WorldWideScience

Sample records for voltage-dependent potassium currents

  1. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  3. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  4. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  5. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  6. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  7. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  8. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  9. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  10. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  11. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  12. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  13. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  14. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  15. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  16. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  17. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  18. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  19. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  20. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  1. Voltage-dependent potassium currents in hypertrophied rat astrocytes after a cortical stab wound

    Czech Academy of Sciences Publication Activity Database

    Anděrová, Miroslava; Antonova, Tatiana; Petřík, David; Neprašová, Helena; Chvátal, Alexandr; Syková, Eva

    2004-01-01

    Roč. 48, - (2004), s. 311-326 ISSN 0894-1491 R&D Projects: GA ČR GA305/03/1172; GA ČR GA305/02/1528; GA MŠk LN00A065 Institutional research plan: CEZ:AV0Z5039906 Keywords : CNS injury * astrogliosis Subject RIV: FH - Neurology Impact factor: 4.781, year: 2004

  2. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  3. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  4. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó

    2016-03-01

    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  5. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  6. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  7. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  8. Effects of cisplatin on potassium currents in CT26 cells

    Directory of Open Access Journals (Sweden)

    Naveen Sharma

    2016-01-01

    Conclusion: Potassium currents were detected in CT26 cells and the currents were reduced by the application of tetraethylammonium (TEA chloride, iberiotoxin, a big conductance calcium-activated potassium channel blocker and barium. The potassium currents were enhanced to 192< by the application of cisplatin (0.5 mM. Moreover, the increase of potassium currents by cisplatin was further inhibited by the application of TEA confirming the action of cisplatin on potassium channels. In addition, relative current induced by cisplatin in CT26 cells was bit larger than in normal IEC-6 cells.

  9. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  10. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  11. Inward rectifier potassium currents in mammalian skeletal muscle fibres

    Science.gov (United States)

    DiFranco, Marino; Yu, Carl; Quiñonez, Marbella; Vergara, Julio L

    2015-01-01

    Inward rectifying potassium (Kir) channels play a central role in maintaining the resting membrane potential of skeletal muscle fibres. Nevertheless their role has been poorly studied in mammalian muscles. Immunohistochemical and transgenic expression were used to assess the molecular identity and subcellular localization of Kir channel isoforms. We found that Kir2.1 and Kir2.2 channels were targeted to both the surface andthe transverse tubular system membrane (TTS) compartments and that both isoforms can be overexpressed up to 3-fold 2 weeks after transfection. Inward rectifying currents (IKir) had the canonical features of quasi-instantaneous activation, strong inward rectification, depended on the external [K+], and could be blocked by Ba2+ or Rb+. In addition, IKir records show notable decays during large 100 ms hyperpolarizing pulses. Most of these properties were recapitulated by model simulations of the electrical properties of the muscle fibre as long as Kir channels were assumed to be present in the TTS. The model also simultaneously predicted the characteristics of membrane potential changes of the TTS, as reported optically by a fluorescent potentiometric dye. The activation of IKir by large hyperpolarizations resulted in significant attenuation of the optical signals with respect to the expectation for equal magnitude depolarizations; blocking IKir with Ba2+ (or Rb+) eliminated this attenuation. The experimental data, including the kinetic properties of IKir and TTS voltage records, and the voltage dependence of peak IKir, while measured at widely dissimilar bulk [K+] (96 and 24 mm), were closely predicted by assuming Kir permeability (PKir) values of ∼5.5 × 10−6 cm s−1 and equal distribution of Kir channels at the surface and TTS membranes. The decay of IKir records and the simultaneous increase in TTS voltage changes were mostly explained by K+ depletion from the TTS lumen. Most importantly, aside from allowing an accurate estimation of

  12. Effects of allocryptopine on outward potassium current and slow delayed rectifier potassium current in rabbit myocardium.

