavonoid subclasses, have been recently associated with a lower risk of type 2 diabetes (T2D) in Europe. Even within the same subclass, flavonoids may differ considerably in bioavailability and bioactivity. We aimed to examine the association between individual...... and incident T2D. These results suggest that individual flavonoids have different roles in the etiology of T2D....... flavanol and flavonol intakes and risk of developing T2D across European countries. The European Prospective Investigation into Cancer and Nutrition (EPIC)–InterAct case-cohort study was conducted in 8 European countries across 26 study centers with 340,234 participants contributing 3.99 million person...

  10. Antinociceptive and Antibacterial Properties of Anthocyanins and Flavonols from Fruits of Black and Non-Black Mulberries

    Directory of Open Access Journals (Sweden)

    Hu Chen

    2017-12-01

    Full Text Available Anthocyanins and flavones are important pigments responsible for the coloration of fruits. Mulberry fruit is rich in anthocyanins and flavonols, which have multiple uses in traditional Chinese medicine. The antinociceptive and antibacterial activities of total flavonoids (TF from black mulberry (MnTF, TF of Morus nigra and non-black mulberry (MmTF, TF of Morus mongolica; and MazTF, TF of Morus alba ‘Zhenzhubai’ fruits were studied. MnTF was rich in anthocyanins (11.3 mg/g and flavonols (0.7 mg/g identified by ultra-performance liquid chromatography–tunable ultraviolet/mass single-quadrupole detection (UPLC–TUV/QDa. Comparatively, MmTF and MazTF had low flavonol contents and MazTF had no anthocyanins. MnTF showed significantly higher antinociceptive and antibacterial activities toward Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus than MmTF and MazTF. MnTF inhibited the expression of interleukin 6 (IL-6, inducible nitric oxide synthase (iNOS, phospho-p65 (p-p65 and phospho-IκBα (p-IκBα, and increased interleukin 10 (IL-10. Additionally, mice tests showed that cyanidin-3-O-glucoside (C3G, rutin (Ru and isoquercetin (IQ were the main active ingredients in the antinociceptive process. Stronger antinociceptive effect of MnTF was correlated with its high content of anthocyanins and flavonols and its inhibitory effects on proinflammatory cytokines, iNOS and nuclear factor-κB (NF-κB pathway-related proteins.

  11. Using an FFQ to assess intakes of dietary flavonols and flavones among female adolescents in the Suihua area of northern China.

    Science.gov (United States)

    Sun, Caihong; Wang, Hui; Wang, Dong; Chen, Yanping; Zhao, Yan; Xia, Wei

    2015-03-01

    The present study aimed to (i) evaluate the reproducibility and validity of a designed FFQ, (ii) apply the FFQ for estimating the dietary intakes of four flavonols and two flavones in female adolescents and (iii) explain their major dietary sources. The reproducibility between the first and second FFQ administrations (1 year interval) was estimated using the intra-class correlation coefficient. The validity of the first FFQ relative to the average of four three-day 24 h dietary recalls (24-HR) from four seasons was assessed using the Spearman correlation coefficient. Using a flavonoid content database, the individual flavonol and flavone intakes were calculated and the major food sources were estimated. Middle school in Suihua area of Heilongjiang Province, northern China. Female adolescents (n 887) aged 12-18 years. Better reproducibility and validity were obtained in the present study. The flavonol and flavone intakes were 16.29 and 4.31 mg/d, respectively. Quercetin and kaempferol were the major contributors (26.8 % and 23.7 %, respectively) to the total intake of flavonols and flavones. The main food sources of flavonols and flavones were apples (14.1 %), followed by potatoes (7.5 %), lettuce (7.3 %) and oranges (7.3 %). The dietary flavonol and flavone intakes among female adolescents in northern China were similar to those reported in several countries, but significant differences were observed in the food sources ascribed to the geographical location and dietary characteristics.

  12. Physico-chemical and Biological Evaluation of Flavonols: Fisetin, Quercetin and Kaempferol Alone and Incorporated in beta Cyclodextrins.

    Science.gov (United States)

    Corina, Danciu; Bojin, Florina; Ambrus, Rita; Muntean, Delia; Soica, Codruta; Paunescu, Virgil; Cristea, Mirabela; Pinzaru, Iulia; Dehelean, Cristina

    2017-01-01

    Fisetin,quercetin and kaempferol are among the important representatives of flavonols, biological active phytocomounds, with low water solubility. To evaluate the antimicrobial effect, respectively the antiproliferative and pro apoptotic activity on the B164A5 murine melanoma cell line of pure flavonols and their beta cyclodextrins complexes. Incorporation of fisetin, quercetin and kaempferol in beta cyclodextrins was proved by scanning electron microscopy (SEM), differencial scanning calorimetry (DSC) and X-ray powder diffraction (XRPD). Pure compounds and their complexes were tested for antiproliferative (MTT) and pro-apoptotic activity (Annexin V-PI) on the B164A5 murine melanoma cell line and for the antimicrobial properties (Disk Diffusion Method) on the selected strains. The phytocompounds presented in a different manner in vitro chemopreventive activity against B164A5 murine melanoma cell line and weak antimicrobial effect. The three flavonols: fisetin, quercetin and kaempferol were successfully incorporated in beta-cyclodextrin (BCD) and hydroxylpropyl-beta-cyclodextrin (HPBCD). Incorporation in beta cyclodextrins had a mix effect on the biological activity conducing to decrease, increase or consistent effect compared to pure phytocompound, depending on the screened process and on the chosen combination. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Characterization of Arabidopsis thaliana FLAVONOL SYNTHASE 1 (FLS1) -overexpression plants in response to abiotic stress.

    Science.gov (United States)

    Nguyen, Nguyen Hoai; Kim, Jun Hyeok; Kwon, Jaeyoung; Jeong, Chan Young; Lee, Wonje; Lee, Dongho; Hong, Suk-Whan; Lee, Hojoung

    2016-06-01

    Flavonoids are an important group of secondary metabolites that are involved in plant growth and contribute to human health. Many studies have focused on the biosynthesis pathway, biochemical characters, and biological functions of flavonoids. In this report, we showed that overexpression of FLS1 (FLS1-OX) not only altered seed coat color (resulting in a light brown color), but also affected flavonoid accumulation. Whereas fls1-3 mutants accumulated higher anthocyanin levels, FLS1-OX seedlings had lower levels than those of the wild-type. Besides, shoot tissues of FLS1-OX plants exhibited lower flavonol levels than those of the wild-type. However, growth performance and abiotic stress tolerance of FLS1-OX, fls1-3, and wild-type plants were not significantly different. Taken together, FLS1 can be manipulated (i.e., silenced or overexpressed) to redirect the flavonoid biosynthetic pathway toward anthocyanin production without negative effects on plant growth and development. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  14. Application of Differential Colorimetry To Evaluate Anthocyanin-Flavonol-Flavanol Ternary Copigmentation Interactions in Model Solutions.

    Science.gov (United States)

    Gordillo, Belén; Rodríguez-Pulido, Francisco J; González-Miret, M Lourdes; Quijada-Morín, Natalia; Rivas-Gonzalo, Julián C; García-Estévez, Ignacio; Heredia, Francisco J; Escribano-Bailón, M Teresa

    2015-09-09

    The combined effect of anthocyanin-flavanol-flavonol ternary interactions on the colorimetric and chemical stability of malvidin-3-glucoside has been studied. Model solutions with fixed malvidin-3-glucoside/(+)-catechin ratio (MC) and variable quercetin-3-β-d-glucoside concentration (MC+Q) and solutions with fixed malvidin-3-glucoside/quercetin-3-β-d-glucoside ratio (MQ) and variable (+)-catechin concentration (MQ+C) were tested at levels closer to those existing in wines. Color variations during storage were evaluated by differential colorimetry. Changes in the anthocyanin concentration were monitored by HPLC-DAD. CIELAB color-difference formulas were demonstrated to be of practical interest to assess the stronger and more stable interaction of quercetin-3-β-d-glucoside with MC binary mixture than (+)-catechin with MQ mixture. The results imply that MC+Q ternary solutions kept their intensity and bluish tonalities for a longer time in comparison to MQ+C solutions. The stability of malvidin-3-glucoside improves when the concentration of quercetin-3-β-d-glucoside increases in MC+Q mixtures, whereas the addition of (+)-catechin in MQ+C mixtures resulted in an opposite effect.

  15. Comparative Analysis of Two Flavonol Synthases from Different-Colored Onions Provides Insight into Flavonoid Biosynthesis.

    Science.gov (United States)

    Park, Sangkyu; Kim, Da-Hye; Lee, Jong-Yeol; Ha, Sun-Hwa; Lim, Sun-Hyung

    2017-07-05

    We isolated cDNAs encoding flavonol synthase (FLS) from the red onion "H6" (AcFLS-H6) and the yellow onion "Hwangryongball" (AcFLS-HRB). We found three amino acid variations between the two sequences. Kinetic analysis with recombinant proteins revealed that AcFLS-HRB exhibited approximately 2-fold higher catalytic efficiencies than AcFLS-H6 for dihydroflavonol substrates and that both proteins preferred dihydroquercetin to dihydrokaempferol. The expression patterns of flavonoid biosynthesis genes corresponded to the accumulation patterns of flavonoid aglycones in both onions. Whereas the other flavonoid biosynthesis genes were weakly expressed in the HRB sheath compared to that of H6, the expression of FLS was similar in both onions. This relatively enhanced FLS expression, along with the higher activity of AcFLS-HRB, could increase the quercetin production in the HRB sheath. The quercetin content was approximately 12-fold higher than the cyanidin content in the H6 sheath, suggesting that FLS has priority in the competition between FLS and dihydroflavonol 4-reductase (DFR) for their substrate dihydroquercetin.

  16. A new flavonol glycoside and activity of compounds from the flower of Nymphaea candida.

    Science.gov (United States)

    Liu, R-N; Wang, W; Ding, Y; Xie, W-D; Ma, C; Du, L-J

    2007-01-01

    A new compound, kaempferol 3-O-(2''-O-galloylrutinoside) (1), was isolated from the white flower of Nymphaea candida, together with nine known flavonol glycosides, kaempferol (2), kaempferol 3-O-beta-D-glucopyranoside (3), kaempferol 3-O-alpha-l-rhamnopyranoside (4), kaempferol 3-O-alpha-l-rhamnopyranosylglucopyranoside (5), kaempferol 7-O-beta-D-glucopyranoside 3-(O-alpha-l-rhamnopyranosylglucopyranoside) (6), quercetin (7), quercetin 3-O-beta-D-xylopyranoside (8), myricetin (9), myricetin 3'-O-beta-D-xylopyranoside (10). The structure of 1 was established on the basis of the analysis of its 1D and 2D NMR spectral data. Compounds 1-7 and 9 exhibited moderate to significant antioxidant activities, which were evaluated by measurement of low-density lipoprotein (LDL) and malondialdehyde (MDA) levels in vitro. Compounds 1, 3, 4, 6 and 9 exhibited promising neuroprotective effects on ischemic injury model of cultured rat cortical neurons treated with sodium dithionite in glucose-free medium. Furthermore, compounds 1, 5, and 9 had distinct cytotoxicity to adrenal gland pheochromocytoma, PC12 cells, being treated by the same way.

  17. Discrimination and Measurements of Three Flavonols with Similar Structure Using Terahertz Spectroscopy and Chemometrics

    Science.gov (United States)

    Yan, Ling; Liu, Changhong; Qu, Hao; Liu, Wei; Zhang, Yan; Yang, Jianbo; Zheng, Lei

    2018-03-01

    Terahertz (THz) technique, a recently developed spectral method, has been researched and used for the rapid discrimination and measurements of food compositions due to its low-energy and non-ionizing characteristics. In this study, THz spectroscopy combined with chemometrics has been utilized for qualitative and quantitative analysis of myricetin, quercetin, and kaempferol with concentrations of 0.025, 0.05, and 0.1 mg/mL. The qualitative discrimination was achieved by KNN, ELM, and RF models with the spectra pre-treatments. An excellent discrimination (100% CCR in the prediction set) could be achieved using the RF model. Furthermore, the quantitative analyses were performed by partial least square regression (PLSR) and least squares support vector machine (LS-SVM). Comparing to the PLSR models, the LS-SVM yielded better results with low RMSEP (0.0044, 0.0039, and 0.0048), higher Rp (0.9601, 0.9688, and 0.9359), and higher RPD (8.6272, 9.6333, and 7.9083) for myricetin, quercetin, and kaempferol, respectively. Our results demonstrate that THz spectroscopy technique is a powerful tool for identification of three flavonols with similar chemical structures and quantitative determination of their concentrations.

  18. Influence of Light and Temperature on Gene Expression Leading to Accumulation of Specific Flavonol Glycosides and Hydroxycinnamic Acid Derivatives in Kale (Brassica oleracea var. sabellica).

    Science.gov (United States)

    Neugart, Susanne; Krumbein, Angelika; Zrenner, Rita

    2016-01-01

    Light intensity and temperature are very important signals for the regulation of plant growth and development. Plants subjected to less favorable light or temperature conditions often respond with accumulation of secondary metabolites. Some of these metabolites have been identified as bioactive compounds, considered to exert positive effects on human health when consumed regularly. In order to test a typical range of growth parameters for the winter crop Brassica oleracea var. sabellica, plants were grown either at 400 μmol m(-2) s(-1) or 100 μmol m(-2) s(-1) at 10°C, or at 400 μmol m(-2) s(-1) with 5 or 15°C. The higher light intensity overall increased flavonol content of leaves, favoring the main quercetin glycosides, a caffeic acid monoacylated kaempferol triglycoside, and disinapoyl-gentiobiose. The higher temperature mainly increased the hydroxycinnamic acid derivative disinapoyl-gentiobiose, while at lower temperature synthesis is in favor of very complex sinapic acid acylated flavonol tetraglycosides such as kaempferol-3-O-sinapoyl-sophoroside-7-O-diglucoside. A global analysis of light and temperature dependent alterations of gene expression in B. oleracea var. sabellica leaves was performed with the most comprehensive Brassica microarray. When compared to the light experiment much less genes were differentially expressed in kale leaves grown at 5 or 15°C. A structured evaluation of differentially expressed genes revealed the expected enrichment in the functional categories of e.g. protein degradation at different light intensities or phytohormone metabolism at different temperature. Genes of the secondary metabolism namely phenylpropanoids are significantly enriched with both treatments. Thus, the genome of B. oleracea was screened for predicted genes putatively involved in the biosynthesis of flavonoids and hydroxycinnamic acid derivatives. All identified B. oleracea genes were analyzed for their most specific 60-mer oligonucleotides present on the

  19. Flavonol-rich dark cocoa significantly decreases plasma endothelin-1 and improves cognition in urban children.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Mora-Tiscareño, Antonieta; Franco-Lira, Maricela; Cross, Janet V; Engle, Randall; Aragón-Flores, Mariana; Gómez-Garza, Gilberto; Jewells, Valerie; Medina-Cortina, Humberto; Solorio, Edelmira; Chao, Chih-Kai; Zhu, Hongtu; Mukherjee, Partha S; Ferreira-Azevedo, Lara; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2013-01-01

    Air pollution exposures are linked to systemic inflammation, cardiovascular and respiratory morbidity and mortality, neuroinflammation and neuropathology in young urbanites. In particular, most Mexico City Metropolitan Area (MCMA) children exhibit subtle cognitive deficits, and neuropathology studies show 40% of them exhibiting frontal tau hyperphosphorylation and 51% amyloid-β diffuse plaques (compared to 0% in low pollution control children). We assessed whether a short cocoa intervention can be effective in decreasing plasma endothelin 1 (ET-1) and/or inflammatory mediators in MCMA children. Thirty gram of dark cocoa with 680 mg of total flavonols were given daily for 10.11 ± 3.4 days (range 9-24 days) to 18 children (10.55 years, SD = 1.45; 11F/7M). Key metabolite ratios in frontal white matter and in hippocampus pre and during cocoa intervention were quantified by magnetic resonance spectroscopy. ET-1 significantly decreased after cocoa treatment (p = 0.0002). Fifteen children (83%) showed a marginally significant individual improvement in one or both of the applied simple short memory tasks. Endothelial dysfunction is a key feature of exposure to particulate matter (PM) and decreased endothelin-1 bioavailability is likely useful for brain function in the context of air pollution. Our findings suggest that cocoa interventions may be critical for early implementation of neuroprotection of highly exposed urban children. Multi-domain nutraceutical interventions could limit the risk for endothelial dysfunction, cerebral hypoperfusion, neuroinflammation, cognitive deficits, structural volumetric detrimental brain effects, and the early development of the neuropathological hallmarks of Alzheimer's and Parkinson's diseases.

  20. Potentiation of luteolin cytotoxicity by flavonols fisetin and quercetin in human chronic lymphocytic leukemia cell lines.

    Science.gov (United States)

    Sak, Katrin; Kasemaa, Kristi; Everaus, Hele

    2016-09-14

    Despite numerous studies chronic lymphocytic leukemia (CLL) still remains an incurable disease. Therefore, all new compounds and novel strategies which are able to eradicate CLL cells should be considered as valuable clues for a potential future remedy against this malignancy. In the present study, the cytotoxic profiles of natural flavonoids were described in two human CLL cell lines, HG-3 and EHEB, indicating the flavone luteolin as the most potent flavonoid with half-maximal inhibitory constants (IC50) of 37 μM and 26 μM, respectively. Luteolin significantly increased the apoptotic cell population in both cell lines by increasing the activities of caspases-3 and -9 and triggering the intrinsic apoptotic pathway. Two flavonols, fisetin and quercetin, were somewhat less efficient in suppressing cellular viability, whereas baicalein, chrysin, (+)-catechin and hesperetin exerted only a small or no response at doses as high as 100 μM. Both fisetin and quercetin were able to augment the cytotoxic activity of luteolin in both cell lines by reducing the IC50 values up to four fold. As a result of this, luteolin displayed cytotoxicity activity already at low micromolar concentrations that could potentially be physiologically achievable through oral ingestion. No other tested flavonoids were capable of sensitizing CLL cells to luteolin pointing to a specific binding of fisetin and quercetin to the cellular targets which interfere with the signaling pathways induced by luteolin. Although further molecular studies to unravel this potentiating mechanism are certainly needed, this phenomenon could contribute to future remedies for prevention and treatment of chronic lymphocytic leukemia.

  1. Behavior of flavonols and carotenoids of minimally processed kale leaves during storage in passive modified atmosphere packaging.

    Science.gov (United States)

    Kobori, C N; Huber, L S; Sarantópoulos, C I G L; Rodriguez-Amaya, D B

    2011-03-01

    Minimally processed kale leaves were packed in passive modified atmosphere and stored at 3 conditions: 1 °C in the dark and 11 °C with or without light exposure. The products were evaluated during storage in terms of headspace gas composition, sensory attributes, flavonol, and carotenoid contents. The sensory quality decreased slightly during 17 d at 1 °C in the dark. At 11 °C, the vegetable shelf life was predicted to be 6 d in the dark and 3 d with light. Quercetin and kaempferol were stable during storage for 15 d at 1 °C in the absence of light. At 11 °C in the dark, quercetin was stable during 10 d, increasing slightly on the 8th day. Kaempferol decreased up to the 5th day but increased on the 8th day, decreasing again on the 10th day. After 5 d at 11 °C under light, the flavonol levels were significantly higher than those of the initial values. Neoxanthin and violaxanthin did not change significantly after 15 d at 1 °C in the dark. Lutein and β-carotene, however, decreased 7.1% and 11.3%, respectively. At 11 °C in the dark, neoxanthin, violaxanthin, lutein, and β-carotene decreased 16.1%, 13.2%, 24.1%, and 23.7% after 10 d, respectively. At 11 °C under light, neoxanthin and lutein had a slight increase while violaxanthin and β-carotene decreased 23.1% and 16.5% after 5 d. Practical Application:  Passive modified atmosphere packaging together with refrigeration can extend the shelf life of minimally processed kale, retaining the health-promoting compounds, flavonols and carotenoids. Quercetin, kaempferol, neoxanthin, and violaxanthin are stable and lutein and β-carotene slightly reduced.

  2. Anticancer activity of flavonol and flavan-3-ol rich extracts from Croton celtidifolius latex.

    Science.gov (United States)

    Biscaro, Fernanda; Parisotto, Eduardo Benedetti; Zanette, Vanilde Citadini; Günther, Tania Mara Fischer; Ferreira, Eduardo Antonio; Gris, Eliana Fortes; Correia, João Francisco Gomes; Pich, Claus Tröger; Mattivi, Fulvio; Filho, Danilo Wilhelm; Pedrosa, Rozangela Curi

    2013-06-01

    Croton celtidifolius Baill (Euphorbiaceae) is a tree found in the Atlantic Forest in Southern Brazil, where it is commonly known as "Sangue-de-Dragão". Its red latex is used traditionally for treating ulcers, diabetes and cancer. To evaluate antitumor activities of Croton celtififolius latex in vitro and in vivo. Phytochemical analyses were conducted using HPLC-DAD-MS. Cytotoxic, nuclease and pro-apoptotic properties were determined using the tetrazolium salt assay (MTT), plasmid DNA damage assay and ethidium bromide (EB)/acridine orange methods, respectively, and antitumor activity was determined in the Ehrlich ascites carcinoma (EAC) mouse model. Phytochemical studies indicated a high phenol content of flavonols (45.67 ± 0.24 and 18.01 ± 0.23 mg/mL of myricetin and quercetin, respectively) and flavan-3-ols (114.12 ± 1.84 and 1527.41 ± 16.42 mg/L of epicatechin and epigallocatechin, respectively) in latex. These compounds reduced MCF-7 and EAC cell viability in the MTT assay (IC50 = 169.0 ± 1.8 and 187.0 ± 2.2 μg/mL, respectively). Latex compounds caused significant DNA fragmentation and increased the number of apoptotic cells (negative control (NC), 12%; latex, 41%) as indicated by differential staining in the EB/acridine orange assay. The in vivo latex treatment at 3.12 mg/kg/day reduced the body weight by 7.57 ± 2.04 g and increased median survival time to 17.5 days when compared to the NC group (13.0 days). In addition, the highest latex concentration inhibited tumor growth by 56%. These results agree with ethno-pharmacological reports showing cytotoxicity and antitumor activity of C. celtidifolius latex. The mechanism of antitumor action may be related to direct DNA fragmentation that reduces survival and induces apoptosis.

  3. Impact of Flavonols on Cardiometabolic Biomarkers: A Meta-Analysis of Randomized Controlled Human Trials to Explore the Role of Inter-Individual Variability

    Science.gov (United States)

    Menezes, Regina; Rodriguez-Mateos, Ana; Kaltsatou, Antonia; González-Sarrías, Antonio; Greyling, Arno; Giannaki, Christoforos; Andres-Lacueva, Cristina; Milenkovic, Dragan; Gibney, Eileen R.; Dumont, Julie; Schär, Manuel; Garcia-Aloy, Mar; Palma-Duran, Susana Alejandra; Ruskovska, Tatjana; Maksimova, Viktorija; Combet, Emilie; Pinto, Paula

    2017-01-01

    Several epidemiological studies have linked flavonols with decreased risk of cardiovascular disease (CVD). However, some heterogeneity in the individual physiological responses to the consumption of these compounds has been identified. This meta-analysis aimed to study the effect of flavonol supplementation on biomarkers of CVD risk such as, blood lipids, blood pressure and plasma glucose, as well as factors affecting their inter-individual variability. Data from 18 human randomized controlled trials were pooled and the effect was estimated using fixed or random effects meta-analysis model and reported as difference in means (DM). Variability in the response of blood lipids to supplementation with flavonols was assessed by stratifying various population subgroups: age, sex, country, and health status. Results showed significant reductions in total cholesterol (DM = −0.10 mmol/L; 95% CI: −0.20, −0.01), LDL cholesterol (DM = −0.14 mmol/L; 95% CI: −0.21, 0.07), and triacylglycerol (DM = −0.10 mmol/L; 95% CI: −0.18, 0.03), and a significant increase in HDL cholesterol (DM = 0.05 mmol/L; 95% CI: 0.02, 0.07). A significant reduction was also observed in fasting plasma glucose (DM = −0.18 mmol/L; 95% CI: −0.29, −0.08), and in blood pressure (SBP: DM = −4.84 mmHg; 95% CI: −5.64, −4.04; DBP: DM = −3.32 mmHg; 95% CI: −4.09, −2.55). Subgroup analysis showed a more pronounced effect of flavonol intake in participants from Asian countries and in participants with diagnosed disease or dyslipidemia, compared to healthy and normal baseline values. In conclusion, flavonol consumption improved biomarkers of CVD risk, however, country of origin and health status may influence the effect of flavonol intake on blood lipid levels. PMID:28208791

  4. Inhibition of dipeptidyl peptidase activity by flavonol glycosides of guava (Psidium guajava L.): a key to the beneficial effects of guava in type II diabetes mellitus.

    Science.gov (United States)

    Eidenberger, Thomas; Selg, Manuel; Krennhuber, Klaus

    2013-09-01

    Based on the traditional use in popular medicine, the effect of extracts from Psidium guajava L. leaves and of the main flavonol-glycoside components on dipeptidyl-peptidase IV (DP-IV), a key enzyme of blood glucose homoeostasis, has been investigated in-vitro. An ethanolic extract was prepared from dried, powdered leaves of guava and was found to contain seven main flavonol-glycosides, which were isolated by semipreparative HPLC and tested individually. The ethanolic guava leave extract was shown to exert a dose-dependent inhibition of DP-IV, with an IC50 of 380 μg/ml test assay solution. Also the individual flavonol-glycosides inhibited DP-IV dose-dependently, with variations of the effects by a factor of 10, and an overall effect accounting for 100% of that observed for the total guava extract. The recovery of individual flavonol-glycosides in CaCo-2 epithelial cells, a model of gastrointestinal tract absorption, amounted to 2.3-5.3% of the amount available for absorption over 60 min at 37°C. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Genetic resources of the functional food, teramnus labialis (L.f.) spreng for improving seed number, flavonol content, oil %, and fatty acid compositions

    Science.gov (United States)

    Teramnus labialis is used as food in India and has potential to be used as a functional food vegetable in the U.S.A. Photoperiod-sensitive T. labialis accessions were grown in the greenhouse from 2010 to 2011 and evaluated for flavonol content, oil %, and fatty acid compositions. Significant variati...

  6. A bipyridine-ligated zinc(II) complex with bridging flavonolate ligation: synthesis, characterization, and visible-light-induced CO release reactivity.

    Science.gov (United States)

    Sorenson, Shayne; Popova, Marina; Arif, Atta M; Berreau, Lisa M

    2017-09-01

    Metal-flavonolate compounds are of significant current interest as synthetic models for quercetinase enzymes and as bioactive compounds of importance to human health. Zinc-3-hydroxyflavonolate compounds, including those of quercetin, kampferol, and morin, generally exhibit bidentate coordination to a single Zn II center. The bipyridine-ligated zinc-flavonolate compound reported herein, namely bis(μ-4-oxo-2-phenyl-4H-chromen-3-olato)-κ 3 O 3 :O 3 ,O 4 ;κ 3 O 3 ,O 4 :O 3 -bis[(2,2'-bipyridine-κ 2 N,N')zinc(II)] bis(perchlorate), {[Zn 2 (C 15 H 9 O 3 ) 2 (C 10 H 8 N 2 ) 2 ](ClO 4 ) 2 } n , (1), provides an unusual example of bridging 3-hydroxyflavonolate ligation in a dinuclear metal complex. The symmetry-related Zn II centers of (1) exhibit a distorted octahedral geometry, with weak coordination of a perchlorate anion trans to the bridging deprotonated O atom of the flavonolate ligand. Variable-concentration conductivity measurements provide evidence that, when (1) is dissolved in CH 3 CN, the complex dissociates into monomers. 1 H NMR resonances for (1) dissolved in d 6 -DMSO were assigned via HMQC to the H atoms of the flavonolate and bipyridine ligands. In CH 3 CN, (1) undergoes quantitative visible-light-induced CO release with a quantum yield [0.004 (1)] similar to that exhibited by other mononuclear zinc-3-hydroxyflavonolate complexes. Mass spectroscopic identification of the [(bpy) 2 Zn(O-benzoylsalicylate)] + ion provides evidence of CO release from the flavonol and of ligand exchange at the Zn II center.

  7. Extensive In Vitro Hyphal Growth of Vesicular-Arbuscular Mycorrhizal Fungi in the Presence of CO(2) and Flavonols.

    Science.gov (United States)

    Bécard, G; Douds, D D; Pfeffer, P E

    1992-03-01

    Various flavonoids were tested for their ability to stimulate in vitro growth of germinated spores of vesicular-arbuscular mycorrhizal fungi. Experiments were performed in the presence of 2% CO(2), previously demonstrated to be required for growth of Gigaspora margarita (G. Bécard and Y. Piché, Appl. Environ. Microbiol. 55:2320-2325, 1989). Only the flavonols stimulated fungal growth. The flavones, flavanones, and isoflavones tested were generally inhibitory. Quercetin (10 muM) prolonged hyphal growth from germinated spores of G. margarita from 10 to 42 days. An average of more than 500 mm of hyphal growth and 13 auxiliary cells per spore were obtained. Quercetin also stimulated the growth of Glomus etunicatum. The glycosides of quercetin, rutin, and quercitrin were not stimulatory. The axenic growth of G. margarita achieved here under rigorously defined conditions is the most ever reported for a vesicular-arbuscular mycorrhizal fungus.

  8. Identification of flavonols in leaves of Maytenus ilicifolia and M. aquifolium (Celastraceae) by LC/UV/MS analysis.

    Science.gov (United States)

    Tiberti, Luciana A; Yariwake, Janete H; Ndjoko, Karine; Hostettmann, Kurt

    2007-02-01

    A comparative analysis of the flavonoid components of the leaves of two medicinal plants known in Brazil as "espinheira santa", namely, Maytenus ilicifolia Mart. ex Reiss. and M. aquifolium Mart. (Celastraceae), and a hybrid plant, M. aquifoliumxM. ilicifolia, has been carried out using high-performance liquid chromatography coupled with photodiode array UV detection and mass spectrometry. One methoxyflavonoid glycoside and 18 flavonol-3-O-glycosides were identified in the extracts on the basis of their on-line UV spectra (measured in the absence and presence of shift reagents) and multiple stage mass spectral data. Fingerprint analysis of the flavonoid extracts revealed significant differences in the profiles of the two Maytenus species, while the hybrid plant contained flavonoids found in both parent species.

  9. Solar UV light regulates flavonoid metabolism in apple (Malus x domestica).

    Science.gov (United States)

    Henry-Kirk, Rebecca A; Plunkett, Blue; Hall, Miriam; McGhie, Tony; Allan, Andrew C; Wargent, Jason J; Espley, Richard V

    2018-03-01

    Ultraviolet-B light (UV-B) is one environmental signal perceived by plants that affects the flavonoid pathway and influences the levels of anthocyanins, flavonols, and proanthocyanidins. To understand the mechanisms underlying UV exposure, apple trees were grown under spectral filters that altered transmission of solar UV light. Fruit analysis showed that UV induced changes in physiology, metabolism, and gene expression levels during development over a season. These changes were sustained after storage. Under low UV, ripening was delayed, fruit size decreased, and anthocyanin and flavonols were reduced. Expression analysis showed changes in response to UV light levels for genes in the regulation and biosynthesis of anthocyanin and flavonols. Transcription of flavonol synthase (FLS), ELONGATED HYPOCOTYL 5 (HY5), MYB10, and MYB22 were down-regulated throughout fruit development under reduced UV. Functional testing showed that the FLS promoter was activated by HY5, and this response was enhanced by the presence of MYB22. The MYB22 promoter can also be activated by the anthocyanin regulator, MYB10. As ambient levels of UV light vary around the globe, this study has implications for future crop production, the quality of which can be determined by the response to UV. © 2018 John Wiley & Sons Ltd.

  10. Solar ultraviolet radiation is necessary to enhance grapevine fruit ripening transcriptional and phenolic responses.

    Science.gov (United States)

    Carbonell-Bejerano, Pablo; Diago, Maria-Paz; Martínez-Abaigar, Javier; Martínez-Zapater, José M; Tardáguila, Javier; Núñez-Olivera, Encarnación

    2014-07-09

    Ultraviolet (UV) radiation modulates secondary metabolism in the skin of Vitis vinifera L. berries, which affects the final composition of both grapes and wines. The expression of several phenylpropanoid biosynthesis-related genes is regulated by UV radiation in grape berries. However, the complete portion of transcriptome and ripening processes influenced by solar UV radiation in grapes remains unknown. Whole genome arrays were used to identify the berry skin transcriptome modulated by the UV radiation received naturally in a mid-altitude Tempranillo vineyard. UV radiation-blocking and transmitting filters were used to generate the experimental conditions. The expression of 121 genes was significantly altered by solar UV radiation. Functional enrichment analysis of altered transcripts mainly pointed out that secondary metabolism-related transcripts were induced by UV radiation including VvFLS1, VvGT5 and VvGT6 flavonol biosynthetic genes and monoterpenoid biosynthetic genes. Berry skin phenolic composition was also analysed to search for correlation with gene expression changes and UV-increased flavonols accumulation was the most evident impact. Among regulatory genes, novel UV radiation-responsive transcription factors including VvMYB24 and three bHLH, together with known grapevine UV-responsive genes such as VvMYBF1, were identified. A transcriptomic meta-analysis revealed that genes up-regulated by UV radiation in the berry skin were also enriched in homologs of Arabidopsis UVR8 UV-B photoreceptor-dependent UV-B -responsive genes. Indeed, a search of the grapevine reference genomic sequence identified UV-B signalling pathway homologs and among them, VvHY5-1, VvHY5-2 and VvRUP were up-regulated by UV radiation in the berry skin. Results suggest that the UV-B radiation-specific signalling pathway is activated in the skin of grapes grown at mid-altitudes. The biosynthesis and accumulation of secondary metabolites, which are appreciated in winemaking and

  11. Regulation

    International Nuclear Information System (INIS)

    Ballereau, P.

    1999-01-01

    The different regulations relative to nuclear energy since the first of January 1999 are given here. Two points deserve to be noticed: the decree of the third august 1999 authorizing the national Agency for the radioactive waste management to install and exploit on the commune of Bures (Meuse) an underground laboratory destined to study the deep geological formations where could be stored the radioactive waste. The second point is about the uranium residues and the waste notion. The judgment of the administrative tribunal of Limoges ( 9. july 1998) forbidding the exploitation of a storage installation of depleted uranium considered as final waste and qualifying it as an industrial waste storage facility has been annulled bu the Court of Appeal. It stipulated that, according to the law number 75663 of the 15. july 1965, no criteria below can be applied to depleted uranium: production residue (possibility of an ulterior enrichment), abandonment of a personal property or simple intention to do it ( future use aimed in the authorization request made in the Prefecture). This judgment has devoted the primacy of the waste notion on this one of final waste. (N.C.)

  12. Priming of seeds with methyl jasmonate induced resistance to hemi-biotroph Fusarium oxysporum f.sp. lycopersici in tomato via 12-oxo-phytodienoic acid, salicylic acid, and flavonol accumulation.

    Science.gov (United States)

    Król, P; Igielski, R; Pollmann, S; Kępczyńska, E

    2015-05-01

    Methyl jasmonate (MeJA) was tested by seed treatment for its ability to protect tomato seedlings against fusarium wilt caused by the soil-borne fungal pathogen Fusarium oxysporum f.sp. lycopersici. Isolated from Solanum lycopersicon L. seeds, cv. Beta fungus was identified as F. oxysporum f.sp. lycopersici Race 3 fungus by using phytopathological and molecular methods. MeJA applied at 0.01, 0.1 and 1 mM reduced spore germination and mycelial growth in vitro. Soaking of tomato seeds in MeJA solution at 0.1 mM for 1 h significantly enhanced the resistance level against the tested fungus in tomato seedlings 4 weeks after inoculation. The extracts from leaves of 15-day-old seedlings obtained from previously MeJA soaked seeds had the ability to inhibit in vitro spore germination of tested fungus. In these seedlings a significant increase in the levels phenolic compounds such as salicylic acid (SA), kaempferol and quercetin was observed. Up-regulation of phenylalanine ammonia-lyase (PAL5) and benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) genes and down-regulation of the isochorysmate synthase (ICS) gene in response to exogenous MeJA application indicate that the phenylalanine ammonia-lyase (PAL), not the isochorismate (IC) pathway, is the primary route for SA production in tomato. Moreover, the increased accumulation of the flavonols quercetin and kaempferol appears closely related to the increase of PAL5, chalcone synthase (CHS) and flavonol synthase/flavanone 3-hydroxylase-like (FLS) genes. Elevated levels of salicylic acid in seedlings raised from MeJA-soaked seeds were simultaneously accompanied by a decrease of jasmonic acid, the precursor of MeJA, and an increase of 12-oxo-phytodienoic acid (OPDA), the precursor of jasmonic acid. The present results indicate that the priming of tomato seeds with 0.1mM MeJA before sowing enables the seedlings grown from these seeds to reduce the attack of the soil-borne fungal pathogen F. oxysporum f.sp. lycopersici

  13. Determination of major anthocyanin pigments and flavonols in red grape skin of some table grape varieties (Vitis vinifera sp. by high-performance liquid chromatography–photodiode array detection (HPLC-DAD

    Directory of Open Access Journals (Sweden)

    Farida Benmeziane

    2016-09-01

    Significance and impact of the study: To the best of our knowledge, this is the first report on the identification of different anthocyanins and flavonols in berry skin from some red grape varieties largely cultivated in this region of Algeria.

  14. The straberry FAMNB 1 transription factor suppresses anthocyanim and flavonol accumulation in transgenic tabacco

    NARCIS (Netherlands)

    Aharoni, A.; Vos, C.H.R.; Wein, M.; Sun, Z.; Greco, R.; Kroon, A.R.; Mol, J.N.M.; O'Connell, A.P.

    2001-01-01

    Fruit ripening is characterized by dramatic changes in gene expression, enzymatic activities and metabolism. Although the process of ripening has been studied extensively, we still lack valuable information on how the numerous metabolic pathways are regulated and co-ordinated. In this paper we

  15. Higher Antioxidant Activity, Total Flavonols, and Specific Quercetin Glucosides in Two Different Onion (Allium cepa L.) Varieties Grown under Organic Production: Results from a 6-Year Field Study.

    Science.gov (United States)

    Ren, Feiyue; Reilly, Kim; Kerry, Joseph P; Gaffney, Michael; Hossain, Mohammad; Rai, Dilip K

    2017-06-28

    We carried out a 6-year study to assess the effect of conventional, organic, and mixed cultivation practices on bioactive compounds (flavonoids, anthocyanins) and antioxidant capacity in onion. Total flavonoids, total anthocyanins, individual flavonols, individual anthocyanins, and antioxidant activity were measured in two varieties ('Hyskin' and 'Red Baron') grown in a long-term split-plot factorial systems comparison trial. This is the first report of repeated measurements of bioactive content over an extensive time period in a single crop type within the same trial. Antioxidant activity (DPPH and FRAP), total flavonol content, and levels of Q 3,4' D and Q 3 G were higher in both varieties under fully organic compared to fully conventional management. Total flavonoids were higher in 'Red Baron' and when onions were grown under organic soil treatment. Differences were primarily due to different soil management practices used in organic agriculture rather than pesticide/ herbicide application.

  16. Molecular insight into the inclusion of the dietary plant flavonol fisetin and its chromophore within a chemically modified γ-cyclodextrin: Multi-spectroscopic, molecular docking and solubility studies.

    Science.gov (United States)

    Pahari, Biswapathik; Chakraborty, Sandipan; Sengupta, Pradeep K

    2018-09-15

    We explored the encapsulation of dietary plant flavonols fisetin and its chromophore 3-hydroxyflavone, within 2-hydroxypropyl-γ-cyclodextrin (HPγ-CDx) nano-cavity in aqueous solution using multi-spectroscopic approaches and molecular docking. Upon addition of HPγ-CDx, dramatic changes occur in the intrinsic 'two color' fluorescence behavior of the fluorophores. This is manifested by significant increase in the steady state fluorescence intensities, anisotropies, average fluorescence lifetimes and rotational correlation times. Furthermore, in the CDx environment, intrinsically achiral flavonols exhibit prominent induced circular dichroism bands. These findings indicate that the flavonol molecules spontaneously enter the relatively hydrophobic, chiral environment of the HPγ-CDx nano-cavities. Molecular docking computations corroborate the spectroscopic findings, and predict selectivity in orientation of the encapsulated flavonols. HPγ-CDx inclusion increases the aqueous solubility of individual flavonols ∼100-1000 times. The present study demonstrates that the hydroxypropyl substituent in γ-CDx controls the inclusion mode of the flavonols, leading to their enhanced solubilization and altered spectral signatures. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Nondestructive Optical Sensing of Flavonols and Chlorophyll in White Head Cabbage (Brassica oleracea L. var. capitata subvar. alba) Grown under Different Nitrogen Regimens.

    Science.gov (United States)

    Agati, Giovanni; Tuccio, Lorenza; Kusznierewicz, Barbara; Chmiel, Tomasz; Bartoszek, Agnieszka; Kowalski, Artur; Grzegorzewska, Maria; Kosson, Ryszard; Kaniszewski, Stanislaw

    2016-01-13

    A multiparametric optical sensor was used to nondestructively estimate phytochemical compounds in white cabbage leaves directly in the field. An experimental site of 1980 white cabbages (Brassica oleracea L. var. capitata subvar. alba), under different nitrogen (N) treatments, was mapped by measuring leaf transmittance and chlorophyll fluorescence screening in one leaf/cabbage head. The provided indices of flavonols (FLAV) and chlorophyll (CHL) displayed the opposite response to applied N rates, decreasing and increasing, respectively. The combined nitrogen balance index (NBI = CHL/FLAV) calculated was able to discriminate all of the plots under four N regimens (0, 100, 200, and 400 kg/ha) and was correlated with the leaf N content determined destructively. CHL and FLAV were properly calibrated against chlorophyll (R(2) = 0.945) and flavonol (R(2) = 0.932) leaf contents, respectively, by using a homographic fit function. The proposed optical sensing of cabbage crops can be used to estimate the N status of plants and perform precision fertilization to maintain acceptable crop yield levels and, additionally, to rapidly detect health-promoting flavonol antioxidants in Brassica plants.

  18. Effect of anthocyanins, carotenoids, and flavonols on chlorophyll fluorescence excitation spectra in apple fruit: signature analysis, assessment, modelling, and relevance to photoprotection.

    Science.gov (United States)

    Merzlyak, Mark N; Melø, Thor Bernt; Naqvi, K Razi

    2008-01-01

    Whole apple fruit (Malus domestica Borkh.) widely differing in pigment content and composition has been examined by recording its chlorophyll fluorescence excitation and diffuse reflection spectra in the visible and near UV regions. Spectral bands sensitive to the pigment concentration have been identified, and linear models for non-destructive assessment of anthocyanins, carotenoids, and flavonols via chlorophyll fluorescence measurements are put forward. The adaptation of apple fruit to high light stress involves accumulation of these protective pigments, which absorb solar radiation in broad spectral ranges extending from UV to the green and, in anthocyanin-containing cultivars, to the red regions of the spectrum. In ripening apples the protective effect in the blue region could be attributed to extrathylakoid carotenoids. A simple model, which allows the simulation of chlorophyll fluorescence excitation spectra in the visible range and a quantitative evaluation of competitive absorption by anthocyanins, carotenoids, and flavonols, is described. Evidence is presented to support the view that anthocyanins, carotenoids, and flavonols play, in fruit with low-to-moderate pigment content, the role of internal traps (insofar as they compete with chlorophylls for the absorption of incident light in specific spectral bands), affecting thereby the shape of the chlorophyll fluorescence excitation spectrum.

  19. Comprehensive evaluation of the flavonol anti-oxidants, alpha-glycosyl isoquercitrin and isoquercitrin, for genotoxic potential.

    Science.gov (United States)

    Hobbs, Cheryl A; Koyanagi, Mihoko; Swartz, Carol; Davis, Jeffrey; Kasamoto, Sawako; Maronpot, Robert; Recio, Leslie; Hayashi, Shim-Mo

    2018-03-01

    Quercetin and its glycosides possess potential benefits to human health. Several flavonols are available to consumers as dietary supplements, promoted as anti-oxidants; however, incorporation of natural quercetin glycosides into food and beverage products has been limited by poor miscibility in water. Enzymatic conjugation of multiple glucose moieties to isoquercitrin to produce alpha-glycosyl isoquercitrin (AGIQ) enhances solubility and bioavailability. AGIQ is used in Japan as a food additive and has been granted generally recognized as safe (GRAS) status. However, although substantial genotoxicity data exist for quercetin, there is very little available data for AGIQ and isoquercitrin. To support expanded global marketing of food products containing AGIQ, comprehensive testing of genotoxic potential of AGIQ and isoquercitrin was conducted according to current regulatory test guidelines. Both chemicals tested positive in bacterial reverse mutation assays, and exposure to isoquercitrin resulted in chromosomal aberrations in CHO-WBL cells. All other in vitro mammalian micronucleus and chromosomal aberration assays, micronucleus and comet assays in male and female B6C3F1 mice and Sprague Dawley rats, and Muta™ Mouse mutation assays evaluating multiple potential target tissues, were negative for both chemicals. These results supplement existing toxicity data to further support the safe use of AGIQ in food and beverage products. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Flavonol-rich dark cocoa significantly decreases plasma endothelin-1 and improves cognitive responses in urban children.

    Directory of Open Access Journals (Sweden)

    Lilian eCalderon-Garciduenas

    2013-08-01

    Full Text Available Air pollution exposures are linked to systemic inflammation, cardiovascular and respiratory morbidity and mortality, neuroinflammation and neuropathology in young urbanites. In particular, most Mexico City Metropolitan Area (MCMA children exhibit subtle cognitive deficits, and neuropathology studies show 40% of them exhibiting frontal tau hyperphosphorylation and 51% amyloid-β diffuse plaques (compared to 0% in low pollution control children. We assessed whether a short cocoa intervention can be effective in decreasing plasma endothelin 1 (ET-1 and/or inflammatory mediators in MCMA children. Thirty g of dark cocoa with 680 mg of total flavonols were given daily for 10.11± 3.4 days (range 9 to 24 days to 18 children (10.55yrs, SD =1.45; 11F/7M. Key metabolite ratios in frontal white matter and in hippocampus pre and during cocoa intervention were quantified by magnetic resonance spectroscopy. ET-1 significantly decreased after cocoa treatment (p=0.0002. Fifteen children (83% showed a marginally significant individual improvement in one or both of the applied simple short memory tasks. Endothelial dysfunction is a key feature of exposure to particulate matter and decreased endothelin-1 bioavailability is likely useful for brain function in the context of air pollution. Our findings suggest that cocoa interventions may be critical for early implementation of neuroprotection of highly exposed urban children. Multi-domain nutraceutical interventions could limit the risk for endothelial dysfunction, cerebral hypoperfusion, neuroinflammation, cognitive deficits, structural volumetric detrimental brain effects, and the early development of the neuropathological hallmarks of Alzheimer’s and Parkinson’s diseases.

  1. Cellular mechanisms underlying the laxative effect of flavonol naringenin on rat constipation model.

    Directory of Open Access Journals (Sweden)

    Zi-Huan Yang

    Full Text Available BACKGROUND & AIMS: Symptoms of constipation are extremely common, especially in the elderly. The present study aim to identify an efficacious treatment strategy for constipation by evaluating the secretion-promoting and laxative effect of a herbal compound, naringenin, on intestinal epithelial anion secretion and a rat constipation model, respectively. METHODS/PRINCIPAL FINDINGS: In isolated rat colonic crypts, mucosal addition of naringenin (100 microM elicited a concentration-dependent and sustained increase in the short-circuit current (I(SC, which could be inhibited in Cl- free solution or by bumetanide and DPC (diphenylamine-2-carboxylic acid, but not by DIDS (4, 4'- diisothiocyanatostilbene-2, 2'-disulfonic acid. Naringenin could increase intracellular cAMP content and PKA activity, consisted with that MDL-12330A (N-(Cis-2-phenyl-cyclopentyl azacyclotridecan-2-imine-hydrochloride pretreatment reduced the naringenin-induced I(SC. In addition, significant inhibition of the naringenin-induced I(SC by quinidine indicated that basolateral K+ channels were involved in maintaining this cAMP-dependent Cl- secretion. Naringenin-evoked whole cell current which exhibited a linear I-V relationship and time-and voltage- independent characteristics was inhibited by DPC, indicating that the cAMP activated Cl- conductance most likely CFTR (cystic fibrosis transmembrane conductance regulator was involved. In rat constipation model, administration of naringenin restored the level of fecal output, water content and mucus secretion compared to loperamide-administrated group. CONCLUSIONS: Taken together, our data suggest that naringenin could stimulate Cl- secretion in colonic epithelium via a signaling pathway involving cAMP and PKA, hence provide an osmotic force for subsequent colonic fluid secretion by which the laxative effect observed in the rat constipation model. Naringenin appears to be a novel alternative treatment strategy for constipation.

  2. Valorisation of typical products through characterising and promoting actions: morpho-biometric traits, sensory analysis and flavonol content in Cipolla di Giarratana

    Directory of Open Access Journals (Sweden)

    Ezio Riggi

    2013-05-01

    Full Text Available The performances of 9 accessions of Cipolla di Giarratana landrace were evaluated at 5 different sites located 2 in the area where this landrace is traditionally grown (South-Eastern Sicily, 550 m asl, 2 in the neighbor areas with similar average altitude, and one on the South East coast of Sicily (sea level. Biometric and morphological traits, flavonol content and sensory profile were all considered in the valorisation of a typical product of a marginal area of Sicily. Data on the actual yield and crop management at farm scale were also obtained involving more than half of the growers actually cultivating Cipolla di Giarratana, and measuring yield, plant density, and bulb weight directly on the farms. The Cipolla di Giarratana landrace is characterised by a large and heavy bulb (535 g, strongly flattened at the poles, with the maximum diameter at the central section, and white in colour. Significant differences in bulb weight and diameter were found among accessions and locations, but there were no interactions between them and one accession reported the highest bulb weight value in all of the locations studied. With regards to bulb weight, farm scale data confirm the results we obtained at the experimental locations. Fifty percent of registered yield at farm scale ranged between 86 and 152 t ha–1 with a median of 119 t ha–1, and measured plant density revealed that 50% of the farmers planted 20-27 plants per square meter. Analysis of the UV-vis and mass spectra showed the presence of 10 different flavonols with Quercetin as the most represented flavonol. The sensory profile of Cipolla di Giarratana onion showed that this landrace is characterised by a high intensity of sweet, typical fresh flavour and texture perception.

  3. Cloning and Characterization of a Flavonol Synthase Gene From Litchi chinensis and Its Variation Among Litchi Cultivars With Different Fruit Maturation Periods

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2018-04-01

    Full Text Available Litchi (Litchi chinensis is an important subtropical fruit tree with high commercial value. However, the short and centralized fruit maturation period of litchi cultivars represents a bottleneck for litchi production. Therefore, the development of novel cultivars with extremely early fruit maturation period is critical. Previously, we showed that the genotypes of extremely early-maturing (EEM, early-maturing (EM, and middle-to-late-maturing (MLM cultivars at a specific locus SNP51 (substitution type C/T were consistent with their respective genetic background at the whole-genome level; a homozygous C/C genotype at SNP51 systematically differentiated EEM cultivars from others. The litchi gene on which SNP51 was located was annotated as flavonol synthase (FLS, which catalyzes the formation of flavonols. Here, we further elucidate the variation of the FLS gene from L. chinensis (LcFLS among EEM, EM, and MLM cultivars. EEM cultivars with a homozygous C/C genotype at SNP51 all contained the same 2,199-bp sequence of the LcFLS gene. For MLM cultivars with a homozygous T/T genotype at SNP51, the sequence lengths of the LcFLS gene were 2,202–2,222 bp. EM cultivars with heterozygous C/T genotypes at SNP51 contained two different alleles of the LcFLS gene: a 2,199-bp sequence identical to that in EEM cultivars and a 2,205-bp sequence identical to that in MLM cultivar ‘Heiye.’ Moreover, the coding regions of LcFLS genes of other MLM cultivars were almost identical to that of ‘Heiye.’ Therefore, the LcFLS gene coding region may be used as a source of diagnostic SNP markers to discriminate or identify genotypes with the EEM trait. The expression pattern of the LcFLS gene and accumulation pattern of flavonol from EEM, EM, and MLM cultivars were analyzed and compared using quantitative real-time PCR (qRT-PCR and high-performance liquid chromatography (HPLC for mature leaves, flower buds, and fruits, 15, 30, 45, and 60 days after anthesis. Flavonol

  4. Quantitative analysis of flavonols, flavones, and flavanones in fruits, vegetables and beverages by high-performance liquid chromatography with photo-diode array and mass spectrometric detection

    DEFF Research Database (Denmark)

    Justesen, U.; Knuthsen, Pia; Leth, Torben

    1998-01-01

    after acid hydrolysis of freeze-dried food material. Identification was based on retention time, UV and mass spectra by comparison with commercial standards, and the UV peak areas were used for quantitation of the flavonoid contents. Examples of HPLC-MS analyses of orange pulp, tomato, and apple......A high-performance liquid chromatographic (HPLC) separation method viith photo-diode array (PDA) and mass spectrometric (MS) detection was developed to determine and quantify flavonols, flavones, and flavanones in fruits, vegetables and beverages. The compounds were analysed as aglycones, obtained...

  5. Characterization of a Vitis vinifera cv. Cabernet Sauvignon 3',5'-O-methyltransferase showing strong preference for anthocyanins and glycosylated flavonols.

    Science.gov (United States)

    Lücker, Joost; Martens, Stefan; Lund, Steven T

    2010-09-01

    At ripening initiation in red grapevine (Vitis vinifera) berries, the exocarp turns color from green to red and then to purple due to the accumulation and extent of methylation of anthocyanins. The accumulation of transcripts encoding an O-methyltransferase was recently shown to be closely correlated with the onset of ripening and the degree of blue/purple pigmentation in grapevine berries; however, the biochemical function of this gene has remained uncharacterized. In this study, an O-methyltransferase cDNA that showed a distinct expression pattern when compared to closely related sequences was expressed in Escherichia coli and enzyme assays were carried out with a broad array of anthocyanin and other flavonoid substrates. We demonstrate that this enzyme carries out 3',5'-O-methylation of anthocyanins and flavonol compounds in vitro, which are known to be present in grape berries, with a preference for glycosylated substrates. The highest relative specific activity for the enzyme was found with delphinidin 3-O-glucoside as substrate. The enzyme is not able to methylate flavan type skeletons with chiral centers, such as either catechins or dihydroquercetin. The enzyme showed negligible specific activity for caffeoyl-CoA, compared to flavonol and anthocyanin substrates. Phylogenetic analysis of the O-methyltransferase suggests that it may be a member of a distinct subclass of Type 2 bivalent metal-dependent S-adenosyl-methionine O-methyltransferases. (c) 2010. Published by Elsevier Ltd. All rights reserved.

  6. Separation and purification of four flavonol diglucosides from the flower of Meconopsis integrifolia by high-speed counter-current chromatography.

    Science.gov (United States)

    Huang, Yanfei; Han, Yatao; Chen, Keli; Huang, Bisheng; Liu, Yuan

    2015-12-01

    Flavonoids are the main components of Meconopsis integrifolia (Maxim.) Franch, which is a traditional Tibetan medicine. However, traditional chromatography separation requires a large quantity of raw M. integrifolia and is very time consuming. Herein, we applied high-speed counter-current chromatography in the separation and purification of flavonoids from the ethanol extracts of M. integrifolia flower. Ethyl acetate/n-butanol/water (2:3:5, v/v/v) was selected as the optimum solvent system to purify the four components, namely quercetin-3-O-β-d-glucopyrannosy-(1→6)-β-d-glucopyranoside (compound 1, 60 mg), quercetin 3-O-[2'''-O-acetyl-β-d-glucopyranosyl-(1→6)-β-d-glucopyranoside (compound 2, 40 mg), quercetin 3-O-[3'''-O-acetyl-β-d-glucopyranosyl-(1→6)-β-d-glucopyranoside (compound 3, 11 mg), and quercetin 3-O-[6'''-O-acetyl-β-d-glucopyranosyl-(1→6)-β-d-glucopyranoside (compound 4, 16 mg). Among the four compounds, 3 and 4 were new acetylated flavonol diglucosides. After the high-speed counter-current chromatography separation, the purities of the four flavonol diglucosides were 98, 95, 90, and 92%, respectively. The structures of these compounds were identified by mass spectrometry and NMR spectroscopy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Comparative Characterization of Total Flavonol Glycosides and Terpene Lactones at Different Ages, from Different Cultivation Sources and Genders of Ginkgo biloba Leaves

    Directory of Open Access Journals (Sweden)

    Yong Qin

    2012-08-01

    Full Text Available The extract from Ginkgo biloba leaves has become a very popular plant medicine and herbal supplement for its potential benefit in alleviating symptoms associated with peripheral vascular disease, dementia, asthma and tinnitus. Most research on G. biloba leaves focus on the leaves collected in July and August from four to seven year-old trees, however a large number of leaves from fruit cultivars (trees older than 10 years are ignored and become obsolete after fruit harvest season (November. In this paper, we expand the tree age range (from one to 300 years and first comparatively analyze the total flavonol glycosides and terpene lactones at different ages, from different cultivation sources and genders of G. biloba leaves collected in November by using the validated HPLC-ELSD and HPLC-PDA methods. The results show that the contents of total terpene lactones and flavonol glycosides in the leaves of young ginkgo trees are higher than those in old trees, and they are higher in male trees than in female trees. Geographical factors appear to have a significant influence on the contents as well. These results will provide a good basis for the comprehensive utilization of G. biloba leaves, especially the leaves from fruit cultivars.

  8. Flavonols and ellagic acid derivatives in peels of different species of jabuticaba (Plinia spp.) identified by HPLC-DAD-ESI/MSn.

    Science.gov (United States)

    Neves, Nathália de Andrade; Stringheta, Paulo César; Gómez-Alonso, Sergio; Hermosín-Gutiérrez, Isidro

    2018-06-30

    Extracts of jabuticaba peels show complex chromatographic profiles at 360 nm, with some peaks presenting UV-Vis spectra resembling those of flavonol glycosides and others resembling that of ellagic acid. The presence and tentative identification of these phenolic compounds were comprehensively studied in four species of Brazilian jabuticaba fruit - Plinia trunciflora, variety 'jabuticaba de cabinho'; P. caulifora, varieties 'jabuticaba paulista' and 'jabuticaba canaã-açu'; P. jaboticaba, variety 'jabuticaba sabará'; and P. phitrantha, variety 'jabuticaba branca-vinho' - using HPLC-DAD-ESI-MS n . Seventeen flavonols derived from quercetin and three from myricetin and eighteen derivatives of ellagic acid and eleven of methyl ellagic acid were detected. Most of them were newly described and mainly occurred in glycosylated and acylglycosylated forms. Some compounds were missing in one variety, such as the absence of methyl ellagic acid derivatives in 'jabuticaba branca-vinho', and others only appeared in one variety, thus suggesting potential capacity for varietal differentiation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Infrared spectroscopy of flavones and flavonols. Reexamination of the hydroxyl and carbonyl vibrations in relation to the interactions of flavonoids with membrane lipids

    Science.gov (United States)

    Baranović, Goran; Šegota, Suzana

    2018-03-01

    Detailed vibrational assignments for twelve flavonoids (seven flavones (flavone, 3- and 5-hydroxyflavone, chrysin, apigenin, fisetin and luteolin) and five flavonols (galangin, kaempferol, quercetin, morin and myricetin)) have been made based on own and reported experimental data and calculations at the B3LYP/6-31 + G(d,p) level of theory. All the molecules are treated in a uniform way by using the same set of redundancy-free set of internal coordinates. A generalized harmonic mode mixing is used to corroborate the vibrational characteristics of this important class of molecules. Each flavonoid molecule can be treated from the vibrational point of view as made of relatively weakly coupled chromone and phenyl part. It has been shown that the strongest band around 1600 cm- 1 need not be attributable to the Cdbnd O stretching. The way the vibrations of any of the hydroxyl groups are mixed with ring vibrations and vibrations of other neighboring hydroxyl groups is rather involved. This imposes severe limitations on any attempt to describe normal modes of a flavonol in terms of hydroxyl or carbonyl group vibrations. The role of water molecules in the appearance of flavonoid IR spectra is emphasized. Knowing for the great affinity of phosphate groups in lipids towards water, the immediate consequence is a reasonable assumption that flavonoid lipid interactions is mediated by water.

  10. Interaction of moderate UV-B exposure and temperature on the formation of structurally different flavonol glycosides and hydroxycinnamic acid derivatives in kale (Brassica oleracea var. sabellica).

    Science.gov (United States)

    Neugart, Susanne; Fiol, Michaela; Schreiner, Monika; Rohn, Sascha; Zrenner, Rita; Kroh, Lothar W; Krumbein, Angelika

    2014-05-07

    Kale has a high number of structurally different flavonol glycosides and hydroxycinnamic acid derivatives. In this study we investigated the interaction of moderate UV-B radiation and temperature on these compounds. Kale plants were grown at daily mean temperatures of 5 or 15 °C and were exposed to five subsequent daily doses (each 0.25 kJ m(-2) d(-1)) of moderate UV-B radiation at 1 d intervals. Of 20 phenolic compounds, 11 were influenced by an interaction of UV-B radiation and temperature, e.g., monoacylated quercetin glycosides. Concomitantly, enhanced mRNA expression of flavonol 3'- hydroxylase showed an interaction of UV-B and temperature, highest at 0.75 kJ m(-2) and 15 °C. Kaempferol glycosides responded diversely and dependent on, e.g., the hydroxycinnamic acid residue. Compounds containing a catechol structure seem to be favored in the response to UV-B. Taken together, subsequent exposure to moderate UV-B radiation is a successful tool for enhancing the flavonoid profile of plants, and temperature should be considered.

  11. Biotransformation of flavonols and taxifolin in hepatocyte in vitro systems as determined by liquid chromatography with various stationary phases and electrospray ionization-quadrupole time-of-flight mass spectrometry

    Czech Academy of Sciences Publication Activity Database

    Vacek, J.; Papoušková, B.; Kosina, P.; Vrba, J.; Křen, Vladimír; Ulrichová, J.

    2012-01-01

    Roč. 899, JUN 2012 (2012), s. 109-115 ISSN 1570-0232 R&D Projects: GA ČR(CZ) GAP301/11/0767 Keywords : Flavonols * Flavononol * Taxifolin Subject RIV: CE - Biochemistry Impact factor: 2.487, year: 2012

  12. Computer-aided method for identification of major flavone/flavonol glycosides by high-performance liquid chromatography-diode array detection-tandem mass spectrometry (HPLC-DAD-MS/MS).

    Science.gov (United States)

    Wang, Zhengfang; Lin, Longze; Harnly, James M; Harrington, Peter de B; Chen, Pei

    2014-11-01

    A new computational tool is proposed here for tentatively identifying major (UV quantifiable) flavone/flavonol glycoside peaks of high performance liquid chromatogram (HPLC)-diode array detection (DAD)-tandem mass spectrometry (MS/MS) profiles based on a MATLAB-based script implementing an in-house algorithm. The HPLC-DAD-MS/MS profiles of red onion, Chinese lettuce, carrot leaf, and celery seed extracts were analyzed by the proposed computer-aided screening method for identifying possible flavone/flavonol glycoside peaks from the HPLC-UV and MS total ion current (TIC) chromatograms. The number of identified flavone/flavonol glycoside peaks of the HPLC-UV chromatograms is four, four, six, and nine for red onion, Chinese lettuce, carrot leaf, and celery seed, respectively. These results have been validated by human(s) experts. For the batch processing of nine HPLC-DAD-MS/MS profiles of celery seed extract, the entire script execution time was within 15 s while manual calculation of only one HPLC-DAD-MS/MS profile by a flavonoid expert could take hours. Therefore, this MATLAB-based screening method is able to facilitate the HPLC-DAD-MS/MS analysis of flavone/flavonol glycosides in plants to a large extent.

  13. Low and moderate photosynthetically active radiation affects the flavonol glycosides and hydroxycinnamic acid derivatives in kale (Brassica oleracea var. sabellica) dependent on two low temperatures.

    Science.gov (United States)

    Neugart, Susanne; Fiol, Michaela; Schreiner, Monika; Rohn, Sascha; Zrenner, Rita; Kroh, Lothar W; Krumbein, Angelika

    2013-11-01

    Kale (Brassica oleracea var. sabellica) contains a large number of naturally occurring structurally different non-acylated and acylated flavonol glycosides as well as hydroxycinnamic acid derivatives. The objective of this study was to determine the effect of low and moderate photosynthetic active radiation (PAR) and how these levels interact with low temperature in these phenolic compounds. Juvenile kale plants were treated with PAR levels from 200 to 800 μmol m(-2) s(-1) at 5 and 10 °C under defined conditions in climate chambers. Of the investigated 20 compounds, 11 and 17 compounds were influenced by PAR and temperature, respectively. In addition, an interaction between PAR and temperature was found for eight compounds. The response of the phenolic compounds to PAR was structure-dependent. While quercetin triglycosides increased with higher PAR at 5 and 10 °C, the kaempferol triglycosides exhibited the highest concentrations at 400 μmol m(-2) s(-1). In contrast, kaempferol diglycosides exhibited the highest concentrations at increased PAR levels of 600 and 800 μmol m(-2) s(-1) at 10 °C. However, key genes of flavonol biosynthesis were influenced by temperature but remained unaffected by PAR. Furthermore, there was no interaction between the PAR level and the low temperature in the response of hydroxycinnamic acid derivatives in kale with the exception of caffeoylquinic acid, which decreased with higher PAR levels of 600 and 800 μmol m(-2) s(-1) and at a lower temperature. In conclusion, PAR and its interaction with temperature could be a suitable tool for modifying the profile of phenolic compounds. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. One-step separation and purification of three lignans and one flavonol from Sinopodophyllum emodi by medium-pressure liquid chromatography and high-speed counter-current chromatography.

    Science.gov (United States)

    Wang, Ping; Liu, Yongling; Chen, Tao; Xu, Wenhua; You, Jinmao; Liu, Yongjun; Li, Yulin

    2013-01-01

    Lignans and flavonols are the primary constituents of Sinopodophyllum emodi and have been used as cathartic, anthelmintic, chemotherapeutic and anti-hypertensive compounds. Although these compounds have been isolated, there have been no reports on the separation of 4'-demethyl podophyllotoxin, podophyllotoxin, deoxypodophyllotoxin and kaempferol in one step by medium-pressure liquid chromatography (MPLC) and high-speed counter-current chromatography (HSCCC). Development of an efficient method for the preparative separation and purification of three lignans and one flavonol from S. emodi. The precipitate of crude extracts was first separated by MPLC into four parts, numbered GJ-1, GJ-2, GJ-3 and GJ-4. GJ-1 was separated and purified by HSCCC using a solvent system composed of n-hexane:ethyl acetate:methanol:water (1.75:1.5:1:0.75, v/v/v/v). The purities of the target compounds were assessed using high-performance liquid chromatography (HPLC) and chemical structures were identified by (1) H-NMR and (13) C-NMR. The HSCCC and MPLC methods were successfully used for the preparative separation and purification of 4'-demethyl podophyllotoxin (8.5 mg, 92.4%), podophyllotoxin (40.1 mg, 92.1%), deoxypodophyllotoxin (4.6 mg, 98.1%), and kaempferol (1.6 mg, 96.7%) from a 100 mg sample. Three lignans (4'-demethyl podophyllotoxin, podophyllotoxin, deoxypodophyllotoxin) and one flavonol (kaempferol) were successfully isolated by HSCCC and MPLC in one step. Copyright © 2013 John Wiley & Sons, Ltd.

  15. Separation of four flavonol glycosides from Solanum rostratum Dunal using aqueous two-phase flotation followed by preparative high-performance liquid chromatography.

    Science.gov (United States)

    Chang, Lin; Shao, Qian; Xi, Xingjun; Chu, Qiao; Wei, Yun

    2017-02-01

    Aqueous two-phase flotation followed by preparative high-performance liquid chromatography was used to separate four flavonol glycosides from Solanum rostratum Dunal. In the aqueous two-phase flotation section, the effects of sublation solvent, solution pH, (NH 4 ) 2 SO 4 concentration in aqueous solution, cosolvent, N 2 flow rate, flotation time, and volumes of the polyethylene glycol phase on the recovery were investigated in detail, and the optimal conditions were selected: 50 wt% polyethylene glycol 1000 ethanol solvent as the flotation solvent, pH 4, 350 g/L of (NH 4 ) 2 SO 4 concentration in aqueous phase, 40 mL/min of N 2 flow rate, 30 min of flotation time, 10.0 mL of flotation solvent volume, and two times. After aqueous two-phase flotation concentration, the flotation products were purified by preparative high-performance liquid chromatography. The purities of the final products A and B were 98.1 and 99.0%. Product B was the mixture of three compounds based on the analysis of high-performance liquid chromatography at the temperature of 10°C, while product A was hyperoside after the identification by nuclear magnetic resonance. Astragalin, 3'-O-methylquercetin 3-O-β-d-galactopyranoside, and 3'-O-methylquercetin 3-O-β-d-glucopyranoside were obtained with the purity of 93.8, 97.1, and 99.2%, respectively, after the further separation of product B using preparative high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Effects of Parsley (Petroselinum crispum) and its Flavonol Constituents, Kaempferol and Quercetin, on Serum Uric Acid Levels, Biomarkers of Oxidative Stress and Liver Xanthine Oxidoreductase Aactivity inOxonate-Induced Hyperuricemic Rats.

    Science.gov (United States)

    Haidari, Fatemeh; Keshavarz, Seid Ali; Mohammad Shahi, Majid; Mahboob, Soltan-Ali; Rashidi, Mohammad-Reza

    2011-01-01

    Increased serum uric acid is known to be a major risk related to the development of several oxidative stress diseases. The aim of this study was to investigate the effect of parsley, quercetin and kaempferol on serum uric acid levels, liver xanthine oxidoreductase activity and two non-invasive biomarkers of oxidative stress (total antioxidant capacity and malondialdehyde concentration) in normal and oxonate-induced hyperuricemic rats. A total of 60 male Wistar rats were randomly divided into ten equal groups; including 5 normal groups (vehicle, parsley, quercetin, kaempferol and allopurinol) and 5 hyperuricemic groups (vehicle, parsley, quercetin, kaempferol and allopurinol). Parsley (5 g/Kg), quercetin (5 mg/Kg), kaempferol (5 mg/Kg) and allopurinol (5 mg/Kg) were administrated to the corresponding groups by oral gavage once a day for 2 weeks. The results showed that parsley and its flavonol did not cause any significant reduction in the serum uric acid levels in normal rats, but significantly reduced the serum uric acid levels of hyperuricemic rats in a time-dependent manner. All treatments significantly inhibited liver xanthine oxidoreductase activity. Parsley, kaempferol and quercetin treatment led also to a significant increase in total antioxidant capacity and decrease in malondialdehyde concentration in hyperuricemic rats. Although the hypouricemic effect of allopurinol was much higher than that of parsley and its flavonol constituents, it could not significantly change oxidative stress biomarkers. These features of parsley and its flavonols make them as a possible alternative for allopurinol, or at least in combination therapy to minimize the side effects of allopurinol to treat hyperuricemia and oxidative stress diseases.

  17. Quantitative Analysis and Comparison of Four Major Flavonol Glycosides in the Leaves of Toona sinensis (A. Juss.) Roemer (Chinese Toon) from Various Origins by High-Performance Liquid Chromatography-Diode Array Detector and Hierarchical Clustering Analysis

    Science.gov (United States)

    Sun, Xiaoxiang; Zhang, Liting; Cao, Yaqi; Gu, Qinying; Yang, Huan; Tam, James P.

    2016-01-01

    Background: Toona sinensis (A. Juss.) Roemer is an endemic species of Toona genus native to Asian area. Its dried leaves are applied in the treatment of many diseases; however, few investigations have been reported for the quantitative analysis and comparison of major bioactive flavonol glycosides in the leaves harvested from various origins. Objective: To quantitatively analyze four major flavonol glycosides including rutinoside, quercetin-3-O-β-D-glucoside, quercetin-3-O-α-L-rhamnoside, and kaempferol-3-O-α-L-rhamnoside in the leaves from different production sites and classify them according to the content of these glycosides. Materials and Methods: A high-performance liquid chromatography-diode array detector (HPLC-DAD) method for their simultaneous determination was developed and validated for linearity, precision, accuracy, stability, and repeatability. Moreover, the method established was then employed to explore the difference in the content of these four glycosides in raw materials. Finally, a hierarchical clustering analysis was performed to classify 11 voucher specimens. Results: The separation was performed on a Waters XBridge Shield RP18 column (150 mm × 4.6 mm, 3.5 μm) kept at 35°C, and acetonitrile and H2O containing 0.30% trifluoroacetic acid as mobile phase was driven at 1.0 mL/min during the analysis. Ten microliters of solution were injected and 254 nm was selected to monitor the separation. A strong linear relationship between the peak area and concentration of four analytes was observed. And, the method was also validated to be repeatable, stable, precise, and accurate. Conclusion: An efficient and reliable HPLC-DAD method was established and applied in the assays for the samples from 11 origins successfully. Moreover, the content of those flavonol glycosides varied much among different batches, and the flavonoids could be considered as biomarkers to control the quality of Chinese Toon. SUMMARY Four major flavonol glycosides in the leaves

  18. Flavonóides em seleções de acerola (Malpighia sp l.. 1- Teor de antocianinas e flavonóis totais Flavonoids in acerola (Malpighia sp L. selections. 1- Anthocyanins and flavonols content

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Arroxelas Galvão de Lima

    2000-12-01

    Full Text Available Os flavonóides englobam classes de pigmentos naturais encontrados com freqüência nos vegetais. As antocianinas e os flavonóis são compostos que pertencem ao grupo dos flavonóides e são responsáveis pela coloração que varia de vermelho vivo à violeta e de branco à amarelo claro, respectivamente. A cor vermelha da acerola é decorrente da presença de antocianinas. Entretanto, a propagaç ão da aceloreira por sementes tem gerado frutos com coloração que varia de amarelo a vermelho púrpura. Dessa forma, há o interesse em difundir plantas com produção de frutos com coloração vermelho. Este trabalho teve como objetivo determinar o teor de antocianinas e flavonóis totais nas seleções de acerola - Barbados, Coopama, Flor Branca, Inada, Miró e Okinawa. Os frutos foram colhidos nos meses de março a junho/1999, com coloração vermelha uniforme, e analisados quanto aos teores de antocianinas e flavonóis totais. As seleções Inada e Barbados apresentaram os mais altos teores desses pigmentos, quando comparados aos das demais seleções, tornando-as agronomicamente interessantes.The flavonoids comprise a class of natural pigments that are frequently found in vegetables. The anthocyanins and flavonols are compounds which belong to the flavonoids group and they are responsible for red to violet and white to light-yellow coloration, respectively. The anthocyanins pigments are responsible for the red colour of the acerola fruit. However, the seed propagation of acerola trees has grown fruits which present colour variation from yellow to dark red. So, there is interest to spread acerola trees with red colour fruits. This paper aimed to determine the content of total anthocyanins and flavonols in selections of acerola - Barbados, Coopama, Flor Branca, Inada, Miró e Okinawa. Fruits were harvested based on homogeneous red colour, between the months of March and June/1999, and analysed with regard to the content of total anthocyanins and

  19. Temporal and spatial regulation of anthocyanin biosynthesis provide diverse flower colour intensities and patterning in Cymbidium orchid.

    Science.gov (United States)

    Wang, Lei; Albert, Nick W; Zhang, Huaibi; Arathoon, Steve; Boase, Murray R; Ngo, Hanh; Schwinn, Kathy E; Davies, Kevin M; Lewis, David H

    2014-11-01

    This study confirmed pigment profiles in different colour groups, isolated key anthocyanin biosynthetic genes and established a basis to examine the regulation of colour patterning in flowers of Cymbidium orchid. Cymbidium orchid (Cymbidium hybrida) has a range of flower colours, often classified into four colour groups; pink, white, yellow and green. In this study, the biochemical and molecular basis for the different colour types was investigated, and genes involved in flavonoid/anthocyanin synthesis were identified and characterised. Pigment analysis across selected cultivars confirmed cyanidin 3-O-rutinoside and peonidin 3-O-rutinoside as the major anthocyanins detected; the flavonols quercetin and kaempferol rutinoside and robinoside were also present in petal tissue. β-carotene was the major carotenoid in the yellow cultivars, whilst pheophytins were the major chlorophyll pigments in the green cultivars. Anthocyanin pigments were important across all eight cultivars because anthocyanin accumulated in the flower labellum, even if not in the other petals/sepals. Genes encoding the flavonoid biosynthetic pathway enzymes chalcone synthase, flavonol synthase, flavonoid 3' hydroxylase (F3'H), dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS) were isolated from petal tissue of a Cymbidium cultivar. Expression of these flavonoid genes was monitored across flower bud development in each cultivar, confirming that DFR and ANS were only expressed in tissues where anthocyanin accumulated. Phylogenetic analysis suggested a cytochrome P450 sequence as that of the Cymbidium F3'H, consistent with the accumulation of di-hydroxylated anthocyanins and flavonols in flower tissue. A separate polyketide synthase, identified as a bibenzyl synthase, was isolated from petal tissue but was not associated with pigment accumulation. Our analyses show the diversity in flower colour of Cymbidium orchid derives not from different individual pigments but from subtle

  20. Regulating the Regulator

    Energy Technology Data Exchange (ETDEWEB)

    1992-08-26

    The article reports on a challenge to the UK electricity regulator to defend his record by the Coalition for Fair Electricity Regulation (COFFER). The challenge centres on whether the obligation for the regional electric companies (REC) to purchase power from the cheapest source is being enforced. This is related to the wider issue of whether the REC's support of combined-cycle gas turbine (CCGT) is economic. COFFER considers that uneconomic gas-fired power plants are being allowed to displace economic coal-fired stations. Aspects discussed include the background to the dispute and the costs of CCGT and coal fired power generation. 1 fig., 1 tab.

  1. Simultaneous Quantification of Flavonol Glycosides, Terpene Lactones, Biflavones, Proanthocyanidins, and Ginkgolic Acids in Ginkgo biloba Leaves from Fruit Cultivars by Ultrahigh-Performance Liquid Chromatography Coupled with Triple Quadrupole Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Xin Yao

    2013-01-01

    Full Text Available On the basis of liquid chromatography coupled with triple quadrupole mass spectrometry working in multiple reaction monitoring mode, an analytical method has been established to simultaneously determine flavonol glycosides, terpene lactones, biflavones, proanthocyanidins, and ginkgolic acids in Ginkgo biloba leaves. Chromatographic separation was carried out on an Acquity BEH C18 column (100 mm × 2.1 mm, 1.7 μm with gradient elution of acetonitrile and 0.10% formic acid (v/v at a flow rate of 0.4 mL/min, and column temperature 30°C. The developed method was validated in terms of linearity, accuracy, precision, stability, and sensitivity. The optimized method was successfully applied to analyze twenty-two G. biloba leaf samples of fruit cultivars collected from different places in China. Furthermore, hierarchical clustering analysis (HCA was performed to evaluate and classify the samples according to the contents of the twenty-four chemical constituents. All of the results demonstrated that the developed method was useful for the overall evaluation of the quality of G. biloba leaves, and this study was also helpful for the comprehensive utilization and development of G. biloba resources.

  2. The onion (Allium cepa L. R2R3-MYB gene MYB1 regulates anthocyanin biosynthesis

    Directory of Open Access Journals (Sweden)

    Kathy Schwinn

    2016-12-01

    Full Text Available Bulb colour is an important consumer trait for onion (Allium cepa L., Allioideae, Asparagales. The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red, flavonols (pale yellow and chalcones (bright yellow. Flavonoid regulation is poorly characterised in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs that commonly activate anthocyanin (SG6, MYB1 or flavonol (SG7, MYB29 production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5. MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressd and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic (A. sativum L. plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum majus of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species.

  3. The Onion (Allium cepa L.) R2R3-MYB Gene MYB1 Regulates Anthocyanin Biosynthesis

    Science.gov (United States)

    Schwinn, Kathy E.; Ngo, Hanh; Kenel, Fernand; Brummell, David A.; Albert, Nick W.; McCallum, John A.; Pither-Joyce, Meeghan; Crowhurst, Ross N.; Eady, Colin; Davies, Kevin M.

    2016-01-01

    Bulb color is an important consumer trait for onion (Allium cepa L., Allioideae, Asparagales). The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red), flavonols (pale yellow), and chalcones (bright yellow). Flavonoid regulation is poorly characterized in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs) that commonly activate anthocyanin (SG6, MYB1) or flavonol (SG7, MYB29) production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5). MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressed and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic (Allium sativum L.) plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum majus of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species. PMID:28018399

  4. The Onion (Allium cepa L.) R2R3-MYB Gene MYB1 Regulates Anthocyanin Biosynthesis.

    Science.gov (United States)

    Schwinn, Kathy E; Ngo, Hanh; Kenel, Fernand; Brummell, David A; Albert, Nick W; McCallum, John A; Pither-Joyce, Meeghan; Crowhurst, Ross N; Eady, Colin; Davies, Kevin M

    2016-01-01

    Bulb color is an important consumer trait for onion ( Allium cepa L., Allioideae, Asparagales). The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red), flavonols (pale yellow), and chalcones (bright yellow). Flavonoid regulation is poorly characterized in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs) that commonly activate anthocyanin (SG6, MYB1) or flavonol (SG7, MYB29) production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5). MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressed and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic ( Allium sativum L.) plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum maju s of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species.

  5. Market, Regulation, Market, Regulation

    DEFF Research Database (Denmark)

    Frankel, Christian; Galland, Jean-Pierre

    2015-01-01

    barriers to trade in Europe, realized the free movement of products by organizing progressively several orders of markets and regulation. Based on historical and institutional documents, on technical publications, and on interviews, this article relates how the European Commission and the Member States had......This paper focuses on the European Regulatory system which was settled both for opening the Single Market for products and ensuring the consumers' safety. It claims that the New Approach and Standardization, and the Global Approach to conformity assessment, which suppressed the last technical...... alternatively recourse to markets and to regulations, at the three main levels of the New Approach Directives implementation. The article focuses also more specifically on the Medical Devices sector, not only because this New Approach sector has long been controversial in Europe, and has recently been concerned...

  6. Light-induced Variation in Phenolic Compounds in Cabernet Sauvignon Grapes (Vitis vinifera L.) Involves Extensive Transcriptome Reprogramming of Biosynthetic Enzymes, Transcription Factors, and Phytohormonal Regulators.

    Science.gov (United States)

    Sun, Run-Ze; Cheng, Guo; Li, Qiang; He, Yan-Nan; Wang, Yu; Lan, Yi-Bin; Li, Si-Yu; Zhu, Yan-Rong; Song, Wen-Feng; Zhang, Xue; Cui, Xiao-Di; Chen, Wu; Wang, Jun

    2017-01-01

    Light environments have long been known to influence grape ( Vitis vinifera L.) berry development and biosynthesis of phenolic compounds, and ultimately affect wine quality. Here, the accumulation and compositional changes of hydroxycinnamic acids (HCAs) and flavonoids, as well as global gene expression were analyzed in Cabernet Sauvignon grape berries under sunlight exposure treatments at different phenological stages. Sunlight exposure did not consistently affect the accumulation of berry skin flavan-3-ol or anthocyanin among different seasons due to climatic variations, but increased HCA content significantly at véraison and harvest, and enhanced flavonol accumulation dramatically with its timing and severity degree trend. As in sunlight exposed berries, a highly significant correlation was observed between the expression of genes coding phenylalanine ammonia-lyase, 4-coumarate: CoA ligase, flavanone 3-hydroxylase and flavonol synthase family members and corresponding metabolite accumulation in the phenolic biosynthesis pathway, which may positively or negatively be regulated by MYB, bHLH, WRKY, AP2/EREBP, C2C2, NAC, and C2H2 transcription factors (TFs). Furthermore, some candidate genes required for auxin, ethylene and abscisic acid signal transductions were also identified which are probably involved in berry development and flavonoid biosynthesis in response to enhanced sunlight irradiation. Taken together, this study provides a valuable overview of the light-induced phenolic metabolism and transcriptome changes, especially the dynamic responses of TFs and signaling components of phytohormones, and contributes to the further understanding of sunlight-responsive phenolic biosynthesis regulation in grape berries.

  7. Light-induced Variation in Phenolic Compounds in Cabernet Sauvignon Grapes (Vitis vinifera L.) Involves Extensive Transcriptome Reprogramming of Biosynthetic Enzymes, Transcription Factors, and Phytohormonal Regulators

    Science.gov (United States)

    Sun, Run-Ze; Cheng, Guo; Li, Qiang; He, Yan-Nan; Wang, Yu; Lan, Yi-Bin; Li, Si-Yu; Zhu, Yan-Rong; Song, Wen-Feng; Zhang, Xue; Cui, Xiao-Di; Chen, Wu; Wang, Jun

    2017-01-01

    Light environments have long been known to influence grape (Vitis vinifera L.) berry development and biosynthesis of phenolic compounds, and ultimately affect wine quality. Here, the accumulation and compositional changes of hydroxycinnamic acids (HCAs) and flavonoids, as well as global gene expression were analyzed in Cabernet Sauvignon grape berries under sunlight exposure treatments at different phenological stages. Sunlight exposure did not consistently affect the accumulation of berry skin flavan-3-ol or anthocyanin among different seasons due to climatic variations, but increased HCA content significantly at véraison and harvest, and enhanced flavonol accumulation dramatically with its timing and severity degree trend. As in sunlight exposed berries, a highly significant correlation was observed between the expression of genes coding phenylalanine ammonia-lyase, 4-coumarate: CoA ligase, flavanone 3-hydroxylase and flavonol synthase family members and corresponding metabolite accumulation in the phenolic biosynthesis pathway, which may positively or negatively be regulated by MYB, bHLH, WRKY, AP2/EREBP, C2C2, NAC, and C2H2 transcription factors (TFs). Furthermore, some candidate genes required for auxin, ethylene and abscisic acid signal transductions were also identified which are probably involved in berry development and flavonoid biosynthesis in response to enhanced sunlight irradiation. Taken together, this study provides a valuable overview of the light-induced phenolic metabolism and transcriptome changes, especially the dynamic responses of TFs and signaling components of phytohormones, and contributes to the further understanding of sunlight-responsive phenolic biosynthesis regulation in grape berries. PMID:28469625

  8. Novel biosensors based on flavonoid-responsive transcriptional regulators introduced into Escherichia coli

    DEFF Research Database (Denmark)

    Siedler, Solvej; Stahlhut, Steen Gustav; Malla, Sailesh

    2014-01-01

    This study describes the construction of two flavonoid biosensors, which can be applied for metabolic engineering of Escherichia coli strains. The biosensors are based on transcriptional regulators combined with autofluorescent proteins. The transcriptional activator FdeR from Herbaspirillum...... and externally added flavonoid concentration. The QdoR-biosensor was successfully applied for detection of kaempferol production in vivo at the single cell level by fluorescence-activated cell sorting. Furthermore, the amount of kaempferol produced highly correlated with the specific fluorescence of E. coli...... cells containing a flavonol synthase from Arabidopsis thaliana (fls1). We expect the designed biosensors to be applied for isolation of genes involved in flavonoid biosynthetic pathways. © 2013 The Authors....

  9. Impact of Flavonols on Cardiometabolic Biomarkers:  A Meta‐Analysis of Randomized Controlled Human  Trials to Explore the Role of Inter‐Individual  Variability

    Directory of Open Access Journals (Sweden)

    Regina Menezes

    2017-02-01

    Full Text Available Several  epidemiological  studies  have  linked  flavonols  with  decreased  risk  of  cardiovascular  disease  (CVD.  However,  some  heterogeneity  in  the  individual  physiological  responses to the consumption of these compounds has been identified. This meta‐analysis aimed to  study the effect of flavonol supplementation on biomarkers of CVD risk such as, blood lipids, blood  pressure and plasma glucose, as well as factors affecting their inter‐individual variability. Data from  18 human randomized controlled trials were pooled and the effect was estimated using fixed or  random effects meta‐analysis model and reported as difference in means (DM. Variability in the  response of blood lipids to supplementation with flavonols was assessed by stratifying various  population subgroups: age, sex, country, and health status. Results showed significant reductions  in total cholesterol (DM = −0.10 mmol/L; 95% CI: −0.20, −0.01, LDL cholesterol (DM = −0.14 mmol/L;  Nutrients 2017, 9, 117  2 of 21  95% CI: −0.21, 0.07, and triacylglycerol (DM = −0.10 mmol/L; 95% CI: −0.18, 0.03, and a significant  increase in HDL cholesterol (DM = 0.05 mmol/L; 95% CI: 0.02, 0.07. A significant reduction was also  observed in fasting plasma glucose (DM = −0.18 mmol/L; 95%CI: −0.29, −0.08, and in blood pressure  (SBP: DM = −4.84 mmHg; 95% CI: −5.64, −4.04; DBP: DM = −3.32 mmHg; 95% CI: -4.09, -2.55.  Subgroup analysis showed a more pronounced effect of flavonol intake in participants from Asian  countries and in participants with diagnosed disease or dyslipidemia, compared to healthy and  normal baseline values. In conclusion, flavonol consumption improved biomarkers of CVD risk,  however, country of

  10. Dihydromyricetin induces mitochondria-mediated apoptosis in HepG2 cells through down-regulation of the Akt/Bad pathway.

    Science.gov (United States)

    Zhang, Zhuangwei; Zhang, Huiqin; Chen, Shiyong; Xu, Yan; Yao, Anjun; Liao, Qi; Han, Liyuan; Zou, Zuquan; Zhang, Xiaohong

    2017-02-01

    The plant flavonol dihydromyricetin (DHM) was reported to induce apoptosis in human hepatocarcinoma HepG2 cells. This study was undertaken to elucidate the underlying molecular mechanism of action of DHM. In the study, DHM down-regulated Akt expression and its phosphorylation at Ser473, up-regulated the levels of mitochondrial proapoptotic proteins Bax and Bad, and inhibited the phosphorylation of Bad at Ser136 and Ser112. It also inhibited the expression of the antiapoptotic protein Bcl-2 and enhanced the cleavage and activation of caspase-3 as well as the degradation of its downstream target poly(ADP-ribose) polymerase. Our results for the first time suggest that DHM-induced apoptosis in HepG2 cells may come about by the inhibition of the Akt/Bad signaling pathway and stimulation of the mitochondrial apoptotic pathway. Dihydromyricetin may be a promising therapeutic medication for hepatocellular carcinoma. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Radiation regulation

    International Nuclear Information System (INIS)

    Braithwaite, J.; Grabosky, P.

    1985-01-01

    The five main areas of radiation regulation considered are radiation exposure in the mining of uranium and other minerals, exposure in the use of uranium in nuclear reactors, risks in the transport of radioactive materials and hazards associated with the disposal of used materials. In Australia these problems are regulated by mines departments, the Australian Atomic Energy Commission and radiation control branches in state health departments. Each of these instutional areas of regulation is examined

  12. Acylated flavonol glycosides from Larix needles

    NARCIS (Netherlands)

    Niemann, Gerard J.