    Science.gov (United States)

    Fu, Yi-Cheng; Zhang, Yu; Tian, Liu-Yang; Li, Nan; Chen, Xi; Cai, Zhong-Qi; Zhu, Chao; Li, Yang

    2016-05-01

    Allocryptopine (ALL) is an effective alkaloid of Corydalis decumbens (Thunb.) Pers. Papaveraceae and has proved to be anti-arrhythmic. The purpose of our study is to investigate the effects of ALL on transmural repolarizing ionic ingredients of outward potassium current (I to) and slow delayed rectifier potassium current (I Ks). The monophasic action potential (MAP) technique was used to record the MAP duration of the epicardium (Epi), myocardium (M) and endocardium (Endo) of the rabbit heart and the whole cell patch clamp was used to record I to and I Ks in cardiomyocytes of Epi, M and Endo layers that were isolated from rabbit ventricles. The effects of ALL on MAP of Epi, M and Endo layers were disequilibrium. ALL could effectively reduce the transmural dispersion of repolarization (TDR) in rabbit transmural ventricular wall. ALL decreased the current densities of I to and I Ks in a voltage and concentration dependent way and narrowed the repolarizing differences among three layers. The analysis of gating kinetics showed ALL accelerated the channel activation of I to in M layers and partly inhibit the channel openings of I to in Epi, M and Endo cells. On the other hand, ALL mainly slowed channel deactivation of I Ks channel in Epi and Endo layers without affecting its activation. Our study gives partially explanation about the mechanisms of transmural inhibition of I to and I Ks channels by ALL in rabbit myocardium. These findings provide novel perspective regarding the anti-arrhythmogenesis application of ALL in clinical settings.

  13. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  14. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  15. VEGF attenuated increase of outward delayed-rectifier potassium currents in hippocampal neurons induced by focal ischemia via PI3-K pathway.

    Science.gov (United States)

    Wu, K W; Yang, P; Li, S S; Liu, C W; Sun, F Y

    2015-07-09

    We recently indicated that the vascular endothelial growth factor (VEGF) protects neurons against hypoxic death via enhancement of tyrosine phosphorylation of Kv1.2, an isoform of the delayed-rectifier potassium channels through activation of the phosphatidylinositol 3-kinase (PI3-K) signaling pathway. The present study investigated whether VEGF could attenuate ischemia-induced increase of the potassium currents in the hippocampal pyramidal neurons of rats after ischemic injury. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion (MCAO) to induce brain ischemia. The whole-cell patch-clamp technique was used to record the potassium currents of hippocampal neurons in brain slices from the ischemically injured brains of the rats 24h after MCAO. We detected that transient MCAO caused a significant increase of voltage-gated potassium currents (Kv) and outward delayed-rectifier potassium currents (IK), but not outward transient potassium currents (IA), in the ipsilateral hippocampus compared with the sham. Moreover, we found that VEGF could acutely, reversibly and voltage-dependently inhibit the ischemia-induced IK increase. This inhibitory effect of VEGF could be completely abolished by wortmannin, an inhibitor of PI3-K. Our data indicate that VEGF attenuates the ischemia-induced increase of IK via activation of the PI3-K signaling pathway. Published by Elsevier Ltd.

  16. [Effects of allitridum on rapidly delayed rectifier potassium current in HEK293 cell line].

    Science.gov (United States)

    Zhang, Jiancheng; Lin, Kun; Wei, Zhixiong; Chen, Qian; Liu, Li; Zhao, Xiaojing; Zhao, Ying; Xu, Bin; Chen, Xi; Li, Yang