    2006-01-01

    Kaempferol-3-p-coumarylglucoside (KCG) was isolated from ether fractions of acetone-extracted freeze-dried needles of all larch species investigated. In each case, KCG was found as one of the main flavonoids, whereas often a variety of closely related, acylated flavonoids was present in either

  13. Fisetin regulates astrocyte migration and proliferation in vitro

    Science.gov (United States)

    Wang, Nan; Yao, Fang; Li, Ke; Zhang, Lanlan; Yin, Guo; Du, Mingjun; Wu, Bingyi

    2017-01-01

    Fisetin (3,3′,4′,7-tetrahydroxyflavone) is a plant flavonol found in fruits and vegetables that has been reported to inhibit migration and proliferation in several types of cancer. Reactive astrogliosis involves astrocyte migration and proliferation, and contributes to the formation of glial scars in central nervous system (CNS) disorders. However, the effect of fisetin on the migration and proliferation of astrocytes remains unclear. In this study, we found that fisetin inhibited astrocyte migration in a scratch-wound assay and diminished the phosphorylation of focal adhesion kinase (FAK; Tyr576/577 and paxillin (Tyr118). It also suppressed cell proliferation, as indicated by the decreased number of 5-ethynyl-2′-deoxyuridine (EdU)-positive cells, induced cell cycle arrest in the G1 phase, reduced the percentage of cells in the G2 and S phase (as measured by flow cytometry), and decreased cyclin D1 expression, but had no effect on apoptosis. Fisetin also decreased the phosphorylation levels of Akt and extracellular signal-regulated kinase (Erk)1/2, but had no effect on the phosphorylation of p38 mitogen-activated protein kinase (MAPK). These results indicate that fisetin inhibits aggressive cell phenotypes by suppressing cell migration and proliferation via the Akt/Erk signaling pathway. Fisetin may thus have potential for use as a therapeutic strategy targeting reactive astrocytes, which may lead to the inhibition of glial scar formation in vitro. PMID:28204814

  14. Regulative environmental policy. Regulative Umweltpolitik

    Energy Technology Data Exchange (ETDEWEB)

    Goerlitz, A; Voigt, R [Universitaet der Bundeswehr Muenchen, Neubiberg (Germany, F.R.). Fakultaet fuer Sozialwissenschaften; eds.

    1991-01-01

    Regulative policy means those governmental attempts to steer the course of things which can fall back on a certain repertoire of instruments for actions in order to warrant the causal and temporal connection between the making available and the employment of means. The fact that environmental protection needs regulative policy is substantiated by the thesis that the market has failed; consequently only government can manage the public goods 'environment' in a suitable way, and it is a matter of fact that environmental protection at present is operated preferably via regulative policy. The problems of regulative enviromental policy are manifold. Its implementation often miscarries because of limited administrative resources on the one hand - making sufficient control impossible for instance -, and because of poor quality regulative instruments on the other hand. One way out would be to increase the efficiency of regulative policy by sophisticating judicial techniques. Other ways out point to the executing level and aim at improving implementation strategies or are concerned with post-regulative law. The latter refers to a new legal quality which demonstrates itself already in corporatistical crisis regulation or in induction programs such as pollution limits. A final way out favours deregulation strategies which includes the introduction of environmental levies or the allocation of environmental licences. An interdisciplinary discourse is to find out what would happen if these ways were taken. Pointers to solutions from varying scientific disciplines resulting from this discourse are to be found in this volume. (orig./HSCH).

  15. NORM regulations

    Energy Technology Data Exchange (ETDEWEB)

    Gray, P. [ed.

    1997-02-01

    The author reviews the question of regulation for naturally occuring radioactive material (NORM), and the factors that have made this a more prominent concern today. Past practices have been very relaxed, and have often involved very poor records, the involvment of contractors, and the disposition of contaminated equipment back into commercial service. The rationale behind the establishment of regulations is to provide worker protection, to exempt low risk materials, to aid in scrap recycling, to provide direction for remediation and to examine disposal options. The author reviews existing regulations at federal and state levels, impending legislation, and touches on the issue of site remediation and potential liabilities affecting the release of sites contaminated by NORM.

  16. Fisheries regulation

    DEFF Research Database (Denmark)

    Jensen, Frank; Frost, Hans Staby; Abildtrup, Jens

    2017-01-01

    Economists normally claim that a stock externality arises within fisheries because each individual fisherman does not take the effect on stock size into account when making harvest decisions. Due to the stock externality, it is commonly argued that fisheries regulation is necessary, but regulatory...... decisions are complicated by a tremendous amount of uncertainty and asymmetric information. This paper provides an overview of selected parts of the literature on the regulation of fisheries under uncertainty and asymmetric information, and possible areas for future research are identified. Specifically...

  17. French regulations

    International Nuclear Information System (INIS)

    Ballereau, P.

    1998-01-01

    In this issue are given the new French regulations relative to radiation protection of temporary personnel, the licensing to release gaseous and liquid wastes and the licensing granted to thirty two laboratories using beta and gamma decay radioisotopes. (N.C.)

  18. Light-induced Variation in Phenolic Compounds in Cabernet Sauvignon Grapes (Vitis vinifera L. Involves Extensive Transcriptome Reprogramming of Biosynthetic Enzymes, Transcription Factors, and Phytohormonal Regulators

    Directory of Open Access Journals (Sweden)

    Jun Wang

    2017-04-01

    Full Text Available Light environments have long been known to influence grape (Vitis vinifera L. berry development and biosynthesis of phenolic compounds, and ultimately affect wine quality. Here, the accumulation and compositional changes of hydroxycinnamic acids (HCAs and flavonoids, as well as global gene expression were analyzed in Cabernet Sauvignon grape berries under sunlight exposure treatments at different phenological stages. Sunlight exposure did not consistently affect the accumulation of berry skin flavan-3-ol or anthocyanin among different seasons due to climatic variations, but increased HCA content significantly at véraison and harvest, and enhanced flavonol accumulation dramatically with its timing and severity degree trend. As in sunlight exposed berries, a highly significant correlation was observed between the expression of genes coding phenylalanine ammonia-lyase, 4-coumarate: CoA ligase, flavanone 3-hydroxylase and flavonol synthase family members and corresponding metabolite accumulation in the phenolic biosynthesis pathway, which may positively or negatively be regulated by MYB, bHLH, WRKY, AP2/EREBP, C2C2, NAC, and C2H2 transcription factors (TFs. Furthermore, some candidate genes required for auxin, ethylene and abscisic acid signal transductions were also identified which are probably involved in berry development and flavonoid biosynthesis in response to enhanced sunlight irradiation. Taken together, this study provides a valuable overview of the light-induced phenolic metabolism and transcriptome changes, especially the dynamic responses of TFs and signaling components of phytohormones, and contributes to the further understanding of sunlight-responsive phenolic biosynthesis regulation in grape berries.

  19. Regulating Internalities

    OpenAIRE

    Sunstein, Cass Robert; Allcott, Hunt

    2015-01-01

    This paper offers a framework for regulating internalities. Using a simple economic model, we provide four principles for designing and evaluating behaviorally-motivated policy. We then outline rules for determining which contexts reliably reflect true preferences and discuss empirical strategies for measuring internalities. As a case study, we focus on energy efficiency policy, including Corporate Average Fuel Economy (CAFE) standards and appliance and lighting energy efficiency standards.

  20. Transcriptional profiling in human HaCaT keratinocytes in response to kaempferol and identification of potential transcription factors for regulating differential gene expression

    Science.gov (United States)

    Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee

    2008-01-01

    Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059

  1. Fisetin regulates astrocyte migration and proliferation in vitro.

    Science.gov (United States)

    Wang, Nan; Yao, Fang; Li, Ke; Zhang, Lanlan; Yin, Guo; Du, Mingjun; Wu, Bingyi

    2017-04-01

    Fisetin (3,3',4',7-tetrahydroxyflavone) is a plant flavonol found in fruits and vegetables that has been reported to inhibit migration and proliferation in several types of cancer. Reactive astrogliosis involves astrocyte migration and proliferation, and contributes to the formation of glial scars in central nervous system (CNS) disorders. However, the effect of fisetin on the migration and proliferation of astrocytes remains unclear. In this study, we found that fisetin inhibited astrocyte migration in a scratch-wound assay and diminished the phosphorylation of focal adhesion kinase (FAK; Tyr576/577 and paxillin (Tyr118). It also suppressed cell proliferation, as indicated by the decreased number of 5-ethynyl-2'-deoxyuridine (EdU)-positive cells, induced cell cycle arrest in the G1 phase, reduced the percentage of cells in the G2 and S phase (as measured by flow cytometry), and decreased cyclin D1 expression, but had no effect on apoptosis. Fisetin also decreased the phosphorylation levels of Akt and extracellular signal-regulated kinase (Erk)1/2, but had no effect on the phosphorylation of p38 mitogen-activated protein kinase (MAPK). These results indicate that fisetin inhibits aggressive cell phenotypes by suppressing cell migration and proliferation via the Akt/Erk signaling pathway. Fisetin may thus have potential for use as a therapeutic strategy targeting reactive astrocytes, which may lead to the inhibition of glial scar formation in vitro.

  2. A cupin domain-containing protein with a quercetinase activity (VdQase regulates Verticillium dahliae’s pathogenicity and contributes to counteracting host defenses

    Directory of Open Access Journals (Sweden)

    Abdel eElHadrami

    2015-06-01

    Full Text Available We previously identified rutin as part of potato root responses to its pathogen Verticillium dahliae. Rutin was directly toxic to the pathogen at doses greater than 160 μM, a threshold below which many V. dahliae pathogenicity-related genes were up-regulated. We identified and characterized a cupin domain-containing protein (VdQase with a dioxygenase activity and a potential role in V. dahliae-potato interactions. The pathogenicity of VdQase knock-out mutants generated through Agrobacterium tumefasciens-mediated transformation was significantly reduced on susceptible potato cultivar Kennebec compared to wild type isolates. Fluorescence microscopy revealed a higher accumulation of flavonols in the stems of infected potatoes and a higher concentration of rutin in the leaves in response to the VdQase mutants as compared to wild type isolates. This, along with the HPLC characterization of high residual and non-utilized quercetin in presence of the knockout mutants, indicates the involvement of VdQase in the catabolism of quercetin and possibly other flavonols in planta. Quantification of Salicylic and Jasmonic Acids (SA, JA in response to the mutants versus wild type isolates revealed involvement of VdQase in the interference with signaling, suggesting a role in pathogenicity. It is hypothesized that the by-product of dioxygenation 2-protocatechuoylphloroglucinolcarboxylic acid, after dissociating into phloroglucinol and protocatechuoyl moieties, becomes a starting point for benzoic acid and SA, thereby interfering with the JA pathway and affecting the interaction outcome. These events may be key factors for V. dahliae in countering potato defenses and becoming notorious in the rhizosphere.

  3. Structural biology of starch-degrading enzymes and their regulation

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Svensson, Birte

    2016-01-01

    disproportionating enzyme and a self-stabilised conformation of amylose accommodated in the active site of plant α-glucosidase. Important inhibitor complexes include a flavonol glycoside, montbretin A, binding at the active site of human pancreatic α-amylase and barley limit dextrinase inhibitor binding...

  4. Kaempferol ameliorates symptoms of metabolic syndrome by regulating activities of liver X receptor-β.

    Science.gov (United States)

    Hoang, Minh-Hien; Jia, Yaoyao; Mok, Boram; Jun, Hee-jin; Hwang, Kwang-Yeon; Lee, Sung-Joon

    2015-08-01

    Kaempferol is a dietary flavonol previously shown to regulate cellular lipid and glucose metabolism. However, its molecular mechanisms of action and target proteins have remained elusive, probably due to the involvement of multiple proteins. This study investigated the molecular targets of kaempferol. Ligand binding of kaempferol to liver X receptors (LXRs) was quantified by time-resolved fluorescence resonance energy transfer and surface plasmon resonance analyses. Kaempferol directly binds to and induces the transactivation of LXRs, with stronger specificity for the β-subtype (EC50 = 0.33 μM). The oral administration of kaempferol in apolipoprotein-E-deficient mice (150 mg/day/kg body weight) significantly reduced plasma glucose and increased high-density lipoprotein cholesterol levels and insulin sensitivity compared with the vehicle-fed control. Kaempferol also reduced plasma triglyceride concentrations and did not cause liver steatosis, a common side effect of potent LXR activation. In immunoblotting analysis, kaempferol reduced the nuclear accumulation of sterol regulatory element-binding protein-1 (SREBP-1). Our results show that the suppression of SREBP-1 activity and the selectivity for LXR-β over LXR-α by kaempferol contribute to the reductions of plasma and hepatic triglyceride concentrations in mice fed kaempferol. They also suggest that kaempferol activates LXR-β and suppresses SREBP-1 to enhance symptoms in metabolic syndrome. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

    Science.gov (United States)

    Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

    2016-08-19

    Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

  6. Antioxidant capacity changes and phenolic profile of Echinacea purpurea, nettle (Urtica dioica L.), and dandelion (Taraxacum officinale) after application of polyamine and phenolic biosynthesis regulators.

    Science.gov (United States)

    Hudec, Jozef; Burdová, Mária; Kobida, L'ubomír; Komora, Ladislav; Macho, Vendelín; Kogan, Grigorij; Turianica, Ivan; Kochanová, Radka; Lozek, Otto; Habán, Miroslav; Chlebo, Peter

    2007-07-11

    The changes of the antioxidant (AOA) and antiradical activities (ARA) and the total contents of phenolics, anthocyanins, flavonols, and hydroxybenzoic acid in roots and different aerial sections of Echinacea purpurea, nettle, and dandelion, after treatment with ornithine decarboxylase inhibitor, a polyamine inhibitor (O-phosphoethanolamine, KF), and a phenol biosynthesis stimulator (carboxymethyl chitin glucan, CCHG) were analyzed spectrophotometrically; hydroxycinnamic acids content was analyzed by RP-HPLC with UV detection. Both regulators increased the AOA measured as inhibition of peroxidation (IP) in all herb sections, with the exception of Echinacea stems after treatment with KF. In root tissues IP was dramatically elevated mainly after CCHG application: 8.5-fold in Echinacea, 4.14-fold in nettle, and 2.08-fold in dandelion. ARA decrease of Echinacea leaves treated with regulators was in direct relation only with cichoric acid and caftaric acid contents. Both regulators uphold the formation of cinnamic acid conjugates, the most expressive being that of cichoric acid after treatment with CCHG in Echinacea roots from 2.71 to 20.92 mg g(-1). There was a strong relationship between increase of the total phenolics in all sections of Echinacea, as well as in the studied sections of dandelion, and the anthocyanin content.

  7. Competition between bank regulators

    OpenAIRE

    Schindler, Dirk; Eggert, Wolfgang

    2004-01-01

    This paper examines competition between bank regulators in open economies. We use a model where credit demand of firms is endogenous and show any tendency for downward competition in regulation policy is limited by the effect of regulation on profits of nonfinancial firms. Moreover, perfect mobility on loans and deposit markets fully eliminates the incentives of regulators to set bank regulation at ine±cient low levels.

  8. Regulating through leverage: Civil regulation in China

    NARCIS (Netherlands)

    Fürst, K.

    2016-01-01

    The overarching goal of this study is to examine the efforts of Chinese NGOs to prevent and/or control industrial pollution risks and then use the findings of this research to study the nature of civil regulation in, and beyond, China’s authoritarian setting. It first argues that 'regulation through

  9. Atomic Energy Control Regulations

    International Nuclear Information System (INIS)

    1992-01-01

    This is the consolidated text of the Atomic Energy Control Regulations of 17 March 1960, with amendments to 27 August 1992. The Regulations cover the licensing of nuclear facilities, radiation sources, including uranium mining, radiation protection questions, etc. (NEA)

  10. Environmental regulation and competitiveness

    NARCIS (Netherlands)

    Mulatu, A.; Florax, R.J.G.M.; Withagen, C.A.A.M.

    2001-01-01

    The potential relationship between domestic environmental regulation and international competitiveness has evoked various speculations. The common neoclassical train of thought is that strict environmental regulation is detrimental to the competitiveness of industry, and that it induces phenomena

  11. Ocean Dumping Control Regulations

    International Nuclear Information System (INIS)

    1978-01-01

    These Regulations were made further to the Ocean Dumping Control Act which provides for restrictions in dumping operations. The Regulations contain model applications for permits to dump or load a series of materials. (NEA)

  12. Regulation of Genetic Tests

    Science.gov (United States)

    ... for Genomics Research Intellectual Property Issues in Genetics Archive Online Bioethics Resources Privacy in Genomics Regulation of ... are not regulated, meaning that they go to market without any independent analysis to verify the claims ...

  13. Trout Stream Special Regulations

    Data.gov (United States)

    Minnesota Department of Natural Resources — This layer shows Minnesota trout streams that have a special regulation as described in the 2006 Minnesota Fishing Regulations. Road crossings were determined using...

  14. Fisetin regulates astrocyte migration and proliferation in vitro

    OpenAIRE

    Wang, Nan; Yao, Fang; Li, Ke; Zhang, Lanlan; Yin, Guo; Du, Mingjun; Wu, Bingyi

    2017-01-01

    Fisetin (3,3?,4?,7-tetrahydroxyflavone) is a plant flavonol found in fruits and vegetables that has been reported to inhibit migration and proliferation in several types of cancer. Reactive astrogliosis involves astrocyte migration and proliferation, and contributes to the formation of glial scars in central nervous system (CNS) disorders. However, the effect of fisetin on the migration and proliferation of astrocytes remains unclear. In this study, we found that fisetin inhibited astrocyte m...

  15. A R2R3-MYB transcription factor from Epimedium sagittatum regulates the flavonoid biosynthetic pathway.

    Directory of Open Access Journals (Sweden)

    Wenjun Huang

    Full Text Available Herba epimedii (Epimedium, a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. The bioactive components in herba epimedii are mainly prenylated flavonol glycosides, end-products of the flavonoid pathway. Epimedium species are also used as garden plants due to the colorful flowers and leaves. Many R2R3-MYB transcription factors (TFs have been identified to regulate the flavonoid and anthocyanin biosynthetic pathways. However, little is known about the R2R3-MYB TFs involved in regulation of the flavonoid pathway in Epimedium. Here, we reported the isolation and functional characterization of the first R2R3-MYB TF (EsMYBA1 from Epimedium sagittatum (Sieb. Et Zucc. Maxim. Conserved domains and phylogenetic analysis showed that EsMYBA1 belonged to the subgroup 6 clade (anthocyanin-related MYB clade of R2R3-MYB family, which includes Arabidopsis AtPAP1, apple MdMYB10 and legume MtLAP1. EsMYBA1 was preferentially expressed in leaves, especially in red leaves that contain higher content of anthocyanin. Alternative splicing of EsMYBA1 resulted in three transcripts and two of them encoded a MYB-related protein. Yeast two-hybrid and transient luciferase expression assay showed that EsMYBA1 can interact with several bHLH regulators of the flavonoid pathway and activate the promoters of dihydroflavonol 4-reductase (DFR and anthocyanidin synthase (ANS. In both transgenic tobacco and Arabidopsis, overexpression of EsMYBA1 induced strong anthocyanin accumulation in reproductive and/or vegetative tissues via up-regulation of the main flavonoid-related genes. Furthermore, transient expression of EsMYBA1 in E. sagittatum leaves by Agrobacterium infiltration also induced anthocyanin accumulation in the wounded area. This first functional characterization of R2R3-MYB TFs in Epimedium species will promote further studies of the flavonoid biosynthesis and regulation in medicinal plants.

  16. A R2R3-MYB transcription factor from Epimedium sagittatum regulates the flavonoid biosynthetic pathway.

    Science.gov (United States)

    Huang, Wenjun; Sun, Wei; Lv, Haiyan; Luo, Ming; Zeng, Shaohua; Pattanaik, Sitakanta; Yuan, Ling; Wang, Ying

    2013-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. The bioactive components in herba epimedii are mainly prenylated flavonol glycosides, end-products of the flavonoid pathway. Epimedium species are also used as garden plants due to the colorful flowers and leaves. Many R2R3-MYB transcription factors (TFs) have been identified to regulate the flavonoid and anthocyanin biosynthetic pathways. However, little is known about the R2R3-MYB TFs involved in regulation of the flavonoid pathway in Epimedium. Here, we reported the isolation and functional characterization of the first R2R3-MYB TF (EsMYBA1) from Epimedium sagittatum (Sieb. Et Zucc.) Maxim. Conserved domains and phylogenetic analysis showed that EsMYBA1 belonged to the subgroup 6 clade (anthocyanin-related MYB clade) of R2R3-MYB family, which includes Arabidopsis AtPAP1, apple MdMYB10 and legume MtLAP1. EsMYBA1 was preferentially expressed in leaves, especially in red leaves that contain higher content of anthocyanin. Alternative splicing of EsMYBA1 resulted in three transcripts and two of them encoded a MYB-related protein. Yeast two-hybrid and transient luciferase expression assay showed that EsMYBA1 can interact with several bHLH regulators of the flavonoid pathway and activate the promoters of dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS). In both transgenic tobacco and Arabidopsis, overexpression of EsMYBA1 induced strong anthocyanin accumulation in reproductive and/or vegetative tissues via up-regulation of the main flavonoid-related genes. Furthermore, transient expression of EsMYBA1 in E. sagittatum leaves by Agrobacterium infiltration also induced anthocyanin accumulation in the wounded area. This first functional characterization of R2R3-MYB TFs in Epimedium species will promote further studies of the flavonoid biosynthesis and regulation in medicinal plants.

  17. Culture and emotion regulation.

    Science.gov (United States)

    Ford, Brett Q; Mauss, Iris B

    2015-06-01

    While anthropological research has long emphasized cultural differences in whether emotions are viewed as beneficial versus harmful, psychological science has only recently begun to systematically examine those differences and their implications for emotion regulation and well-being. Underscoring the pervasive role of culture in people's emotions, we summarize research that has examined links between culture, emotion regulation, and well-being. Specifically, we focus on two questions. First, how does culture lead individuals to regulate their emotions? And second, how does culture modulate the link between emotion regulation and well-being? We finish by suggesting directions for future research to advance the study of culture and emotion regulation.

  18. Radiation Control Regulation 1993

    International Nuclear Information System (INIS)

    1993-01-01

    This Regulation (No. 434-1993) was made in pursuance of the Radiation Control Act 1990 and replaces the Active Substances Regulations 1959 repealed by the Act. It entered into force on 1 September 1993. The Regulation specifies that the technical radiation protection definitions have the same meaning as in the 1990 recommendations. The Regulation provides for the licensing of persons to use radioactive substances and radiation apparatus. It prescribes activities which may only be carried out by an accredited radiation expert and regulates the use of radiation apparatus and radioactive substances as well as the disposal and transport of radiation apparatus and radioactive substances. (NEA)

  19. Load regulating expansion fixture

    International Nuclear Information System (INIS)

    Wagner, L.M.; Strum, M.J.

    1998-01-01

    A free standing self contained device for bonding ultra thin metallic films, such as 0.001 inch beryllium foils is disclosed. The device will regulate to a predetermined load for solid state bonding when heated to a bonding temperature. The device includes a load regulating feature, whereby the expansion stresses generated for bonding are regulated and self adjusting. The load regulator comprises a pair of friction isolators with a plurality of annealed copper members located there between. The device, with the load regulator, will adjust to and maintain a stress level needed to successfully and economically complete a leak tight bond without damaging thin foils or other delicate components. 1 fig

  20. Volume regulation in epithelia

    DEFF Research Database (Denmark)

    Larsen, Erik Hviid; Hoffmann, Else Kay

    2016-01-01

    to amphibian skin and mammalian cortical collecting tubule of low and intermediate osmotic permeability. Crosstalk between entrance and exit mechanisms interferes with volume regulation both at aniso-osmotic and iso-osmotic volume perturbations. It has been proposed that cell volume regulation is an intrinsic...... regulation are cloned. The volume-regulated anion channel (VRAC) exhibiting specific electrophysiological characteristics seems exclusive to serve cell volume regulation. This is contrary to K+ channels as well as cotransporters and exchange mechanisms that may serve both transepithelial transport and cell...... volume regulation. In the same cell, these functions may be maintained by different ion pathways that are separately regulated. RVD is often preceded by increase in cytosolic free Ca2+, probably via influx through TRP channels, but Ca2+ release from intracellular stores has also been observed. Cell...

  1. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  2. Simultaneous Determination of Flavonols and Terpene Lactones in ...

    African Journals Online (AJOL)

    School of Chinese Materia Medica, Beijing University of Chinese Medicine, Beijing ... were collected following oral administration of four different preparations and the ... disadvantages. ..... biloba leaf extracts to rats via different routes of.

  3. Tomato ( Lycopersicon esculentum ) seeds: new flavonols and cytotoxic effect.

    Science.gov (United States)

    Ferreres, Federico; Taveira, Marcos; Pereira, David M; Valentão, Patrícia; Andrade, Paula B

    2010-03-10

    In this study, seeds of Lycopersicon esculentum Mill. were analyzed by HPLC/UV-PAD/MS(n)-ESI. Fourteen flavonoids were identified, including quercetin, kaempferol, and isorhamnetin derivatives, with 13 of them being reported for the first time in tomato seeds. The major identified compounds were quercetin-3-O-sophoroside, kaempferol-3-O-sophoroside, and isorhamnetin-3-O-sophoroside. A significant cell proliferation inhibition (>80%), against rat basophile leukemia (RBL-2H3) cell line, was observed with this extract (IC(50) = 5980 microg/mL). For acetylcholinesterase inhibitory activity, a concentration-dependent effect was verified (IC(20) = 2400 microg/mL). The same behavior was noted regarding antioxidant capacity, evaluated against DPPH (IC(10) = 284 microg/mL), nitric oxide (IC(25) = 396 microg/L), and superoxide radicals (IC(25) = 3 microg/mL).

  4. Two oxidation pathways of bioactive flavonol rhamnazin under ambient conditions

    Czech Academy of Sciences Publication Activity Database

    Ramešová, Šárka; Degano, I.; Sokolová, Romana

    2014-01-01

    Roč. 133, JUL 2014 (2014), s. 359-363 ISSN 0013-4686 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR M200401201 Program:M Institutional support: RVO:61388955 Keywords : oxidation * flavonoids * rhamnazin Subject RIV: CG - Electrochemistry Impact factor: 4.504, year: 2014

  5. Clinical benefit and preservation of flavonols in dark chocolate manufacturing.

    Science.gov (United States)

    McShea, Andrew; Ramiro-Puig, Emma; Munro, Sandra B; Casadesus, Gemma; Castell, Margarida; Smith, Mark A

    2008-11-01

    The consumption of high-cacao-content chocolate has been associated with positive health benefits ascribed to flavanol [corrected] antioxidants derived from the ground, fermented cocoa seeds of Theobroma cacao. However, flavanols [corrected] impart a bitter, astringent flavor to foodstuffs, frequently masked in chocolates and confections by aggressive processing and adulteration with other flavors. Recent reports have implied that not all varieties of dark chocolate are created equally, and significant caveats exist regarding its potential health benefits. It is perhaps not surprising that extensive processing, dilution, and the addition of flavor modifiers may improve the palatability of chocolate, but could have negative nutritional and clinical benefits. This article examines the chemical composition of chocolate and the clinical data associated with the consumption of flavonoid-rich cocoa. We review the steps in chocolate manufacturing that directly affect the antioxidant levels in chocolate products, and the caveats associated with claims of health benefits from the consumption of dark chocolate.

  6. Simultaneous Determination of Flavonols and Terpene Lactones in ...

    African Journals Online (AJOL)

    Lactones in Beagle Dog Plasma by Ultra-Performance ... School of Chinese Materia Medica, Beijing University of Chinese Medicine, Beijing 100102, ... Matrix effect derived from QC samples was in the range of 85.09 – 113.14 %. ..... with the suitable weighting factor of 1/x. .... pharmacokinetic studies of G. biloba and its.

  7. Simultaneous Determination of Flavonols and Terpene Lactones in ...

    African Journals Online (AJOL)

    Lactones in Beagle Dog Plasma by Ultra-Performance ... School of Chinese Materia Medica, Beijing University of Chinese Medicine, Beijing 100102, China ... Purpose: To evaluate the pharmacokinetics of the major compounds in Ginkgo leaf dosage ... pharmacological effect. .... conversion factor was calculated as in Eq 1.

  8. A flavonol present in cocoa [(-)epicatechin] enhances snail memory.

    Science.gov (United States)

    Fruson, Lee; Dalesman, Sarah; Lukowiak, Ken

    2012-10-15

    Dietary consumption of flavonoids (plant phytochemicals) may improve memory and neuro-cognitive performance, though the mechanism is poorly understood. Previous work has assessed cognitive effects in vertebrates; here we assess the suitability of Lymnaea stagnalis as an invertebrate model to elucidate the effects of flavonoids on cognition. (-)Epicatechin (epi) is a flavonoid present in cocoa, green tea and red wine. We studied its effects on basic snail behaviours (aerial respiration and locomotion), long-term memory (LTM) formation and memory extinction of operantly conditioned aerial respiratory behaviour. We found no significant effect of epi exposure (15 mg l(-1)) on either locomotion or aerial respiration. However, when snails were operantly conditioned in epi for a single 0.5 h training session, which typically results in memory lasting ~3 h, they formed LTM lasting at least 24 h. Snails exposed to epi also showed significantly increased resistance to extinction, consistent with the hypothesis that epi induces a more persistent LTM. Thus training in epi facilitates LTM formation and results in a more persistent and stronger memory. Previous work has indicated that memory-enhancing stressors (predator kairomones and KCl) act via sensory input from the osphradium and are dependent on a serotonergic (5-HT) signalling pathway. Here we found that the effects of epi on LTM were independent of osphradial input and 5-HT, demonstrating that an alternative mechanism of memory enhancement exists in L. stagnalis. Our data are consistent with the notion that dietary sources of epi can improve cognitive abilities, and that L. stagnalis is a suitable model with which to elucidate neuronal mechanisms.

  9. Two oxidation pathways of bioactive flavonol rhamnazin under ambient conditions

    International Nuclear Information System (INIS)

    Ramešová, Šárka; Degano, Ilaria; Sokolová, Romana

    2014-01-01

    Graphical abstract: - Highlights: • The oxidation mechanism of rhamnazin has not been solved yet. • Rhamnazin decomposes in solution during minutes handled in the presence of air. • The main oxidation product of rhamnazin was identified even if it is not stable. • Two parallel oxidation mechanisms of rhamnazin in air were determined. - Abstract: Two pathways of the oxidation mechanism of rhamnazin under ambient conditions are proposed. The redox potential of rhamnazin strongly depends on the presence of dissociation forms in solution. In situ spectroelectrochemistry and identification of degradation products by HPLC-DAD and HPLC–ESI-MS/MS confirmed the presence of fast subsequent chemical reactions following the electron transfer. As demonstrated, strict anaerobic conditions have to be preserved in studies of antioxidant properties and of its pharmacological efficiency. In the absence of oxygen, 2,4-dihydroxy-2-(4′-hydroxy-3′-methoxybenzoyl) -6-methoxy-benzofuran-3(2H)-one was identified as the only oxidation product

  10. Simultaneous Determination of Flavonols and Terpene Lactones in ...

    African Journals Online (AJOL)

    Plasma samples were collected following oral administration of four different preparations and the effective ingredients, namely, kaempferol, quercetin, isorhamnetin, ginkgolides A, ginkgolides B, ginkgolides C and bilobalide were detected by a validated ultra-performance liquid chromatography-tandem mass spectrometry ...

  11. Simultaneous Determination of Flavonols and Terpene Lactones in ...

    African Journals Online (AJOL)

    Purpose: To develop an ultra-performance liquid chromatography-tandem mass spectrometry (UPLCMS/MS) method for the simultaneous determination of 7 major components of Ginkgo leaf (kaempferol, quercetin, isorhamnetin, ginkgolides A, ginkgolides B, ginkgolides C and bilobalide) in dog plasma. Methods: Beagle ...

  12. Three flavonol glycosides from Ricinus communis | Aqil | Bulletin of ...

    African Journals Online (AJOL)

    The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more information about how to print, save, and work with PDFs, Highwire Press provides a helpful Frequently Asked Questions about PDFs.

  13. TOWARD MORE EFFECTIVE REGULATION

    Energy Technology Data Exchange (ETDEWEB)

    J. GRAF

    2000-06-01

    This paper proposes a model relationship between the operator engaged in a hazardous activity, the regulator of that activity, and the general public. The roles and responsibilities of each entity are described in a way that allows effective communication flow. The role of the regulator is developed using the steam boiler as an example of a hazard subject to regulation; however, the model applies to any regulated activity. In this model the safety analyst has the extremely important role of communicating sometimes difficult technical information to the regulator in a way that the regulator can provide credible assurance to the general public as to the adequacy of the control of the hazardous activity. The conclusion asserts that acceptance of the model, understanding of the roles and responsibilities and definition of who communicates what information to whom will mitigate frustration on the part of each of the three entities.

  14. The development of regulations

    International Nuclear Information System (INIS)

    Slokan Dusic, D.; Levstek, M.F.; Stritar, A.

    2003-01-01

    In October 2002, The Act on Protection Against Ionising Radiation and Nuclear Safety which regulates all aspects of protection against ionising radiation and nuclear safety entered into force in Slovenia. The Slovenian government and its responsible ministries shall issue several governmental and ministerial regulations to support the above - mentioned act. The Slovenian Nuclear Safety Administration (SNSA) which acts within the Ministry of the Environment, Spatial Planing and Energy takes an active part in drafting the regulations which are defined in the act. Due to a very comprehensive and pretentious task, that is to be completed in a relatively short period of time, taking into consideration the involvement of stakeholders and all competent ministries, the SNSA within the Quality Management System developed a special procedure that insures the systematic approach to the preparation of regulations. The article will briefly represent the process that: defines the preparation, development, harmonisation, review, approval and issue of regulations and uniforms the format of developed regulations. (author)

  15. Regulating hedge funds.

    OpenAIRE

    Daníelsson, J.; Zigrand, JP.

    2007-01-01

    Due to the ever-increasing amounts under management and their unregulated and opaque nature, hedge funds have emerged as a key concern for policymakers. While until now, hedge funds have been left essentially unregulated, we are seeing increasing calls for regulation for both microprudential and macroprudential reasons. In our view, most calls for the regulation of hedge funds are based on a misperception of the effectiveness of financial regulations, perhaps coupled with a lack of understand...

  16. Regulating household financial advice

    Directory of Open Access Journals (Sweden)

    Benjamin F. Cummings

    2012-08-01

    Full Text Available This paper reviews economic theory related to investment advice. This theory explains 1 why financial advisors need to be carefully regulated for the benefit of both the investment advice industry and for consumers, 2 why principles-based regulation (e.g., a fiduciary standard is more efficient than rules-based regulation, 3 why dual regulation of financial professionals providing investment or insurance advice is inefficient and inequitable policy, and 4 why the application of a universal and uniform fiduciary standard will be difficult to implement.

  17. The regulation of hunting

    DEFF Research Database (Denmark)

    Abildtrup, Jens; Jensen, Frank

    Within hunting, wildlife populations are estimated to be too high in many countries which is assumed to be due to the market failure, that each hunter harvests too little compared to what the regulator wants. This may be due to the existing regulation which, among other things, requires knowledge...... by an individual, variable tax rate. The variable tax rate is, among other things, based on the difference in marginal value of the population between the hunter and the regulator. The paper shows that the population tax/subsidy secures a first-best optimum. Thus, the population tax is a good alternative...... to the existing regulation....

  18. Nuclear safety and regulation

    International Nuclear Information System (INIS)

    Kim, Hho Jung

    2000-03-01

    This book contains 12 chapters, which are atom and radiation, nuclear reactor and kinds of nuclear power plant, safeguard actuation system and stability evaluation for rock foundation of nuclear power plant, nuclear safety and principle, safety analysis and classification of incident, probabilistic safety assessment and major incident, nuclear safety regulation, system of nuclear safety regulation, main function and subject of safety regulation in nuclear facilities, regulation of fuel cycle and a nuclear dump site, protection of radiation and, safety supervision and, safety supervision and measurement of environmental radioactivity.

  19. Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

    Science.gov (United States)

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation

  20. Exogenous Melatonin Application Delays Senescence of Kiwifruit Leaves by Regulating the Antioxidant Capacity and Biosynthesis of Flavonoids

    Directory of Open Access Journals (Sweden)

    Dong Liang

    2018-04-01

    Full Text Available Melatonin, a multiple signal molecule, plays important roles in delaying senescence during the development of plants. Because few species have been studied for the effect of exogenous melatonin on anti-aging, the plausible mechanism of melatonin of anti-aging effects on other plant species has remained largely unknown. In the present study, the effects of exogenous melatonin on leaf senescence in kiwifruit were examined during natural aging after melatonin (200 μM or water (Control pretreatment. The decreased membrane damage and lower hydrogen peroxide (H2O2 content due to the enhanced scavenging activity of antioxidant enzymes peroxidase (POD, superoxide dismutase (SOD, and catalase (CAT demonstrated that melatonin effectively delayed the aging of kiwifruit leaves. Likewise, owing to up-regulated expression of chlorophyll a/b-binding protein (CAB gene in the sampled leaves pretreated with melatonin, chlorophyll degradation decreased. Therefore, osmoregulatory substances in sampled leaves accumulated (e.g., soluble sugar and soluble protein and seedling cell environment stability was maintained. Simultaneously, melatonin decreased H2O2 concentration owing to increased glutathione (GSH and ascorbate (AsA content, and the expression levels of glutathione reductase (GR, ascorbate peroxidase (APX, monodehydroascorbate reductase (MDAR, dehydroascorbate reductase (DHAR were up-regulated by melatonin application, indicating that the increase of GSH and AsA was attributed to the expression of these genes. In addition, a large amount of flavonoids accumulated in seedlings pretreated with melatonin, and transcript levels of eight genes involved in flavonoid synthesis, including phenylalanine ammonia-lyase (PAL, cinnamate-4-hydroxymate (C4H, chalcone synthase (CHS, flavanone 3-hydroxylase (F3H, flavonol synthase (FNS, leucoanthocyanin reductase (LAR, anthocyanin reductase (ANR, flavonoid 3-O-glucosyltransferase (UFGT were enhanced in response to melatonin

  1. Peak regulation right

    International Nuclear Information System (INIS)

    Gao, Z. |; Ren, Z.; Li, Z.; Zhu, R.

    2005-01-01

    A peak regulation right concept and corresponding transaction mechanism for an electricity market was presented. The market was based on a power pool and independent system operator (ISO) model. Peak regulation right (PRR) was defined as a downward regulation capacity purchase option which allowed PRR owners to buy certain quantities of peak regulation capacity (PRC) at a specific price during a specified period from suppliers. The PRR owner also had the right to decide whether or not they would buy PRC from suppliers. It was the power pool's responsibility to provide competitive and fair peak regulation trading markets to participants. The introduction of PRR allowed for unit capacity regulation. The PRR and PRC were rated by the supplier, and transactions proceeded through a bidding process. PRR suppliers obtained profits by selling PRR and PRC, and obtained downward regulation fees regardless of whether purchases are made. It was concluded that the peak regulation mechanism reduced the total cost of the generating system and increased the social surplus. 6 refs., 1 tab., 3 figs

  2. Soft Regulators, though judges

    NARCIS (Netherlands)

    de Geest, G.G.A.; Dari Mattiacci, G.

    Judges have a tendency to be more demanding than regulators. In the United States, a majority of the courts has adopted the rule that the unexcused violation of a statutory standard is negligence per se. However, the converse does not hold: compliance with regulation does not relieve the injurer of

  3. Mortgage market regulation: Europe

    NARCIS (Netherlands)

    Aalbers, M.B.; Smith, S.J.

    2012-01-01

    Despite several European Union (EU) initiatives, there is only limited pan-European mortgage market regulation. The EU strategy can be characterised as one of parallel liberalisation and consolidation. This article highlights the key differences in regulation among European mortgage markets.

  4. Regulation as Rhetoric

    DEFF Research Database (Denmark)

    Boll, Karen; Györy, Csaba

    This paper analyses the way regulatory agencies strategically use public ‘rhetoric’ and ‘management of appearance’ to strengthen their regulation. It reports a comparative study of the Securities and Exchange Commission (SEC) which is the US federal securities regulator and the Danish Tax...... and Customs Administration (SKAT) which is the national tax regulator in Denmark. SEC operates in a US context where the agency fights to get trust, while SKAT operates in a context where high trust in public agencies is a basic condition. We argue, however, that despite the radically different institutional...... engage reflectively in image promotion which serves two purposes: establishing and maintaining legitimacy in a particular social and political environment and producing compliance. Further, we argue that this regulation is a form of ‘post-bureaucratic’ regulation in which compliance is achieved...

  5. Reconceptualizing Civil Regulation

    DEFF Research Database (Denmark)

    Galang, Roberto Martin; Castello, Itziar

    2011-01-01

    This article re-conceptualizes the notion of civil regulation, through an analysis of 775 projects by firms located in 21 Asian countries, wherein we map the state of civil regulation initiatives in the region. We challenge two established assumptions in the Corporate Social Responsibility litera....... Finally, we argue that, in Asia, governments act as a structuration mechanism which challenges the current understanding of CSR.......This article re-conceptualizes the notion of civil regulation, through an analysis of 775 projects by firms located in 21 Asian countries, wherein we map the state of civil regulation initiatives in the region. We challenge two established assumptions in the Corporate Social Responsibility...... and environmental standards; but also that local, small and medium companies play a key role in the development of Asian civil regulation. We call this second finding the “CSR importation trap”. Our findings are supported by evidence on the limitations in the interchangeable properties of business and governments...

  6. Risk-informed regulation

    International Nuclear Information System (INIS)

    Hoffman, D.R.

    2003-01-01

    In assessing safety for nuclear facilities, regulators have traditionally used a deterministic approach. New techniques for assessing nuclear or radiological risks make it possible for regulators to incorporate risk insights into their regulations. By 'risk-informing' the regulatory processes, independent bodies tasked with protecting the health and safety of the public can focus on those design and operational issues most important to safety. Such an approach is a move away from prescriptive regulations that were based on conservative engineering judgments toward regulations focused on issues that contribute significantly to safety. Despite the availability of probabilistic risk assessment (PRA) tools, organisations often struggle with how to best use this capability. Most international regulations are still based largely on deterministic analyses that were developed without the benefit of quantitative or measurable estimates of risk. PRA considers issues of risk in a more comprehensive manner by examining a wider spectrum of initiating events and their frequency, and considers the likelihood of events in a rigorous and comprehensive manner. In some countries, nuclear regulators are actively moving toward increasing the use of risk insights in a variety of strategic arenas, including risk-informed technical specifications (operating limits and conditions), in-service inspection and testing, programs, and assessment and enforcement actions. A risk-informed approach enhances the traditional deterministic approach by explicitly considering a broader range of safety challenges, focusing resources on the basis of risk significance, considering a broader range of counter measures to mitigate challenges, and explicitly identifying and quantifying uncertainties in analyses. (author)

  7. Epigenetic Regulation of Adipokines

    Directory of Open Access Journals (Sweden)

    Tho X. Pham

    2017-08-01

    Full Text Available Adipose tissue expansion in obesity leads to changes in the expression of adipokines, adipocyte-specific hormones that can regulate whole body energy metabolism. Epigenetic regulation of gene expression is a mechanism by which cells can alter gene expression through the modifications of DNA and histones. Epigenetic mechanisms, such as DNA methylation and histone modifications, are intimately tied to energy metabolism due to their dependence on metabolic intermediates such as S-adenosylmethionine and acetyl-CoA. Altered expression of adipokines in obesity may be due to epigenetic changes. The goal of this review is to highlight current knowledge of epigenetic regulation of adipokines.

  8. The power of regulation

    International Nuclear Information System (INIS)

    Lewis, M.G.

    1995-01-01

    Slides accompanying a presentation at The Power of Change Conference in Vancouver, BC in April 1995 about regulations affecting the power industry were presented. Issues addressed included customer choice, incentive regulation changes (price-caps, revenue sharing and pricing flexibility), the reactions of Canadian industry to regulatory changes, and anticipated reactions of the financial markets to changes in regulations. The potential effects of competition and changes that will create competition were discussed. The level of readiness of Canadian financial, ownership and regulatory bodies was discussed. The needs and expectations of investors from a new regulatory regime were quesstimated. Possible alternatives to the present regulatory framework were suggested

  9. Electrical installations and regulations

    CERN Document Server

    Whitfield, J F

    1966-01-01

    Electrical Installations and Regulations focuses on the regulations that apply to electrical installations and the reasons for them. Topics covered range from electrical science to alternating and direct current supplies, as well as equipment for providing protection against excess current. Cables, wiring systems, and final subcircuits are also considered, along with earthing, discharge lighting, and testing and inspection.Comprised of 12 chapters, this book begins with an overview of electrical installation work, traits of a good electrician, and the regulations governing installations. The r

  10. Legislation and regulation

    International Nuclear Information System (INIS)

    1998-01-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 3 of the document contains some details about the Brazilian legislation and regulation, the nuclear and environmental licensing, and emergency preparedness legislation

  11. Benchmarking and Regulation

    DEFF Research Database (Denmark)

    Agrell, Per J.; Bogetoft, Peter

    . The application of benchmarking in regulation, however, requires specific steps in terms of data validation, model specification and outlier detection that are not systematically documented in open publications, leading to discussions about regulatory stability and economic feasibility of these techniques...

  12. Legislation and regulation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-09-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 3 of the document contains some details about the Brazilian legislation and regulation, the nuclear and environmental licensing, and emergency preparedness legislation.

  13. The regulation of appetite

    OpenAIRE

    Druce, M; Bloom, S R

    2006-01-01

    The worsening global obesity epidemic, particularly the increase in childhood obesity, has prompted research into the mechanisms of appetite regulation. Complex pathways modulate energy balance, involving appetite centres in the hypothalamus and brain stem, and hormonal signals of energy status released by the gut and by the periphery. Better understanding of appetite regulation improves understanding of the aetiology of obesity. Manipulation of this homoeostatic system offers potentially use...