    2015-08-01

    To study the effect of allitridum on rapidly delayed rectifier potassium current (IKr) in HEK293 cell line. HEK293 cells were transiently transfected with HERG channel cDNA plasmid pcDNA3.1 via Lipofectamine. Allitridum was added to the extracellular solution by partial perfusion after giga seal at the final concentration of 30 µmol/L. Whole-cell patch clamp technique was used to record the HERG currents and gating kinetics before and after allitridum exposure at room temperature. The amplitude and density of IHERG were both suppressed by allitridum in a voltage-dependent manner. In the presence of allitridum, the peak current of IHERG was reduced from 73.5∓4.3 pA/pF to 42.1∓3.6 pA/pF at the test potential of +50 mV (P<0.01). Allitridum also concentration-dependently decreased the density of the IHERG. The IC50 of allitridum was 34.74 µmol/L with a Hill coefficient of 1.01. Allitridum at 30 µmol/L caused a significant positive shift of the steady-state activation curve of IHERG and a markedly negative shift of the steady-state inactivation of IHERG, and significantly shortened the slow time constants of IHERG deactivation. Allitridum can potently block IHERG in HEK293 cells, which might be the electrophysiological basis for its anti-arrhythmic action.

  17. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  18. Effect of ethanol at clinically relevant concentrations on atrial inward rectifier potassium current sensitive to acetylcholine.

    Science.gov (United States)

    Bébarová, Markéta; Matejovič, Peter; Pásek, Michal; Hořáková, Zuzana; Hošek, Jan; Šimurdová, Milena; Šimurda, Jiří

    2016-10-01

    Alcohol intoxication tends to induce arrhythmias, most often the atrial fibrillation. To elucidate arrhythmogenic mechanisms related to alcohol consumption, the effect of ethanol on main components of the ionic membrane current is investigated step by step. Considering limited knowledge, we aimed to examine the effect of clinically relevant concentrations of ethanol (0.8-80 mM) on acetylcholine-sensitive inward rectifier potassium current I K(Ach). Experiments were performed by the whole-cell patch clamp technique at 23 ± 1 °C on isolated rat and guinea-pig atrial myocytes, and on expressed human Kir3.1/3.4 channels. Ethanol induced changes of I K(Ach) in the whole range of concentrations applied; the effect was not voltage dependent. The constitutively active component of I K(Ach) was significantly increased by ethanol with the maximum effect (an increase by ∼100 %) between 8 and 20 mM. The changes were comparable in rat and guinea-pig atrial myocytes and also in expressed human Kir3.1/3.4 channels (i.e., structural correlate of I K(Ach)). In the case of the acetylcholine-induced component of I K(Ach), a dual ethanol effect was apparent with a striking heterogeneity of changes in individual cells. The effect correlated with the current magnitude in control: the current was increased by eth-anol in the cells showing small current in control and vice versa. The average effect peaked at 20 mM ethanol (an increase of the current by ∼20 %). Observed changes of action potential duration agreed well with the voltage clamp data. Ethanol significantly affected both components of I K(Ach) even in concentrations corresponding to light alcohol consumption.

  19. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  20. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  1. Docetaxel modulates the delayed rectifier potassium current (IK) and ATP-sensitive potassium current (IKATP) in human breast cancer cells.

    Science.gov (United States)

    Sun, Tao; Song, Zhi-Guo; Jiang, Da-Qing; Nie, Hong-Guang; Han, Dong-Yun

    2015-04-01

    Ion channel expression and activity may be affected during tumor development and cancer growth. Activation of potassium (K(+)) channels in human breast cancer cells is reported to be involved in cell cycle progression. In this study, we investigated the effects of docetaxel on the delayed rectifier potassium current (I K) and the ATP-sensitive potassium current (I KATP) in two human breast cancer cell lines, MCF-7 and MDA-MB-435S, using the whole-cell patch-clamp technique. Our results show that docetaxel inhibited the I K and I KATP in both cell lines in a dose-dependent manner. Compared with the control at a potential of +60 mV, treatment with docetaxel at doses of 0.1, 1, 5, and 10 µM significantly decreased the I K in MCF-7 cells by 16.1 ± 3.5, 30.2 ± 5.2, 42.5 ± 4.3, and 46.4 ± 9% (n = 5, P < 0.05), respectively and also decreased the I KATP at +50 mV. Similar results were observed in MDA-MB-435S cells. The G-V curves showed no significant changes after treatment of either MCF-7 or MDA-MB-435S cells with 10 μM docetaxel. The datas indicate that the possible mechanisms of I K and I KATP inhibition by docetaxel may be responsible for its effect on the proliferation of human breast cancer cells.

  2. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  3. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  4. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  5. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  6. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  7. Hydrogen peroxide-induced reduction of delayed rectifier potassium current in hippocampal neurons involves oxidation of sulfhydryl groups.

    Science.gov (United States)

    Hasan, Sonia M K; Redzic, Zoran B; Alshuaib, Waleed B

    2013-07-03

    This study examined the effect of H2O2 on the delayed rectifier potassium current (IKDR) in isolated hippocampal neurons. Whole-cell voltage-clamp experiments were performed on freshly dissociated hippocampal CA1 neurons of SD rats before and after treatment with H2O2. To reveal the mechanism behind H2O2-induced changes in IKDR, cells were treated with different oxidizing and reducing agents. External application of membrane permeable H2O2 reduced the amplitude and voltage-dependence of IKDR in a concentration dependent manner. Desferoxamine (DFO), an iron-chelator that prevents hydroxyl radical (OH) generation, prevented H2O2-induced reduction in IKDR. Application of the sulfhydryl-oxidizing agent 5,5 dithio-bis-nitrobenzoic acid (DTNB) mimicked the effect of H2O2. Sulfhydryl-reducing agents dithiothreitol (DTT) and glutathione (GSH) alone did not affect IKDR; however, DTT and GSH reversed and prevented the H2O2-induced inhibition of IKDR, respectively. Membrane impermeable agents GSH and DTNB showed effects only when added intracellularly identifying intracellular sulfhydryl groups as potential targets for hydroxyl-mediated oxidation. However, the inhibitory effects of DTNB and H2O2 at the positive test potentials were completely and partially abolished by DTT, respectively, suggesting an additional mechanism of action for H2O2, that is not shared by DTNB. In summary, this study provides evidence for the redox modulation of IKDR, identifies hydroxyl radical as an intermediate oxidant responsible for the H2O2-induced decrease in current amplitude and identifies intracellular sulfhydryl groups as an oxidative target. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  9. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  10. Accumulation of slowly activating delayed rectifier potassium current (IKs) in canine ventricular myocytes

    DEFF Research Database (Denmark)

    Stengl, Milan; Volders, Paul G A; Thomsen, Morten Bækgaard

    2003-01-01

    In guinea-pig ventricular myocytes, in which the deactivation of slowly activating delayed rectifier potassium current (IKs) is slow, IKs can be increased by rapid pacing as a result of incomplete deactivation and subsequent current accumulation. Whether accumulation of IKs occurs in dogs, in which...

  11. Nicotine inhibits potassium currents in Aplysia bag cell neurons

    Science.gov (United States)

    White, Sean H.; Sturgeon, Raymond M.

    2016-01-01

    Acetylcholine and the archetypal cholinergic agonist, nicotine, are typically associated with the opening of ionotropic receptors. In the bag cell neurons, which govern the reproductive behavior of the marine snail, Aplysia californica, there are two cholinergic responses: a relatively large acetylcholine-induced current and a relatively small nicotine-induced current. Both currents are readily apparent at resting membrane potential and result from the opening of distinct ionotropic receptors. We now report a separate current response elicited by applying nicotine to cultured bag cell neurons under whole cell voltage-clamp. This current was ostensibly inward, best resolved at depolarized voltages, presented a noncooperative dose-response with a half-maximal concentration near 1.5 mM, and associated with a decrease in membrane conductance. The unique nicotine-evoked response was not altered by intracellular perfusion with the G protein blocker GDPβS or exposure to classical nicotinic antagonists but was occluded by replacing intracellular K+ with Cs+. Consistent with an underlying mechanism of direct inhibition of one or more K+ channels, nicotine was found to rapidly reduce the fast-inactivating A-type K+ current as well as both components of the delayed-rectifier K+ current. Finally, nicotine increased bag cell neuron excitability, which manifested as reduction in spike threshold, greater action potential height and width, and markedly more spiking to continuous depolarizing current injection. In contrast to conventional transient activation of nicotinic ionotropic receptors, block of K+ channels could represent a nonstandard means for nicotine to profoundly alter the electrical properties of neurons over prolonged periods of time. PMID:26864763