  14. Corruption, Institutions and Regulation

    OpenAIRE

    Michael Breen; Robert Gillanders

    2011-01-01

    We analyze the effects of corruption and institutional quality on the quality of business regulation. Our key findings indicate that corruption negatively aspects the quality of regulation and that general institutional quality is insignificant once corruption is controlled for. These findings hold over a number of specifications which include additional exogenous historical and geographic controls. The findings imply that policy-makers should focus on curbing corruption to improve regulat...

  15. Regulating deregulated energy markets

    International Nuclear Information System (INIS)

    Jackson, M.

    2002-01-01

    The North American gas and electricity markets are fast evolving, and regulators are currently faced with a host of issues such as market-based rates, unbundling, stranded costs, open access, and incentive regulation are surfacing as a result of deregulation. The regulatory environment in Ontario was reviewed by the author. Deregulated markets rule, from commodities to gas and electricity. Additionally, there is an evolution of traditional utility regulation. A look at deregulated markets revealed that there are regulations on boundary conditions on the deregulated market. Under the Ontario Energy Board (OEB), all generators, transmitters, distributors, and retailers of electricity must be licensed. The standard supply service (SSS) offered by electricity distributors and system gas which is still being sold by natural gas distributors continues to be regulated by OEB. One issue that was addressed was separation for revenues and costs of the utility's purchase and sale of gas business, at least for accounting purposes. The next issue discussed was cost of system gas and SSS, followed by timely signals and prudent incurred costs. Historical benefits were reviewed, such as historical commitments to low-cost electricity. Pooling transportation costs, transmission pricing continued, market-based rates, unbundling, stranded costs, open access, incentive regulation/ performance based regulation (PBR) were all discussed. Price cap on PBR, both partial and comprehensive were looked at. A requirement to review guidelines on cost of capital and an application to extend blanket approval provisions for gas storage were discussed, as they are amongst some of the challenges of the future. Other challenges include revised rules and practice and procedure; practice directions for cost awards, appeals, and other functions; confidentiality guidelines; and refinements to the role of and approaches to alternative dispute resolution. The future role of regulators was examined in light

  16. Interpersonal emotion regulation.

    Science.gov (United States)

    Zaki, Jamil; Williams, W Craig

    2013-10-01

    Contemporary emotion regulation research emphasizes intrapersonal processes such as cognitive reappraisal and expressive suppression, but people experiencing affect commonly choose not to go it alone. Instead, individuals often turn to others for help in shaping their affective lives. How and under what circumstances does such interpersonal regulation modulate emotional experience? Although scientists have examined allied phenomena such as social sharing, empathy, social support, and prosocial behavior for decades, there have been surprisingly few attempts to integrate these data into a single conceptual framework of interpersonal regulation. Here we propose such a framework. We first map a "space" differentiating classes of interpersonal regulation according to whether an individual uses an interpersonal regulatory episode to alter their own or another person's emotion. We then identify 2 types of processes--response-dependent and response-independent--that could support interpersonal regulation. This framework classifies an array of processes through which interpersonal contact fulfills regulatory goals. More broadly, it organizes diffuse, heretofore independent data on "pieces" of interpersonal regulation, and identifies growth points for this young and exciting research domain.

  17. Federal Aviation Regulations - National Aviation Regulations of Russia

    Science.gov (United States)

    Chernykh, O.; Bakiiev, M.

    2018-03-01

    Chinese Aerospace Engineering is currently developing cooperation with Russia on a wide-body airplane project that has directed the work towards better understanding of Russian airworthiness management system. The paper introduces national Aviation regulations of Russia, presents a comparison of them with worldwide recognized regulations, and highlights typical differences. They have been found to be: two general types of regulations used in Russia (Aviation Regulations and Federal Aviation Regulations), non-unified structure of regulations on Aircraft Operation management, various separate agencies responsible for regulation issuance instead of one national aviation authority, typical confusions in references. The paper also gives a list of effective Russian Regulations of both types.

  18. Nuclear regulation in transition

    International Nuclear Information System (INIS)

    Tomain, J.P.

    1986-01-01

    The current state of nuclear regulations in the USA is examined. Since Three Mile Island the regulation of the nuclear power industry has been undergoing a noticeable transition. It will be argued here that the transition is characterized by two indicia. First, the primary focus of state and federal regulators has been on the financial aspects of the industry: this is best seen in the context of decisions allocating the costs of nuclear plant cancellations. Second, decisionmaking power has been decentralized: although the regulatory history of nuclear power demonstrates the tradition of centralized decisionmaking power (i.e., formerly the primary decisionmaking body was the Atomic Energy Commission), now States share decisionmaking power with the Nuclear Regulatory Commission. In Section 1 a brief legislative history of nuclear regulation is presented to establish the assertion that nuclear regulation, both de jure and de facto, was centralized. Next, Section 2 canvasses recent United States Supreme Court opinions regarding nuclear regulation. The Court frequently acts as policymaker through the consequences of its opinions, if not by its intent. In the area of nuclear policymaking, the Court has paid allegiance recently both to the tradition of centralization and to the movement toward decentralization. This dualism is reflected in other federal court decisions as well which will be briefly mentioned. Continuing the analysis of Federal regulation, Section 3 examines the current reform efforts of the NRC. Section 4 presents an examination of State responses to nuclear plant cancellations. In this section, State administrative agency and court decisions will be examined and recent State legislation will be discussed. (author)

  19. Nuclear regulation in transition

    Energy Technology Data Exchange (ETDEWEB)

    Tomain, J.P. (Cincinnati Univ., OH, US. Coll. of Law)

    1986-01-01

    The current state of nuclear regulations in the USA is examined. Since Three Mile Island the regulation of the nuclear power industry has been undergoing a noticeable transition. It will be argued here that the transition is characterized by two indicia. First, the primary focus of state and federal regulators has been on the financial aspects of the industry: this is best seen in the context of decisions allocating the costs of nuclear plant cancellations. Second, decisionmaking power has been decentralized: although the regulatory history of nuclear power demonstrates the tradition of centralized decisionmaking power (i.e., formerly the primary decisionmaking body was the Atomic Energy Commission), now States share decisionmaking power with the Nuclear Regulatory Commission. In Section 1 a brief legislative history of nuclear regulation is presented to establish the assertion that nuclear regulation, both de jure and de facto, was centralized. Next, Section 2 canvasses recent United States Supreme Court opinions regarding nuclear regulation. The Court frequently acts as policymaker through the consequences of its opinions, if not by its intent. In the area of nuclear policymaking, the Court has paid allegiance recently both to the tradition of centralization and to the movement toward decentralization. This dualism is reflected in other federal court decisions as well which will be briefly mentioned. Continuing the analysis of Federal regulation, Section 3 examines the current reform efforts of the NRC. Section 4 presents an examination of State responses to nuclear plant cancellations. In this section, State administrative agency and court decisions will be examined and recent State legislation will be discussed.

  20. To regulate or not to regulate?

    Energy Technology Data Exchange (ETDEWEB)

    Mason, G.; Wrixon, A. [IAEA, Vienna (Austria)

    2006-07-01

    Full text of publication follows: In Hamlet famous soliloquy to be or not to be, he wrestles with the perennial human problem of choosing the right course of action in difficult circumstances. In recent years, we have witnessed a cast of thousands playing out a long-running scene that seems to echo Hamlet dilemma on a rather more prosaic level. When is it necessary to apply regulations to the control of exposure to ionizing radiation and when is regulatory control not warranted? This seemingly straightforward question has brought out the philosopher, ethician, lawyer, pragmatist, orator in simple radiation protection folk and has led to passionate debate on numerous occasions. This paper attempts an answer based on a review of recent developments. For deciding when to apply regulatory controls, several concepts have evolved over time, including exemption of practices and sources, exclusion of exposures and clearance of materials. These have different origins, purposes and characteristics. Exemption and clearance have often been associated with triviality of risk, while exclusion has been related to un-amenability of control. For each concept, criteria have been developed to assist the regulator in reaching a decision, but there has much disputation over numerical values. This paper briefly reviews and analyses recent developments and attempts to clarify the problem from first principles. The conclusion is that the underlying issue in each case is to determine when regulatory controls become unwarranted: that is, when the societal resources expended in applying them and complying with them would be disproportionate to any benefit they might bring. This is a natural extension of the principle of optimization of protection to the regulatory control of protection, in the context of exposure to radiation at very low levels. It also reflects common expectations of good governance: wise management of finite societal resources and avoidance of unwarranted controls on

  1. To regulate or not to regulate?

    International Nuclear Information System (INIS)

    Mason, G.; Wrixon, A.

    2006-01-01

    Full text of publication follows: In Hamlet famous soliloquy to be or not to be, he wrestles with the perennial human problem of choosing the right course of action in difficult circumstances. In recent years, we have witnessed a cast of thousands playing out a long-running scene that seems to echo Hamlet dilemma on a rather more prosaic level. When is it necessary to apply regulations to the control of exposure to ionizing radiation and when is regulatory control not warranted? This seemingly straightforward question has brought out the philosopher, ethician, lawyer, pragmatist, orator in simple radiation protection folk and has led to passionate debate on numerous occasions. This paper attempts an answer based on a review of recent developments. For deciding when to apply regulatory controls, several concepts have evolved over time, including exemption of practices and sources, exclusion of exposures and clearance of materials. These have different origins, purposes and characteristics. Exemption and clearance have often been associated with triviality of risk, while exclusion has been related to un-amenability of control. For each concept, criteria have been developed to assist the regulator in reaching a decision, but there has much disputation over numerical values. This paper briefly reviews and analyses recent developments and attempts to clarify the problem from first principles. The conclusion is that the underlying issue in each case is to determine when regulatory controls become unwarranted: that is, when the societal resources expended in applying them and complying with them would be disproportionate to any benefit they might bring. This is a natural extension of the principle of optimization of protection to the regulatory control of protection, in the context of exposure to radiation at very low levels. It also reflects common expectations of good governance: wise management of finite societal resources and avoidance of unwarranted controls on

  2. Staff rules and regulations

    CERN Multimedia

    HR Department

    2007-01-01

    The 11th edition of the Staff Rules and Regulations, dated 1 January 2007, adopted by the Council and the Finance Committee in December 2006, is currently being distributed to departmental secretariats. The Staff Rules and Regulations, together with a summary of the main modifications made, will be available, as from next week, on the Human Resources Department's intranet site: http://cern.ch/hr-web/internal/admin_services/rules/default.asp The main changes made to the Staff Rules and Regulations stem from the five-yearly review of employment conditions of members of the personnel. The changes notably relate to: the categories of members of the personnel (e.g. removal of the local staff category); the careers structure and the merit recognition system; the non-residence, installation and re-installation allowances; the definition of family, family allowances and family-related leave; recognition of partnerships; education fees. The administrative circulars, some of which are being revised following the ...

  3. Deciphering Transcriptional Regulation

    DEFF Research Database (Denmark)

    Valen, Eivind

    The myriad of cells in the human body are all made from the same blueprint: the human genome. At the heart of this diversity lies the concept of gene regulation, the process in which it is decided which genes are used where and when. Genes do not function as on/off buttons, but more like a volume...... mostly near the start of the gene known as the promoter. This region contains patterns scattered in the DNA that the TFs can recognize and bind to. Such binding can prompt the assembly of the pre-initiation complex which ultimately leads to transcription of the gene. In order to achieve the regulation...... on what characterizes a hippocampus promoter. Pairing CAGE with TF binding site prediction we identi¿ed a likely key regulator of hippocampus. Finally, we developed a method for CAGE exploration. While the DeepCAGE library characterized a full 1.4 million transcription initiation events it did not capture...

  4. Radiation emitting devices regulations

    International Nuclear Information System (INIS)

    1970-01-01

    The Radiation Emitting Devices Regulations are the regulations referred to in the Radiation Emitting Devices Act and relate to the operation of devices. They include standards of design and construction, standards of functioning, warning symbol specifications in addition to information relating to the seizure and detention of machines failing to comply with the regulations. The radiation emitting devices consist of the following: television receivers, extra-oral dental x-ray equipment, microwave ovens, baggage inspection x-ray devices, demonstration--type gas discharge devices, photofluorographic x-ray equipment, laser scanners, demonstration lasers, low energy electron microscopes, high intensity mercury vapour discharge lamps, sunlamps, diagnostic x-ray equipment, ultrasound therapy devices, x-ray diffraction equipment, cabinet x-ray equipment and therapeutic x-ray equipment

  5. Natural Gas Regulation

    International Nuclear Information System (INIS)

    1995-01-01

    The regulation of Natural Gas. Natural gas Regulation clarifies and consolidates the legal and institutional framework for development of the industry through six principal elements: 1) Establishment of a vision of the industry. 2) Development of regulatory objectives. 3) Determination of relationships among industry participants. 4) Clear specification of the role of PEMEX in the industry. 5) Definition of the functions of the Regulatory authority. 6) Creation of a transition regime. In parallel with the development of the substantive legal framework, the law of the Comision Reguladora de Energia (CRE) was also enacted by Congress in October 1995 to strength the institutional framework and implement the legal changes. This law defines the CRE as an agency of the Energy Ministry with technical, operational, and budgetary autonomy, and responsibility for implementing natural gas industry regulation. (Author)

  6. Volume Regulated Channels

    DEFF Research Database (Denmark)

    Klausen, Thomas Kjær

    of volume perturbations evolution have developed system of channels and transporters to tightly control volume homeostasis. In the past decades evidence has been mounting, that the importance of these volume regulated channels and transporters are not restricted to the defense of cellular volume...... but are also essential for a number of physiological processes such as proliferation, controlled cell death, migration and endocrinology. The thesis have been focusing on two Channels, namely the swelling activated Cl- channel (ICl, swell) and the transient receptor potential Vanilloid (TRPV4) channel. I: Cl......- serves a multitude of functions in the mammalian cell, regulating the membrane potential (Em), cell volume, protein activity and the driving force for facilitated transporters giving Cl- and Cl- channels a major potential of regulating cellular function. These functions include control of the cell cycle...

  7. QUANTITATIVE ANALYSIS OF FLUX REGULATION THROUGH HIERARCHICAL REGULATION ANALYSIS

    NARCIS (Netherlands)

    van Eunen, Karen; Rossell, Sergio; Bouwman, Jildau; Westerhoff, Hans V.; Bakker, Barbara M.; Jameson, D; Verma, M; Westerhoff, HV

    2011-01-01

    Regulation analysis is a methodology that quantifies to what extent a change in the flux through a metabolic pathway is regulated by either gene expression or metabolism. Two extensions to regulation analysis were developed over the past years: (i) the regulation of V(max) can be dissected into the

  8. Quantitative analysis of flux regulation through hierarchical regulation analysis

    NARCIS (Netherlands)

    Eunen, K. van; Rossell, S.; Bouwman, J.; Westerhoff, H.V.; Bakker, B.M.

    2011-01-01

    Regulation analysis is a methodology that quantifies to what extent a change in the flux through a metabolic pathway is regulated by either gene expression or metabolism. Two extensions to regulation analysis were developed over the past years: (i) the regulation of Vmax can be dissected into the

  9. The Impact of Regulating Social Science Research with Biomedical Regulations

    Science.gov (United States)

    Durosinmi, Brenda Braxton

    2011-01-01

    The Impact of Regulating Social Science Research with Biomedical Regulations Since 1974 Federal regulations have governed the use of human subjects in biomedical and social science research. The regulations are known as the Federal Policy for the Protection of Human Subjects, and often referred to as the "Common Rule" because 18 Federal…

  10. Public regulators and CSR

    DEFF Research Database (Denmark)

    Buhmann, Karin

    2016-01-01

    The social licence to operate (SLO) concept is little developed in the academic literature so far. Deployment of the term was made by the United National (UN) Guiding Principles on Business and Human Rights and the UN ‘Protect, Respect and Remedy’ Framework, which apply SLO as an argument...... for responsible business conduct, connecting to social expectations and bridging to public regulation. This UN guidance has had a significant bearing on how public regulators seek to influence business conduct beyond Human Rights to broader Corporate Social Responsibility (CSR) concerns. Drawing on examples...

  11. Collaborative Tax Regulation

    DEFF Research Database (Denmark)

    Boll, Karen

    2016-01-01

    This article shows a new form of regulation within a tax administration where tax administrators abate tax evasion by nudging and motivating consumers to only purchase services from tax compliant businesses. This indirectly closes or forces tax evading businesses to change their practices, because...... stakeholders, i.e. the consumers, in the regulatory craft. The study is based on a qualitative methodology and draws on a unique case of regulation in the cleaning sector. This sector is at high risk of tax evasion and human exploitation of vulnerable workers operating in the informal economy. The article has...

  12. Public regulators and CSR

    DEFF Research Database (Denmark)

    Buhmann, Karin

    2016-01-01

    of such public regulatory governance, this article explores and explains developments towards a juridification of CSR entailing efforts by public regulators to reach beyond jurisdictional and territorial limitations of conventional public law to address adverse effects of transnational economic activity. Through...... analysis of an expansion of law into the normative framing of what constitutes responsible business conduct, we demonstrate a process of juridification entailing a legal framing of social expectations of companies, a proliferation of law into the field of business ethics, and an increased regulation by law...

  13. Nuclear regulations and environment

    International Nuclear Information System (INIS)

    Oliveira, Antonio A.

    2001-01-01

    After an historical overview of the nuclear regulation system in Argentina a description is made of the country's Nuclear Regulatory Authority (ARN) and of its regulation and control functions. Its organic structure is also outlined. A detailed report is given of the environmental monitoring activities in the sites of the operating Argentine nuclear power plants as well as those of the nuclear research centres. A special reference is made of the monitoring of the relevant uranium mining districts in Argentina. The radon determination in houses of several regions of the country is also mentioned

  14. Nuclear regulation and safety

    International Nuclear Information System (INIS)

    Hendrie, J.M.

    1982-01-01

    Nuclear regulation and safety are discussed from the standpoint of a hypothetical country that is in the process of introducing a nuclear power industry and setting up a regulatory system. The national policy is assumed to be in favor of nuclear power. The regulators will have responsibility for economic, reliable electric production as well as for safety. Reactor safety is divided into three parts: shut it down, keep it covered, take out the afterheat. Emergency plans also have to be provided. Ways of keeping the core covered with water are discussed

  15. Regulated underground storage tanks

    International Nuclear Information System (INIS)

    1992-06-01

    This guidance package is designed to assist DOE Field operations by providing thorough guidance on the underground storage tank (UST) regulations. [40 CFR 280]. The guidance uses tables, flowcharts, and checklists to provide a ''roadmap'' for DOE staff who are responsible for supervising UST operations. This package is tailored to address the issues facing DOE facilities. DOE staff should use this guidance as: An overview of the regulations for UST installation and operation; a comprehensive step-by-step guidance for the process of owning and operating an UST, from installation to closure; and a quick, ready-reference guide for any specific topic concerning UST ownership or operation

  16. An apple MYB transcription factor, MdMYB3, is involved in regulation of anthocyanin biosynthesis and flower development.

    Science.gov (United States)

    Vimolmangkang, Sornkanok; Han, Yuepeng; Wei, Guochao; Korban, Schuyler S

    2013-11-07

    Red coloration of fruit is an important trait in apple, and it is mainly attributed to the accumulation of anthocyanins, a class of plant flavonoid metabolites. Anthocyanin biosynthesis is genetically determined by structural and regulatory genes. Plant tissue pigmentation patterns are mainly controlled by expression profiles of regulatory genes. Among these regulatory genes are MYB transcription factors (TFs), wherein the class of two-repeats (R2R3) is deemed the largest, and these are associated with the anthocyanin biosynthesis pathway. Although three MdMYB genes, almost identical in nucleotide sequences, have been identified in apple, it is likely that there are other R2R3 MYB TFs that are present in the apple genome that are also involved in the regulation of coloration of red color pigmentation of the skin of apple fruits. In this study, a novel R2R3 MYB gene has been isolated and characterized in apple. This MYB gene is closely related to the Arabidopsis thaliana AtMYB3, and has been designated as MdMYB3. This TF belongs to the subgroup 4 R2R3 family of plant MYB transcription factors. This apple MdMYB3 gene is mapped onto linkage group 15 of the integrated apple genetic map. Transcripts of MdMYB3 are detected in all analyzed tissues including leaves, flowers, and fruits. However, transcripts of MdMYB3 are higher in excocarp of red-skinned apple cultivars than that in yellowish-green skinned apple cultivars. When this gene is ectopically expressed in Nicotiana tabacum cv. Petite Havana SR1, flowers of transgenic tobacco lines carrying MdMYB3 have exhibited increased pigmentation and accumulate higher levels of anthocyanins and flavonols than wild-type flowers. Overexpression of MdMYB3 has resulted in transcriptional activation of several flavonoid pathway genes, including CHS, CHI, UFGT, and FLS. Moreover, peduncles of flowers and styles of pistils of transgenic plants overexpressing MdMYB3 are longer than those of wild-type plants, thus suggesting that this

  17. Ketamine and international regulations.

    Science.gov (United States)

    Liao, Yanhui; Tang, Yi-Lang; Hao, Wei

    2017-09-01

    Ketamine is an anesthetic commonly used in low-income countries and has recently been shown to be effective for treatment-resistant depression. However, the illicit manufacturing, trafficking, and nonmedical use of ketamine are increasing globally, and its illicit use poses major public health challenges in many countries. To review the nonmedical use of ketamine in selected countries and its regulatory control. We conducted a review of literature identified from searches of the China National Knowledge Infrastructure (CNKI) (1979-2016) and PubMed databases, supplemented by additional references identified by the authors. Special attention was given to the regulation of ketamine. Illicit manufacturing, trafficking, and use of ketamine appear to have begun on a large scale in several Asian nations, and it has subsequently spread to other regions. Regulations governing availability of ketamine vary across countries, but there is a clear trend toward tighter regulations. As nonmedical use of ketamine and its harmful consequences have worsened globally, stricter controls are necessary. Appropriate regulation of ketamine is important for international efforts to control ketamine's cross-border trafficking and its nonmedical use.

  18. Federal Gasoline Regulations

    Science.gov (United States)

    The Clean Air Act requires EPA to regulate fuels and fuel additives for use in mobile sources if such fuel, fuel additive or any emission products causes or contributes to air or water pollution that may endanger the public health or welfare.

  19. Emotion regulation during isolation

    Czech Academy of Sciences Publication Activity Database

    Poláčková Šolcová, Iva; Šolcová, Iva

    2012-01-01

    Roč. 47, Suppl. 1 (2012) ISSN 0020-7594. [International Congress of Psychology /30./. 22.07.2012-27.07.2012, Cape Town] R&D Projects: GA ČR(CZ) GAP407/11/2226 Institutional support: RVO:68081740 Keywords : emotion regulation * isolation * Mars500 Subject RIV: AN - Psychology

  20. Legislation and regulation

    International Nuclear Information System (INIS)

    2001-01-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 3 of the document contains some details about the Brazilian legislation and regulation, the legislative and regulatory framework, regulatory body and responsibility of the license holder

  1. Legislation and regulation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-09-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 3 of the document contains some details about the Brazilian legislation and regulation, the legislative and regulatory framework, regulatory body and responsibility of the license holder.

  2. Regulations in radiation protection

    International Nuclear Information System (INIS)

    1986-01-01

    On the occasion of the twenty fifth anniversary of the Dutch Society for Radiation Protection, a symposium was held about Regulations in Radiation Protection. The program consisted of six contributions of which four are included in this publication. The posters presented are published in NVS-nieuws, 1985, vol. 11(5). (G.J.P.)

  3. Nuclear safety regulations

    International Nuclear Information System (INIS)

    1998-01-01

    The Departmental Rules and The Safety Guides were issued by the NNSA in 1998. The NNSA performed the activities of propagation and implementation of nuclear safety regulations at QTNPP in order to improve the nuclear safety culture of operating organization and construct and contract organizations

  4. Regulation under Uncertainty

    DEFF Research Database (Denmark)

    Sabel, Charles; Herrigel, Gary; Hull Kristensen, Peer

    2017-01-01

    generation of the implicated components or installations are updated accordingly. In this essay we develop these arguments and look closely at changes in the Norwegian offshore oil and gas industry and its regulator, the Petroleum Safety Authority to better understand the coevolution of vertically...

  5. Nondissipative optimum charge regulator

    Science.gov (United States)

    Rosen, R.; Vitebsky, J. N.

    1970-01-01

    Optimum charge regulator provides constant level charge/discharge control of storage batteries. Basic power transfer and control is performed by solar panel coupled to battery through power switching circuit. Optimum controller senses battery current and modifies duty cycle of switching circuit to maximize current available to battery.

  6. Vehicle recycling regulations

    DEFF Research Database (Denmark)

    Smink, Carla

    2007-01-01

    The number of end-of-life vehicles (ELVs) in the EU is increasing continously. Around 75 percent of an ELV are recyclable metals. The forecast growth in the number of ELVs calls for regulation that aims to minimise the environmental impact of a car. Using Denmark as an example, this article...

  7. Regulating nuclear fuel waste

    International Nuclear Information System (INIS)

    1995-01-01

    When Parliament passed the Atomic Energy Control Act in 1946, it erected the framework for nuclear safety in Canada. Under the Act, the government created the Atomic Energy Control Board and gave it the authority to make and enforce regulations governing every aspect of nuclear power production and use in this country. The Act gives the Control Board the flexibility to amend its regulations to adapt to changes in technology, health and safety standards, co-operative agreements with provincial agencies and policy regarding trade in nuclear materials. This flexibility has allowed the Control Board to successfully regulate the nuclear industry for more than 40 years. Its mission statement 'to ensure that the use of nuclear energy in Canada does not pose undue risk to health, safety, security and the environment' concisely states the Control Board's primary objective. The Atomic Energy Control Board regulates all aspects of nuclear energy in Canada to ensure there is no undue risk to health, safety, security or the environment. It does this through a multi-stage licensing process

  8. Metabolic regulation of yeast

    Science.gov (United States)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  9. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  10. Maintenance and regulations

    International Nuclear Information System (INIS)

    Noel, R.

    1984-01-01

    Description of the main regulations concerning the processes tied with maintenance and in service supervision of the pressure vessels in classical or nuclear power plants or of their accessories (essentially in order to fix the time-table of the hydraulic test procedures and the inspection chronology [fr

  11. Allosteric Regulation of Proteins

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 1. Allosteric Regulation of Proteins: A Historical Perspective on the Development of Concepts and Techniques. General Article Volume 22 Issue 1 January 2017 pp 37-50 ...

  12. Optimal Regulation of Lumpy Investments

    NARCIS (Netherlands)

    Zwart, G.; Broer, D.P.

    2012-01-01

    When a monopolist has discretion over the timing of infrastructure investments, regulation of post-investment prices interferes with incentivizing socially optimal investment timing. In a model of regulated lumpy investment under uncertainty, we study regulation when the regulator can condition

  13. Markets, religion, regulation

    DEFF Research Database (Denmark)

    Fischer, Johan

    2016-01-01

    Most recent scholarship on moral economies or religious markets argues for the compatibility of economies/markets and religious practices in particular national or regional contexts. However, over the last couple of decades or so religious markets have entered a new phase characterized by new forms...... of regulation, certification and standardization on a global scale. Building on research on global kosher (a Hebrew term meaning “fit” or “proper”), halal (an Arabic word that literally means “permissible” or “lawful”) and Hindu vegetarianism this paper argues that these economies or markets to a large extent...... are conditioned by and themselves condition forms of transnational governmentality, that is, new and often overlapping practices of government and grassroots politics. I explore religious economies and markets at three interrelated levels of the social scale: state and non-state regulation, the marketplace...

  14. Environmental considerations and regulations

    International Nuclear Information System (INIS)

    Blanco, R.E.

    1976-01-01

    Methods used to control the radiological impact of the nuclear fuel cycle are described. This control is exercised through the application of a series of federal laws and regulations that are used as the basis for licensing nuclear facilities. The control is exercised more directly by the use of radwaste treatment equipment at the nuclear facilities to limit the release of radioactive materials. Federal laws and regulations are summarized and their applications in licensing actions are discussed. Radiological doses from materials released from licensed facilities are compared with doses from natural background. A series of cost/benefit engineering surveys are being made to determine the cost and effectiveness of radwaste systems for decreasing the release of radioactive materials from model fuel cycle facilities and to determine the benefits in terms of reduction in dose commitment to individuals and populations in surrounding areas

  15. Transients: The regulator's view

    International Nuclear Information System (INIS)

    Sheron, B.W.; Speis, T.P.

    1984-01-01

    This chapter attempts to clarify the basis for the regulator's concerns for transient events. Transients are defined as both anticipated operational occurrences and postulated accidents. Recent operational experience, supplemented by improved probabilistic risk analysis methods, has demonstrated that non-LOCA transient events can be significant contributors to overall risk. Topics considered include lessons learned from events and issues, the regulations governing plant transients, multiple failures, different failure frequencies, operator errors, and public pressure. It is concluded that the formation of Owners Groups and Regulatory Response Groups within the owners groups are positive signs of the industry's concern for safety and responsible dealing with the issues affecting both the US NRC and the industry

  16. The regulator's perspective

    International Nuclear Information System (INIS)

    Norrby, S.

    1997-01-01

    Recommendations on general safety objectives and good practices related to radioactive waste management are given by international organisations such as the OECD/NEA and the IAEA. Moreover, international conventions and other supranational legal instruments, such as EU directives, lay down requirements on the safe management of radioactive waste. The implementer of the system for waste management and disposal and the regulator will have different roles. The responsibility for the management and disposal of radioactive waste is with the implementer, who has taken over that responsibility from the generator of the waste. The regulator's responsibility is to define safety and radiation protection requirements, to issue guidance on safety assessment methodology and documentation, to review the implementer's safety assessments as a basis for licensing of waste management and disposal activities and facilities and to inspect and review construction and operation of nuclear facilities to ensure compliance with licensing conditions. (R.P.)

  17. Probiotics and Appetite Regulation

    DEFF Research Database (Denmark)

    Bjerg, Anne Toksvig

    resistance and blood lipid profile among others. Probiotics which are health promoting bacteria can potentially be used to affect the GM and thereby change metabolic outcomes of the host. Animal studies have shown associations between intake of probiotics and appetite regulation, but currently no human...... studies have investigated this effect. Supplementation with different probiotic strains have been shown to have an effect on blood lipid profiles in both animals and humans and the mechanisms behind have been studied in vitro and in rodents. The aim of the present thesis was to examine in an ex vivo...... intestine, in an animal study and in two human studies the effect of the probiotic bacteria Lactobacillus paracasei subsp. paracasei L. casei W8 (W8) on appetite regulation, blood lipids and blood fatty acids. In addition, it was investigated if W8 had an effect on the fecal microbiota of the human...

  18. Regulation of Meiotic Recombination

    Energy Technology Data Exchange (ETDEWEB)

    Gregory p. Copenhaver

    2011-11-09

    Meiotic recombination results in the heritable rearrangement of DNA, primarily through reciprocal exchange between homologous chromosome or gene conversion. In plants these events are critical for ensuring proper chromosome segregation, facilitating DNA repair and providing a basis for genetic diversity. Understanding this fundamental biological mechanism will directly facilitate trait mapping, conventional plant breeding, and development of genetic engineering techniques that will help support the responsible production and conversion of renewable resources for fuels, chemicals, and the conservation of energy (1-3). Substantial progress has been made in understanding the basal recombination machinery, much of which is conserved in organisms as diverse as yeast, plants and mammals (4, 5). Significantly less is known about the factors that regulate how often and where that basal machinery acts on higher eukaryotic chromosomes. One important mechanism for regulating the frequency and distribution of meiotic recombination is crossover interference - or the ability of one recombination event to influence nearby events. The MUS81 gene is thought to play an important role in regulating the influence of interference on crossing over. The immediate goals of this project are to use reverse genetics to identify mutants in two putative MUS81 homologs in the model plant Arabidopsis thaliana, characterize those mutants and initiate a novel forward genetic screen for additional regulators of meiotic recombination. The long-term goal of the project is to understand how meiotic recombination is regulated in higher eukaryotes with an emphasis on the molecular basis of crossover interference. The ability to monitor recombination in all four meiotic products (tetrad analysis) has been a powerful tool in the arsenal of yeast geneticists. Previously, the qrt mutant of Arabidopsis, which causes the four pollen products of male meiosis to remain attached, was developed as a facile system

  19. German seismic regulations

    International Nuclear Information System (INIS)

    Danisch, Ruediger

    2002-01-01

    Rules and regulations for seismic design in Germany cover the following: seismic design of conventional buildings; and seismic design of nuclear facilities. Safety criteria for NPPs, accident guidelines, and guidelines for PWRs as well as safety standards are cited. Safety standards concerned with NPPs seismic design include basic principles, soil analysis, design of building structures, design of mechanical and electrical components, seismic instrumentation, and measures to be undertaken after the earthquake

  20. Regulation and the Marketplace

    OpenAIRE

    Shyam Sunder; Michael Maier; Karim Jamal

    2004-01-01

    Under what conditions is government regulation better at protecting market participants than private, evolving, market-driven protections? An intriguing answer to that question emerges if we examine a relatively unregulated area of market participant protection: e-commerce privacy. In the United States, the privacy of participants engaged in e-commerce is largely unregulated by government; instead, many commercial websites contract with third parties to establish privacy protection codes and ...

  1. The regulation of hunting

    DEFF Research Database (Denmark)

    Abildtrup, Jens; Jensen, Frank

    2014-01-01

    This paper examines a tax/subsidy on hunters based on game population. The tax/subsidy is the difference between actual and optimal population multiplied by an individual, variable tax rate. The tax rate is, among other things, based on the difference between the marginal value of the game popula...... population to the hunter and the regulator and differences in user costs of the population. The paper shows that the population tax/subsidy secures a first-best optimum....

  2. Human telomerase activity regulation

    OpenAIRE

    Wojtyla, Aneta; Gladych, Marta; Rubis, Blazej

    2010-01-01

    Telomerase has been recognized as a relevant factor distinguishing cancer cells from normal cells. Thus, it has become a very promising target for anticancer therapy. The cell proliferative potential can be limited by replication end problem, due to telomeres shortening, which is overcome in cancer cells by telomerase activity or by alternative telomeres lengthening (ALT) mechanism. However, this multisubunit enzymatic complex can be regulated at various levels, including expression control b...

  3. Improving CS regulations.

    Energy Technology Data Exchange (ETDEWEB)

    Nesse, R.J.; Scheer, R.M.; Marasco, A.L.; Furey, R.

    1980-10-01

    President Carter issued Executive Order 12044 (3/28/78) that required all Federal agencies to distinguish between significant and insignificant regulations, and to determine whether a regulation will result in major impacts. This study gathered information on the impact of the order and the guidelines on the Office of Conservation and Solar Energy (CS) regulatory practices, investigated problems encountered by the CS staff when implementing the order and guidelines, and recommended solutions to resolve these problems. Major tasks accomplished and discussed are: (1) legislation, Executive Orders, and DOE Memoranda concerning Federal administrative procedures relevant to the development and analysis of regulations within CS reviewed; (2) relevant DOE Orders and Memoranda analyzed and key DOE and CS staff interviewed in order to accurately describe the current CS regulatory process; (3) DOE staff from the Office of the General Counsel, the Office of Policy and Evaluation, the Office of the Environment, and the Office of the Secretary interviewed to explore issues and problems encountered with current CS regulatory practices; (4) the regulatory processes at five other Federal agencies reviewed in order to see how other agencies have approached the regulatory process, dealt with specific regulatory problems, and responded to the Executive Order; and (5) based on the results of the preceding four tasks, recommendations for potential solutions to the CS regulatory problems developed. (MCW)

  4. Staff rules and regulations

    CERN Multimedia

    HR Department

    2007-01-01

    The 11th edition of the Staff Rules and Regulations, dated 1 January 2007, adopted by the Council and the Finance Committee in December 2006, is currently being distributed to departmental secretariats. The Staff Rules and Regulations, together with a summary of the main modifications made, will be available, as from next week, on the Human Resources Department's intranet site: http://cern.ch/hr-web/internal/admin_services/rules/default.asp The main changes made to the Staff Rules and Regulations stem from the five-yearly review of employment conditions of members of the personnel. The changes notably relate to: the categories of members of the personnel (e.g. removal of the local staff category); the careers structure and the merit recognition system; the non-residence, installation and re-installation allowances; the definition of family, family allowances and family-related leave; recognition of partnerships; education fees. The administrative circulars, some of which are being revised following the m...

  5. Whither tobacco product regulation?

    Science.gov (United States)

    McNeill, Ann; Hammond, David; Gartner, Coral

    2012-03-01

    Despite decades of industry innovation and regulatory efforts, the harmfulness of conventional cigarettes has not changed. There are several pitfalls in this area, including the long time lag before health impacts of product regulatory changes become apparent, the danger of consumers deriving false reassurance of lesser harm in the interim period, the lack of relevant expertise and the lack of an internationally agreed and evidence-based strategic approach. Articles 9 and 10 of the Framework Convention on Tobacco Control provide the potential for such a global strategy, and knowledge and research has increased significantly over recent years. However, there are huge opportunity costs in implementing product disclosure and regulatory strategies: most national regulators have very limited human and financial resources, which should be focused on other evidence-based tobacco control interventions. We believe therefore that it is now time to abandon the notion of safe or safer cigarettes while moving consumers towards cleaner nicotine products as soon as possible. In parallel to this, we recommend a number of other strategies be implemented including: reducing the appeal of all tobacco products, forbidding new tobacco products or brand variants being marketed without evidence of reduced harm, appeal or addictiveness, and developing a tobacco industry resourced, but industry independent, Framework Convention on Tobacco Control global repository to assist national regulators in understanding and regulating the products on their markets.

  6. Nuclear Safety Regulations

    International Nuclear Information System (INIS)

    Novosel, N.; Prah, M.

    2008-01-01

    Beside new Ordinance on the control of nuclear material and special equipment ('Official Gazette' No. 15/08), from 2006 State Office for Nuclear Safety (SONS) adopted Ordinance on performing nuclear activities ('Official Gazette' No. 74/06) and Ordinance on special requirements which expert organizations must fulfil in order to perform certain activities in the field of nuclear safety ('Official Gazette' No. 74/06), based on Nuclear Safety Act ('Official Gazette' No. 173/03). The Ordinance on performing nuclear activities regulates the procedure of notification of the intent to perform nuclear activities, submitting the application for the issue of a licence to perform nuclear activities, and the procedure for issuing decisions on granting a licence to perform a nuclear activity. The Ordinance also regulates the content of the forms for notification of the intent to perform nuclear activities, as well as of the application for the issue of a licence to perform the nuclear activity and the method of keeping the register of nuclear activities. According to the Nuclear Safety Act, nuclear activities are the production, processing, use, storage, disposal, transport, import, export, possession or other handling of nuclear material or specified equipment. The Ordinance on special requirements which expert organizations must fulfil in order to perform certain activities in the field of nuclear safety regulates these mentioned conditions, whereas compliance is established by a decision passed by the SONS. Special requirements which expert organizations must fulfil in order to perform certain activities in the field of nuclear safety are organizational, technical, technological conditions and established system of quality assurance. In 2007, State Office for Nuclear Safety finalized the text of new Ordinance on conditions for nuclear safety and protection with regard to the siting, design, construction, use and decommissioning of a facility in which a nuclear activity is

  7. New Nuclear Safety Regulations

    International Nuclear Information System (INIS)

    Novosel, N.; Prah, M.; Cizmek, A.

    2008-01-01

    Beside new Ordinance on the control of nuclear material and special equipment (Official Gazette No. 15/08), from 2006 State Office for Nuclear Safety (SONS) adopted Ordinance on performing nuclear activities (Official Gazette No. 74/06) and Ordinance on special conditions for individual activities to be performed by expert organizations which perform activities in the area of nuclear safety (Official Gazette No. 74/06), based on Nuclear Safety Act (Official Gazette No. 173/03). The Ordinance on performing nuclear activities regulates the procedure of announcing the intention to perform nuclear activity, submitting an application for the issue of a license to perform nuclear activity, and the procedure for adoption a decision on issuing a nuclear activity license. The Ordinance also regulates the contents of the application form for the announcement of the intention to perform nuclear activity, as well as of the application for the issue of a nuclear activity license and the method of keeping a nuclear activity register. The Ordinance on special conditions for individual activities to be performed by expert organizations which perform activities in the area of nuclear safety regulates these mentioned conditions, whereas compliance is established by a decision passed by the SONS. Special conditions for individual activities to be performed by expert organizations which perform activities in the area of nuclear safety are organizational, technical, technological conditions and established system of quality assurance. In 2007, SONS finalized the text of new Ordinance on nuclear safety and protection conditions for location, design, construction, operation and decommissioning of facility in which nuclear activity is performed. This Ordinance regulates nuclear safety and protection conditions for location, design, construction, operation and decommissioning of facility in which nuclear activity is performed. This Ordinance defines facilities in which nuclear activity is

  8. The international radioactive transportation regulations: A model for national regulations

    International Nuclear Information System (INIS)

    Pope, R.B.; Rawl, R.R.

    1990-06-01

    The International Atomic Energy Agency's (IAEA) Regulations for the Safe Transport of Radioactive Material, Safety Series No. 6 (herein after denoted as the ''International Regulations'') serve as the model for the regulations for individual countries and international modal organizations controlling the packaging and transportation of radioactive materials. The purpose of this paper is to outline the background and history of the International Regulations, the general principles behind the requirements of the International Regulations, the structure and general contents of the latest edition of the International Regulations, and the roles of various international bodies in the development and implementation of the International Regulations and the current status of regulatory and supportive document development at both the international and domestic level. This review will provide a basis for users and potential users to better understand the source and application of the International Regulations. 1 tab

  9. Regulations for ionizing radiation protection

    International Nuclear Information System (INIS)

    1999-01-01

    General regulations and principles of radiation protection and safety are presented. In addition, the regulations for licensing and occupational and medical exposure as well as for safe transport of radioactive materials and wastes are given

  10. [Regulation of terpene metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.

    1992-01-01

    This report describes accomplishments over the past year on understanding of terpene synthesis in mint plants and sage. Specifically reported are the fractionation of 4-S-limonene synthetase, the enzyme responsible for the first committed step to monoterpene synthesis, along with isolation of the corresponding RNA and DNA cloning of its gene; the localization of the enzyme within the oil glands, regulation of transcription and translation of the synthetase, the pathway to camphor biosynthesis,a nd studies on the early stages and branch points of the isoprenoid pathway.

  11. Wiring regulations in brief

    CERN Document Server

    Tricker, Ray

    2012-01-01

    Tired of trawling through the Wiring Regs?Perplexed by Part P?Confused by cables, conductors and circuits?Then look no further! This handy guide provides an on-the-job reference source for Electricians, Designers, Service Engineers, Inspectors, Builders, Students, DIY enthusiastsTopic-based chapters link areas of working practice - such as cables, installations, testing and inspection, special locations - with the specifics of the Regulations themselves. This allows quick and easy identification of the official requirements relating to the situati

  12. Regulated functions and integrability

    Directory of Open Access Journals (Sweden)

    Ján Gunčaga

    2009-04-01

    Full Text Available Properties of functions defined on a bounded closed interval, weaker than continuity, have been considered by many mathematicians. Functions having both sides limits at each point are called regulated and were considered by J. Dieudonné [2], D. Fraňková [3] and others (see for example S. Banach [1], S. Saks [8]. The main class of functions we deal with consists of piece-wise constant ones. These functions play a fundamental role in the integration theory which had been developed by Igor Kluvanek (see Š. Tkacik [9]. We present an outline of this theory.

  13. Nanomaterials: Regulation and Risk Assessment

    DEFF Research Database (Denmark)

    Hansen, Steffen Foss; Grieger, Khara Deanne; Baun, Anders

    2013-01-01

    , the Water Framework Directive, pharmaceuticals regulation, and the Novel Foods Regulation. Current regulation of nanomaterials entail three overall challenges: 1) limitations in regard to terminology and definitions of key terms such as a “substance,” “novel food,” etc.; 2) safety assessment requirements...

  14. Nuclear regulation - the Canadian approach

    International Nuclear Information System (INIS)

    Jennekens, J.

    1981-09-01

    Although the Atomic Energy Control Board was established 35 years ago the basic philosophy of nuclear regulation in Canada and the underlying principles of the regulatory process remain essentially unchanged. This paper outlines the Canadian approach to nuclear regulation and explains in practical terms how the principles of regulation are applied. (author)

  15. The Regulation of Street Foods

    DEFF Research Database (Denmark)

    Forkour, John Boulard; Samuelsen, Helle; Yeboah, Eric Henry

    2017-01-01

    the challenges and negotiating strategies of regulators of street-vended foods in Ghana and analyses the implication for their relationship with street food vendors. The paper reveals that regulators operate in a context of limited resources, leading to a general feeling of neglect. In coping, regulators adopt...

  16. A novel micromechanical flow regulator

    NARCIS (Netherlands)

    van Toor, M.W.; van Toor, M.W.; Lammerink, Theodorus S.J.; Gardeniers, Johannes G.E.; Elwenspoek, Michael Curt; Monsma, D.J.

    1996-01-01

    A new concept for a micromechanical flow regulator is presented. Regulation of the flow is achieved using variation of channel length instead of channel diameter. Several design concepts together with their application in fluidic systems are presented. A regulator for biomedical use, as a part of a

  17. Regulations and Procedures Manual

    Energy Technology Data Exchange (ETDEWEB)

    Young, Lydia J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2011-07-25

    The purpose of the Regulations and Procedures Manual (RPM) is to provide LBNL personnel with a reference to University and Lawrence Berkeley National Laboratory (LBNL or Laboratory) policies and regulations by outlining normal practices and answering most policy questions that arise in the day-to-day operations of Laboratory organizations. Much of the information in this manual has been condensed from detail provided in LBNL procedure manuals, Department of Energy (DOE) directives, and Contract DE-AC02-05CH11231. This manual is not intended, however, to replace any of those documents. RPM sections on personnel apply only to employees who are not represented by unions. Personnel policies pertaining to employees represented by unions may be found in their labor agreements. Questions concerning policy interpretation should be directed to the LBNL organization responsible for the particular policy. A link to the Managers Responsible for RPM Sections is available on the RPM home page. If it is not clear which organization is responsible for a policy, please contact Requirements Manager Lydia Young or the RPM Editor.