  12. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

    Science.gov (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

    2012-06-06

    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  13. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  14. Inhibition of potassium currents is involved in antiarrhythmic effect of moderate ethanol on atrial fibrillation

    International Nuclear Information System (INIS)

    Yang, Baode; Li, Chenxing; Sun, Junyi; Wang, Xinghui; Liu, Xinling; Yang, Chun; Chen, Lina; Zhou, Jun; Hu, Hao

    2017-01-01

    Excessive consumption of alcohol is a well-established risk factor of atrial fibrillation (AF). However, the effects of moderate alcohol drinking remain to be elucidated. This study was designed to determine the effects of moderate ethanol ingestion on atrial fibrillation and the electrophysiological mechanisms. In acetylcholine-induced canine and mouse AF models, the moderate ethanol prevented the generation and persistence of AF through prolonging the latent period of AF and shortening the duration of AF. The action potential duration (APD) was remarkably prolonged under the concentration range of 12.5–50.0 mM ethanol in guinea pig atrial myocytes. Ultra-rapid delayed rectified potassium currents (I Kv1.5 ) were markedly inhibited by 12.5–50.0 mM ethanol in a concentration-dependent manner. Ethanol with 50.0 mM could inhibit rapid delayed rectifier potassium currents (I hERG ). Ethanol under 6.25–50.0 mM did not affect on inward rectifier potassium currents (I Kir2.1 ). Collectively, the present study provided an evidence that moderate ethanol intake can prolong the APD of atrial myocytes by inhibition of I Kv1.5 and I hERG , which contributed to preventing the development and duration of AF. - Highlights: • Moderate ethanol prevented the development of AF in animal models. • Moderate ethanol prolonged APD in guinea pig atrial myocytes. • Moderate ethanol inhibited Kv1.5 currents.

  15. Inward rectifier potassium current IKir promotes intrinsic pacemaker activity of thalamocortical neurons.

    Science.gov (United States)

    Amarillo, Yimy; Tissone, Angela I; Mato, Germán; Nadal, Marcela S

    2018-06-01

    Slow repetitive burst firing by hyperpolarized thalamocortical (TC) neurons correlates with global slow rhythms (rectifier potassium current I Kir induces repetitive burst firing at slow and delta frequency bands. We demonstrate this in mouse TC neurons in brain slices by manipulating the Kir maximum conductance with dynamic clamp. We also performed a thorough theoretical analysis that explains how the unique properties of I Kir enable this current to induce slow periodic bursting in TC neurons. We describe a new ionic mechanism based on the voltage- and time-dependent interaction of I Kir and hyperpolarization-activated cationic current I h that endows TC neurons with the ability to oscillate spontaneously at very low frequencies, even below 0.5 Hz. Bifurcation analysis of conductance-based models of increasing complexity demonstrates that I Kir induces bistability of the membrane potential at the same time that it induces sustained oscillations in combination with I h and increases the robustness of low threshold-activated calcium current I T -mediated oscillations. NEW & NOTEWORTHY The strong inwardly rectifying potassium current I Kir of thalamocortical neurons displays a region of negative slope conductance in the current-voltage relationship that generates potassium currents activated by hyperpolarization. Bifurcation analysis shows that I Kir induces bistability of the membrane potential; generates sustained subthreshold oscillations by interacting with the hyperpolarization-activated cationic current I h ; and increases the robustness of oscillations mediated by the low threshold-activated calcium current I T . Upregulation of I Kir in thalamocortical neurons induces repetitive burst firing at slow and delta frequency bands (<4 Hz).