  18. Regulations and Procedures Manual

    Energy Technology Data Exchange (ETDEWEB)

    Young, Lydia [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2010-09-30

    The purpose of the Regulations and Procedures Manual (RPM) is to provide Laboratory personnel with a reference to University and Lawrence Berkeley National Laboratory policies and regulations by outlining the normal practices and answering most policy questions that arise in the day-to-day operations of Laboratory departments. Much of the information in this manual has been condensed from detail provided in Laboratory procedure manuals, Department of Energy (DOE) directives, and Contract DE-AC02-05CH11231. This manual is not intended, however, to replace any of those documents. The sections on personnel apply only to employees who are not represented by unions. Personnel policies pertaining to employees represented by unions may be found in their labor agreements. Questions concerning policy interpretation should be directed to the department responsible for the particular policy. A link to the Managers Responsible for RPM Sections is available on the RPM home page. If it is not clear which department should be called, please contact the Associate Laboratory Director of Operations.

  19. Strategisk compliance og regulering

    DEFF Research Database (Denmark)

    Kühn Pedersen, Mogens

    2016-01-01

    Denne artikel introducerer strategisk compliance og påpeger dens samspil med klassiske og nyere former for reguleringer i digital værdiskabelse. Konteksten er den digitale økonomi, som vokser frem imellem den materielle økonomis bærepiller: Virksomheder og markeder, men består af en helt ny...... materialitet, som er det digitale univers og dets modsvarighed i nye krav til compliance. Den nye materialitet stiller nye krav, hvad angår digitale processer og transaktioner. Klassisk regulering, som aktører ikke selv kan ændre, støder på egenregulering, hvor aktørerne selv opsætter regler for at skabe...... digital værdi. Dette kalder på strategisk compliance. Med digitalisering er strategisk compliance sat på dagsordnen i reguleringsdebatten. Vi hævder, at regulering og egenregulering kan komme til at virke komplementært i det post-industrielle, digitaliserede samfund....

  20. [Regulation of terpene metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.

    1991-01-01

    During the last grant period, we have completed studies on the key pathways of monoterpene biosynthesis and catabolism in sage and peppermint, and have, by several lines of evidence, deciphered the rate-limiting step of each pathway. We have at least partially purified and characterized the relevant enzymes of each pathway. We have made a strong case, based on analytical, in vivo, and in vitro studies, that terpene accumulation depends upon the balance between biosynthesis and catabolism, and provided supporting evidence that these processes are developmentally-regulated and very closely associated with senescence of the oil glands. Oil gland ontogeny has been characterized at the ultrastructural level. We have exploited foliar-applied bioregulators to delay gland senescence, and have developed tissue explant and cell culture systems to study several elusive aspects of catabolism. We have isolated pure gland cell clusters and localized monoterpene biosynthesis and catabolism within these structures, and have used these preparations as starting materials for the purification to homogeneity of target regulatory'' enzymes. We have thus developed the necessary background knowledge, based on a firm understanding of enzymology, as well as the necessary experimental tools for studying the regulation of monoterpene metabolism at the molecular level. Furthermore, we are now in a position to extend our systematic approach to other terpenoid classes (C[sub 15]-C[sub 30]) produced by oil glands.

  1. Circadian rhythms regulate amelogenesis.

    Science.gov (United States)

    Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros

    2013-07-01

    Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of the development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24 h) intervals both at RNA and protein levels. This study also reveals that the two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory stage ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation stage ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stages of amelogenesis might be under circadian control. Changes in clock gene expression patterns might result in significant alterations of enamel apposition and mineralization. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Regulation of ATM induction

    International Nuclear Information System (INIS)

    Clarke, R.A.; Fang, Z.M.; Kearsley, J.H.; Lee, C.S.; Sarris, M.; De Murrell, D.

    2000-01-01

    Full text: ATM, the tumour suppressor protein mutated in ataxia-telangiectasia, is of pivotal importance in controlling the cells primary response to ionising radiation (IR) induced DNA damage. Mutations in ATM which reduce the level of the ATM protein and/or compromise ATM functions are known to give rise to radiosensitivity and defective cell cycle checkpoint control. In response to DNA damage ATM kinase is rapidly activated and initiates downstream signalling to cell cycle control molecules including p53. To investigate additional mechanisms of ATM control we have employed ATM antisense expression in cultured cells, western analyses and immunohistochemistry in situ. We report that ATM can be up-regulated up to 10-fold following exposure to low levels of ionising radiation. ATM radiation-induction was radiation dose dependent while the rapidity of the response indicates a post translational pathway. The concurrent time frames for the radiation-induction of ATM levels and the activation of ATM kinase activity appear to be complimentary in boosting ATM's protective response to IR induced DNA damage, especially in ATM 'low expressing' systems. We also provide the first report of ATM misregulation in 2 cancer patients, indicating that ATM is not only radio-protective but has possible implications in cancer, particularly breast cancer. These results have particular importance in defining the regulation of the ATM protein as an: adaptive radio-response; radio-prognostic market in tumours and normal tissue, and breast cancer marker

  3. Is self-regulation possible

    International Nuclear Information System (INIS)

    Barkenbus, J.N.

    1983-01-01

    The Nuclear Regulatory Commission's increasingly prescriptive regulation of the nuclear industry can have deleterious effects, perhaps the most serious being the shift in responsibility for safety from the utility to the NRC. Several factors account for this type of regulation including the nature and structure of the nuclear industry, public opinion and bureaucratic incentives, and the nature of the technology itself. The opportunities to create heightened industry self-regulation (performance-based regulation) deserve further examination. The key to self-regulation is to structure incentives so that it is clearly within the nuclear utilities' interests to build and operate nuclear power facilities in the safest manner possible. 27 references

  4. Modulation of flavonoid metabolites in Arabidopsis thaliana through overexpression of the MYB75 transcription factor: role of kaempferol-3,7-dirhamnoside in resistance to the specialist insect herbivore Pieris brassicae

    NARCIS (Netherlands)

    Onkokesung, N.; Reichelt, M.; Doorn, van A.; Schuurink, R.C.; Loon, van J.J.A.; Dicke, M.

    2014-01-01

    Anthocyanins and flavonols are secondary metabolites that can function in plant defence against herbivores. In Arabidopsis thaliana, anthocyanin and flavonol biosynthesis are regulated by MYB transcription factors. Overexpression of MYB75 (oxMYB75) in Arabidopsis results in increasing anthocyanin

  5. Regulation as delegation

    Directory of Open Access Journals (Sweden)

    Oren Bar-Gill

    2016-03-01

    Full Text Available Objective to consider the conception of reverse delegation when the government acts a principal and an individual ndash an agent from the point of view of behavioral PrincipalAgent Theory. Methods statistical method sociological polling. Results In diverse areas ndash from retirement savings to consumer credit to prescription drug use to fuel economy and energy efficiency rules to tobacco consumption to food and beverage consumption ndash government makes decisions for us or endeavors to help us make better decisions thus serving as our agent. From the point of view of PrincipalAgent Theory and behavioral PrincipalAgent Theory a great deal of modern regulation can be helpfully evaluated as a hypothetical delegation. Shifting from personal decisions to public goods problems the authors view the idea of reverse delegation with the government as principal and the individuals as agents. They show that the essence of delegation changes depending on the context. The article describes conditions under which various approaches will make sense. Scientific novelty the paper is devoted to the foreign experience of regulation through delegation by the example of a country with developed market economy the USA. It shows the prospects of such approach in solving both the public and the private tasks. Application of PrincipalAgent Theory and behavioral PrincipalAgent Theory is viewed to distinguish between such types of hypothetical delegation as information default rules incentives precommitments mandates and prohibitions. The article considers the benefits and costs of delegation and circumstances in which one or another approach makes sense. Practical significance PrincipalAgent Theory is widely used in economics and political science and can serve as a convenient tool to consider the optimal scale and essence of the assistance rendered to us by the government as our agent. The paper is of interest for the Russian legal science as the institution of

  6. Current environmental regulations

    International Nuclear Information System (INIS)

    Martz, M.K.

    1985-01-01

    An overview of the Federal environmental statutes and implementation regulations is provided, including the National Environmental Policy Act, the Clean Air Act, the Clean Water Act, the Safe Drinking Water Act, the Resource Conservation and Recovery Act, the Comprehensive Environmental Response, Compensation, and Liability Act, the Toxic Substances Control Act, the Federal Insecticide, Fungicide, and Rodenticide Act, and the Endangered Species Act. Recent developments which may have a direct impact on waste repository siting and management activities include: final promulgation of National Emission Standards for hazardous Air Pollutants for radionuclides, the DOE-EPA memorandum of understanding which brings mixed radioactive and chemical waste under the requirements of RCRA, and the proposed designation of additional sole source aquifers

  7. Meat and Appetite Regulation

    DEFF Research Database (Denmark)

    Kehlet, Ursula Nana

    effects of new formulations of pork products. Different strategies can be applied to potentially enhance the satiating properties of pork. Processed meat products such as meatballs can serve as a matrix for the addition of fiber ingredients. Based on their high protein and fiber contents, high......-fibre meatballs could provide a dual mechanistic action that would lead to greater satiety. For whole muscles, cooking is known to induce structural, physical and chemical changes of the meat proteins, which in turn may affect protein digestibility and potentially affect satiety. The overall aim of this Ph......D thesis was to investigate the effects of fiber addition to meatballs and the effects of cooking methods of pork on appetite regulation. The PhD thesis is based on three human meal test studies and one analytical study related to the characteristics of fiber meat products. In paper I, the objective...

  8. From research to regulations

    International Nuclear Information System (INIS)

    Flury-Herard, A.

    2000-01-01

    from the beginning of nuclear energy utilization, the necessity arose to take into account the knowledge progress in order to give the best scientific base possible to the regulation protecting workers and the public against the potentially injurious effects of ionizing radiations. These next years, the experts should make their benefit of numerous new results with the conjunction of ultra precise experimental irradiation techniques and to global approach of the genome. The United Nations scientific committee on effect of atomic radiation (U.N.S.C.E.A.R.) plays an essential part in the analysis and the synthesis of the most recent researches to evaluate more precisely, these effects, especially for low radiations doses. (N.C.)

  9. Higher regulators, algebraic

    CERN Document Server

    Bloch, Spencer J

    2000-01-01

    This book is the long-awaited publication of the famous Irvine lectures. Delivered in 1978 at the University of California at Irvine, these lectures turned out to be an entry point to several intimately-connected new branches of arithmetic algebraic geometry, such as regulators and special values of L-functions of algebraic varieties, explicit formulas for them in terms of polylogarithms, the theory of algebraic cycles, and eventually the general theory of mixed motives which unifies and underlies all of the above (and much more). In the 20 years since, the importance of Bloch's lectures has not diminished. A lucky group of people working in the above areas had the good fortune to possess a copy of old typewritten notes of these lectures. Now everyone can have their own copy of this classic work.

  10. NRC's license renewal regulations

    International Nuclear Information System (INIS)

    Akstulewicz, Francis

    1991-01-01

    In order to provide for the continuity of the current generation of nuclear power plant operating licenses and at the same time ensure the health and safety of the public, and the quality of the environment, the US Nuclear Regulatory Commission (NRC) established a goal of developing and issuing regulations and regulatory guidance for license renewal in the early 1990s. This paper will discuss some of those activities underway to achieve this goal. More specifically, this paper will discuss the Commission's regulatory philosophy for license renewal and the two major license renewal rule makings currently underway. The first is the development of a new Part 54 to address procedural and technical requirements for license renewal; the second is a revision to existing Part 51 to exclude environmental issues and impacts from consideration during the license renewal process. (author)

  11. NCAM regulates cell motility

    DEFF Research Database (Denmark)

    Prag, Søren; Lepekhin, Eugene A; Kolkova, Kateryna

    2002-01-01

    Cell migration is required during development of the nervous system. The regulatory mechanisms for this process, however, are poorly elucidated. We show here that expression of or exposure to the neural cell adhesion molecule (NCAM) strongly affected the motile behaviour of glioma cells...... independently of homophilic NCAM interactions. Expression of the transmembrane 140 kDa isoform of NCAM (NCAM-140) caused a significant reduction in cellular motility, probably through interference with factors regulating cellular attachment, as NCAM-140-expressing cells exhibited a decreased attachment...... to a fibronectin substratum compared with NCAM-negative cells. Ectopic expression of the cytoplasmic part of NCAM-140 also inhibited cell motility, presumably via the non-receptor tyrosine kinase p59(fyn) with which NCAM-140 interacts. Furthermore, we showed that the extracellular part of NCAM acted as a paracrine...

  12. [Regulation of terpene metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.

    1989-11-09

    Terpenoid oils, resins, and waxes from plants are important renewable resources. The objective of this project is to understand the regulation of terpenoid metabolism using the monoterpenes (C[sub 10]) as a model. The pathways of monoterpene biosynthesis and catabolism have been established, and the relevant enzymes characterized. Developmental studies relating enzyme levels to terpene accumulation within the oil gland sites of synthesis, and work with bioregulators, indicate that monoterpene production is controlled by terpene cyclases, the enzymes catalyzing the first step of the monoterpene pathway. As the leaf oil glands mature, cyclase levels decline and monoterpene biosynthesis ceases. Yield then decreases as the monoterpenes undergo catabolism by a process involving conversion to a glycoside and transport from the leaf glands to the root. At this site, the terpenoid is oxidatively degraded to acetate that is recycled into other lipid metabolites. During the transition from terpene biosynthesis to catabolism, the oil glands undergo dramatic ultrastructural modification. Degradation of the producing cells results in mixing of previously compartmentized monoterpenes with the catabolic enzymes, ultimately leading to yield decline. This regulatory model is being applied to the formation of other terpenoid classes (C[sub 15] C[sub 20], C[sub 30], C[sub 40]) within the oil glands. Preliminary investigations on the formation of sesquiterpenes (C[sub 15]) suggest that the corresponding cyclases may play a lesser role in determining yield of these products, but that compartmentation effects are important. From these studies, a comprehensive scheme for the regulation of terpene metabolism is being constructed. Results from this project wail have important consequences for the yield and composition of terpenoid natural products that can be made available for industrial exploitation.

  13. Transcriptome Analysis Reveals that Red and Blue Light Regulate Growth and Phytohormone Metabolism in Norway Spruce [Picea abies (L. Karst].

    Directory of Open Access Journals (Sweden)

    Fangqun OuYang

    yielded the higher IAA level. DELLA and phytochrome-interacting factor 3 (PIF3, involved in negative GA signaling, were also upregulated under blue light, which may be related to the lower GA level. Light quality also affects endogenous hormones by influencing secondary metabolism. Blue light promoted phenylpropanoid biosynthesis, phenylalanine metabolism, flavonoid biosynthesis and flavone and flavonol biosynthesis, accompanied by upregulation of most of the genes in their pathways. In conclusion, red light may promote stem growth by regulating biosynthesis of GAs, and blue light may promote flavonoid, lignin, phenylpropanoid and some hormones (such as jasmonic acid which were related to plant defense in Norway spruce, which might reduce the primary metabolites available for plant growth.

  14. Branded prescription drug fee. Final regulations, temporary regulations, and removal of temporary regulations.

    Science.gov (United States)

    2014-07-28

    This document contains final regulations that provide guidance on the annual fee imposed on covered entities engaged in the business of manufacturing or importing branded prescription drugs. This fee was enacted by section 9008 of the Patient Protection and Affordable Care Act, as amended by section 1404 of the Health Care and Education Reconciliation Act of 2010. This document also withdraws the Branded Prescription Drug Fee temporary regulations and contains new temporary regulations regarding the definition of controlled group that apply beginning on January 1, 2015. The final regulations and the new temporary regulations affect persons engaged in the business of manufacturing or importing certain branded prescription drugs. The text of the temporary regulations in this document also serves as the text of proposed regulations set forth in a notice of proposed rulemaking (REG-123286-14) on this subject in the Proposed Rules section in this issue of the Federal Register.

  15. Metabolic and molecular analyses of white mutant Vaccinium berries show down-regulation of MYBPA1-type R2R3 MYB regulatory factor.

    Science.gov (United States)

    Primetta, Anja K; Karppinen, Katja; Riihinen, Kaisu R; Jaakola, Laura

    2015-09-01

    MYBPA1-type R2R3 MYB transcription factor shows down-regulation in white mutant berries of Vaccinium uliginosum deficient in anthocyanins but not proanthocyanidins suggesting a role in the regulation of anthocyanin biosynthesis. Berries of the genus Vaccinium are among the best natural sources of flavonoids. In this study, the expression of structural and regulatory flavonoid biosynthetic genes and the accumulation of flavonoids in white mutant and blue-colored wild-type bog bilberry (V. uliginosum) fruits were measured at different stages of berry development. In contrast to high contents of anthocyanins in ripe blue-colored berries, only traces were detected by HPLC-ESI-MS in ripe white mutant berries. However, similar profile and high levels of flavonol glycosides and proanthocyanidins were quantified in both ripe white and ripe wild-type berries. Analysis with qRT-PCR showed strong down-regulation of structural genes chalcone synthase (VuCHS), dihydroflavonol 4-reductase (VuDFR) and anthocyanidin synthase (VuANS) as well as MYBPA1-type transcription factor VuMYBPA1 in white berries during ripening compared to wild-type berries. The profiles of transcript accumulation of chalcone isomerase (VuCHI), anthocyanidin reductase (VuANR), leucoanthocyanidin reductase (VuLAR) and flavonoid 3'5' hydroxylase (VuF3'5'H) were more similar between the white and the wild-type berries during fruit development, while expression of UDP-glucose: flavonoid 3-O-glucosyltransferase (VuUFGT) showed similar trend but fourfold lower level in white mutant. VuMYBPA1, the R2R3 MYB family member, is a homologue of VmMYB2 of V. myrtillus and VcMYBPA1 of V. corymbosum and belongs to MYBPA1-type MYB family which members are shown in some species to be related with proanthocyanidin biosynthesis in fruits. Our results combined with earlier data of the role of VmMYB2 in white mutant berries of V. myrtillus suggest that the regulation of anthocyanin biosynthesis in Vaccinium species could differ

  16. Regulation of the power sector

    CERN Document Server

    2013-01-01

    Regulation of the Power Sector is a unified, consistent and comprehensive treatment of the theories and practicalities of regulation in modern power-supply systems. The need for generation to occur at the time of use occasioned by the impracticality of large-scale electricity storage coupled with constant and often unpredictable changes in demand make electricity-supply systems large, dynamic and complex and their regulation a daunting task. Conceptually arranged in four parts, this book addresses both traditional regulatory frameworks and also liberalized and re-regulated environments. First, an introduction gives a full characterization of power supply including engineering, economic and regulatory viewpoints. The second part presents the fundamentals of regulation and the third looks at the regulation of particular components of the power sector in detail. Advanced topics and subjects still open or subject to dispute form the content of the fourth part. In a sector where regulatory design is the key driver...

  17. Age discrimination: the new Regulations

    OpenAIRE

    Sprack, John

    2006-01-01

    A summary of the principal changes introduced by the Employment Equality (Age) Regulations 2006 as they came into effect in England and Wales. Extracts from the Regulations follow the commentary. Article by John Sprack (Barrister, part-time Chairman of Employment Tribunals and author of Tottel's Guide to the Age Discrimination Regulations 2006) published in Amicus Curiae – Journal of the Society for Advanced Legal Studies at the Institute of Advanced Legal Studies. The Journal is produced by ...

  18. Regulations for RA reactor operation

    International Nuclear Information System (INIS)

    1980-09-01

    Regulations for RA reactor operation are written in accordance with the legal regulations defined by the Law about radiation protection and related legal acts, as well as technical standards according to the IAEA recommendations. The contents of this book include: fundamental data about the reactor; legal regulations for reactor operation; organizational scheme for reactor operation; general and detailed instructions for operation, behaviour in the reactor building, performing experiments; operating rules for operation under steady state and accidental conditions [sr

  19. Banking regulation and market making

    OpenAIRE

    Cimon, David A.; Garriott, Corey

    2017-01-01

    We present a model of market makers subject to recent banking regulations: liquidity and capital constraints in the style of Basel III and a position limit in the style of the Volcker Rule. Regulation causes market makers to reduce their intermediation by refusing principal positions. However, it can improve the bid-ask spread because it induces new market makers to enter. Since market makers intermediate less, asset prices exhibit a liquidity premium. Costs of regulation can be assessed by m...

  20. Financial Private Regulation and Enforcement

    OpenAIRE

    MILLER, Geoffrey

    2011-01-01

    This paper has been delivered within the context of the research project "Transnational Private Regulatory Regimes: Constitutional foundations and governance design". This paper considers the topic of private regulation and enforcement for internationally active financial services firms. The paper documents the following types of regulation and enforcement that involve significant private input: house rules, contracts, internal compliance, management-based regulation, private standard-sett...

  1. Thermal flow regulator of refrigerant

    International Nuclear Information System (INIS)

    Dubinskij, S.I.; Savchenko, A.G.; Suplin, V.Z.

    1988-01-01

    A thermal flow regulator of refrigerant for helium flow-type temperature-controlled cryostats based on controlling the channel hydraulic resistance due to variation of the flow density and viscosity during liquid helium transformation into the gaseous state. Behind the regulator both two-phase flow and a heated gas can be produced. The regulator resolution is (7-15)x10 -4 l/mW of liquid helium

  2. Electricity regulation and economic growth

    OpenAIRE

    Costa, M. Teresa (Maria Teresa), 1951-; Garcia-Quevedo, Jose; Trujillo-Baute, Elisa

    2018-01-01

    The main objective of this paper is to analyse the effect of electricity regulation on economic growth. Although the relationship between electricity consumption and economic growth has been extensively analysed in the empirical literature, this framework has not been used to estimate the effect of electricity regulation on economic growth. Understanding this effect is essential for the assessment of regulatory policy. Specifically, we assess the effects of two major areas of regulation, rene...

  3. Epigenetic regulation in obesity.

    Science.gov (United States)

    Drummond, Elaine M; Gibney, Eileen R

    2013-07-01

    Research suggests that 65% of variation in obesity is genetic. However, much of the known genetic associations have little known function and their effect size small, thus the gene-environment interaction, including epigenetic influences on gene expression, is suggested to be an important factor in the susceptibilty to obesity. This review will explore the potential of epigenetic markers to influence expression of genes associated with obesity. Epigenetic changes in utero are known to have direct implications on the phenotype of the offspring. More recently work has focused on how such epigenetic changes continue to regulate risk of obesity from infancy through to adulthood. Work has shown that, for example, hypomethylation of the MC4 gene causes an increase in expression, and has a direct impact on appetite and intake, and thus influences risk of obesity. Similar influences are also seen in other aspects of obesity including inflammation and adiposity. Maternal diet during foetal development has many epigenetic implications, which affect the offspring's risk factors for obesity during childhood and adulthood, and even in subsequent generations. Genes associated with risk of obesity, are susceptible to epigenetic mutations, which have subsequent effects on disease mechanisms, such as appetite and impaired glucose and insulin tolerance.

  4. Challenges in Regulating Ageing

    International Nuclear Information System (INIS)

    Tiippana, P.

    2016-01-01

    Finland has recent experience in regulating design, construction, commissioning and operation of nuclear facilities. Also decommissioning is topical as the research reactor will enter a decommissioning phase in the near future. From regulator’s point of view, the paper discusses potential challenges related to ageing management at the Finnish nuclear facilities throughout their lifetime. Based on the experience the most important decisions to ensure adequate provisions against adverse effects of various ageing phenomena and mechanisms are made much earlier than operation starts, namely during design, construction and manufacturing of systems, structures and components (SSC). Early consideration of ageing management resulting in good engineering including ageing-proof manufacturing and construction practices is of particular importance for new reactors. Elongated design lifetime of new reactors underlines the need of all available means to minimize progress of ageing beforehand and to create prerequisites for well-established condition monitoring and maintenance up to decommissioning. Furthermore, continuous research and development in order to understand various types of ageing and to detect degradation before SSC’s failure is expected as soon as a facility has been put in service. All these activities have to be supported by proper information and knowledge management in each phase of the facility’s life span. (author)

  5. [Ghrelin: beyond hunger regulation].

    Science.gov (United States)

    Milke García, Maria del Pilar

    2005-01-01

    Man ingests food to mitigate hunger (mediated by physiological and biochemical signals), satisfy appetite (subjective sensation) and because of psychosocial reasons. Satiation biomarkers (stop feeding) are gastric distention and hormones (CCK, GLP-1) and satiety biomarkers (induce feeding) are food-induced thermogenesis, body temperature, glycaemia and also hormones (insulin, leptin and ghrelin). Oxidative metabolism/body composition, tryptophan/serotonin and proinflammatory cytokines are also implicated on hunger physiology. At the present time, ghrelin is the only known circulating orexigenic with potential on hunger/body weight regulation. It is a neuropeptide (endogenous ligand for the GH secretagogue) recently isolated from the oxyntic mucosa and synthesized mainly in the stomach. Its blood concentration depends on diet, hyperglucemia and adiposity/leptin. It is secreted 1-2 hours preprandially and its concentration decreases drastically during the postprandium. Ghrelin acts on the lateral hypothalamus and theoretically inhibits proinflammatory cytokine secretion and antagonizes leptin. Ghrelin physiologically increases food intake and stimulates adipogenesis, gastrointestinal motility and gastric acid secretion, and has other hormonal and cardiovascular functions. Ghrelin blood concentration is reduced in massive obesity, non-alcoholic steatohepatitis, polycystic ovary syndrome, acromegaly, hypogonadism, ageing, short bowel syndrome and rheumatoid arthritis; and increased in primary or secondary anorexia, starvation, chronic liver disease and celiac disease. Cerebral and peritoneal ghrelin administration (rats) and systemic administration (rats and healthy volunteers, cancer patients or patients on peritoneal dialysis) promotes food consumption and increases adiposity, of utmost importance in the treatment of patients with anorexia.

  6. Regulating the sharing economy

    Directory of Open Access Journals (Sweden)

    Kristofer Erickson

    2016-06-01

    Full Text Available In this introductory essay, we explore definitions of the ‘sharing economy’, a concept indicating both social (relational, communitarian and economic (allocative, profit-seeking aspects which appear to be in tension. We suggest combining the social and economic logics of the sharing economy to focus on the central features of network enabled, aggregated membership in a pool of offers and demands (for goods, services, creative expressions. This definition of the sharing economy distinguishes it from other related peer-to-peer and collaborative forms of production. Understanding the social and economic motivations for and implications of participating in the sharing economy is important to its regulation. Each of the papers in this special issue contributes to knowledge by linking the social and economic aspects of sharing economy practices to regulatory norms and mechanisms. We conclude this essay by suggesting future research to further clarify and render intelligible the sharing economy, not as a contradiction in terms but as an empirically observable realm of socio-economic activity.

  7. Between regulation and independence

    International Nuclear Information System (INIS)

    Ladoucette, Ph. de

    2007-01-01

    This article stresses, first, on the differences between electricity and gas in terms of storability and place of production before introducing the gas sector and its reorganization and re-structuration in the framework of energy markets deregulation. Then, it presents the actions carried out by the commission of energy regulation (CRE) intended to improve the operation of the gas market: improvement of transparency, incitation to invest in transportation infrastructures, organisation of the downstream market and development of regional gas markets. Since July 1, 2007, the opening of gas market is juridically and technically complete. The role of CRE is also to inform the consumers and to warrant a non-discriminatory access to infrastructures in a context of sound competition. On this point, the new situation is satisfactory but improvements are needed to increase the offer. The future objectives of CRE is to maintain a climate favorable to investments, to implement stable and efficient conditions of access to infrastructures and, finally, to regularly work at the European scale for the building up of a domestic gas market synonymous of security of supplies, sustainable development and competitiveness. (J.S.)

  8. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  9. Personality and Emotion Regulation Strategies

    Directory of Open Access Journals (Sweden)

    Esti Hayu Purnamaningsih

    2017-01-01

    Full Text Available The emotions has many important functions in our life such as in relation of interpersonal communication, and health. In interpersonal communicative function aimed to signal to other information about internal state. Emotions manifests in specific cognitive, behavioural, and physiological reactions, thus closely related to health. There is wide variety of ways for individuals to regulate their emotion. In this regard, there are two kinds of emotion regulation strategy; first Antecedent-focused emotion regulation consisting of situation selection, situation modification, attentional deployment, cognitive change and second, Response-focused emotion regulation consisting of suppression. The purpose of this research is to investigate personality factors relate with emotion regulation strategies. 339 students from Faculty of Psychology, Universitas Gadjah Mada were participating in this study and given The Big Five Personality Factors (Ramdhani, 2012, adaptation, and the modified version of the Emotion Regulation Scale was used, Emotion Regulation Questionnaire (John & Gross, 2004 which measure personality and emotion regulation respectively. Using multiple regression analysis, the study indicated that personality predicts emotion regulation strategies.

  10. Utility regulation and competition policy

    International Nuclear Information System (INIS)

    Robinson, Colin

    2002-03-01

    Contents: 1. The New Electricity Trading Arrangements in England and Wales: A Review - David Currie, 2. A Critique of Rail Regulation - Dieter Helm, 3. Moving to a Competitive Market in Water - Colin Robinson, 4. The New Gas Trading Arrangements - George Yarrow, 5. A Review of Privatization and Regulation Experience in Britain - Irwin M. Stelzer, 6. Converging Communications: Implications for Regulation - Mark Armstrong, 7. Opening European Electricity and Gas Markets - Graham Shuttleworth, 8. Concurrency or Convergence? Competition and Regulation Under the Competition Act 1998 - Tom Sharpe QC, 9. Ten Years of European Merger Control - Paul Seabright. (Author)

  11. Drinking Water Contaminants -- Standards and Regulations

    Science.gov (United States)

    ... and Research Centers Contact Us Share Drinking Water Contaminants – Standards and Regulations EPA identifies contaminants to regulate ... other partners to implement these SDWA provisions. Regulated Contaminants National Primary Drinking Water Regulations (NPDWRs) - table of ...

  12. Choosing to regulate: does choice enhance craving regulation?

    Science.gov (United States)

    Mobasser, Arian; Zeithamova, Dagmar; Pfeifer, Jennifer H

    2018-01-01

    Abstract Goal-directed behavior and lifelong well-being often depend on the ability to control appetitive motivations, such as cravings. Cognitive reappraisal is an effective way to modulate emotional states, including cravings, but is often studied under explicit instruction to regulate. Despite the strong prediction from Self-Determination Theory that choice should enhance task engagement and regulation success, little is known empirically about whether and how regulation is different when participants choose (vs are told) to exert control. To investigate how choice affects neural activity and regulation success, participants reappraised their responses to images of personally-craved foods while undergoing functional neuroimaging. Participants were either instructed to view or reappraise (‘no-choice’) or chose freely to view or reappraise (‘yes-choice’). Choice increased activity in the frontoparietal control network. We expected this activity would be associated with increased task engagement, resulting in better regulation success. However, contrary to this prediction, choice slightly reduced regulation success. Follow-up multivariate functional neuroimaging analyses indicated that choice likely disrupted allocation of limited cognitive resources during reappraisal. While unexpected, these results highlight the importance of studying upstream processes such as regulation choice, as they may affect the ability to regulate cravings and other emotional states. PMID:29462475

  13. Post-translational regulation enables robust p53 regulation.

    Science.gov (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-08-30

    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  14. Constructing regulation and regulating for energy efficient construction

    Energy Technology Data Exchange (ETDEWEB)

    Shove, Elizabeth [Lancaster University (United Kingdom). Centre for the Study of Environmental Change

    1998-07-01

    This project considers the process of formulating energy-related building regulation in the light of the revisions to Part L (Conservation of Fuel and Power) of the Building Regulations for England and Wales. Details are given of the main objectives of the research, namely, the examination of the roles of the UK government, local government and pressure groups in shaping energy efficiency standards, the impacts of environmental regulations, the limits of energy-related regulation, environmental regulation of the building sector, and the features of energy related building control. This control is compared with current practice in other European countries. The methodology of the project involving the review of governmental documents and interviews is described. (UK)

  15. Regulation of electricity prices?

    International Nuclear Information System (INIS)

    Mihok, P.

    2006-01-01

    In this paper author deals with the regulation of electricity prices in the Slovak Republic. Author contests the social policy of the government through doped prices of electricity. Two thirds of electricity is generated in nuclear power plants in Slovakia. Hence, it is necessary to focus on the solution of problem of nuclear waste. In 2004 Ministry of Economy stated, that the deficit in nuclear fund, from which the country have to fully cover the costs of liquidation and final disposal of nuclear waste, is estimated in the amount of around 89 billion Slovak crowns (≅ 3.7 billion $). From it, so called historical deficit, which originated because of late foundation of fund, represents officially 15 billion Slovak crowns (≅ 0.62 billion $). In Slovakia exists the real risk, that by maintenance of present state by creation and draw of the fund, it will be possible to ensure only 39 per cent of financial sources necessary for full financial handling of the back part of nuclear energetic. Even though the Ministry of Economy in connection with privatisation of Slovenske elektrarne designed to decrease the transfers of operators of nuclear power plants into nuclear fund. In 2006 the Parliament decreased by the law the level of gains of the fund from sale of nuclear electricity (the second from two components of the gains of the fund) from 6.8 to 5.95 per cent from annual revenues. So the tax of forced reduction of the price of nuclear electricity will be represented by loading of the further generations

  16. Deceptive Business Practices: Federal Regulations.

    Science.gov (United States)

    Rohrer, Daniel Morgan

    Federal regulations to prevent deceptive advertising seek to balance the advertiser's freedom of speech with protection of the consumer. This paper discusses what the Federal Trade Commission (FTC) has done to regulate advertising and evaluates the adequacy of its controls. The commission uses cease-and-desist orders, affirmative disclosure,…

  17. The evolution of nuclear regulation

    International Nuclear Information System (INIS)

    Martin, A.

    1997-01-01

    The already not so young history of nuclear regulations shows patterns and specific causes that have characterized and influenced its own evolution as well as the industry itself. Today's regulation is facing relevant challenges with potential significant effects. The quest for higher regulatory efficiency brings up the increasing need to base future actions on firmly established strategies. (Author) 7 refs

  18. Gravity and body mass regulation

    Science.gov (United States)

    Warren, L. E.; Horwitz, B. A.; Fuller, C. A.

    1997-01-01

    The effects of altered gravity on body mass, food intake, energy expenditure, and body composition are examined. Metabolic adjustments are reviewed in maintenance of energy balance, neural regulation, and humoral regulation are discussed. Experiments with rats indicate that genetically obese rats respond differently to hypergravity than lean rats.

  19. Forhastet regulering af de store

    DEFF Research Database (Denmark)

    Thomsen, Steen

    2013-01-01

    Christiansborg gennemfører sandsynligvis en markant skærpet regulering af de store finansielle virksomheder. Det vil virke kontraktivt og medvirke til erhvervslivets kredittørke.......Christiansborg gennemfører sandsynligvis en markant skærpet regulering af de store finansielle virksomheder. Det vil virke kontraktivt og medvirke til erhvervslivets kredittørke....

  20. The Organization of Regulated Production

    DEFF Research Database (Denmark)

    Jansen, Jos; Jeon, Doh-Shin; Menicucci, Domenico

    2008-01-01

    We analyze the choice between vertical separation (VS) and vertical integration (VI) when two regulated firms produce complementary inputs with correlated costs and are protected by ex post break-even constraints. First, in the absence of collusion the regulator prefers VI (VS) for negative...

  1. Environmental regulation and international trade

    NARCIS (Netherlands)

    Mulatu, A.; Florax, R.J.G.M.; Withagen, C.A.A.M.

    2004-01-01

    We empirically investigate the responsiveness of international trade to the stringency of environmental regulation. Stringent environmental regulation may impair the export competitiveness of ´dirty´ domestic industries, and as a result, ´pollution havens´ emerge in countries where environmental

  2. Regulating Pornography: A Public Dilemma.

    Science.gov (United States)

    Thompson, Margaret E.; And Others

    1990-01-01

    Examines attitudes toward sex and pornography by means of a telephone survey of Dane County, Wisconsin, adults. Describes survey questions about sexual attitudes, perceived effects of pornography, and pornography regulation. Concludes that adults who feel more strongly that pornography has negative effects are more opposed to its regulation. (SG)

  3. RNA-guided transcriptional regulation

    Science.gov (United States)

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  4. REGULATION OF NATIONAL QUALIFICATIONS SYSTEMS

    Directory of Open Access Journals (Sweden)

    Anna A. Muravyeva

    2014-01-01

    Full Text Available The paper looks into the diverse aspects of qualifications system regulation, designed for balancing the supply and demand in the labor and educational service markets. Both the objects and mechanisms of such regulation are described. Special attention is given to institutions, involved in regulation of qualifications, and their jurisdiction. Another emphasis is on the industry-related regulation of qualifications which proved to be effective both on the national and European level. Such structures were first established on the national levels to regulate the qualifications and ensure their comparability and compatibility, given the economic globalization and growing labor and academic mobility. The author points out the role of the ministries of education and labor in maintaining a steady qualifications system, and outlines the positive experience of Great Britain using the industry councils for continuing development of qualifications system.

  5. Regulation of gas infrastructure expansion

    International Nuclear Information System (INIS)

    De Joode, J.

    2012-01-01

    The topic of this dissertation is the regulation of gas infrastructure expansion in the European Union (EU). While the gas market has been liberalised, the gas infrastructure has largely remained in the regulated domain. However, not necessarily all gas infrastructure facilities - such as gas storage facilities, LNG import terminals and certain gas transmission pipelines - need to be regulated, as there may be scope for competition. In practice, the choice of regulation of gas infrastructure expansion varies among different types of gas infrastructure facilities and across EU Member States. Based on a review of economic literature and on a series of in-depth case studies, this study explains these differences in choices of regulation from differences in policy objectives, differences in local circumstances and differences in the intrinsic characteristics of the infrastructure projects. An important conclusion is that there is potential for a larger role for competition in gas infrastructure expansion.

  6. Designing Next Generation Telecom Regulation

    DEFF Research Database (Denmark)

    Henten, Anders; Samarajiva, Rohan

    – ICT convergence regulation and multisector utility regulation. Whatever structure of next generation telecom regulation is adopted, all countries will need to pay much greater attention to the need for increased coordination of policy directions and regulatory activities both across the industries......Continuously expanding applications of information and communication technologies (ICT) are transforming local, national, regional and international economies into network economies, the foundation for information societies. They are being built upon expanded and upgraded national telecom networks...... to creating an environment to foster a massive expansion in the coverage and capabilities of the information infrastructure networks, with national telecom regulators as the key implementers of the policies of reform. The first phase of reform has focused on industry specific telecom policy and regulation...

  7. Regulation of GMOs in China.

    Science.gov (United States)

    Liu, Yinliang

    2008-12-01

    Genetically modified organisms (GMOs) are created by biotechnology to serve people with much benefit while may impose risks to ecological environment and human health and therefore need careful regulation. During the past two decades, GMOs have been well developed in China and so has their corresponding regulation. This paper reviews and comments the multiple aspects of mainly the agricultural GMOs, including their safety assessment, control measures, trade activities, import, labels, and GM food, which have been prescribed by the corresponding laws, regulations and administrative measures. It is held that till present a framework for regulation of agricultural GMOs and GM food has been established basically in China, while a more comprehensive system for regulation of all kinds of GMOs and all kinds of related activities is still needed at present and in the future.

  8. PPARγ regulates exocrine pancreas lipase.

    Science.gov (United States)

    Danino, Hila; Naor, Ronny Peri-; Fogel, Chen; Ben-Harosh, Yael; Kadir, Rotem; Salem, Hagit; Birk, Ruth

    2016-12-01

    Pancreatic lipase (triacylglycerol lipase EC 3.1.1.3) is an essential enzyme in hydrolysis of dietary fat. Dietary fat, especially polyunsaturated fatty acids (PUFA), regulate pancreatic lipase (PNLIP); however, the molecular mechanism underlying this regulation is mostly unknown. As PUFA are known to regulate expression of proliferator-activated receptor gamma (PPARγ), and as we identified in-silico putative PPARγ binding sites within the putative PNLIP promoter sequence, we hypothesized that PUFA regulation of PNLIP might be mediated by PPARγ. We used in silico bioinformatics tools, reporter luciferase assay, PPARγ agonists and antagonists, PPARγ overexpression in exocrine pancreas AR42J and primary cells to study PPARγ regulation of PNLIP. Using in silico bioinformatics tools we mapped PPARγ binding sites (PPRE) to the putative promoter region of PNLIP. Reporter luciferase assay in AR42J rat exocrine pancreas acinar cells transfected with various constructs of the putative PNLIP promoter showed that PNLIP transcription is significantly enhanced by PPARγ dose-dependently, reaching maximal levels with multi PPRE sites. This effect was significantly augmented in the presence of PPARγ agonists and reduced by PPARγ antagonists or mutagenesis abrogating PPRE sites. Over-expression of PPARγ significantly elevated PNLIP transcript and protein levels in AR42J cells and in primary pancreas cells. Moreover, PNLIP expression was up-regulated by PPARγ agonists (pioglitazone and 15dPGJ2) and significantly down-regulated by PPARγ antagonists in non-transfected rat exocrine pancreas AR42J cell line cells. PPARγ transcriptionally regulates PNLIP gene expression. This transcript regulation resolves part of the missing link between dietary PUFA direct regulation of PNLIP. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. The regulator's view

    International Nuclear Information System (INIS)

    Sendin, P.

    2004-01-01

    Spanish experience holds a relatively important position in the field of the decommissioning of nuclear and radioactive facilities. Nuclear facilities are subject to a system of prior authorization by the competent authorities before they come into service and to subsequent regulation and control during their operating life. Nuclear and radioactive facilities that stop operating, for technical or financial reasons or because they are compelled to, remain subject to this regulatory control system as long as the competent authorities consider that their residual radioactivity represents a potential source of radiological hazard to the individuals affected or entails an unacceptable environmental risk. The decommissioning of nuclear facilities is contemplated in Spain a further or an additional step of their life cycle in which, in principle, the whole regulatory framework in force during the previous stages - sitting, construction, commissioning, operation, etc. - remains applicable. The term decommissioning is used to delineate the final stage of the life of a definitely non-operational facility and also to introduce a new licensing regime and a new regulatory control scheme. In the regulatory context, the decommissioning of a facility is understood as a set of administrative and technical actions and processes whose purpose, once a facility has been withdrawn from service, is to release it from regulatory control and so to relieve the former licensee of its previous responsibilities relating to the facility's safety. With the increasing age of nuclear and radioactive facilities in service, and as the number of facilities reaching the end of their operating life rises, the administrative process required in order to decommissioning them safely has become a real challenge in all countries, especially in those like Spain with an old nuclear power programme. Let me first give you a quick overview of the Spanish regulatory decommissioning framework. Then I will try to

  10. Regulating chemicals: law, science, and the unbearable burdens of regulation.

    Science.gov (United States)

    Silbergeld, Ellen K; Mandrioli, Daniele; Cranor, Carl F

    2015-03-18

    The challenges of regulating industrial chemicals remain unresolved in the United States. The Toxic Substances Control Act (TSCA) of 1976 was the first legislation to extend coverage to the regulation of industrial chemicals, both existing and newly registered. However, decisions related to both law and science that were made in passing this law inevitably rendered it ineffectual. Attempts to fix these shortcomings have not been successful. In light of the European Union's passage of innovative principles and requirements for chemical regulation, it is no longer possible to deny the opportunity and need for reform in US law and practice.

  11. Ionising radiation: a guide to the Regulations

    International Nuclear Information System (INIS)

    Hughes, Donald.

    1986-01-01

    The author explains the basic requirements on health and safety personnel in relation to the Ionising Radiations Regulations 1985. The outline paper is presented under the following headings: Dose assessment, Interpretation and general regulations 1-5, Dose limitation regulations 6 and 7, Regulation of work - regulations 8-12, Dosimetry and medical surveillance - regulations 13-17, summary of records to be kept, entry to controlled areas, Control of radioactive substances -regulations 18-23, Monitoring of radiation regulation 24, Assessments and notifications - regulations 25-31, Safety of articles and equipment - regulations 32-34, Other guidance. (U.K.)

  12. Regulated electricity retailing in Chile

    Energy Technology Data Exchange (ETDEWEB)

    Galetovic, Alexander, E-mail: alexander@galetovic.cl [Facultad de Ciencias Economicas y Empresariales, Universidad de los Andes, Santiago, Chile. Av. San Carlos de Apoquindo 2200, Las Condes, Santiago (Chile); Munoz, Cristian M., E-mail: cmunozm@aes.com [AES Gener and Departamento de Ingenieria Electrica, Universidad Catolica de Chile (Chile)

    2011-10-15

    While some countries have unbundled distribution and retailing, skeptics argue that the physical attributes of electricity make retailers redundant. Instead, it is claimed that passive pass through of wholesale prices plus regulated charges for transmission and distribution suffice for customers to benefit from competitive generation markets. We review the Chilean experience with regulated retailing and pass through of wholesale prices. We argue that when energy wholesale prices are volatile and prices are stabilized, distortions emerge. Regulated retailers gain little by mitigating or correcting them. On the contrary, sometimes price distortions increase their profits. We estimate the cost of three distortions that neither regulated retailers nor the regulator have shown any interest in correcting. - Highlights: > We review Chile's experience with regulated electricity retailing. > Distortions emerge when energy wholesale prices are volatile and prices stabilized. > Regulated retailers gain little by mitigating or correcting distortions. > Sometimes price distortions increase retailers' profits. > We estimate the cost of three distortions, which retailers have not corrected.

  13. Regulated electricity retailing in Chile

    International Nuclear Information System (INIS)

    Galetovic, Alexander; Munoz, Cristian M.

    2011-01-01

    While some countries have unbundled distribution and retailing, skeptics argue that the physical attributes of electricity make retailers redundant. Instead, it is claimed that passive pass through of wholesale prices plus regulated charges for transmission and distribution suffice for customers to benefit from competitive generation markets. We review the Chilean experience with regulated retailing and pass through of wholesale prices. We argue that when energy wholesale prices are volatile and prices are stabilized, distortions emerge. Regulated retailers gain little by mitigating or correcting them. On the contrary, sometimes price distortions increase their profits. We estimate the cost of three distortions that neither regulated retailers nor the regulator have shown any interest in correcting. - Highlights: → We review Chile's experience with regulated electricity retailing. → Distortions emerge when energy wholesale prices are volatile and prices stabilized. → Regulated retailers gain little by mitigating or correcting distortions. → Sometimes price distortions increase retailers' profits. → We estimate the cost of three distortions, which retailers have not corrected.

  14. Grandfather regulations, new source bias, and state air toxics regulations

    International Nuclear Information System (INIS)

    Levinson, Arik

    1999-01-01

    This paper uses plant-level data from the Census of Manufactures and the variation in toxic air pollution regulations across states to measure the effects of laws that are more stringent for new sources of pollution than for existing sources (so-called 'grandfather' regulations). Of particular interest is the resulting 'new source bias' and its effects on capital vintage and investment. Two industries are examined: commercial printing, which has a local product market; and paint manufacturing, which has a more national market. In general, there seem to be no statistically significant differences in capital vintage or investment between plants in states that grandfather new sources of pollution, plants in states that have no air toxics regulations, and plants in states that regulate both new and existing sources

  15. Regulation of NF-κB activity in astrocytes: effects of flavonoids at dietary-relevant concentrations

    International Nuclear Information System (INIS)

    Spilsbury, Alison; Vauzour, David; Spencer, Jeremy P.E.; Rattray, Marcus

    2012-01-01

    Highlights: ► We tested the hypothesis that low concentrations of flavonoids inhibit NF-κB in astrocytes. ► Primary cultured astrocytes possess a functional κB-system, measured using luciferase assays. ► Seven flavonoids (100 nM–1 μM) failed to reduce NF-κB activity in astrocytes. ► Four flavonoids (100 nM–1 μM) failed to reduce TNFa-stimulated NF-κB activity in astrocytes. ► (−)-Epicatechin did not regulate nuclear translocation of the NF-κB subunit, p65. -- Abstract: Neuroinflammation plays an important role in the progression of neurodegenerative disorders such as Alzheimer’s disease and Parkinson’s disease. Sustained activation of nuclear transcription factor κB (NF-κB) is thought to play an important role in the pathogenesis of neurodegenerative disorders. Flavonoids have been shown to possess antioxidant and anti-inflammatory properties and we investigated whether flavonoids, at submicromolar concentrations relevant to their bioavailability from the diet, were able to modulate NF-κB signalling in astrocytes. Using luciferase reporter assays, we found that tumour necrosis factor (TNFα, 150 ng/ml) increased NF-κB-mediated transcription in primary cultures of mouse cortical astrocytes, which was abolished on co-transfection of a dominant-negative IκBα construct. In addition, TNFα increased nuclear localisation of p65 as shown by immunocytochemistry. To investigate potential flavonoid modulation of NF-κB activity, astrocytes were treated with flavonoids from different classes; flavan-3-ols ((−)-epicatechin and (+)-catechin), flavones (luteolin and chrysin), a flavonol (kaempferol) or the flavanones (naringenin and hesperetin) at dietary-relevant concentrations (0.1–1 μM) for 18 h. None of the flavonoids modulated constitutive or TNFα-induced NF-κB activity. Therefore, we conclude that NF-κB signalling in astrocytes is not a major target for flavonoids.

  16. Regulation of NF-{kappa}B activity in astrocytes: effects of flavonoids at dietary-relevant concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Spilsbury, Alison [Reading School of Pharmacy, University of Reading, Reading RG6 6UB (United Kingdom); Vauzour, David; Spencer, Jeremy P.E. [Molecular Nutrition Group, Centre for Integrative Neuroscience and Neurodynamics, School of Chemistry, Food and Pharmacy, University of Reading, Reading RG6 6AP (United Kingdom); Rattray, Marcus, E-mail: m.a.n.rattray@reading.ac.uk [Reading School of Pharmacy, University of Reading, Reading RG6 6UB (United Kingdom)

    2012-02-17

    Highlights: Black-Right-Pointing-Pointer We tested the hypothesis that low concentrations of flavonoids inhibit NF-{kappa}B in astrocytes. Black-Right-Pointing-Pointer Primary cultured astrocytes possess a functional {kappa}B-system, measured using luciferase assays. Black-Right-Pointing-Pointer Seven flavonoids (100 nM-1 {mu}M) failed to reduce NF-{kappa}B activity in astrocytes. Black-Right-Pointing-Pointer Four flavonoids (100 nM-1 {mu}M) failed to reduce TNFa-stimulated NF-{kappa}B activity in astrocytes. Black-Right-Pointing-Pointer (-)-Epicatechin did not regulate nuclear translocation of the NF-{kappa}B subunit, p65. -- Abstract: Neuroinflammation plays an important role in the progression of neurodegenerative disorders such as Alzheimer's disease and Parkinson's disease. Sustained activation of nuclear transcription factor {kappa}B (NF-{kappa}B) is thought to play an important role in the pathogenesis of neurodegenerative disorders. Flavonoids have been shown to possess antioxidant and anti-inflammatory properties and we investigated whether flavonoids, at submicromolar concentrations relevant to their bioavailability from the diet, were able to modulate NF-{kappa}B signalling in astrocytes. Using luciferase reporter assays, we found that tumour necrosis factor (TNF{alpha}, 150 ng/ml) increased NF-{kappa}B-mediated transcription in primary cultures of mouse cortical astrocytes, which was abolished on co-transfection of a dominant-negative I{kappa}B{alpha} construct. In addition, TNF{alpha} increased nuclear localisation of p65 as shown by immunocytochemistry. To investigate potential flavonoid modulation of NF-{kappa}B activity, astrocytes were treated with flavonoids from different classes; flavan-3-ols ((-)-epicatechin and (+)-catechin), flavones (luteolin and chrysin), a flavonol (kaempferol) or the flavanones (naringenin and hesperetin) at dietary-relevant concentrations (0.1-1 {mu}M) for 18 h. None of the flavonoids modulated constitutive or

  17. Hygienic regulation of ionizing radiations

    International Nuclear Information System (INIS)

    Saurov, M.M.

    1984-01-01

    Modern state of the problem on hygienic regulation of ionizing radiations is considered. Concepts and principles of the regulation based on risk concept are presented according to ICRP 26 and 27. Two types of risk are designated: ''absolute'' and ''relative'' ones. The concept of acceptable risk on the basis of cost - benefit ratio is substantiated. Special attention is paid to the principle of accounting the complex of health signs, when determining radiation hazard. To determine the level of permissible risk and permissible dose to population the concept of ''inadmissibility of s-tatistically significant risk'' has been developed. Standards, regulating population doses in the USSR, which are valid nowadays, are considered

  18. Introduction to international radio regulations

    Energy Technology Data Exchange (ETDEWEB)

    Radicella, S M [Abdus Salam International Centre for Theoretical Physics, Trieste (Italy)

    2003-12-15

    These lecture notes contain an overview of basic problems of the International Radio Regulations. Access to the existing information infrastructure, and to that of the future Information Society, depends critically on radio, especially in poor, remote and sparsely populated regions with under-developed telecommunication infrastructure. How the spectrum of radio frequencies is regulated has profound impact on the society, its security, prosperity, and culture. The radio regulations represent a very important framework for an adequate use of radio and should be known by all of those working in the field.

  19. Introduction to international radio regulations

    International Nuclear Information System (INIS)

    Radicella, S.M.

    2003-01-01

    These lecture notes contain an overview of basic problems of the International Radio Regulations. Access to the existing information infrastructure, and to that of the future Information Society, depends critically on radio, especially in poor, remote and sparsely populated regions with under-developed telecommunication infrastructure. How the spectrum of radio frequencies is regulated has profound impact on the society, its security, prosperity, and culture. The radio regulations represent a very important framework for an adequate use of radio and should be known by all of those working in the field

  20. Nanometrology - challenges for health regulation

    Directory of Open Access Journals (Sweden)

    Jailton Carreteiro Damasceno

    2013-11-01

    Full Text Available The relationship between metrology, nanotechnology and nanoscience and sanitary regulation is discussed from the point of view of its importance and the interrelationship between the themes for the development of products and services involving nanotech-nology. The discussion involves the main techniques for measuring dimensional, chemical and biological properties of materials, and presents some of the challenges for the future. Issues such as processes of standardization and regulation in Europe, U.S. and Brazil are also addressed, providing an overview of how these processes are related to sanitary regulation.

  1. Designing Next Generation Telecom Regulation

    DEFF Research Database (Denmark)

    Henten, Anders; Samarajiva, Rohan; Melody, William H.

    2003-01-01

    This article critically examines the multiple rationales for telecom, IT, media convergence regulation, on the one hand, and multisector utility regulation, on the other, and the practical questions of implementation they pose, with a view to contributing to informed policy and regulatory decisions...... to the regulatory process such as scarcity of regulatory resources and safeguards for regulatory independence, are examined. It is concluded that ICT and media convergence issues are primarily about improving the efficiency of market economies, and how changes in regulation can facilitate this process. Multi...

  2. Molecular Regulation of Histamine Synthesis

    Directory of Open Access Journals (Sweden)

    Hua Huang

    2018-06-01

    Full Text Available Histamine is a critical mediator of IgE/mast cell-mediated anaphylaxis, a neurotransmitter and a regulator of gastric acid secretion. Histamine is a monoamine synthesized from the amino acid histidine through a reaction catalyzed by the enzyme histidine decarboxylase (HDC, which removes carboxyl group from histidine. Despite the importance of histamine, transcriptional regulation of HDC gene expression in mammals is still poorly understood. In this review, we focus on discussing advances in the understanding of molecular regulation of mammalian histamine synthesis.

  3. Towards trust in regulation. Moving to a public value regulation

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, Catherine; Woodman, Bridget [Energy Policy Group, University of Exeter Cornwall Campus, Treliever Road, Penryn, TR10 9EZ (United Kingdom)

    2010-06-15

    The UK Government has committed itself to reducing its carbon dioxide emissions. The challenge of successfully achieving a transition to a sustainable energy system, in the context of the UK's largely privately owned energy industry, rests on the ability of policy makers to encourage and enable the necessary changes or innovation at all levels of the energy system. This paper argues that the UK's current, dominant political paradigm or framework (the regulatory state paradigm (RSP)) and within it, the role of the economic regulator, Ofgem acts as a fundamental block to this challenge. The current economic regulatory system is based on trust in the market, or on predicted (albeit theoretical) known outcomes. To expand our regulatory system to one which can deliver a sustainable energy system requires innovation in a certain direction (as opposed to any innovation). That is the antithesis of the current process of regulation. Trust is required that Ofgem, the economic regulator, will develop rules and incentives which deliver an agreed sustainable energy goal, which is 'trusted' to be the 'right' goal. This requires Ofgem moving away from ex-ante regulation to a type of regulation where all costs, benefits and outcomes cannot be known beforehand and where they cannot necessarily be quantifiable. This has, very provisionally, been called Public Value Regulation (PVR). (author)

  4. Attachment and Dyadic Regulation Processes.

    Science.gov (United States)

    Overall, Nickola C; Simpson, Jeffry A

    2015-02-01

    Insecurely attached people have relatively unhappy and unstable romantic relationships, but the quality of their relationships depends on how their partners regulate them. Some partners find ways to regulate the emotional and behavioral reactions of insecurely attached individuals, which promotes greater relationship satisfaction and security. We discuss attachment theory and interdependence dilemmas, and then explain how and why certain responses by partners assuage the cardinal concerns of insecure individuals in key interdependent situations. We then review recent studies illustrating how partners can successfully regulate the reactions of anxiously and avoidantly attached individuals, yielding more constructive interactions. We finish by considering how these regulation processes can create a more secure dyadic environment, which helps to improve relationships and attachment security across time.

  5. Network Regulation and Support Schemes

    DEFF Research Database (Denmark)

    Ropenus, Stephanie; Schröder, Sascha Thorsten; Jacobsen, Henrik

    2009-01-01

    -in tariffs to market-based quota systems, and network regulation approaches, comprising rate-of-return and incentive regulation. National regulation and the vertical structure of the electricity sector shape the incentives of market agents, notably of distributed generators and network operators......At present, there exists no explicit European policy framework on distributed generation. Various Directives encompass distributed generation; inherently, their implementation is to the discretion of the Member States. The latter have adopted different kinds of support schemes, ranging from feed....... This article seeks to investigate the interactions between the policy dimensions of support schemes and network regulation and how they affect the deployment of distributed generation. Firstly, a conceptual analysis examines how the incentives of the different market agents are affected. In particular...

  6. Electronic Code of Federal Regulations

    Data.gov (United States)

    National Archives and Records Administration — The Electronic Code of Federal Regulations (e-CFR) is the codification of the general and permanent rules published in the Federal Register by the executive...

  7. Comparison of some European regulations

    Energy Technology Data Exchange (ETDEWEB)

    Argyriadis, K [Germanisher Lloyd, Hamburg (Germany)

    1996-09-01

    Fatigue calculations are an essential part in certification of a wind turbine. Manufacturers have to fulfill recommendations of several different regulations throughout Europe with the result that the design has often to be altered to satisfy them. In general three national (D/GL, NL, DK), and two international (GL, IEC) regulations are in use, with the IEC standard getting more importance with wind energy deploying to more in regions with no yet clearly defined national standards (India, Spain). The Germanischer Lloyd made calculations for wind turbines they are certifying and in one case we compared the resulting damages for different regulations and classes on a 600 kW, three bladed, stall regulated wind turbine. (EG) 18 refs.

  8. How should Bitcoin be regulated ?

    OpenAIRE

    SHCHERBAK, Sergii

    2014-01-01

    The lack of clarity about Bitcoin’s legal framework has meant that none of the regulators across the EU have yet achieved sufficient clarity in the legal treatment of Bitcoin and its stakeholders. This uncertainty poses a number of substantial risks to Bitcoin stakeholders and creates challenges for regulatory authorities. Therefore, there is a need for a clear strategy for Bitcoin’s regulation aiming to ensure the maximum possible balance between the interests of Bitcoin stakeholders longing...

  9. Money Laundering and its Regulation

    OpenAIRE

    Alberto E. Chong; Florencio López-de-Silanes

    2007-01-01

    The recent wave of terrorist attacks has increased the attention paid to money laundering activities. Using several methodologies, this paper investigates empirically the determinants of money laundering and its regulation in over 80 countries by assembling a cross-country dataset on proxies for money laundering and the prevalence of feeding activities. The paper additionally constructs specific money laundering regulation indices based on available information on laws and their mechanisms of...

  10. The Legal Regulation of Cybersecurity

    OpenAIRE

    Darius Štitilis

    2013-01-01

    Cybercrime has become a global phenomenon, which is causing more harm to individual citizens, organizations, society and the state. Most countries in the world compare cybercrime with offences such as terrorism and drug trafficking due to its risks and profitability. Cybersecurity is the central category to fight cybercrime in cyberspace. Therefore, the strategic legal regulation of cybersecurity is one of the most relevant problems in EU, including Lithuania. So far cybersecurity legal regul...

  11. Regulation on control systems tests

    International Nuclear Information System (INIS)

    Grau, J.; Navarro, J.M.

    1978-01-01

    Requirements under regulation applicable to the testing of control systems and controlled equipments in the case of USA nuclear projects are examined. They are reviewed, in particular, the following standards and criteria: 10 Code of Federal Regulations 50, Appendix A, General Design Criteria 20 and 21; IEEE Standards 279 and 308; IEEE Standard 338; US Regulatory Guides 1.22 and 1.118.(J.E.de C.)

  12. Liquidity regulation and bank behavior

    OpenAIRE

    Bonner, C.

    2014-01-01

    In response to the 2007-08 financial crisis, the Basel Committee on Banking Supervision proposed two liquidity standards to reinforce banks’ resilience to liquidity risks. The purpose of this thesis is to analyze the impact of liquidity regulation on bank behavior. The first of four main chapters analyzes the development of global liquidity standards, their objectives as well as their interaction with capital standards. The analysis suggests that regulating capital is associated with declinin...

  13. Civilsamfundets ABC: R for Regulering

    DEFF Research Database (Denmark)

    Meyer, Gitte; Lund, Anker Brink

    2016-01-01

    Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til R for Regulering.......Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til R for Regulering....

  14. 7 CFR 987.48 - Container regulation.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container regulation. 987.48 Section 987.48... IN RIVERSIDE COUNTY, CALIFORNIA Order Regulating Handling Container Regulation § 987.48 Container regulation. Whenever the Committee deems it advisable to establish a container regulation for any variety of...

  15. Two new pollution regulations introduced

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    A newly proposed regulation in Ontario will require the mandatory tracking of 358 airborne pollutants by the electricity sector as well as by other large industrial facilities such as iron and steel manufacturers and petroleum refiners. If passed, the regulation would make Ontario the first jurisdiction in the world to require monitoring and reporting of a full suite of major greenhouse gases, including smog and acid-rain causing emissions. The proposed regulation also provides for immediate public access to any reported information. Ontario residents can comment on the proposed regulation through the Environmental Bill of Rights registry. A new, more severe hazardous waste regulation will also take effect on March 31, 2001, whereby testing for 88 contaminants will be done according to a new standard called the Toxicity Characteristic Leaching Procedure (TCLP). This new regulation also introduces a new 'derived from' rule which requires that a listed hazardous waste keep its classification until it can be demonstrated otherwise. Ontario's list of hazardous wastes has been updated to include 129 new chemicals and industrial processes. The Ontario Ministry has also adopted the Canada-wide Standards for Particulate Matter and Ozone, as well as the Canada-wide Standards for mercury emissions from base metal smelters as well as from incineration of sewage sludge and municipal, medical, hazardous waste

  16. Regulation Development for Drinking Water Contaminants

    Science.gov (United States)

    To explain what process and information underlies regulations including how the Safe Drinking Water Act applies to regulation development i.e. how does the drinking water law translate into regulations.

  17. To Regulate or Not to Regulate? Views on Electronic Cigarette Regulations and Beliefs about the Reasons for and against Regulation.

    Directory of Open Access Journals (Sweden)

    Ashley Sanders-Jackson

    Full Text Available Policies designed to restrict marketing, access to, and public use of electronic cigarettes (e-cigarettes are increasingly under debate in various jurisdictions in the US. Little is known about public perceptions of these policies and factors that predict their support or opposition.Using a sample of US adults from Amazon Mechanical Turk in May 2015, this paper identifies beliefs about the benefits and costs of regulating e-cigarettes and identifies which of these beliefs predict support for e-cigarette restricting policies.A higher proportion of respondents agreed with 8 different reasons to regulate e-cigarettes (48.5% to 83.3% agreement versus 7 reasons not to regulate e-cigarettes (11.5% to 18.9%. The majority of participants agreed with 7 out of 8 reasons for regulation. When all reasons to regulate or not were included in a final multivariable model, beliefs about protecting people from secondhand vapor and protecting youth from trying e-cigarettes significantly predicted stronger support for e-cigarette restricting policies, whereas concern about government intrusion into individual choices was associated with reduced support.This research identifies key beliefs that may underlie public support or opposition to policies designed to regulate the marketing and use of e-cigarettes. Advocates on both sides of the issue may find this research valuable in developing strategic campaigns related to the issue.Specific beliefs of potential benefits and costs of e-cigarette regulation (protecting youth, preventing exposure to secondhand vapor, and government intrusion into individual choices may be effectively deployed by policy makers or health advocates in communicating with the public.

  18. To Regulate or Not to Regulate? Views on Electronic Cigarette Regulations and Beliefs about the Reasons for and against Regulation.

    Science.gov (United States)

    Sanders-Jackson, Ashley; Tan, Andy S L; Bigman, Cabral A; Mello, Susan; Niederdeppe, Jeff

    2016-01-01

    Policies designed to restrict marketing, access to, and public use of electronic cigarettes (e-cigarettes) are increasingly under debate in various jurisdictions in the US. Little is known about public perceptions of these policies and factors that predict their support or opposition. Using a sample of US adults from Amazon Mechanical Turk in May 2015, this paper identifies beliefs about the benefits and costs of regulating e-cigarettes and identifies which of these beliefs predict support for e-cigarette restricting policies. A higher proportion of respondents agreed with 8 different reasons to regulate e-cigarettes (48.5% to 83.3% agreement) versus 7 reasons not to regulate e-cigarettes (11.5% to 18.9%). The majority of participants agreed with 7 out of 8 reasons for regulation. When all reasons to regulate or not were included in a final multivariable model, beliefs about protecting people from secondhand vapor and protecting youth from trying e-cigarettes significantly predicted stronger support for e-cigarette restricting policies, whereas concern about government intrusion into individual choices was associated with reduced support. This research identifies key beliefs that may underlie public support or opposition to policies designed to regulate the marketing and use of e-cigarettes. Advocates on both sides of the issue may find this research valuable in developing strategic campaigns related to the issue. Specific beliefs of potential benefits and costs of e-cigarette regulation (protecting youth, preventing exposure to secondhand vapor, and government intrusion into individual choices) may be effectively deployed by policy makers or health advocates in communicating with the public.

  19. Balancing Public and Private Regulation

    Directory of Open Access Journals (Sweden)

    Martijn Scheltema

    2016-01-01

    Full Text Available Voluntary Sustainability Standards (VSS might develop into a viable alternative to public regulation. However, it turns on the (regulatory circumstances whether that holds true in practice. If public regulation on CSR topics is lacking, governments are unable to agree upon certain topics on a global level or diverging public regulation exists, VSS can be helpful to set global standards. Obviously, private standards will especially be helpful if they are commensurate with local public legislation (and e.g. treaties and/or are accepted by local governments. If one neglects this, numerous domestic structures might exist that frustrate VSS. Furthermore, governments have to remain vigilant as to whether these private regimes do not result in market disruption, consumer detriment or hamper trade. VSS might also compete with public arrangements which might limit the uptake of VSS. However, if public regulation exists VSS might be a viable alternative if compliance with not too compelling public norms by market participants is rather poor and the public policymaker is aiming to incentivize the better performing part of the market to embark on higher standards and thus only desires to regulate the less performing part of the market. However, of paramount importance is the effectiveness of VSS in order to be a viable alternative to public regulation. The effectiveness of VSS should be assessed using an integrated multi-disciplinary (comparative approach entailing legal, impact-assessment, legitimacy, governance and behavioural aspects. Only effective VSS in the aforementioned sense are a true alternative to public regulation.Beyond that, the legal perspective in connection with (the effectiveness of VSS is discussed, featuring FSC and UTZ Certified as an example. It is important from this perspective that VSS have a clear and sufficiently selective objective and sufficiently specific norms, are regularly evaluated, entail ‘conflict of law rules’ and

  20. Re-Framing Biotechnology Regulation.

    Science.gov (United States)

    Peck, Alison

    Biotechnology is about to spill the banks of federal regulation. New genetic engineering techniques like CRISPR-Cas9 promise revolutionary breakthroughs in medicine, agriculture, and public health—but those techniques would not be regulated under the terms of the Coordinated Framework for Regulation of Biotechnology. This revolutionary moment in biotechnology offers an opportunity to correct the flaws in the framework, which was hastily patched together at the advent of the technology. The framework has never captured all relevant technologies, has never satisfied the public that risk is being effectively managed, and has never been accessible to small companies and publicly-funded labs that increasingly are positioned to make radical, life-saving innovations. This Article offers a proposal for new legislation that would reshape biotechnology regulation to better meet these goals. Key reforms include tying regulation to risk rather than technology category; consolidating agency review; capturing distinct regulatory expertise through inter-agency consultations; creating a clearinghouse to help guide applicants and disseminate information; setting up more comprehensive monitoring of environmental effects; and providing federal leadership to fill key data gaps and address socio-economic impacts.

  1. Progress toward risk informed regulation

    International Nuclear Information System (INIS)

    Rogers, K.C.

    1997-01-01

    For the last several years, the NRC, with encouragement from the industry, has been moving in the direction of risk informed regulation. This is consistent with the regulatory principle of efficiency, formally adopted by the Nuclear Regulatory Commission in 1991, which requires that regulatory activities be consistent with the degree of risk reduction they achieve. Probabilistic risk analysis has become the tool of choice for selecting the best of several alternatives. Closely related to risk informed regulation is the development of performance based rules. Such rules focus on the end result to be achieved. They do not specify the process, but instead establish the goals to be reached and how the achievement of those goals is to be judged. The inspection and enforcement activity is based on whether or not the goals have been met. The author goes on to offer comments on the history of the development of this process and its probable development in the future. He also addresses some issues which must be resolved or at least acknowledged. The success of risk informed regulation ultimately depends on having sufficiently reliable data to allow quantification of regulatory alternatives in terms of relative risk. Perhaps the area of human reliability and organizational performance has the greatest potential for improvement in reactor safety. The ability to model human performance is significantly less developed that the ability to model mechanical or electrical systems. The move toward risk informed, performance based regulation provides an unusual, perhaps unique, opportunity to establish a more rational, more effective basis for regulation

  2. Regulation of Autophagy by Kinases

    International Nuclear Information System (INIS)

    Sridharan, Savitha; Jain, Kirti; Basu, Alakananda

    2011-01-01

    Autophagy is a process of self-degradation that maintains cellular viability during periods of metabolic stress. Although autophagy is considered a survival mechanism when faced with cellular stress, extensive autophagy can also lead to cell death. Aberrations in autophagy are associated with several diseases, including cancer. Therapeutic exploitation of this process requires a clear understanding of its regulation. Although the core molecular components involved in the execution of autophagy are well studied there is limited information on how cellular signaling pathways, particularly kinases, regulate this complex process. Protein kinases are integral to the autophagy process. Atg1, the first autophagy-related protein identified, is a serine/threonine kinase and it is regulated by another serine/threonine kinase mTOR. Emerging studies suggest the participation of many different kinases in regulating various components/steps of this catabolic process. This review focuses on the regulation of autophagy by several kinases with particular emphasis on serine/threonine protein kinases such as mTOR, AMP-activated protein kinase, Akt, mitogen-activated protein kinase (ERK, p38 and JNK) and protein kinase C that are often deregulated in cancer and are important therapeutic targets

  3. Regulation of Autophagy by Kinases

    Energy Technology Data Exchange (ETDEWEB)

    Sridharan, Savitha; Jain, Kirti; Basu, Alakananda, E-mail: alakananda.basu@unthsc.edu [Department of Molecular Biology and Immunology, Institute for Cancer Research, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-06-09

    Autophagy is a process of self-degradation that maintains cellular viability during periods of metabolic stress. Although autophagy is considered a survival mechanism when faced with cellular stress, extensive autophagy can also lead to cell death. Aberrations in autophagy are associated with several diseases, including cancer. Therapeutic exploitation of this process requires a clear understanding of its regulation. Although the core molecular components involved in the execution of autophagy are well studied there is limited information on how cellular signaling pathways, particularly kinases, regulate this complex process. Protein kinases are integral to the autophagy process. Atg1, the first autophagy-related protein identified, is a serine/threonine kinase and it is regulated by another serine/threonine kinase mTOR. Emerging studies suggest the participation of many different kinases in regulating various components/steps of this catabolic process. This review focuses on the regulation of autophagy by several kinases with particular emphasis on serine/threonine protein kinases such as mTOR, AMP-activated protein kinase, Akt, mitogen-activated protein kinase (ERK, p38 and JNK) and protein kinase C that are often deregulated in cancer and are important therapeutic targets.

  4. Regulation of Autophagy by Kinases

    Science.gov (United States)

    Sridharan, Savitha; Jain, Kirti; Basu, Alakananda

    2011-01-01

    Autophagy is a process of self-degradation that maintains cellular viability during periods of metabolic stress. Although autophagy is considered a survival mechanism when faced with cellular stress, extensive autophagy can also lead to cell death. Aberrations in autophagy are associated with several diseases, including cancer. Therapeutic exploitation of this process requires a clear understanding of its regulation. Although the core molecular components involved in the execution of autophagy are well studied there is limited information on how cellular signaling pathways, particularly kinases, regulate this complex process. Protein kinases are integral to the autophagy process. Atg1, the first autophagy-related protein identified, is a serine/threonine kinase and it is regulated by another serine/threonine kinase mTOR. Emerging studies suggest the participation of many different kinases in regulating various components/steps of this catabolic process. This review focuses on the regulation of autophagy by several kinases with particular emphasis on serine/threonine protein kinases such as mTOR, AMP-activated protein kinase, Akt, mitogen-activated protein kinase (ERK, p38 and JNK) and protein kinase C that are often deregulated in cancer and are important therapeutic targets. PMID:24212825

  5. Regulation of Autophagy by Kinases

    Directory of Open Access Journals (Sweden)

    Savitha Sridharan

    2011-06-01

    Full Text Available Autophagy is a process of self-degradation that maintains cellular viability during periods of metabolic stress. Although autophagy is considered a survival mechanism when faced with cellular stress, extensive autophagy can also lead to cell death. Aberrations in autophagy are associated with several diseases, including cancer. Therapeutic exploitation of this process requires a clear understanding of its regulation. Although the core molecular components involved in the execution of autophagy are well studied there is limited information on how cellular signaling pathways, particularly kinases, regulate this complex process. Protein kinases are integral to the autophagy process. Atg1, the first autophagy-related protein identified, is a serine/threonine kinase and it is regulated by another serine/threonine kinase mTOR. Emerging studies suggest the participation of many different kinases in regulating various components/steps of this catabolic process. This review focuses on the regulation of autophagy by several kinases with particular emphasis on serine/threonine protein kinases such as mTOR, AMP-activated kinase, Akt, mitogen-activated protein kinase (ERK, p38 and JNK and protein kinase C that are often deregulated in cancer and are important therapeutic targets.

  6. Cosmetic Regulations: A Comparative Study.

    Science.gov (United States)

    Suhag, Jyoti; Dureja, Harish

    2015-01-01

    The regulatory framework, compliance requirement, efficacy, safety, and marketing of cosmetic products are considered the most important factors for growth of the cosmetic industry. There are different regulatory bodies across the globe that have their own insights for regulation; moreover, governments such as the United States, European Union, and Japan follow a stringent regulatory framework, whereas cosmetics are not so much strictly regulated in countries such as India, Brazil, and China. The alignment of a regulatory framework will play a significant role in the removal of barriers to trade, growth of market at an international level, innovation in the development and presentation of new products, and most importantly safety and efficacy of the marketed products. The present contribution gives insight into the important cosmetic regulations in areas of premarket approval, ingredient control, and labeling and warnings, with a special focus on the cosmetic regulatory environments in the United States, European Union, Japan, and India. Most importantly, the authors highlight the dark side of cosmetics associated with allergic reactions and even skin cancer. The importance of cosmetic regulations has been highlighted by dint of which the society can be healthier, accomplished by more stringent and harmonized regulations.

  7. 7 CFR 301.89-5 - Movement of regulated articles from regulated areas.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Movement of regulated articles from regulated areas. 301.89-5 Section 301.89-5 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL... § 301.89-5 Movement of regulated articles from regulated areas. (a) Any regulated article may be moved...

  8. Decisions to regulate genotoxic substances

    Energy Technology Data Exchange (ETDEWEB)

    Bengtsson, G

    1988-07-01

    Decisions to regulate genotoxic substances involve trade-offs between various incomparable factors such as risks to human health and other environmental risks, public perceptions, costs and uncertainties. Two different approaches towards these trade-offs are discussed. In one approach, all relevant factors are defined and trade-offs are considered using a general and very elaborate analysis. Cost-benefit analysis is an exponent of this approach. An illustration is given for the regulation of transboundary releases of radioactive materials. The other approach considers what is politically feasible for the time being and seeks a decision with much room for later corrections. Incrementalism is a philosophy in this vein. It is illustrated by reference to the regulation of transboundary air pollution. Weaknesses and strengths of the two approaches are discussed. (author)

  9. Digital Convergence and Content Regulation

    Directory of Open Access Journals (Sweden)

    Michael John Starks

    2014-12-01

    Full Text Available Broadcasting, Press and Internet journalism systems of distribution are converging: the same infrastructure can deliver all three historically separate services. Reception devices mirror this: the Connected TV, the tablet and the smart phone overlap in their functionality. Service overlaps are evident too, with broadcasters providing online and on-demand services and newspapers developing electronic versions. Does this mean that media regulation policies must converge too?My argument is that they should, though only where historically different communications are now fulfilling a similar function, e.g. broadcaster online services and electronic versions of newspapers. Convergence requires a degree of harmonisation and, to this end, I advocate a review of UK broadcasting's 'due impartiality' requirement and of the UK's application of the public service concept. I also argue for independent self-regulation (rather than state-based regulation of non-public-service broadcasting journalism.

  10. Environmental Regulation and International Trade

    Energy Technology Data Exchange (ETDEWEB)

    Mulatu, A. [London School of Economics, London (United Kingdom); Florax, R.J.G.M.; Withagen, C.A. [Faculty of Economics and Business Administration, Vrije Universiteit, Amsterdam (Netherlands)

    2004-07-01

    We empirically investigate the responsiveness of international trade to the stringency of environmental regulation. Stringent environmental regulation may impair the export competitiveness of 'dirty' domestic industries, and as a result, 'pollution havens' emerge in countries where environmental regulation is 'over-lax.' We examine the impact of pollution abatement and control costs on net exports in order to grasp this phenomenon. Theoretically, our analysis is related to a general equilibrium model of trade and pollution nesting the pollution haven motive for trade with the factor endowment motive. We analyze data on two-digit ISIC manufacturing industries during the period 1977-1992 in Germany, the Netherlands and the US, and show that trade patterns in 'dirty' commodities are jointly determined by relative factor endowments and environmental stringency differentials.

  11. Decisions to regulate genotoxic substances

    International Nuclear Information System (INIS)

    Bengtsson, G.

    1988-01-01

    Decisions to regulate genotoxic substances involve trade-offs between various incomparable factors such as risks to human health and other environmental risks, public perceptions, costs and uncertainties. Two different approaches towards these trade-offs are discussed. In one approach, all relevant factors are defined and trade-offs are considered using a general and very elaborate analysis. Cost-benefit analysis is an exponent of this approach. An illustration is given for the regulation of transboundary releases of radioactive materials. The other approach considers what is politically feasible for the time being and seeks a decision with much room for later corrections. Incrementalism is a philosophy in this vein. It is illustrated by reference to the regulation of transboundary air pollution. Weaknesses and strengths of the two approaches are discussed. (author)

  12. Guidelines on Building Regulations 2008

    DEFF Research Database (Denmark)

    Thse guidelines clarify and intepret the provisions of the Building Regulations of 2008 (BR08). The Guidelines, which match BR08 in terms of organisation into Parts, are accompanied by the full text of the regulations and the explanatory notes issued by the Danish Enterprise and Construction...... Authority. The Guidelines refer the reader to sources such as relevant standards, instructions and other background material which provides more detailed information. The Guidelines cover the same ground as BR08, including building control regulations, layout, fitting out, structures, fire safety, indoor...... climate, energy consumotion and services. The Guidelines are aimed at all professionals involved in building projects, particularly building design consultants, contractors and municipal application officers....

  13. Regulation of beta cell replication

    DEFF Research Database (Denmark)

    Lee, Ying C; Nielsen, Jens Høiriis

    2008-01-01

    Beta cell mass, at any given time, is governed by cell differentiation, neogenesis, increased or decreased cell size (cell hypertrophy or atrophy), cell death (apoptosis), and beta cell proliferation. Nutrients, hormones and growth factors coupled with their signalling intermediates have been...... suggested to play a role in beta cell mass regulation. In addition, genetic mouse model studies have indicated that cyclins and cyclin-dependent kinases that determine cell cycle progression are involved in beta cell replication, and more recently, menin in association with cyclin-dependent kinase...... inhibitors has been demonstrated to be important in beta cell growth. In this review, we consider and highlight some aspects of cell cycle regulation in relation to beta cell replication. The role of cell cycle regulation in beta cell replication is mostly from studies in rodent models, but whether...

  14. Retooling for new environmental regulations

    International Nuclear Information System (INIS)

    Levy, W.W.

    1997-01-01

    The petroleum industry is subject to regulations which require better management of emissions. This presentation discussed those regulations that dealt specifically with gasoline and diesel fuels and how they impact on vehicle emissions. The review showed that since 1975 the average fuel economy and improvements in tailpipe emissions for a light duty vehicle has increased significantly. Nitrogen oxide emissions were reduced by 94 per cent, carbon monoxide emissions were reduced by 96 per cent, and hydrocarbon emissions from tailpipes were reduced by 98 per cent. The phase-out of lead in fuel formulations, the controversy over the octane enhancing fuel additive MMT and a major study underway investigating the reduction of sulphur in gasoline, were also discussed. Future developments in regulations are likely to include capture of vapour emissions, mandatory inspection and maintenance programs, remote sensing of tailpipe emissions, and scrapping of old high emitting vehicles.5 figs

  15. Planned and proposed pipeline regulations

    International Nuclear Information System (INIS)

    De Leon, C.

    1992-01-01

    The Research and Special Programs Administration administers the Natural Gas Pipeline Safety Act of 1968 (NGPSA) and the Hazardous Liquid Pipeline Safety Act of 1979 (HLPSA). The RSPA issues and enforces design, construction, operation and maintenance regulations for natural gas pipelines and hazardous liquid pipelines. This paper discusses a number of proposed and pending safety regulations and legislative initiatives currently being considered by the RSPA and the US Congress. Some new regulations have been enacted. The next few years will see a great deal of regulatory activity regarding natural gas and hazardous liquid pipelines, much of it resulting from legislative requirements. The office of Pipeline Safety is currently conducting a study to streamline its operations. This study is analyzing the office's business, social and technical operations with the goal of improving overall efficiency, effectiveness, productivity and job satisfaction to meet the challenges of the future

  16. Air pollution control regulation. [Japan

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, K

    1975-05-01

    The Basic Law for Environmental Pollution Control is reviewed. The fundamental ideology of pollution control, range of pollution control, environmental standards, and national policy concerning pollution control are discussed. The content of the Air Pollution Control Law is summarized. The purpose of the Air Pollution Control Law, a list of substances regulated by the law, the type of facilities regulated by the law, control standards, type of control means, and emission standards for flue gas (sulfur oxides, particulate matters, and toxic substances) are described. The environmental standard for each pollutant and the target date for achieving the environmental standard are also given. The list of cities where the 7-rank K value control regulation for SOx is enforced is given. The procedure for registration in compliance with the law is also described.

  17. Assessing self-regulation strategies

    DEFF Research Database (Denmark)

    de Vet, Emely; de Ridder, Denise T. D.; Stok, Marijn

    2014-01-01

    intake and background characteristics. In study 3, the TESQ-E was administered twice within four weeks to evaluate test-retest reliability (n = 140). Study 4 was a cross-sectional survey (n = 93) that assessed the TESQ-E and related psychological constructs (e.g., motivation, autonomy, self-control). All...... general self-regulation and motivation measures. Conclusions: The TESQ-E provides a reliable and valid measure to assess six theory-based self-regulation strategies that adolescents may use to ensure their healthy eating....

  18. Supersymmetric regulators and supercurrent anomalies

    International Nuclear Information System (INIS)

    Majumdar, P.; Poggio, E.C.; Schnitzer, H.J.

    1980-01-01

    The supercurrent anomalies of the supercurrent deltasub(μ) of the supersymmetric Yang-Mills theory in Wess-Zumino gauge are computed using the supersymmetric dimensional regulator of Siegel. It is shown that γsub(μ)deltasup(μ) = 0 and deltasub(μ)deltasup(μ) unequal 0 in agreement with an earlier calculation based on the Adler-Rosenberg method. The problem of exhibiting the chiral anomaly and a regulator for local supersymmetry suggests that the interpretation of dimensional reduction in component language is incomplete. (orig.)

  19. Introduction to international radio regulations

    Energy Technology Data Exchange (ETDEWEB)

    Struzak, R

    2003-12-15

    These notes introduce the ITU Radio Regulations and related UN and WTO agreements that specify how terrestrial and satellite radio should be used in all countries over the planet. Access to the existing information infrastructure, and to that of the future Information Society, depends critically on these regulations. The paper also discusses few problems related to the use of the radio frequencies and satellite orbits. The notes are extracted from a book under preparation, in which these issues are discussed in more detail. (author)

  20. Introduction to international radio regulations

    International Nuclear Information System (INIS)

    Struzak, R.

    2003-01-01

    These notes introduce the ITU Radio Regulations and related UN and WTO agreements that specify how terrestrial and satellite radio should be used in all countries over the planet. Access to the existing information infrastructure, and to that of the future Information Society, depends critically on these regulations. The paper also discusses few problems related to the use of the radio frequencies and satellite orbits. The notes are extracted from a book under preparation, in which these issues are discussed in more detail. (author)

  1. Government regulation of gambling business

    Directory of Open Access Journals (Sweden)

    Stepasyuk S.A.

    2017-05-01

    Full Text Available the article deals with the problems of modern gambling business in the Russian Federation, political and legal, civil and economic aspects of state politics development in the field of activities regulation. The Federal Law regulating the activity of gambling business has been analyzed. The author has offered some developments of gambling business in the Russian Federation in order to increase the revenues to the budgets of the regions; to increase the attractiveness of the Russian resorts; to create more job opportunities and to eradicate unemployment.

  2. Gas distribution regulations (Nova Scotia)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-11-03

    A consolidation of Nova Scotia`s gas distribution regulations made under subsection 42(1) of the Gas Distribution Act S.N.S. 1997, c4 - O.I.C. 1998-576 (November 10, 1998), N.S. Reg. 86/98 are presented. The consolidation is issued for reference purposes only, and while it has no official sanction, it is considered useful in providing an interpretation of the regulation, explaining franchise evaluation, the granting of franchises, and exemptions from application requirements. 1 tab.

  3. Explaining (Missing) Regulator Paradigm Shifts

    DEFF Research Database (Denmark)

    Wigger, Angela; Buch-Hansen, Hubert

    2014-01-01

    The global financial and economic crisis has prompted some scholars to suggest that a fundamental regulatory shift away from neoliberalism will take place – both in general and in the field of EU competition regulation. This paper shows that so far no radical break with the neoliberal type...... regulation after the crisis in the 1970s, the paper argues that the preconditions for a fundamental shift in this issue area are not present this time around. Several reasons account for this: the current crisis has been construed by economic and political elites as a crisis within and not of neoliberal...

  4. Minsky and dynamic macroprudential regulation

    Directory of Open Access Journals (Sweden)

    Jan Kregel

    2014-06-01

    Full Text Available In the context of current debates about the proper form of prudential regulation and proposals for the imposition of liquidity and capital ratios, the paper examines Hyman Minsky’s work as a consultant to government agencies exploring financial regulatory reform in the 1960s. As the author explains, this often-overlooked early work, a precursor to Minsky’s “financial instability hypothesis”, serves as yet another useful guide to explaining why regulation and supervision in the lead-up to the 2008 financial crisis were flawed, and why the approach to reregulation after the crisis has been incomplete.

  5. Development of waste management regulations

    International Nuclear Information System (INIS)

    Elnour, E.G.

    2012-04-01

    Radioactive wastes are generated during nuclear fuel cycle operation, production and application of radioisotope in medicine, industry, research, and agriculture, and as a by product of natural resource exploitation, which includes mining and processing of ores. To ensure the protection of human health and the environment from the hazard of these wastes, a planned integrated radioactive waste management practice should be applied. The purpose of this study is to develop regulations for radioactive waste management for low and intermediate radioactive level waste (LILW), and other purpose of regulations is to establish requirements with which all organizations must comply in Sudan from LILW in particular disused/spent sources, not including radioactive waste for milling and mining practices. The national regulations regarding the radioactive waste management, should prescribe the allocation of responsibilities and roles of the Country, the regulatory body, user/owner, waste management organization, including regulations on transport packaging of waste and applied a quality assurance programme, to ensure that radioactive waste management is done safely and securely. (author)

  6. Regulating and Combating Underground Banking

    NARCIS (Netherlands)

    Borgers, M.J.

    2009-01-01

    In combating and regulating underground banking, a choice can be made of roughly two models, the risk model and the assimilation model. The risk model comes down to a complete prohibition of underground banking combined with an active investigation and prosecution policy. In the assimilation model,

  7. Transcriptional regulation of hepatic lipogenesis.

    Science.gov (United States)

    Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

    2015-11-01

    Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.

  8. Technical regulation of nondestructive inspection

    International Nuclear Information System (INIS)

    1995-01-01

    It starts with the explanation of definition of nondestructive inspection and qualifications for a inspection. It lists the technical regulations of nondestructive inspections which are radiographic testing, ultrasonic flaw detecting test, liquid penetrant test, magnetic particle inspection, eddy current test visual inspection and leakage test.

  9. Immune regulation by microbiome metabolites.

    Science.gov (United States)

    Kim, Chang H

    2018-03-22

    Commensal microbes and the host immune system have been co-evolved for mutual regulation. Microbes regulate the host immune system, in part, by producing metabolites. A mounting body of evidence indicates that diverse microbial metabolites profoundly regulate the immune system via host receptors and other target molecules. Immune cells express metabolite-specific receptors such as P2X 7 , GPR41, GPR43, GPR109A, aryl hydrocarbon receptor precursor (AhR), pregnane X receptor (PXR), farnesoid X receptor (FXR), TGR5 and other molecular targets. Microbial metabolites and their receptors form an extensive array of signals to respond to changes in nutrition, health and immunological status. As a consequence, microbial metabolite signals contribute to nutrient harvest from diet, and regulate host metabolism and the immune system. Importantly, microbial metabolites bidirectionally function to promote both tolerance and immunity to effectively fight infection without developing inflammatory diseases. In pathogenic conditions, adverse effects of microbial metabolites have been observed as well. Key immune-regulatory functions of the metabolites, generated from carbohydrates, proteins and bile acids, are reviewed in this article. © 2018 John Wiley & Sons Ltd.