  16. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  17. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  18. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  19. Inhibition of potassium currents is involved in antiarrhythmic effect of moderate ethanol on atrial fibrillation

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Baode; Li, Chenxing [Department of Pharmacology, Health Science Center, Xi' an Jiaotong University, Xi' an (China); Sun, Junyi [Key Laboratory of Shaanxi Province for Craniofacial Precision Medicine Research, College of Stomatology, Xi' an Jiaotong University, Xi' an (China); Department of Periodontology, College of Stomatology, Xi' an Jiaotong University, Xi' an (China); Wang, Xinghui; Liu, Xinling [Basic Medical Experiment Teaching Center, Health Science Center, Xi' an Jiaotong University, Xi' an (China); Yang, Chun [Department of Cardiology, The First Affiliated Hospital, Xi' an Jiaotong University, Xi' an (China); Chen, Lina; Zhou, Jun [Department of Pharmacology, Health Science Center, Xi' an Jiaotong University, Xi' an (China); Key Laboratory of Environment and Genes Related to Diseases, Xi' an Jiaotong University, Ministry of Education of China, Xi' an (China); Hu, Hao, E-mail: huhao@mail.xjtu.edu.cn [Department of Pharmacology, Health Science Center, Xi' an Jiaotong University, Xi' an (China); Key Laboratory of Environment and Genes Related to Diseases, Xi' an Jiaotong University, Ministry of Education of China, Xi' an (China)

    2017-05-01

    Excessive consumption of alcohol is a well-established risk factor of atrial fibrillation (AF). However, the effects of moderate alcohol drinking remain to be elucidated. This study was designed to determine the effects of moderate ethanol ingestion on atrial fibrillation and the electrophysiological mechanisms. In acetylcholine-induced canine and mouse AF models, the moderate ethanol prevented the generation and persistence of AF through prolonging the latent period of AF and shortening the duration of AF. The action potential duration (APD) was remarkably prolonged under the concentration range of 12.5–50.0 mM ethanol in guinea pig atrial myocytes. Ultra-rapid delayed rectified potassium currents (I{sub Kv1.5}) were markedly inhibited by 12.5–50.0 mM ethanol in a concentration-dependent manner. Ethanol with 50.0 mM could inhibit rapid delayed rectifier potassium currents (I{sub hERG}). Ethanol under 6.25–50.0 mM did not affect on inward rectifier potassium currents (I{sub Kir2.1}). Collectively, the present study provided an evidence that moderate ethanol intake can prolong the APD of atrial myocytes by inhibition of I{sub Kv1.5} and I{sub hERG}, which contributed to preventing the development and duration of AF. - Highlights: • Moderate ethanol prevented the development of AF in animal models. • Moderate ethanol prolonged APD in guinea pig atrial myocytes. • Moderate ethanol inhibited Kv1.5 currents.

  20. β1-Adrenoceptor autoantibodies affect action potential duration and delayed rectifier potassium currents in guinea pigs.

    Science.gov (United States)

    Zhao, Yuhui; Huang, Haixia; Du, Yunhui; Li, Xiao; Lv, Tingting; Zhang, Suli; Wei, Hua; Shang, Jianyu; Liu, Ping; Liu, Huirong

    2015-01-01

    β1-Adrenoceptor autoantibodies (β1-AAs) affect the action potential duration (APD) in cardiomyocytes and are related to ventricular arrhythmias. The delayed rectifier potassium current (I K) plays a crucial role in APD, but the effects of β1-AAs on I K have not been completely illuminated. This work aimed to observe the effects of β1-AAs on I K and APD and further explore the mechanisms of β1-AA-mediated ventricular arrhythmias. β1-AAs were obtained from sera of patients with coronary heart disease (CHD) and nonsustained ventricular tachycardia. With whole-cell patch clamp technique, action potentials and I K were recorded. The results illustrated 0.1 μmol/L β1-AAs shortened APD at 50 % (APD50) and 90 % (APD90) of the repolarization. However, at 0.01 μmol/L, β1-AAs had no effects on either APD90 or APD50 (P > 0.05). At 0.001 μmol/L, β1-AAs significantly prolonged APD90 and APD50. Moreover, β1-AAs (0.001, 0.01, 0.1 μmol/L) dose-dependently increased the rapidly activating delayed rectifier potassium current (I Kr), but similarly decreased the slowly activating delayed rectifier potassium current (I Ks) and increased L-type calcium currents at the different concentrations. Taken together, the IKr increase induced by high β1-AA concentrations is responsible for a significant APD reduction which would contribute to repolarization changes and trigger the malignant ventricular arrhythmias in CHD patients.