  10. Deceptive Business Practices: State Regulations.

    Science.gov (United States)

    Rohrer, Daniel Morgan

    Although much has been done at the federal level to control deceptive advertising practices, many states have no criminal laws designed to regulate advertising, and several states recently repealed such laws. This paper examines states' efforts to balance the advertiser's freedom of speech with the consumer's need for information about products by…

  11. Lasp-1 regulates podosome function.

    Directory of Open Access Journals (Sweden)

    Miriam Stölting

    Full Text Available Eukaryotic cells form a variety of adhesive structures to connect with their environment and to regulate cell motility. In contrast to classical focal adhesions, podosomes, highly dynamic structures of different cell types, are actively engaged in matrix remodelling and degradation. Podosomes are composed of an actin-rich core region surrounded by a ring-like structure containing signalling molecules, motor proteins as well as cytoskeleton-associated proteins. Lasp-1 is a ubiquitously expressed, actin-binding protein that is known to regulate cytoskeleton architecture and cell migration. This multidomain protein is predominantely present at focal adhesions, however, a second pool of Lasp-1 molecules is also found at lamellipodia and vesicle-like microdomains in the cytosol.In this report, we show that Lasp-1 is a novel component and regulator of podosomes. Immunofluorescence studies reveal a localization of Lasp-1 in the podosome ring structure, where it colocalizes with zyxin and vinculin. Life cell imaging experiments demonstrate that Lasp-1 is recruited in early steps of podosome assembly. A siRNA-mediated Lasp-1 knockdown in human macrophages affects podosome dynamics as well as their matrix degradation capacity. In summary, our data indicate that Lasp-1 is a novel component of podosomes and is involved in the regulation of podosomal function.

  12. Entry: direct control or regulation?

    NARCIS (Netherlands)

    Perotti, E.; Vorage, M.

    2009-01-01

    We model a setting in which citizens form coalitions to seek preferential entry to a given market. The lower entry the higher firm profits and political contributions, but the lower social welfare. Politicians choose to either control entry directly and be illegally bribed, or regulate entry using a

  13. Hard work in soft regulation

    DEFF Research Database (Denmark)

    Hohnen, Pernille; Hasle, Peter; Helbo Jespersen, Anne

    Certified occupational health and safety management (OHSM) systems have become a global instrument in the regulation of work environment. However, their actual impact on occupational health and safety – in particular on ‘softer’ psychosocial areas of the working environment – has been questioned...

  14. Epigenetic regulation of macrophage function

    NARCIS (Netherlands)

    Hoeksema, M.A.

    2016-01-01

    Atherosclerosis is a lipid-driven chronic inflammatory disorder with a key role for macrophages in all disease stages. Macrophages are involved as scavengers of lipids, regulate inflammation, attract other immune cells and contribute to the resolution of inflammation, fibrosis and plaque stability.

  15. Incentives and regulation in banking

    NARCIS (Netherlands)

    Martynova, N.

    2015-01-01

    The financial crisis of 2007-2008 has unveiled the hidden flaws in the regulatory framework of the financial sector. The rules of the game established by regulators were not stringent enough and provided bankers with wrong incentives to gamble with depositors’ money. There are two major challenges

  16. Wave Dragon Buoyancy Regulation Study

    DEFF Research Database (Denmark)

    Jakobsen, Jens; Kofoed, Jens Peter

    Wave Dragon is a wave energy converter, which was deployed offshore at Nissum Bredning in Denmark in 2003. The experience gained from operating Wave Dragon during 2003 and 2004 has shown that the buoyancy regulation system can be improved in a number of ways. This study describes the current...

  17. Some regulation aspects in dismantling

    International Nuclear Information System (INIS)

    Niel, J.C.

    1993-01-01

    In the French regulation framework, operations linked to dismantling are controlled by an overall technical and legislative system applied to all the different stages of the facility (commissioning, etc.). Government control on facilities under dismantling is aimed at dismantling operation safety and security, and dismantling waste processing in order to ensure public and environmental protection

  18. Compliance with air quality regulations

    International Nuclear Information System (INIS)

    Steen, D.V.; Tackett, D.L.

    1990-01-01

    Due to the probable passage of Clean Air Act Amendments in 1990, electric utilities throughout the United States are faced with numerous choices to comply with the new acid rain regulations, expected in 1991. The choice of a compliance plan is not a simple task. Every compliance option will be costly. At Ohio Edison, deliberations are quite naturally influenced by past compliance with air quality regulations. This paper discusses compliance with air quality regulations in the 1970's, clean coal technologies and advanced scrubbers, and compliance with air quality regulations in 1995 - 2000. The choice of a compliance strategy for many utilities will involve serving customer loads through some combination of scrubbers, clean coal technologies, fuel switching, fuel blending, redispatch of units, and emissions trading. Whatever the final choice, it must be economic while providing sufficient flexibility to accommodate the critical uncertainties of load growth, state regulatory treatment, markets for emission allowances, advancements in control technologies, additional federal requirements for air emissions, equipment outages and fuel supply disruptions.s

  19. Transport regulation for radioactive materials

    International Nuclear Information System (INIS)

    Ha Vinh Phuong.

    1986-01-01

    Taking into account the specific dangers associated with the transport of radioactive materials (contamination, irradiation, heat, criticality), IAEA regulations concerning technical specifications and administrative procedures to ward off these dangers are presented. The international agreements related to the land transport, maritime transport and air transport of radioactive materials are also briefly reviewed

  20. Liquidity regulation and bank behavior

    NARCIS (Netherlands)

    Bonner, C.

    2014-01-01

    In response to the 2007-08 financial crisis, the Basel Committee on Banking Supervision proposed two liquidity standards to reinforce banks’ resilience to liquidity risks. The purpose of this thesis is to analyze the impact of liquidity regulation on bank behavior. The first of four main chapters

  1. Capital regulation and tail risk

    NARCIS (Netherlands)

    Perotti, E.; Ratnovski, L.; Vlahu, R.

    2011-01-01

    The paper studies risk mitigation associated with capital regulation, in a context when banks may choose tail risk assets. We show that this undermines the traditional result that higher capital reduces excess risk-taking driven by limited liability. When capital raising is costly, poorly

  2. Capital regulation and tail risk

    NARCIS (Netherlands)

    Perotti, E.; Ratnovski, L.; Vlahu, R.

    2011-01-01

    The paper studies risk mitigation associated with capital regulation, in a context where banks may choose tail risk assets. We show that this undermines the traditional result that higher capital reduces excess risk taking driven by limited liability. Moreover, higher capital may have an unintended

  3. The New Brussels I Regulation

    DEFF Research Database (Denmark)

    Arnt Nielsen, Peter

    2013-01-01

    The most important amendments to the Brussels I Regulation adopted on 12 December 2012 are presented and discussed. The amendments concern: 1) arbitration, 2) external situations, 3) choice-of-court agreements, and 4) abolition of exequatur. Compared to the Commission's ambitions, only modest...

  4. 7 CFR 3.87 - Agency regulations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Agency regulations. 3.87 Section 3.87 Agriculture Office of the Secretary of Agriculture DEBT MANAGEMENT Federal Salary Offset § 3.87 Agency regulations. USDA agencies may issue regulations or policies not inconsistent with OPM regulations (5 CFR part 550...

  5. 76 FR 62630 - Information Security Regulations

    Science.gov (United States)

    2011-10-11

    ... CENTRAL INTELLIGENCE AGENCY 32 CFR Part 1902 Information Security Regulations AGENCY: Central... information security regulations which have become outdated. The Executive Order upon which the regulations... CFR Part 1902 Information security regulations. PART 1902 [REMOVED AND RESERVED] Sec. 1902.13 [Removed...

  6. The Legal Regulation of Cybersecurity

    Directory of Open Access Journals (Sweden)

    Darius Štitilis

    2013-08-01

    Full Text Available Cybercrime has become a global phenomenon, which is causing more harm to individual citizens, organizations, society and the state. Most countries in the world compare cybercrime with offences such as terrorism and drug trafficking due to its risks and profitability. Cybersecurity is the central category to fight cybercrime in cyberspace. Therefore, the strategic legal regulation of cybersecurity is one of the most relevant problems in EU, including Lithuania. So far cybersecurity legal regulation analysis in scientific literature has been rather limited. The European Commission, together with the High Representative of the Union for Foreign Affairs and Security Policy, has published a cybersecurity strategy alongside a Commission proposed directive on network and information security (NIS. The cybersecurity strategy – “An Open, Safe and Secure Cyberspace” - represents the EU’s comprehensive vision on how best to prevent and respond to cyber disruptions and attacks. The purpose of its is to further European values of freedom and democracy and ensure the digital economy can safely grow. Specific actions are aimed at enhancing cyber resilience of information systems, reducing cybercrime and strengthening EU international cyber-security policy and cyber defence. The main goal of the paper is to analyze and compare the EU cybersecurity strategy and experience of several foreign countries with the strategic legal regulation of cybersecurity in Lithuania. The article consists of four parts. The first part dealt with the EU cybersecurity strategy. The second part of the article examines the comparative aspect of foreign cybersecurity strategic legal regulation. The third part deals with attempts in Lithuania to draft cybersecurity law and the holistic approach of cybersecurity legal regulation. The fourth part examines Lithuanian cybersecurity strategy and comments on the main probleas related with the strategy. Several different approaches

  7. Self-regulation in securities markets

    OpenAIRE

    Carson, John

    2011-01-01

    This paper canvasses the trends in self-regulation and the role of self-regulation in securities markets in different parts of the world. The paper also describes the conditions in which self-regulation might be an effective element of securities markets regulation, particularly in emerging markets. Use of self-regulation and self-regulatory organizations is often recommended in emerging m...

  8. Connections or conflicts between nuclear regulations and other regulations

    International Nuclear Information System (INIS)

    Shapar, H.K.

    1976-01-01

    The potential for conflicts between nuclear and other regulations stems in large part from overlapping jurisdictional lines which reflect not only the basic governmental structure but the political realities as well. A completely logical pattern - with a clear differentiation of responsibilities assigned to the various departments and agencies involved - is assuredly a worthy goal, but one not often, if ever, achieved. Fortunately, innovative means for obviating or mitigating the conflicts can be and have been found. (Auth) [fr

  9. Targeted genome regulation via synthetic programmable transcriptional regulators

    KAUST Repository

    Piatek, Agnieszka Anna

    2016-04-19

    Regulation of gene transcription controls cellular functions and coordinates responses to developmental, physiological and environmental cues. Precise and efficient molecular tools are needed to characterize the functions of single and multiple genes in linear and interacting pathways in a native context. Modular DNA-binding domains from zinc fingers (ZFs) and transcriptional activator-like proteins (TALE) are amenable to bioengineering to bind DNA target sequences of interest. As a result, ZF and TALE proteins were used to develop synthetic programmable transcription factors. However, these systems are limited by the requirement to re-engineer proteins for each new target sequence. The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated 9 (Cas9) genome editing tool was recently repurposed for targeted transcriptional regulation by inactivation of the nuclease activity of Cas9. Due to the facile engineering, simplicity, precision and amenability to library construction, the CRISPR/Cas9 system is poised to revolutionize the functional genomics field across diverse eukaryotic species. In this review, we discuss the development of synthetic customizable transcriptional regulators and provide insights into their current and potential applications, with special emphasis on plant systems, in characterization of gene functions, elucidation of molecular mechanisms and their biotechnological applications. © 2016 Informa UK Limited, trading as Taylor & Francis Group

  10. Regulating danger on the highways: hours of service regulations.

    Science.gov (United States)

    Mansfield, Daniel; Kryger, Meir

    2015-12-01

    Current hours of service regulations governing commercial truck drivers in place in the United States, Canada, Australia, and the European Union are summarized and compared to facilitate the assessment of the effectiveness of such provisions in preventing fatigue and drowsiness among truck drivers. Current hours of service provisions governing commercial truck drivers were derived from governmental sources. The commercial truck driver hours of service provisions in the United States, Canada, and the European Union permit drivers to work 14 hours and those of Australia permit drivers to work 12 hours a day on a regular basis. The regulations do not state what a driver may do with time off. They are consistent with a driver being able to drive after 24 hours without sleep. They do not take into account circadian rhythm by linking driving or rest to time of day. Current hours of service regulations governing commercial truck drivers leave gaps--permitting drivers to work long hours on a regular basis, permitting driving after no sleep for 24 hours, and failing to take into account the importance of circadian rhythm, endangering the public safety and the truck drivers themselves. Copyright © 2015 National Sleep Foundation. Published by Elsevier Inc. All rights reserved.

  11. Incentive regulation of nuclear power plants by state regulators

    International Nuclear Information System (INIS)

    Martin, R.L.; Baker, K.; Olson, J.

    1991-02-01

    The Nuclear Regulatory Commission (NRC) monitors incentive programs established by state regulators in order to obtain current information and to consider the potential safety effects of the incentive programs as applied to nuclear units. The current report is an update of NUREG/CR-5509, Incentive Regulation of Nuclear Power Plants by State Public Utility Commissions, published in December 1989. The information in this report was obtained from interviews conducted with each state regulator and each utility with a minimum entitlement of 10%. The agreements, orders, and settlements from which each incentive program was implemented were reviewed as required. The interviews and supporting documentation form the basis for the individual state reports describing the structure and financial impact of each incentive program. The programs currently in effect represent the adoption of an existing nuclear performance incentive program proposal and one new program. In addition, since 1989 a number of nuclear units have been included in one existing program; while one program was discontinued and another one concluded. 6 refs., 27 tabs

  12. Study on the Regulating Performance of Sliding Regulation-Valve

    Science.gov (United States)

    Hu, Wei; Peng, Xiaoyong; Zhang, Yuan; Zheng, Yulan; Zhu, Fangyao

    2018-01-01

    Using a proven reliable method of CFD to study the regulating performance of a sliding regulation valve with a conical spool and rugby body. The numerical simulation results indicate that no matter where the spool is located, the flow field always has a vortex at the center of the valve body; When the spool is at the origin, the vortex and resistance coefficient of the valve are the minimum; When the spool moves from the origin to the right (the opening of the valve becomes smaller) to reach a certain position later, vortex currents also begin to appear around the tube wall behind the orifice. In addition, the vortex increases as the throttling port decreases whereas the resistance coefficient of the valve ascends slowly with the increase of the deviation of the spool and the rise in series; This type of regulating valve has S type (slow at both ends, sensitive at the center) flow characteristics at the stroke, and is not affected by the size of Re.

  13. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  14. Frontiers of environmental regulation: environmental management systems: a regulator`s perspective

    Energy Technology Data Exchange (ETDEWEB)

    Stone, M.J. [South Australian Dept. of Mines and Energy, Adelaide, SA (Australia)

    1996-12-31

    Leading edge companies throughout the world have embraced management systems to achieve optimal sustainable performance in the ever changing business environment of the 1990s. Given that the natural environment and environmental performance have become major issues affecting organizations, the need for integrating environmental management with all the other components of an organization`s overall management approach is now widely recognized. This paper is organized in five parts. The first explores recently released environmental standards, the interim environmental management systems (EMS) general guidelines standard AS/NZS ISO 14004 (Int) and identifies how this has dealt with the regulator/community/company interface. The second identifies company requirements for addressing environmental issues. The third, considers regulatory theory to identify current requirements for an effective regulatory system and how this can interface with a company`s EMS. These form the basis in the fourth section for identifying some opportunities which occur at the company/ regulator interface. The fifth and final section draws a number of conclusions about the current frontiers of environmental regulation. The coincidence of the requirements of a regulatory framework with the areas of interface between what is referred to in the draft International Standard for EMS as `Interested Parties`, the regulators and community, are identified. (author). 1 tab., 2 figs., 20 refs.

  15. 75 FR 10997 - Cuban Assets Control Regulations; Sudanese Sanctions Regulations; Iranian Transactions Regulations

    Science.gov (United States)

    2010-03-10

    ... specific license, or otherwise exempt, the exportation of such services and software from the United States... services and software. Paragraph (c) of each of these two sections provides that specific licenses may be... Iranian Transactions Regulations to authorize the exportation of certain services and software incident to...

  16. Information, Interests, and Environmental Regulation

    DEFF Research Database (Denmark)

    Winter, Søren; May, Peter J.

    2002-01-01

    This study contributes to the understanding of informational approaches to bringing about compliance with environmental regulations with particular attention to differences in the influence of information provided by different information sources. Based on theorizing from a combination of informa......This study contributes to the understanding of informational approaches to bringing about compliance with environmental regulations with particular attention to differences in the influence of information provided by different information sources. Based on theorizing from a combination...... of information processing and interest group literatures, we develop hypotheses about regulatees' reliance upon and the influence of different sources of information. We test these hypotheses for Danish farmers’ compliance with agro-environmental rules. Our findings show that information plays a role in bringing...

  17. Ligand-regulated peptide aptamers.

    Science.gov (United States)

    Miller, Russell A

    2009-01-01

    The peptide aptamer approach employs high-throughput selection to identify members of a randomized peptide library displayed from a scaffold protein by virtue of their interaction with a target molecule. Extending this approach, we have developed a peptide aptamer scaffold protein that can impart small-molecule control over the aptamer-target interaction. This ligand-regulated peptide (LiRP) scaffold, consisting of the protein domains FKBP12, FRB, and GST, binds to the cell-permeable small-molecule rapamycin and the binding of this molecule can prevent the interaction of the randomizable linker region connecting FKBP12 with FRB. Here we present a detailed protocol for the creation of a peptide aptamer plasmid library, selection of peptide aptamers using the LiRP scaffold in a yeast two-hybrid system, and the screening of those peptide aptamers for a ligand-regulated interaction.

  18. Electric Power Regulation in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Landa, J V [Universidad Nacional Autonoma de Mexico, Mexico City (Mexico)

    1994-12-31

    The history of the electrical power sector in Mexico, the prominent role that government plays in the generation, transformation, distribution and supply of electrical power, and the implications of the North American Free Trade Agreement (NAFTA) for this sector were summarized. The slow pace of the Mexican electricity sector in achieving cost efficiency through pricing policy was criticized, and the issue of regulation versus deregulation of the electricity sector was examined in the context of NAFTA, emphasizing the contradiction between the idea of international trade and a highly regulated industry. Revisions of the original constitutional article to exclude electrical power generation from governmental control and to allow market mechanisms and competition to lower costs and increase efficiency was recommended.It was considered a pre-condition to a stable balance between competition and energy efficient environmentally friendly practices.

  19. Decentralized method for utility regulation

    Energy Technology Data Exchange (ETDEWEB)

    Loeb, M. (North Carolina State Univ., Raleigh); Magat, W.A.

    1979-10-01

    A new institutional arrangement for regulating utilities is suggested that minimizes the costs of natural monopolies. A mixture of regulation and franchising, the plan draws on the advantages of each and eliminates many of the problems. The proposal allows utilities to set their own price on the basis of demand and marginal-cost projections. Subsidies are provided by the regulatory agency if there is a consumer surplus. The system encourages the utility to select a competitive price and to produce only the amount of service needed. Operating efficiency is encouraged by rewarding cost reductions and discouraging cost overstatement at the rate review. The regulatory agency would not need to take action to bring price and marginal costs into equality. The franchise sale can be made by competitive bidding, in which the bidders would capitalize part or all of the subsidy or the regulatory agency could recover the subsidy in a lump-sum tax on the utility.

  20. Regulating health: transcending disciplinary boundaries.

    Science.gov (United States)

    Seddon, Toby

    2013-03-01

    Health and health care problems can be addressed from multiple disciplinary perspectives. This raises challenges for how to do cross-disciplinary scholarship in ways that are still robust, rigorous and coherent. This paper sets out one particular approach to cross-cutting research--regulation--which has proved extremely fertile for scholars working in diverse fields, from coal mine safety to tax compliance. The first part of the paper considers how regulatory ideas might be applied to health and health care research in general. The second part goes on to sketch out how a regulation perspective on one specific area, illicit drug policy, can open up new directions for research. In conclusion, a future research agenda is outlined for regulatory scholarship on health and health care.

  1. Culture, emotion regulation, and adjustment.

    Science.gov (United States)

    Matsumoto, David; Yoo, Seung Hee; Nakagawa, Sanae

    2008-06-01

    This article reports differences across 23 countries on 2 processes of emotion regulation--reappraisal and suppression. Cultural dimensions were correlated with country means on both and the relationship between them. Cultures that emphasized the maintenance of social order--that is, those that were long-term oriented and valued embeddedness and hierarchy--tended to have higher scores on suppression, and reappraisal and suppression tended to be positively correlated. In contrast, cultures that minimized the maintenance of social order and valued individual Affective Autonomy and Egalitarianism tended to have lower scores on Suppression, and Reappraisal and Suppression tended to be negatively correlated. Moreover, country-level emotion regulation was significantly correlated with country-level indices of both positive and negative adjustment. (PsycINFO Database Record (c) 2008 APA, all rights reserved).

  2. Public regulation of nuclear plants

    International Nuclear Information System (INIS)

    Burtheret, M.; Cormis, de

    1980-01-01

    The construction and operation of nuclear plants are subject to a complex system of governmental administration. The authors list the various governmental authorisations and rules applicable to these plants. In the first part, they describe the national regulations which relate specifically to nuclear plants, and emphasize the provisions which are intended to ensure the safety of the installations and the protection of the public against ionizing radiation. However, while the safety of nuclear plants is a major concern of the authorities, other interests are also protected. This is accomplished by various laws or regulations which apply to nuclear plants as well as other industrial installations. The duties which these texts, and the administrative practice based thereon, impose on Electricite de France are covered in the second part [fr

  3. Epigenetic microRNA Regulation

    DEFF Research Database (Denmark)

    Wiklund, Erik Digman

    2011-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs (ncRNAs) that negatively regulate gene expression post-transcriptionally by binding to complementary sequences in the 3’UTR of target mRNAs in the cytoplasm. However, recent evidence suggests that certain miRNAs are enriched in the nucleus, and their t......MicroRNAs (miRNAs) are small non-coding RNAs (ncRNAs) that negatively regulate gene expression post-transcriptionally by binding to complementary sequences in the 3’UTR of target mRNAs in the cytoplasm. However, recent evidence suggests that certain miRNAs are enriched in the nucleus...

  4. Molecular Mechanisms of Appetite Regulation

    Directory of Open Access Journals (Sweden)

    Ji Hee Yu

    2012-12-01

    Full Text Available The prevalence of obesity has been rapidly increasing worldwide over the last several decades and has become a major health problem in developed countries. The brain, especially the hypothalamus, plays a key role in the control of food intake by sensing metabolic signals from peripheral organs and modulating feeding behaviors. To accomplish these important roles, the hypothalamus communicates with other brain areas such as the brainstem and reward-related limbic pathways. The adipocyte-derived hormone leptin and pancreatic β-cell-derived insulin inform adiposity to the hypothalamus. Gut hormones such as cholecystokinin, peptide YY, pancreatic polypeptide, glucagon-like peptide 1, and oxyntomodulin transfer satiety signals to the brain and ghrelin relays hunger signals. The endocannabinoid system and nutrients are also involved in the physiological regulation of food intake. In this article, we briefly review physiological mechanisms of appetite regulation.

  5. Regulating Power from Supermarket Refrigeration

    DEFF Research Database (Denmark)

    O'Connell, Niamh; Madsen, Henrik; Pinson, Pierre

    2014-01-01

    the Danfoss refrigeration test centre. The complexities of modelling demand response are demonstrated through simulation. Simulations are conducted by placing the identified model in a direct-control demand response architecture, with power reference tracking using model predictive control. The energylimited......This paper presents an analysis of the demand response capabilities of a supermarket refrigeration system, with a particular focus on the suitability for participation in the regulating power market. An ARMAX model of a supermarket refrigeration system is identified using experimental data from...... nature of demand response from refrigeration is identified as the key consideration when considering participation in the regulating power market. It is demonstrated that by restricting the operating regions of the supermarket refrigeration system, a simple relationship can be found between the available...

  6. Epigenetic regulation of photoperiodic flowering

    OpenAIRE

    Takeno, Kiyotoshi

    2010-01-01

    The cytidine analogue 5-azacytidine, which causes DNA demethylation, induced flowering in the non-vernalization-requiring plants Perilla frutescens var. crispa, Silene armeria and Pharbitis nil (synonym Ipomoea nil) under non-inductive photoperiodic conditions, suggesting that the expression of photoperiodic flowering-related genes is regulated epigenetically by DNA methylation. The flowering state induced by DNA demethylation was not heritable. Changes in the genome-wide methylation state we...

  7. Insurance: Accounting, Regulation, Actuarial Science

    OpenAIRE

    Alain Tosetti; Thomas Behar; Michel Fromenteau; Stéphane Ménart

    2001-01-01

    We shall be examining the following topics: (i) basic frameworks for accounting and for statutory insurance rules; and (ii) actuarial principles of insurance; for both life and nonlife (i.e. casualty and property) insurance.Section 1 introduces insurance terminology, regarding what an operation must include in order to be an insurance operation (the legal, statistical, financial or economic aspects), and introduces the accounting and regulation frameworks and the two actuarial models of insur...

  8. Radiation Safety (Qualifications) Regulations 1980

    International Nuclear Information System (INIS)

    1980-01-01

    These Regulations, promulgated pursuant to the provisions of the Radiation Safety Act, 1975-1979, require persons engaged in activities involving radiation to pass a radiation safety examination or to possess an approved qualification in radiation. The National Health and Medical Research Council is authorised to exempt persons from compliance with these requirements or, conversely, to impose such requirements on persons other than those designated. (NEA) [fr

  9. Illiquidity, insolvency, and banking regulation

    OpenAIRE

    Cao, Jin

    2010-01-01

    This paper provides a compact framework for banking regulation analysis in the presence of uncertainty between systemic liquidity and solvency shocks. Extending the work by Cao & Illing (2009a, b), it is shown that systemic liquidity shortage arises endogenously as part of the inferior mixed strategy equilibrium. The paper compares dierent traditional regulatory policies which intend to fix the ineciencies, and argues that the co-existence of illiquidity and insolvency problems adds extra ...

  10. Radioactive waste management and regulation

    International Nuclear Information System (INIS)

    Willrich, M.

    1976-12-01

    The following conclusions are reached: (1) safe management of post-fission radioactive waste is already a present necessity and an irreversible long-term commitment; (2) basic goals of U.S. radioactive waste policy are unclear; (3) the existing organization for radioactive waste management is likely to be unworkable if left unchanged; and (4) the existing framework for radioactive waste regulation is likely to be ineffective if left unchanged

  11. Regulators of Tfh cell differentiation

    Directory of Open Access Journals (Sweden)

    Gajendra Motiram Jogdand

    2016-11-01

    Full Text Available The follicular helper T (Tfh cells help is critical for activation of B cells, antibody class switching and germinal center formation. The Tfh cells are characterized by the expression of CXCR5, ICOS, PD-1, Bcl-6, and IL-21. They are involved in clearing infections and are adversely linked with autoimmune diseases and also have a role in viral replication as well as clearance. Tfh cells are generated from naïve CD4 T cells with sequential steps involving cytokine signaling (IL-21, IL-6, IL-12, activin A, migration and positioning in the germinal center by CXCR5, surface receptors (ICOS/ICOSL, SAP/SLAM as well as transcription factor (Bcl-6, c-Maf, STAT3 signaling and repressor miR155. On the other hand Tfh generation is negatively regulated at specific steps of Tfh generation by specific cytokine (IL-2, IL-7, surface receptor (PD-1, CTLA-4, transcription factors Blimp-1, STAT5, T-bet, KLF-2 signaling and repressor miR 146a. Interestingly, miR 17-92 and FOXO1 acts as a positive as well as a negative regulator of Tfh differentiation depending on the time of expression and disease specificity. Tfh cells are also generated from the conversion of other effector T cells as exemplified by Th1 cells converting into Tfh during viral infection. The mechanistic details of effector T cells conversion into Tfh are yet to be clear. To manipulate Tfh cells for therapeutic implication and or for effective vaccination strategies, it is important to know positive and negative regulators of Tfh generation. Hence, in this review we have highlighted and interlinked molecular signaling from cytokines, surface receptors, transcription factors, ubiquitin Ligase and miRNA as positive and negative regulators for Tfh differentiation.

  12. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  13. On self regulation and laughter

    DEFF Research Database (Denmark)

    Buhl, Mie

      Abstract: The paper addresses the new premises for being a professional in the increasing virtual reality of universities. The new premises are being exemplified with the expansion of the professional duties of the university scholar to extend beyond merely acting as a disseminator of knowledge...... that video streaming increases self regulation and laughter. The discussions are based on empirical material in relation to both video streamed teaching sessions and online discussions....

  14. Self-regulation: the need to succeed

    International Nuclear Information System (INIS)

    Sorenson, G.C.

    1985-01-01

    The nuclear industry has long complained that it is over-regulated. Others - including the regulator - are now beginning to accept this complaint and acknowledge that perhaps the industry is over regulated and something should be done to provide relief. It is clear that regulation will not simply go away. The industry is perceived by some as one that cannot be trusted and must be closely regulated or serious health and safety consequences will result. Headlines claiming coverup of design deficiencies, allegations concerning construction problems, cheating on exams, mismanagement, intimidation of QA/QC personnel, etc., do little to dispel these concerns for the layman. This paper looks at two areas that must be considered in attempting to decrease the amount of regulator-imposed activities and increase self-regulation: 1) establish greater trust and confidence in the industry's ability to do a good job and be responsible for self-regulation; and 2) establish industry initiatives to regulate itself

  15. Circadian Regulation of Glutamate Transporters

    Directory of Open Access Journals (Sweden)

    Donají Chi-Castañeda

    2018-06-01

    Full Text Available L-glutamate is the major excitatory amino acid in the mammalian central nervous system (CNS. This neurotransmitter is essential for higher brain functions such as learning, cognition and memory. A tight regulation of extra-synaptic glutamate levels is needed to prevent a neurotoxic insult. Glutamate removal from the synaptic cleft is carried out by a family of sodium-dependent high-affinity transporters, collectively known as excitatory amino acid transporters. Dysfunction of glutamate transporters is generally involved in acute neuronal injury and neurodegenerative diseases, so characterizing and understanding the mechanisms that lead to the development of these disorders is an important goal in the design of novel treatments for the neurodegenerative diseases. Increasing evidence indicates glutamate transporters are controlled by the circadian system in direct and indirect manners, so in this contribution we focus on the mechanisms of circadian regulation (transcriptional, translational, post-translational and post-transcriptional regulation of glutamate transport in neuronal and glial cells, and their consequence in brain function.

  16. Redox regulation of plant development.

    Science.gov (United States)

    Considine, Michael J; Foyer, Christine H

    2014-09-20

    We provide a conceptual framework for the interactions between the cellular redox signaling hub and the phytohormone signaling network that controls plant growth and development to maximize plant productivity under stress-free situations, while limiting growth and altering development on exposure to stress. Enhanced cellular oxidation plays a key role in the regulation of plant growth and stress responses. Oxidative signals or cycles of oxidation and reduction are crucial for the alleviation of dormancy and quiescence, activating the cell cycle and triggering genetic and epigenetic control that underpin growth and differentiation responses to changing environmental conditions. The redox signaling hub interfaces directly with the phytohormone network in the synergistic control of growth and its modulation in response to environmental stress, but a few components have been identified. Accumulating evidence points to a complex interplay of phytohormone and redox controls that operate at multiple levels. For simplicity, we focus here on redox-dependent processes that control root growth and development and bud burst. The multiple roles of reactive oxygen species in the control of plant growth and development have been identified, but increasing emphasis should now be placed on the functions of redox-regulated proteins, along with the central roles of reductants such as NAD(P)H, thioredoxins, glutathione, glutaredoxins, peroxiredoxins, ascorbate, and reduced ferredoxin in the regulation of the genetic and epigenetic factors that modulate the growth and vigor of crop plants, particularly within an agricultural context.

  17. Neuroendocrine Regulation of Maternal Behavior

    Science.gov (United States)

    Bridges, Robert S.

    2015-01-01

    The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

  18. Hate crimes and normative regulation

    Directory of Open Access Journals (Sweden)

    Kovačević Milica

    2011-01-01

    Full Text Available This paper is primarily devoted to issues related to the normative regulation of hate crimes, with special reference to the regulations of the Republic of Serbia, which are indirectly related to this matter. This kind of crimes are characterized by prejudices that perpetrators have towards injured parties, as members of certain, mostly, minority groups, due to which many hate crimes could be also called crimes of prejudice. In comparative law there are two different basic directions when it comes to regulating hate crimes: separation of hate crimes in a separate category on the one hand, and punishment of perpetrators of criminal acts with the detriment of minority groups through the usual charges of a given criminal justice system, on the other. The author finds that, regardless of the formal response forms, real life suggests that hate crimes can be essentially suppressed only by promoting values such as equality, respect for diversity and tolerance, and by continuous education of public about the danger of hate crimes.

  19. NRC - regulator of nuclear safety

    International Nuclear Information System (INIS)

    1997-01-01

    The U.S. Nuclear Regulatory Commission (NRC) was formed in 1975 to regulate the various commercial and institutional uses of nuclear energy, including nuclear power plants. The agency succeeded the Atomic Energy Commission, which previously had responsibility for both developing and regulating nuclear activities. Federal research and development work for all energy sources, as well as nuclear weapons production, is now conducted by the U.S. Department of Energy. Under its responsibility to protect public health and safety, the NRC has three principal regulatory functions: (1) establish standards and regulations, (2) issue licenses for nuclear facilities and users of nuclear materials, and (3) inspect facilities and users of nuclear materials to ensure compliance with the requirements. These regulatory functions relate to both nuclear power plants and to other uses of nuclear materials - like nuclear medicine programs at hospitals, academic activities at educational institutions, research work, and such industrial applications as gauges and testing equipment. The NRC places a high priority on keeping the public informed of its work. The agency recognizes the interest of citizens in what it does through such activities as maintaining public document rooms across the country and holding public hearings, public meetings in local areas, and discussions with individuals and organizations

  20. Regulation of cell wall biosynthesis.

    Science.gov (United States)

    Zhong, Ruiqin; Ye, Zheng-Hua

    2007-12-01

    Plant cell walls differ in their amount and composition among various cell types and even in different microdomains of the wall of a given cell. Plants must have evolved regulatory mechanisms controlling biosynthesis, targeted secretion, and assembly of wall components to achieve the heterogeneity in cell walls. A number of factors, including hormones, the cytoskeleton, glycosylphosphatidylinositol-anchored proteins, phosphoinositides, and sugar nucleotide supply, have been implicated in the regulation of cell wall biosynthesis or deposition. In the past two years, there have been important discoveries in transcriptional regulation of secondary wall biosynthesis. Several transcription factors in the NAC and MYB families have been shown to be the key switches for activation of secondary wall biosynthesis. These studies suggest a transcriptional network comprised of a hierarchy of transcription factors is involved in regulating secondary wall biosynthesis. Further investigation and integration of the regulatory players participating in the making of cell walls will certainly lead to our understanding of how wall amounts and composition are controlled in a given cell type. This may eventually allow custom design of plant cell walls on the basis of our needs.

  1. Rethinking regulations for disposal criticality

    International Nuclear Information System (INIS)

    Scott, M.; Doering, T.

    1997-01-01

    This paper provides the basis for the position that the current U.S. Nuclear Regulatory Commission (NRC) criticality regulation is in need of revision to address problems in implementing it for the postclosure period in a geologic high-level waste repository. The authors believe that the applicant for such a facility should be able to demonstrate that postulated postclosure criticality events will not cause unacceptable risk of deleterious effects on public health and safety. In addition, the applicant should be expected to take practical and feasible measures to reduce the probability of a criticality occurring, even if (as expected) the consequences of such a criticality for repository performance and public health and safety would be negligible. This approach, while recognizing the probabilistic nature of analyses of events and conditions in the distant future, is also arguably consistent with the defense in depth concept that has been successfully applied to nuclear reactor regulation. The authors believe regulations for postclosure criticality control should support this dual approach, rather than require a deterministic prohibition of criticality as does the current rule. The existing rule seems appropriate for the preclosure period, as long as it is clearly specified to apply only to that period

  2. Deregulation, a challenge for regulators

    International Nuclear Information System (INIS)

    Alonso, Augustin

    2001-01-01

    Deregulation and competitiveness in the electricity market invites the plant owner/operator to reduce operating cost with a potential reduction in maintenance, degradation of investment in safety, reduction of operating staff and a downgrading in research and development. On the other side, deregulation and competitiveness brings the social and industrial benefit of reducing the electricity cost. Regulatory organisations have to watch that the safety level of the plant does not go beyond the established level, while recognising the benefits of the new situation; therefore they have the moral responsibility of regulating nuclear energy effectively and efficiently and in eliminating unnecessary regulatory burdens. Regulation has evolved with time and in accordance with the knowledge gained from research and the analysis of operating experience. The knowledge gained has made it possible to follow the path of other modern advanced technologies, where risk is quantified and the system approved when the risk becomes lower than an accepted level. The regulatory use of this advanced tool is being now developed by the most advanced regulatory organisations, under the name of risk informed regulation, where the reference level is the expected frequency of core damage. Deregulation and competitiveness will not change the basis of the already well established procedure to verify compliance. Nevertheless, the contents of Safety Analysis Reports and other regulatory documents, such as Technical Specifications for Operation, offer room for improvement in the sense of being more to the roots of the matter and becoming more efficient tools in the verification process. The contents of these documents have been evolving along the time and they have become unnecessary voluminous and rather burdensome. Much work has been done to improve the efficiency of regulatory inspections by concentrating on basic aspects. As a partial application of the already mentioned risk-informed regulation

  3. Regulation, control, tele-management; Regulation, commande, telegestion

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    In 1998, the French public authorities have started an ambitious energy mastery policy under the auspices of the Agency of environment and energy mastery (Ademe). One aspect of this policy concerns the R and D, industrial development and applications of automation and computerized control to the energy systems of buildings. This RCT 2000 seminar takes stock of the recent advances in this domain 7 years after the previous RCT issue. The first day of the seminar was devoted to new developments in regulation and control (ergonomics aspects, lighting systems, air conditioning in accommodations, solar systems etc..). Stress was put on the revolution expected with the introduction of domestic computer applications and Internet. This first day ended with a precise status of the standardization and future regulatory aspects. The second day was dealing with tele-management and technical management systems for buildings with an analysis of the impact of Internet and of the sensors and actuators capacity in information processing. The consequences and new requirements of the thermal regulation 2000 and the factors of success of a new start-up of the tele-management market in local authorities and social accommodations were analyzed too. (J.S.)

  4. Feedback regulation between autophagy and PKA.

    Science.gov (United States)

    Torres-Quiroz, Francisco; Filteau, Marie; Landry, Christian R

    2015-01-01

    Protein kinase A (PKA) controls diverse cellular processes and homeostasis in eukaryotic cells. Many processes and substrates of PKA have been described and among them are direct regulators of autophagy. The mechanisms of PKA regulation and how they relate to autophagy remain to be fully understood. We constructed a reporter of PKA activity in yeast to identify genes affecting PKA regulation. The assay systematically measures relative protein-protein interactions between the regulatory and catalytic subunits of the PKA complex in a systematic set of genetic backgrounds. The candidate PKA regulators we identified span multiple processes and molecular functions (autophagy, methionine biosynthesis, TORC signaling, protein acetylation, and DNA repair), which themselves include processes regulated by PKA. These observations suggest the presence of many feedback loops acting through this key regulator. Many of the candidate regulators include genes involved in autophagy, suggesting that not only does PKA regulate autophagy but that autophagy also sends signals back to PKA.

  5. 77 FR 4885 - Patent Compensation Board Regulations

    Science.gov (United States)

    2012-02-01

    ... existing regulations and the promulgation of new regulations, section 3(a) of E.O.12988, ``Civil Justice... constitutional and statutory authority supporting any action that would limit the policymaking discretion of the...

  6. The financial regulations of the Agency

    International Nuclear Information System (INIS)

    2000-01-01

    On 8 June 1999, the Board of Governors adopted certain amendments to the IAEA Financial Regulations to take effect from 1 January 2002. A consolidated text of the Financial Regulations, as revised, will be issued in 2001

  7. New regulation of radioactive materials transport

    International Nuclear Information System (INIS)

    Grenier, M.

    1993-01-01

    In this text we give the modifications bringed to the French regulation to take into account the IAEA recommendations of 1990 and the regulations of the European agreements RID and ADR. 3 figs., 6 refs

  8. 75 FR 10567 - Commerce Acquisition Regulation (CAR)

    Science.gov (United States)

    2010-03-08

    ... regulations, Federal acquisition regulations, Government procurement, Government contracts, Procurement, Reporting and recordkeeping requirements. 48 CFR Part 1302 Definitions, Government procurement, Terms. 48 CFR Part 1303 Antitrust, Conflict of interests, Ethical conduct, Government procurement, Reporting and...

  9. Emotion regulation strategies in Patients with schizophrenia

    NARCIS (Netherlands)

    van der Meer, Lisette; van't Wout, Mascha; Aleman, Andre

    2009-01-01

    Schizophrenia patients might experience difficulties in applying two widely used emotion regulation strategies, reappraisal and suppression. We investigated the relationships among emotion regulation strategies, alexithymia (i.e. inability to identify and verbalize feelings) and the role of

  10. A Consumer Protection Model for Regulating Lawyers.

    Science.gov (United States)

    Chalfie, Deborah M.

    1992-01-01

    Describes and critiques the "discipline model" of lawyer regulation from a consumer point of view and outlines an alternative model for regulating lawyers that is grounded in consumer protection principles. (JOW)

  11. Working without limits – reconsidering regulation

    DEFF Research Database (Denmark)

    Jensen, Per Langå

    2001-01-01

    In the light ofthe development of industry and working conditions present challenges to regulation is presented.......In the light ofthe development of industry and working conditions present challenges to regulation is presented....

  12. Contract & agency labour: beyond self-regulation?

    OpenAIRE

    Cotton, Elizabeth

    2010-01-01

    A paper about the regulation of contract labour. Academic and legal aspects as well as case studies of global union federation work to organise and regulate contract labour in Thailand, Pakistan, Colombia, South Korea and at international level.

  13. Securities regulation and implicit penalties

    Directory of Open Access Journals (Sweden)

    Donghua Chen

    2011-06-01

    Full Text Available The extant literature offers extensive support for the significant role played by institutions in financial markets, but implicit regulation and monitoring have yet to be examined. This study fills this void in the literature by employing unique Chinese datasets to explore the implicit regulation and penalties imposed by the Chinese government in regulating the initial public offering (IPO market. Of particular interest are the economic consequences of underwriting IPO deals for client firms that violate regulatory rules in China’s capital market. We provide evidence to show that the associated underwriters’ reputations are impaired and their market share declines. We further explore whether such negative consequences result from a market disciplinary mechanism or a penalty imposed by the government. To analyze the possibility of a market disciplinary mechanism at work, we investigate (1 the market reaction to other client firms whose IPO deals were underwritten by underwriters associated with a violation at the time the violation was publicly disclosed and (2 the under-pricing of IPO deals undertaken by these underwriters after such disclosure. To analyze whether the government imposes an implicit penalty, we examine the application processing time for future IPO deals underwritten by the associated underwriters and find it to be significantly longer than for IPO deals underwritten by other underwriters. Overall, there is little evidence to suggest that the market penalizes underwriters for the rule-violating behavior of their client firms in China. Instead, the Chinese government implicitly penalizes them by imposing more stringent criteria on and lengthening the processing time of the IPO deals they subsequently underwrite.

  14. Regulation of radioactive waste management

    International Nuclear Information System (INIS)

    2002-01-01

    This bulletin contains information about activities of the Nuclear Regulatory Authority of the Slovak Republic (UJD). In this leaflet the regulation of radioactive waste management of the UJD are presented. Radioactive waste (RAW) is the gaseous, liquid or solid material that contains or is contaminated with radionuclides at concentrations or activities greater than clearance levels and for which no use is foreseen. The classification of radioactive waste on the basis of type and activity level is: - transition waste; - short lived low and intermediate level waste (LlLW-SL); - long lived low and intermediate level waste (LlLW-LL); - high level waste. Waste management (in accordance with Act 130/98 Coll.) involves collection, sorting, treatment, conditioning, transport and disposal of radioactive waste originated by nuclear facilities and conditioning, transport to repository and disposal of other radioactive waste (originated during medical, research and industrial use of radioactive sources). The final goal of radioactive waste management is RAW isolation using a system of engineered and natural barriers to protect population and environment. Nuclear Regulatory Authority of the Slovak Republic regulates radioactive waste management in accordance with Act 130/98 Coll. Inspectors regularly inspect and evaluate how the requirements for nuclear safety at nuclear facilities are fulfilled. On the basis of safety documentation evaluation, UJD issued permission for operation of four radioactive waste management facilities. Nuclear facility 'Technologies for treatment and conditioning contains bituminization plants and Bohunice conditioning centre with sorting, fragmentation, evaporation, incineration, supercompaction and cementation. Final product is waste package (Fibre reinforced container with solidified waste) acceptable for near surface repository in Mochovce. Republic repository in Mochovce is built for disposal of short lived low and intermediate level waste. Next

  15. Regulated polyploidy in halophilic archaea.

    Directory of Open Access Journals (Sweden)

    Sebastian Breuert

    Full Text Available Polyploidy is common in higher eukaryotes, especially in plants, but it is generally assumed that most prokaryotes contain a single copy of a circular chromosome and are therefore monoploid. We have used two independent methods to determine the genome copy number in halophilic archaea, 1 cell lysis in agarose blocks and Southern blot analysis, and 2 Real-Time quantitative PCR. Fast growing H. salinarum cells contain on average about 25 copies of the chromosome in exponential phase, and their ploidy is downregulated to 15 copies in early stationary phase. The chromosome copy number is identical in cultures with a twofold lower growth rate, in contrast to the results reported for several other prokaryotic species. Of three additional replicons of H. salinarum, two have a low copy number that is not growth-phase regulated, while one replicon even shows a higher degree of growth phase-dependent regulation than the main replicon. The genome copy number of H. volcanii is similarly high during exponential phase (on average 18 copies/cell, and it is also downregulated (to 10 copies as the cells enter stationary phase. The variation of genome copy numbers in the population was addressed by fluorescence microscopy and by FACS analysis. These methods allowed us to verify the growth phase-dependent regulation of ploidy in H. salinarum, and they revealed that there is a wide variation in genome copy numbers in individual cells that is much larger in exponential than in stationary phase. Our results indicate that polyploidy might be more widespread in archaea (or even prokaryotes in general than previously assumed. Moreover, the presence of so many genome copies in a prokaryote raises questions about the evolutionary significance of this strategy.