  1. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  2. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  3. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  4. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  5. Inhibition of large conductance calcium-dependent potassium ...

    African Journals Online (AJOL)

    conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.

  6. A Small Potassium Current in AgRP/NPY Neurons Regulates Feeding Behavior and Energy Metabolism.

    Science.gov (United States)

    He, Yanlin; Shu, Gang; Yang, Yongjie; Xu, Pingwen; Xia, Yan; Wang, Chunmei; Saito, Kenji; Hinton, Antentor; Yan, Xiaofeng; Liu, Chen; Wu, Qi; Tong, Qingchun; Xu, Yong

    2016-11-08

    Neurons that co-express agouti-related peptide (AgRP) and neuropeptide Y (NPY) are indispensable for normal feeding behavior. Firing activities of AgRP/NPY neurons are dynamically regulated by energy status and coordinate appropriate feeding behavior to meet nutritional demands. However, intrinsic mechanisms that regulate AgRP/NPY neural activities during the fed-to-fasted transition are not fully understood. We found that AgRP/NPY neurons in satiated mice express high levels of the small-conductance calcium-activated potassium channel 3 (SK3) and are inhibited by SK3-mediated potassium currents; on the other hand, food deprivation suppresses SK3 expression in AgRP/NPY neurons, and the decreased SK3-mediated currents contribute to fasting-induced activation of these neurons. Genetic mutation of SK3 specifically in AgRP/NPY neurons leads to increased sensitivity to diet-induced obesity, associated with chronic hyperphagia and decreased energy expenditure. Our results identify SK3 as a key intrinsic mediator that coordinates nutritional status with AgRP/NPY neural activities and animals' feeding behavior and energy metabolism. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  8. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  9. Urocortin2 prolongs action potential duration and modulates potassium currents in guinea pig myocytes and HEK293 cells.

    Science.gov (United States)

    Yang, Li-Zhen; Zhu, Yi-Chun

    2015-07-05

    We previously reported that activation of corticotropin releasing factor receptor type 2 by urocortin2 up-regulates both L-type Ca(2+) channels and intracellular Ca(2+) concentration in ventricular myocytes and plays an important role in cardiac contractility and arrhythmogenesis. This study goal was to further test the hypothesis that urocortin2 may modulate action potentials as well as rapidly and slowly activating delayed rectifier potassium currents. With whole cell patch-clamp techniques, action potentials and slowly activating delayed rectifier potassium currents were recorded in isolated guinea pig ventricular myocytes, respectively. And rapidly activating delayed rectifier potassium currents were tested in hERG-HEK293 cells. Urocortin2 produced a time- and concentration-dependent prolongation of action potential duration. The EC50 values of action potential duration and action potential duration at 90% of repolarization were 14.73 and 24.3nM respectively. The prolongation of action potential duration of urocortin2 was almost completely or partly abolished by H-89 (protein kinase A inhibitor) or KB-R7943 (Na(+)/Ca(2+) exchange inhibitor) pretreatment respectively. And urocortin2 caused reduction of rapidly activating delayed rectifier potassium currents in hERG-HEK293 cells. In addition, urocortin2 slowed the rate of slowly activating delayed rectifier potassium channel activation, and rightward shifted the threshold of slowly activating delayed rectifier potassium currents to more positive potentials. Urocortin2 prolonged action potential duration via activation of protein kinase A and Na(+)/ Ca(2+) exchange in isolated guinea pig ventricular myocytes in a time- and concentration- dependent manner. In hERG-HEK293 cells, urocortin2 reduced rapidly activating delayed rectifier potassium current density which may contribute to action potential duration prolongation. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Aldosterone downregulates delayed rectifier potassium currents through an angiotensin type 1 receptor-dependent mechanism.