  16. Autonomic Regulation of Splanchnic Circulation

    Directory of Open Access Journals (Sweden)

    Kathleen A Fraser

    1991-01-01

    Full Text Available The role of the autonomic nervous system in circulatory regulation of the splanchnic organs (stomach, small intestine, colon, liver, pancreas and spleen is reviewed. In general, the sympathetic nervous system is primarily involved in vasoconstriction, while the parasympathetic contributes to vasodilation. Vasoconstriction in the splanchnic circulation appears to be mediated by alpha-2 receptors and vasodilation by activation of primary afferent nerves with subsequent release of vasodilatory peptides, or by stimulation of beta-adrenergic receptors. As well, an important function of the autonomic nervous system is to provide a mechanism by which splanchnic vascular reserve can be mobilized during stress to maintain overall cardiovascular homeostasis.

  17. Regulation on radioactive waste management

    International Nuclear Information System (INIS)

    1999-01-01

    A national calculator control system for the metropolitan radioactive waste banks was developed in 1999. The NNSA reviewed by the regulations the feasibility of some rectification projects for uranium ore decommissioning and conducted field inspections on waste treating systems and radioactive waste banks at the 821 plant. The NNSA realized in 1999 the calculator control for the disposal sites of low and medium radioactive waste. 3 routine inspections were organized on the reinforced concrete structures for disposal units and their pouring of concrete at waste disposal site and specific requirements were put forth

  18. Pricing regulations in Great Britain

    International Nuclear Information System (INIS)

    Cicoletti, G.

    1993-01-01

    This paper briefly describes the structure and functions of Great Britain's essential electric power regulatory authority institutionalized by the 1989 British Electricity Act, i.e., the Office of Electricity Regulation, OFFER, and the responsibilities and tasks of the head of OFFER -the Director General of Electricity Supply (DGES). In particular, with regard to the latter, the paper describes how the DGES works together with regional electricity commissions to ensure the respect, by the various utilities, of consumer price caps and compliance with overall quality of service standards, as well as, to oversee 'pooling' activities by producers and distributors

  19. Pricing regulations in Great Britain

    International Nuclear Information System (INIS)

    Cicoletti, G.

    1993-01-01

    This paper briefly describes the structure and functions of Great Britain's essential electric power regulatory authority institutionalized by the 1989 British Electricity Act, i.e., the Office of Electricity Regulation, OFFER, and the responsibilities and tasks of the head of OFFER - the Director General of Electricity Supply (DGES). In particular, with regard to the latter, the paper describes how the DGES works together with regional electricity commissions to ensure the respect, by the various utilities, of consumer price caps and compliance with overall quality of service standards, as well as, to oversee 'pooling' activities by producers and distributors

  20. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  1. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  2. International aspect of waste regulations

    International Nuclear Information System (INIS)

    Nercy, B. de.

    1981-01-01

    The international agreements respecting the immersion of waste in the sea, the transportation of radioactive waste and the civil liability of the operators are examined. The specialized international organizations (IAEA, NEA, EEC) have, for many years now, been making a significant effort to bring together and unify the technical rules and legal standards. Finally, an endeavour is made to single out the broad lines of the foreign regulations relating to the long term control of radioactive waste which is beginning to come to light in various countries [fr

  3. Nuclear safety: risks and regulation

    International Nuclear Information System (INIS)

    Wood, W.C.

    1983-01-01

    Taking a fresh look at nuclear safety regulations, this study finds that the mandate and organization of the Nuclear Regulatory Commission (NRC) militate against its making sound decisions. The author criticizes failures to make hard decisions on societal risk, to clarify responsibility, and to implement cost-effective safety measures. Among his recommendations are reorganization of the NRC under a single authoritative administrator, separation of technical issues from social ones, and reform of the Price-Anderson Act. The author concludes that the worst eventuality would be to continue the current state of indecision. 161 references, 6 figures, 4 tables

  4. Power electronics converters and regulators

    CERN Document Server

    Dokić, Branko L

    2015-01-01

    This book is the result of the extensive experience the authors gained through their year-long occupation at the Faculty of Electrical Engineering at the University of Banja Luka. Starting at the fundamental basics of electrical engineering, the book guides the reader into this field and covers all the relevant types of converters and regulators. Understanding is enhanced by the given examples, exercises and solutions. Thus this book can be used as a textbook for students, for self-study or as a reference book for professionals.

  5. Model of accounting regulation in Lithuania

    OpenAIRE

    Rudžionienė, Kristina; Gipienė, Gailutė

    2008-01-01

    This paper analyses the regulation of accounting system in Lithuania. There are different approaches to accounting regulation. For example, the "free market" approach is against any regulation; it says that each process in the market will be in equilibrium itself. Mostly it is clear that regulation is important and useful, especially in financial accounting. It makes information in financial reports understandable and comparable in one country or different countries. There are three theories ...

  6. Analysis of the Portuguese building regulation system

    OpenAIRE

    Costa Branco De Oliveira Pedro, J.A.; Meijer, F.M.; Visscher, H.J.

    2008-01-01

    The Portuguese building regulation system has undergone significant changes in the last 20 years. Almost all building regulations presently in force were approved during that period. Some of those building regulations resulted from the transposition of European Directives. Other building regulations were changed due to improvements in the scientific knowledge. The changes in the building control system were mainly driven by an adaptation to more pressing circumstances of practice. The lack...

  7. Regulating a Monopoly Offering Priority Service

    OpenAIRE

    Matsukawa, Isamu

    2006-01-01

    This paper investigates the effects of alternative forms of regulation on the market penetration and capacity, which are determined by a profit-maximizing monopolist providing priority service to consumers. For continuous priority service, a minimum reliability standard, price cap and rate of return regulation lead to larger capacity than in the absence of regulation. A minimum reliability standard reduces the market penetration while price cap and rate of return regulation increase it. T...

  8. Regulations and instructions; Propisi i uputstva

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1960-07-01

    Regulations and instructions for operating the RA reactor consist of the following chapters: general regulations with the fundamental RA reactor characteristics, operating regulations and instructions for the personnel on duty, regulations for accidental conditions, training program for the staff of the Laboratory for reactor operation. Propisi i uputstva za rad reaktora RA sadrze sledeca poglavlja: opsti deo sa kratkim opisom karakteristika reaktora RA, propisi za rad dezurnog osoblja, propisi za slucaj udesa, program obuke osoblja Laboratorije za eksploataciju reaktora RA.

  9. Market reaction to bank liquidity regulation

    OpenAIRE

    Bruno, Brunella; Onali, Enrico; Schaeck, Klaus

    2018-01-01

    We measure market reactions to announcements concerning liquidity regulation, a key innovation in the Basel framework. Our initial results show that liquidity regulation attracts negative abnormal returns. However, the price responses are less pronounced when coinciding announcements concerning capital regulation are backed out, suggesting that markets do not consider liquidity regulation to be binding. Bank- and country-specific characteristics also matter. Liquid balance sheets and high cha...

  10. Emotional Intelligence of Self Regulated Learners

    Science.gov (United States)

    Rathore, Ami

    2018-01-01

    The study was conducted on self regulated learners of senior secondary school. The main objectives of the study were to find out significant dimensions of emotional intelligence held by self regulated learners. To compare the emotional intelligence dimensions of self regulated learners, in terms of subject and gender. To find out the relationship…

  11. 50 CFR 216.86 - Local regulations.

    Science.gov (United States)

    2010-10-01

    ... Pribilof Islands Administration § 216.86 Local regulations. Local regulations will be published from time... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Local regulations. 216.86 Section 216.86 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION...

  12. Good Practice Standards – a Regulation Tool

    DEFF Research Database (Denmark)

    Sørensen, Marie Jull

    2013-01-01

    The purpose of this article is to identify the considerations weighed in regulation with good practice standards. In this article, potential due process problems with regulation via legal standards are identified and compared to other considerations, which this regulation technique meets....

  13. The financial regulations of the Agency

    International Nuclear Information System (INIS)

    1994-01-01

    On 14 September 1994, the Board of Governors approved revised Financial Regulations of the Agency, with implementation of these Regulations beginning 1 January 1995. The Financial Regulations, as revised, are reproduced in this document for the information of all Member States

  14. Understanding Regulation of Metabolism through Feasibility Analysis

    NARCIS (Netherlands)

    Nikerel, I.E.; Berkhout, J.; Hu, F.; Teusink, B.; Reinders, M.J.T.; De Ridder, D.

    2012-01-01

    Understanding cellular regulation of metabolism is a major challenge in systems biology. Thus far, the main assumption was that enzyme levels are key regulators in metabolic networks. However, regulation analysis recently showed that metabolism is rarely controlled via enzyme levels only, but

  15. Business Models and Regulation | Distributed Generation Interconnection

    Science.gov (United States)

    Collaborative | NREL Business Models and Regulation Business Models and Regulation Subscribe to new business models and approaches. The growing role of distributed resources in the electricity system is leading to a shift in business models and regulation for electric utilities. These

  16. The theory of regulation : a review article

    NARCIS (Netherlands)

    Uche, C.U.

    2001-01-01

    This paper examines the various theoretical issues in regulation with a view to enhancing understanding of the regulation arena. Special emphasis has been placed on the banking industry. The paper shows how regulation serves different purposes for different interest groups on different occasions. It

  17. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  18. No. 434 - Radiation Control Regulation 1993

    International Nuclear Information System (INIS)

    1993-01-01

    This Regulation, made under the Radiation Control Act 1990, replaces the Radioactive Substances Regulation 1959, repealed by the 1990 Act. It deals with licensing of the use of radioactive substances and radiation apparatus, regulates their use, disposal and transport. It also provides for radiation monitoring and emergency planning. (NEA)

  19. Definitional Issues in Emotion Regulation Research

    Science.gov (United States)

    Bridges, Lisa J.; Denham, Susanne A.; Ganiban, Jody M.

    2004-01-01

    Operational definitions of emotion regulation are frequently unclear, as are links between emotion regulation measures and underlying theoretical constructs. This is of concern because measurement decisions can have both intentional and unintentional implications for underlying conceptualizations of emotion regulation. This report examines the…

  20. 78 FR 15869 - Repeal of Disclosure Regulations

    Science.gov (United States)

    2013-03-13

    ...) with respect to the entities regulated by OFHEO and by the Finance Board. The regulations being repealed govern public financial disclosures made by the entities with respect to certain federal... Government to regulate and oversee the Federal National Mortgage Association, the Federal Home Loan Mortgage...

  1. 76 FR 79529 - Community Reinvestment Act Regulations

    Science.gov (United States)

    2011-12-22

    ... ``agencies'') are amending their Community Reinvestment Act (CRA) regulations to adjust the asset-size... ``intermediate small savings association.'' As required by the CRA regulations, the adjustment to the threshold... Description of the Joint Final Rule The agencies' CRA regulations establish CRA performance standards for...

  2. 25 CFR 275.4 - Implementing regulations.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Implementing regulations. 275.4 Section 275.4 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM STAFFING § 275.4 Implementing regulations. Regulations to implement section 105 of the Act...

  3. Self-Regulation in Online Learning

    Science.gov (United States)

    Cho, Moon-Heum; Shen, Demei

    2013-01-01

    The purpose of this study was to examine the role of goal orientation and academic self-efficacy in student achievement mediated by effort regulation, metacognitive regulation, and interaction regulation in an online course. The results show that intrinsic goal orientation and academic self-efficacy predicted students' metacognitive…

  4. 76 FR 9988 - Improving EPA Regulations

    Science.gov (United States)

    2011-02-23

    ... suggestions do you have for how the Agency could change the regulations to be more flexible? 6. Benefits and... public input on the design of a plan to use for periodic retrospective review of its regulations. DATES... At this time, EPA seeks help in designing the plan it will use for periodic review of regulations...

  5. Self-regulation through Goal Setting

    DEFF Research Database (Denmark)

    Koch, Alexander; Nafziger, Julia

    self-control problems. We show how goals permit self-regulation, but also that they are painful self-disciplining devices. Greater self-control problems therefore lead to stronger self-regulation through goals only up to a certain point. For severely present-biased preferences, the required goal...... for self-regulation is too painful and the individual rather gives up....

  6. [Consideration of Mobile Medical Device Regulation].

    Science.gov (United States)

    Peng, Liang; Yang, Pengfei; He, Weigang

    2015-07-01

    The regulation of mobile medical devices is one of the hot topics in the industry now. The definition, regulation scope and requirements, potential risks of mobile medical devices were analyzed and discussed based on mobile computing techniques and the FDA guidance of mobile medical applications. The regulation work of mobile medical devices in China needs to adopt the risk-based method.

  7. Reducing Ripple In A Switching Voltage Regulator

    Science.gov (United States)

    Paulkovich, John; Rodriguez, G. Ernest

    1994-01-01

    Ripple voltage in output of switching voltage regulator reduced substantially by simple additional circuitry adding little to overall weight and size of regulator. Heretofore, additional filtering circuitry needed to obtain comparable reductions in ripple typically as large and heavy as original regulator. Current opposing ripple current injected into filter capacitor.

  8. NRC regulation of DOE facilities

    International Nuclear Information System (INIS)

    Buhl, A.R.; Edgar, G.; Silverman, D.; Murley, T.

    1997-01-01

    The US Department of Energy (DOE), its contractors, and the Nuclear Regulatory Commission (NRC) are in for major changes if the DOE follows through on its intentions announced December 20, 1996. The DOE is seeking legislation to establish the NRC as the regulatory agency with jurisdiction over nuclear health, safety, and security at a wide range of DOE facilities. At this stage, it appears that as many as 200 (though not all) DOE facilities would be affected. On March 28, 1997, the NRC officially endorsed taking over the responsibility for regulatory oversight of DOE nuclear facilities as the DOE had proposed, contingent upon adequate funding, staffing resources, and a clear delineation of NRC authority. This article first contrasts the ways in which the NRC and the DOE carry out their basic regulatory functions. Next, it describes the NRC's current authority over DOE facilities and the status of the DOE's initiative to expand that authority. Then, it discusses the basic changes and impacts that can be expected in the regulation of DOE facilities. The article next describes key lessons learned from the recent transition of the GDPs from DOE oversight to NRC regulation and the major regulatory issues that arose in that transition. Finally, some general strategies are suggested for resolving issues likely to arise as the NRC assumes regulatory authority over DOE facilities

  9. New technologies to meet regulations

    International Nuclear Information System (INIS)

    Frank, C.; Harmon, L.

    1991-01-01

    The US Department of Energy's (DOE's) Office of Environmental Restoration and Waste Management has set the ambitious goal of having all of its facilities cleaned up and in compliance with applicable environmental laws and regulations by the year 2019. This goal is ambitious both because of the magnitude of the effort required and because, in many cases, the means for attaining the goal do not now exist. The DOE's strategy for reaching its goal is based on applied research and development, education, and cooperation with regulators. The Office of Technology Development (OTD) within the Office of Environmental Restoration and Waste Management has instituted a program to assess the magnitude of the cleanup effort and to evaluate the potential technologies to be used. The OTD has program responsibility for providing new and more effective technologies for meeting DOE's goal for compliance and cleanup. Included are research and development of new technologies; demonstration, testing, and evaluation of technologies developed elsewhere; transportation; and educational programs to produce the scientists and engineers needed to maintain the momentum of research, development, demonstration, testing, and evaluation (RDDT and E) until the job is complete

  10. [Drug regulation: theory and practice].

    Science.gov (United States)

    Zara Yahni, C; Segú Tolsa, L; Font Pous, M; Rovira, J

    1998-01-01

    Regulation of drugs from the public administration is an activity which is produced in different countries independently from the sanitary model they own. In the field of public financing of drugs there have been several measures to improve the efficiency of their use. However, the analysis of the impact of these measures is complex and this may justify the shortage of objectivable results, especially at long term. The objective of this study is to perform a systematic review of such measures due to the need to have information about the different alternatives before making a decision. The introduction of an isolated measure is in many cases compensated by other changes in other regulating or aiding fields which suggests the creation of an integral strategy which affects different fields (supply/demand of drugs and prescribers). It seems necessary to suggest a social debate taking as a basis the scientific information available at the moment and promote the taking of decisions which lead to a rational use of the available pharmacological resources.

  11. Strategic regulation of gas transport

    International Nuclear Information System (INIS)

    Nese, Gjermund; Straume, Odd Rune

    2005-01-01

    The basis of the article has been the steadily increasing focus particularly from EU, on increased competition in the natural gas markets. This could influence the profit distribution between the gas producing and consuming counties which is an important problem situation for Norway as a gas producer. The gas market value chain consist of three parts (production, transport and distribution). How the countries may use strategic regulation of the transport tariff for the transport and distribution systems in order to move as much as possible of the total profit to the part of the value chain in control is studied. The focus has been on how increased competition influences the incentives of the authorities through low or high transport tariff and to what extent increased competition influences the welfare level in the producer and consumer counties when strategic regulations of the transport occur. The analysis is based on a theoretical model developed in 2005. Some central mechanisms related to the natural gas market are mapped and Norway may counteract some negative effects of liberalisation of the European gas market through strategic adaptation of the transport tariff to the Norwegian gas transport systems

  12. Corticostriatal Regulation of Acute Pain

    Directory of Open Access Journals (Sweden)

    Erik Martinez

    2017-05-01

    Full Text Available The mechanisms for acute pain regulation in the brain are not well understood. The prefrontal cortex (PFC provides top-down control of emotional processes, and it projects to the nucleus accumbens (NAc. This corticostriatal projection forms an important regulatory pathway within the brain’s reward system. Recently, this projection has been suggested to control both sensory and affective phenotypes specifically associated with chronic pain. As this projection is also known to play a role in the transition from acute to chronic pain, we hypothesized that this corticostriatal circuit can also exert a modulatory function in the acute pain state. Here, we used optogenetics to specifically target the projection from the PFC to the NAc. We tested sensory pain behaviors with Hargreaves’ test and mechanical allodynia, and aversive pain behaviors with conditioned place preference (CPP test. We found that the activation of this corticostriatal circuit gave rise to bilateral relief from peripheral nociceptive inputs. Activation of this circuit also provided important control for the aversive response to transient noxious stimulations. Hence, our results support a novel role for corticostriatal circuitry in acute pain regulation.

  13. Substation Reactive Power Regulation Strategy

    Science.gov (United States)

    Zhang, Junfeng; Zhang, Chunwang; Ma, Daqing

    2018-01-01

    With the increasing requirements on the power supply quality and reliability of distribution network, voltage and reactive power regulation of substations has become one of the indispensable ways to ensure voltage quality and reactive power balance and to improve the economy and reliability of distribution network. Therefore, it is a general concern of the current power workers and operators that what kind of flexible and effective control method should be used to adjust the on-load tap-changer (OLTC) transformer and shunt compensation capacitor in a substation to achieve reactive power balance in situ, improve voltage pass rate, increase power factor and reduce active power loss. In this paper, based on the traditional nine-zone diagram and combining with the characteristics of substation, a fuzzy variable-center nine-zone diagram control method is proposed and used to make a comprehensive regulation of substation voltage and reactive power. Through the calculation and simulation of the example, this method is proved to have satisfactorily reconciled the contradiction between reactive power and voltage in real-time control and achieved the basic goal of real-time control of the substation, providing a reference value to the practical application of the substation real-time control method.

  14. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria.

    Science.gov (United States)

    Troxell, Bryan; Hassan, Hosni M

    2013-01-01

    In the ancient anaerobic environment, ferrous iron (Fe(2+)) was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe(3+)) and later to defend against reactive oxygen species (ROS) generated by the Fenton chemistry. To acquire Fe(3+), bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe(3+). However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur) is a transcription factor which utilizes Fe(2+) as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well-documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms (1) indirectly via small RNAs, (2) binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP), and (3) functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR) and control uptake of other metals such as zinc (Zur) and manganese (Mur) in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  15. The undertow of de-regulation : re-regulation

    International Nuclear Information System (INIS)

    Bradford, J.A.

    2003-01-01

    Alberta, Ontario and New Brunswick each initiated steps to deregulate their electric power industries in order to remain competitive with lower electricity rates in certain American states where the industry was also moving towards deregulation. This paper considers how the original sweep of deregulation policy goals succumbed to electricity re regulation policies. The decision by British Columbia to re-examine its deregulation plans in light of the experience in Canada's 3 other province's was also examined. The paper describes the electric power industry from 1900 to 1960s, before the deregulation wave hit the industry and then proceeds to the 1970s which was marked by the oil embargo. The 1980s saw a new era of policy shifts towards deregulation and privatization activity which was intended to introduce competition into regulated industries. Technological advances were taking place in the electricity sector, improving the viability of small gas turbines and making cogeneration possible. In the 1990s, Alberta was the first Canadian province to introduce competition to its electricity industry in an effort to remain competitive with neighbouring U.S. jurisdictions. By the 1990s Ontario's vertically integrated electricity industry was in trouble and recommendations were made to dissolve Ontario's Hydro One monopoly, particularly in power generation. In 1999, New Brunswick restructured its electricity industry to remain competitive with New England's electricity industry. The paper describes the gradual pull back from deregulation by all three provinces and the measures taken to impose price controls. Both industry and consumers paid a price for major policy changes. Complete competition in New Brunswick never materialized. It was suggested that controlled competition will likely move the electricity industry in the future. 40 refs

  16. Corruption and optimal regulation under common agency

    Directory of Open Access Journals (Sweden)

    Pedro Hemsley

    2016-05-01

    Full Text Available I show that it is optimal to separate non-benevolent regulators when regulated projects are large. Separation prevents regulators from coordinating to appropriate all of the agent's informational rent when they know the type of the latter; therefore, there is a trade-off between saving on informational rent and efficiency, since the game between the regulators induced by separation causes further distortions when compared to the allocation under one regulator. When the informational rent at stake is large due to the size of the project, separation is the optimal institutional answer.

  17. Public and private regulation of reproductive technologies.

    Science.gov (United States)

    Byk, C

    1995-01-01

    Human reproduction is interrelated with privacy. However, in most countries where new reproductive technologies are used public regulations have been passed to provide a legal framework for such technologies. This interference in private life can be justified by the need to control medical intervention in the human reproductive process. But in order to find a balance between public regulations and other social regulations, this article analyses the impact private regulation may have on issues raised by reproductive technologies. It also addresses the issue of the influence of private bodies on the drafting of public regulations.

  18. Phosphorylation regulates SIRT1 function.

    Directory of Open Access Journals (Sweden)

    Tsutomu Sasaki

    Full Text Available BACKGROUND: SIR2 is an NAD(+-dependent deacetylase [1]-[3] implicated in the regulation of lifespan in species as diverse as yeast [4], worms [5], and flies [6]. We previously reported that the level of SIRT1, the mammalian homologue of SIR2 [7], [8], is coupled to the level of mitotic activity in cells both in vitro and in vivo[9]. Cells from long-lived mice maintained SIRT1 levels of young mice in tissues that undergo continuous cell replacement by proliferating stem cells. Changes in SIRT1 protein level were not associated with changes in mRNA level, suggesting that SIRT1 could be regulated post-transcriptionally. However, other than a recent report on sumoylation [10] and identification of SIRT1 as a nuclear phospho-protein by mass spectrometry [11], post-translational modifications of this important protein have not been reported. METHODOLOGY/PRINCIPAL FINDINGS: We identified 13 residues in SIRT1 that are phosphorylated in vivo using mass spectrometry. Dephosphorylation by phosphatases in vitro resulted in decreased NAD(+-dependent deacetylase activity. We identified cyclinB/Cdk1 as a cell cycle-dependent kinase that forms a complex with and phosphorylates SIRT1. Mutation of two residues phosphorylated by Cyclin B/Cdk1 (threonine 530 and serine 540 disturbs normal cell cycle progression and fails to rescue proliferation defects in SIRT1-deficient cells [12], [13]. CONCLUSIONS/SIGNIFICANCE: Pharmacological manipulation of SIRT1 activity is currently being tested as a means of extending lifespan in mammals. Treatment of obese mice with resveratrol, a pharmacological activator of SIRT1, modestly but significantly improved longevity and, perhaps more importantly, offered some protection against the development of type 2 diabetes mellitus and metabolic syndrome [14]-[16]. Understanding the endogenous mechanisms that regulate the level and activity of SIRT1, therefore, has obvious relevance to human health and disease. Our results identify

  19. 75 FR 75904 - Global Terrorism Sanctions Regulations; Terrorism Sanctions Regulations; Foreign Terrorist...

    Science.gov (United States)

    2010-12-07

    ... Terrorism Sanctions Regulations; Terrorism Sanctions Regulations; Foreign Terrorist Organizations Sanctions... Foreign Assets Control (``OFAC'') of the U.S. Department of the Treasury is amending the Global Terrorism Sanctions Regulations (``GTSR'') and the Terrorism Sanctions Regulations (``TSR'') to expand the scope of...

  20. Private regulation in EU better regulation : Past performance and future promises

    NARCIS (Netherlands)

    Verbruggen, Paul

    The promotion of private regulation is frequently part of better regulation programmes. Also the Better Regulation programme of the European Union (EU) initiated in 2002 advocated forms of private regulation as important means to improve EU law-making activities. However, for various reasons the

  1. 78 FR 31551 - Federal Acquisition Regulation; Submission for OMB Review; Commerce Patent Regulations

    Science.gov (United States)

    2013-05-24

    ...; Submission for OMB Review; Commerce Patent Regulations AGENCIES: Department of Defense (DOD), General... collection requirement concerning Department of Commerce patent regulations. A notice was published in...- 0095, Commerce Patent Regulations, by any of the following methods: Regulations.gov : http://www...

  2. The challenge of legitimizing spatially differentiated regulation

    DEFF Research Database (Denmark)

    Thorsøe, Martin Hvarregaard; Graversgaard, Morten; Noe, Egon

    2017-01-01

    Differentiating regulation is a promising approach to agri-environmental regulation that may potentially reduce the environmental impact of agriculture at the lowest possible costs for the farmers and society, but also possesses a number of challenges. In this article, we explore the challenges...... to the legitimacy of agri-environmental regulation that occurs when the regulatory regime changes from general regulation to differentiated regulation. The analysis is based on a case study of the implementation of the Buffer zone act in Denmark – a regulation that prevents agricultural production in a 10 (later 9......) meter fringe around selected waterbodies. We distinguish between two different ways of legitimizing: Producing knowledge and participation. We conclude that to harvest some of the obvious benefits of differentiated regulation a number of challenges must be resolved, 1) ensuring legitimacy...

  3. Functional analyses of a flavonol synthase–like gene from Camellia ...

    Indian Academy of Sciences (India)

    2013-07-22

    Jul 22, 2013 ... The flavonoids metabolic pathway plays central roles in floral coloration, in which anthocyanins and .... Conserved fragments were amplified for RNAi construction ... time PCR was performed with ABI PRISM 7300 Real-Time.

  4. Uncommon Trimethoxylated Flavonol Obtained from Rubus rosaefolius Leaves and Its Antiproliferative Activity

    Directory of Open Access Journals (Sweden)

    Marcel Petreanu

    2015-01-01

    Full Text Available This study shows the evaluation the antiproliferative effect of the extract, fractions, and uncommon compounds isolated from R. rosaefolius leaves. The compounds were identified by conventional spectroscopic methods such as NMR-H1 and C13 and identified as 5,7-dihydroxy-6,8,4′-trimethoxyflavonol (1, 5-hydroxy-3,6,7,8,4′-pentamethoxyflavone (2, and tormentic acid (3. Both hexane and dichloromethane fractions showed selectivity for multidrug-resistant ovary cancer cell line (NCI-ADR/RES with total growth inhibition values of 11.1 and 12.6 μg/ml, respectively. Compound 1 also showed selective activity against the same cell line (18.8 μg/ml; however, it was especially effective against glioma cells (2.8 μg/ml, suggesting that this compound may be involved with the in vitro antiproliferative action.

  5. H-1-NMR Fingerprinting of Vaccinium vitis-idaea Flavonol Glycosides

    NARCIS (Netherlands)

    Riihinen, K.R.; Mihaleva, V.V.; Gödecke, T.; Soininen, P.; Laatikainen, R.; Vervoort, J.; Lankin, D.C.; Pauli, G.F.

    2013-01-01

    Introduction - The fruits of Vaccinium vitis-idaea L. are a valuable source of biologically active flavonoid derivatives. For studies focused on the purification of its quercetin glycosides (QGs) and related glycosides from plants and for the purpose of biological studies, the availability of

  6. Bifenthrin-induced oxidative stress in human erythrocytes in vitro and protective effect of selected flavonols.

    Science.gov (United States)

    Sadowska-Woda, Izabela; Popowicz, Diana; Karowicz-Bilińska, Agata

    2010-03-01

    Bifenthrin is a synthetic pyrethroid with a broad spectrum of insecticidal and acaricidal activity used to control wide range of insect pests in a variety of applications. This investigation was designed to examine (1) bifenthrin as an inducer of oxidative stress in human erythrocytes in vitro through effects on catalase (CAT) and superoxide dismutase (SOD) activities, and (2) the role of the flavonoids quercetin (Q, 40 and 80microM) and rutin (R, 80microM) in alleviating the effects of bifenthrin. Erythrocytes were divided into portions. The first portion was incubated for 4h at 37 degrees C with different concentrations (0, 42.2, 211, 1055ppm) of bifenthrin. The other portions were preincubated with Q or R for 30min, followed incubation with bifenthrin for 4h. The influence of solvent (ethanol) was also checked on the parameters studied. Malondialdehyde (MDA) concentrations, CAT and SOD activities were measured in all treatment portions of erythrocytes. Our results demonstrated that bifenthrin-induced oxidative stress causes enhanced lipid peroxidation and decreased antioxidative enzyme activities in human peripheral blood. R pretreated erythrocytes were protected against the increase of MDA induced by bifenthrin. Q (80microM) and R pretreated erythrocytes were protected against the inhibition of CAT activity induced by bifenthrin. The protective action against the inhibition of SOD activity of Q was greater than that of R at the same concentration. These results suggest that Q and R may play a role in reducing bifenthrin-induced oxidative stress in vitro. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  7. Minor components in food plants--Note I. Flavonol glycosides from Ullucus tuberosus.

    Science.gov (United States)

    Dini, A; Rastrelli, L; Saturnino, P; Schettino, O

    1991-12-01

    This work deals with the isolation and characterization in Ullucus tuberosus of flavonoids, a class of natural products influencing potentially the taste and nutritional value of the plant food. The three flavonoids, rutin, narcissin and kaempferol 3-O-(2",6"-di-O-alpha-L-rhamnopyranosil)-beta-D-glucopyranoside, isolated, are devoid of taste, but appear to possess health promoting effects.

  8. Functional analyses of a flavonol synthase–like gene from Camellia ...

    Indian Academy of Sciences (India)

    ACAATCCAGGGCAAGGTC 172-190. ACAATCAGGGCATTAGGG 815-833. CLoning (JF343560). CnFLS-FL. AGGAGTGAGAAGGGGAAAAA 43-62. CAAGACAATGAAACGAGTGAGT. 1106-1127. Full Length cloing. (JF343560). CnFLS-Q. TGGAAGGCAAGAAAGGATGGG. 407-427. CCACCGGAACAACTTGTCTGC 566-585.

  9. A new acylated flavonol from the aerial parts of Asteriscus maritimus (L.) Less (Asteraceae).

    Science.gov (United States)

    Ezzat, Marwa I; Ezzat, Shahira M; El Deeb, Kadriya S; El Fishawy, Ahlam M; El-Toumy, Sayed A

    2016-08-01

    Phytochemical investigation of the flowering aerial parts of Asteriscus maritimus (L.) Less (Asteraceae) led to the isolation of a new compound: patuletin 7-O-β-D-[(2″'S) 6″(3″'-hydroxy-2″'-methyl-propanoyl)] glucopyranoside, together with five known metabolites; β-sitosterol 2, chlorogenic acid 3, P-hydroxy -methylbenzoate 4, luteolin 5 and protocatechuic acid 6. The structures of the isolated compounds were determined by comprehensive analyses of its 1D and 2D NMR, HRMS and compared with previously known analogues. The ethanolic extract of the flowering aerial parts of A. maritimus was found to be safe (LD50 = 4.6 mg/kg) and possess significant antioxidant and anti-inflammatory activities and this was in accordance with its high phenolic content (107.36 ± 0.051 mg GAE/g extract).

  10. A hydroxylated flavonol, fisetin inhibits the formation of a carcinogenic estrogen metabolite.

    Science.gov (United States)

    Meng, Xin; Sun, Hui; Yang, Lianrong; Yin, Rui; Qi, Lehui

    2017-03-01

    Fisetin can be found in a wide variety of plants and possesses strong efficacy against many cancers. 17β-Estradiol (E2) is hydrolyzed to 4-hydroxy-E2 (4-OHE2) via cytochrome P450 (CYP) 1B1 in vivo. In estrogen target tissues including the mammary gland, ovaries, and uterus, CYP1B1 is highly expressed, and 4-OHE2 is predominantly formed in cancerous tissues. Herein, we investigated the inhibitory activity of fisetin and flavone against CYP1B1 using estrogen E2 as substrate in vitro to reveal structure-activity relationship between structure of flavonoids and inhibition. The results showed that fisetin possessed inhibitory effect on CYP1B1 activity. Compared with flavone, the inhibition of fisetin was stronger. The V max and K i values were 1.950±0.157pmol/μgprotein/min and 4.925±0.689nM for fisetin and 2.277±0.231pmol/μgprotein/min and 9.148±2.150nM for flavone, respectively. By kinetic analyses, both fisetin and flavone displayed mixed inhibition. Taken together the data suggested that fisetin is able to inhibit the formation of carcinogenic 4-OHE2 from E2, which reveals one of its anti-cancer mechanisms and helps to reveal the relationship between the structure of flavonoids and the inhibition CYP1B1 for discovering new drugs in cancer therapy and prevention. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Fisetin, a flavonol, inhibits TH2-type cytokine production by activated human basophils.

    Science.gov (United States)

    Higa, Shinji; Hirano, Toru; Kotani, Mayumi; Matsumoto, Motonobu; Fujita, Akihito; Suemura, Masaki; Kawase, Ichiro; Tanaka, Toshio

    2003-06-01

    Activation of mast cells and basophils through allergen stimulation releases chemical mediators and synthesizes cytokines. Among these cytokines, IL-4, IL-13, and IL-5 have major roles in allergic inflammation. We sought to determine the potency of flavonoids (astragalin, fisetin, kaempferol, myricetin, quercetin, and rutin) for the inhibition of cytokine expression and synthesis by human basophils. The inhibitory effect of flavonoids on cytokine expression by stimulated KU812 cells, a human basophilic cell line, and freshly purified peripheral blood basophils was measured by means of semiquantitative RT-PCR and ELISA assays. The effects of flavonoids on transcriptional activation of the nuclear factor of activated T cells were assessed by means of electrophoretic mobility shift assays. Fisetin suppressed the induction of IL-4, IL-13, and IL-5 mRNA expression by A23187-stimulated KU812 cells and basophils in response to cross-linkage of the IgE receptor. Fisetin reduced IL-4, IL-13, and IL-5 synthesis (inhibitory concentration of 50% [IC(50)] = 19.4, 17.7, and 17.4 micromol/L, respectively) but not IL-6 and IL-8 production by KU812 cells. In addition, fisetin inhibited IL-4 and IL-13 synthesis by anti-IgE antibody-stimulated human basophils (IC(50) = 5.1 and 6.2 micromol/L, respectively) and IL-4 synthesis by allergen-stimulated basophils from allergic patients (IC(50) = 4.8 micromol/L). Among the flavonoids examined, kaempferol and quercetin showed substantial inhibitory activities in cytokine expression but less so than those of fisetin. Fisetin inhibited nuclear localization of nuclear factor of activated T cells c2 by A23187-stimulated KU812 cells. These results provide evidence of a novel activity of the flavonoid fisetin that suppresses the expression of T(H)2-type cytokines (IL-4, IL-13, and IL-5) by basophils.

  12. Novel Flavonol Glycosides from the Aerial Parts of Lentil (Lens culinaris

    Directory of Open Access Journals (Sweden)

    Jerzy Żuchowski

    2014-11-01

    Full Text Available While the phytochemical composition of lentil (Lens culinaris seeds is well described in scientific literature, there is very little available data about secondary metabolites from lentil leaves and stems. Our research reveals that the aerial parts of lentil are a rich source of flavonoids. Six kaempferol and twelve quercetin glycosides were isolated, their structures were elucidated using NMR spectroscopy and chemical methods. This group includes 16 compounds which have not been previously described in the scientific literature: quercetin 3-O-β-D-glucopyranosyl(1→2-β-D-galactopyranoside-7-O-β-D-glucuropyranoside (1, kaempferol 3-O-β-D-glucopyranosyl(1→2-β-D-galacto-pyranoside-7-O-β-D-glucuropyranoside (3, their derivatives 4–10,12–15,17,18 acylated with caffeic, p-coumaric, ferulic, or 3,4,5-trihydroxycinnamic acid and kaempferol 3-O-{[(6-O-E-p-coumaroyl-β-D-glucopyranosyl(1→2]-α-L-rhamnopyranosyl(1→6}-β-D-galactopyranoside-7-O-α-L-rhamnopyranoside (11. Their DPPH scavenging activity was also evaluated. This is probably the first detailed description of flavonoids from the aerial parts of lentil.

  13. Flavonol robinobiosides and rutinosides from Alternanthera brasiliana (Amaranthaceae and their effects on lymphocyte proliferation in vitro

    Directory of Open Access Journals (Sweden)

    Brochado Claudia de O.

    2003-01-01

    Full Text Available The extract of the medicinal species Alternanthera brasiliana Kuntze afforded six di- and triglycosyl kaempferol and quercetin derivatives. Their structures were elucidated based on the ¹H- and 13C-NMR data and are reported here for the first time in this genus. Kaempferol 3-O-robinobioside and kaempferol 3-O-rutinoside significantly inhibited the human lymphocyte proliferation in vitro.

  14. N-trans-feruloyltyramine and flavonol glycosides from the leaves of Solanum sordidum

    Directory of Open Access Journals (Sweden)

    Regina Mikie Kanada

    2012-03-01

    Full Text Available Chemical investigation of the leaves of Solanum sordidum Sendtn., Solanaceae, resulted in the isolation and identification of sitosterol, stigmasterol, 3β-O-β-glycopyranosyl stigmasterol, 3β-O-β-glycopyranosyl sitosterol, kaempferol-3-O-α-rhamnopyranosyl-(1-6-α-glycopyranoside, rutin, and N-trans-feruloyltyramine. The structures of these compounds were established by analysis of 1D and 2D NMR spectrometric data and comparison with data in the literature. The evaluation of antioxidant activity showed an IC50 of 159.5 ppm for the chloroformic fraction and IC50 of 77.5 ppm for the hydromethanolic fraction.

  15. Acylated flavonol tri- and tetraglycosides in the flavonoid metabolome of Cladrastis kentukea (Leguminosae).

    Science.gov (United States)

    Kite, Geoffrey C; Rowe, Emily R; Lewis, Gwilym P; Veitch, Nigel C

    2011-04-01

    The foliar metabolome of Cladrastis kentukea (Leguminosae) contains a complex mixture of flavonoids including acylated derivatives of the 3-O-rhamnosyl(1→2)[rhamnosyl(1→6)]-galactosides of kaempferol and quercetin and their 7-O-rhamnosides, together with an array of non-acylated kaempferol and quercetin di-, tri- and tetraglycosides. Thirteen of the acylated flavonoids, 12 of which had not been reported previously, were characterised by spectroscopic and chemical methods. Eight of these were the four isomers of kaempferol 3-O-α-l-rhamnopyranosyl(1→2)[α-l-rhamnopyranosyl(1→6)]-(3/4-O-E/Z-p-coumaroyl-β-d-galactopyranoside) and their 7-O-α-l-rhamnopyranosides, and three were isomers of quercetin 3-O-α-l-rhamnopyranosyl(1→2)[α-l-rhamnopyranosyl(1→6)]-(3/4-O-E/Z-p-coumaroyl-β-d-galactopyranoside) - the remaining 4Z isomer was identified by LC-UV-MS analysis of a crude extract. The final two acylated flavonoids characterised by NMR were the 3E and 4E isomers of kaempferol 3-O-α-l-rhamnopyranosyl(1→2)[α-l-rhamnopyranosyl(1→6)]-(3/4-O-E-feruloyl-β-d-galactopyranoside)-7-O-α-l-rhamnopyranoside while the 3Z and 4Z isomers were again detected by LC-UV-MS. Using the observed fragmentation behaviour of the isolated compounds following a variety of MS experiments, a further 18 acylated flavonoids were given tentative structures by LC-MS analysis of a crude extract. Acylated flavonoids were absent from the flowers of C. kentukea, which contained an array of non-acylated kaempferol and quercetin glycosides. Immature fruits contained kaempferol 3-O-α-rhamnopyranosyl(1→2)[α-rhamnopyranosyl(1→6)]-β-galactopyranoside and its 7-O-α-rhamnopyranoside as the major flavonoids with acylated flavonoids, different from those in the leaves, only present as minor constituents. The presence of acylated flavonoids distinguishes the foliar flavonoid metabolome of C. kentukea from that of a closely related legume, Styphnolobium japonicum, which contains a similar range of non-acylated flavonoids. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Flavonol robinobiosides and rutinosides from Alternanthera brasiliana (Amaranthaceae) and their effects on lymphocyte proliferation in vitro

    OpenAIRE

    Brochado,Claudia de O.; Almeida,Ana P. de; Barreto,Beatriz P.; Costa,Leandro P.; Ribeiro,Luciene S.; Pereira,Rachel L. da C.; Koatz,Vera L. Gonçalves; Costa,Sonia S.

    2003-01-01

    The extract of the medicinal species Alternanthera brasiliana Kuntze afforded six di- and triglycosyl kaempferol and quercetin derivatives. Their structures were elucidated based on the ¹H- and 13C-NMR data and are reported here for the first time in this genus. Kaempferol 3-O-robinobioside and kaempferol 3-O-rutinoside significantly inhibited the human lymphocyte proliferation in vitro. O extrato da espécie medicinal Alternanthera brasiliana Kuntze forneceu seis derivados di- e triglicosi...

  17. N-trans-feruloyltyramine and flavonol glycosides from the leaves of Solanum sordidum

    Directory of Open Access Journals (Sweden)

    Regina Mikie Kanada

    2012-06-01

    Full Text Available Chemical investigation of the leaves of Solanum sordidum Sendtn., Solanaceae, resulted in the isolation and identification of sitosterol, stigmasterol, 3β-O-β-glycopyranosyl stigmasterol, 3β-O-β-glycopyranosyl sitosterol, kaempferol-3-O-α-rhamnopyranosyl-(1-6-α-glycopyranoside, rutin, and N-trans-feruloyltyramine. The structures of these compounds were established by analysis of 1D and 2D NMR spectrometric data and comparison with data in the literature. The evaluation of antioxidant activity showed an IC50 of 159.5 ppm for the chloroformic fraction and IC50 of 77.5 ppm for the hydromethanolic fraction.

  18. 7-Rhamnosylated Flavonols Modulate Homeostasis of the Plant Hormone Auxin and Affect Plant Development

    Czech Academy of Sciences Publication Activity Database

    Kuhn, B.M.; Errafi, S.; Bucher, R.; Dobrev, Petre; Geisler, M.; Bigler, L.; Zažímalová, Eva; Ringli, Ch.

    2016-01-01

    Roč. 291, č. 10 (2016), s. 5385-5395 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GAP305/11/0797 Institutional support: RVO:61389030 Keywords : Arabidopsis thaliana * auxin * flavonoid Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.125, year: 2016

  19. The study of the oxidation of the natural flavonol fisetin confirmed quercetin oxidation mechanism

    Czech Academy of Sciences Publication Activity Database

    Ramešová, Šárka; Sokolová, Romana; Degano, I.

    2015-01-01

    Roč. 182, NOV 2015 (2015), s. 544-549 ISSN 0013-4686 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR M200401201 Program:M Institutional support: RVO:61388955 Keywords : oxidation * flavonoids * cyclic voltammetry Subject RIV: CG - Electrochemistry Impact factor: 4.803, year: 2015

  20. Fire safety regulations and licensing

    International Nuclear Information System (INIS)

    Berg, H.P.

    1998-01-01

    Experience of the past tow decades of nuclear power plant operation and results obtained from modern analytical techniques confirm that fires may be a real threat to nuclear safety and should receive adequate attention from the design phase throughout the life of the plant. Fire events, in particular influence significantly plant safety due to the fact that fires have the potential to simultaneously damage components of redundant safety-related equipment. Hence, the importance of fire protection for the overall safety of a nuclear power plant has to be reflected by the fire safety regulations and to be checked during the licensing process of a plant as well as during the continuous supervision of the operating plant