    Science.gov (United States)

    Lv, Yankun; Wang, Yanjun; Zhu, Xiaoran; Zhang, Hua

    2018-01-01

    We have previously shown that aldosterone downregulates delayed rectifier potassium currents (I Ks ) via activation of the mineralocorticoid receptor (MR) in adult guinea pig cardiomyocytes. Here, we investigate whether angiotensin II/angiotensin type 1 receptor (AngII/AT1R) and intracellular calcium also play a role in these effects. Ventricular cardiomyocytes were isolated from adult guinea pigs and incubated with aldosterone (1 μmol·L -1 ) either alone or in combination with enalapril (1 μmol·L -1 ), losartan (1 μmol·L -1 ), nimodipine (1 μmol·L -1 ), or BAPTA-AM (2.5 μmol·L -1 ) for 24 h. We used the conventional whole cell patch-clamp technique to record the I Ks component. In addition, we evaluated expression of the I Ks subunits KCNQ1 and KCNE1 using Western blotting. Our results showed that both enalapril and losartan, but not nimodipine or BAPTA-AM, completely reversed the aldosterone-induced inhibition of I Ks and its effects on KCNQ1/KCNE1 protein levels. Furthermore, we found that AngII/AT1R mediates the inhibitory effects of aldosterone on I Ks . Finally, the downregulation of I Ks induced by aldosterone did not occur secondarily to a change in intracellular calcium concentrations. Taken together, our findings demonstrate that crosstalk between MR and AT1R underlies the effects of aldosterone, and provide new insights into the mechanism underlying potassium channels.

  11. The transient outward current in mice lacking the potassium channel gene Kv1.4

    Science.gov (United States)

    London, Barry; Wang, Dao W; Hill, Joseph A; Bennett, Paul B

    1998-01-01

    The transient outward current (Ito) plays a prominent role in the repolarization phase of the cardiac action potential. Several K+ channel genes, including Kv1.4, are expressed in the heart, produce rapidly inactivating currents when heterologously expressed, and may be the molecular basis of Ito.We engineered mice homozygous for a targeted disruption of the K+ channel gene Kv1.4 and compared Ito in wild-type (Kv1.4+/+), heterozygous (Kv1.4+/-) and homozygous ‘knockout’ (Kv1.4−/−) mice. Kv1.4 RNA was truncated in Kv1.4−/− mice and protein expression was absent.Adult myocytes isolated from Kv1.4+/+, Kv1.4+/− and Kv1.4−/− mice had large rapidly inactivating outward currents. The peak current densities at 60 mV (normalized by cellular capacitance, in pA pF−1; means ± s.e.m.) were 53.8 ± 5.3, 45.3 ± 2.2 and 44.4 ± 2.8 in cells from Kv1.4+/+, Kv1.4+/− and Kv1.4−/− mice, respectively (P mice.The voltage dependence and time course of inactivation were not changed by targeted disruption of Kv1.4. The mean best-fitting V½ (membrane potential at 50 % inactivation) values for myocytes from Kv1.4 +/+, Kv1.4+/− and Kv1.4−/− mice were -53.5 ± 3.7, -51.1 ± 2.6 and -54.2 ± 2.4 mV, respectively. The slope factors (k) were -10.1 ± 1.4, -8.8 ± 1.4 and -9.5 ± 1.2 mV, respectively. The fast time constants for development of inactivation at -30 mV were 27.8 ± 2.2, 26.2 ± 5.1 and 19.6 ± 2.1 ms in Kv1.4+/+, Kv1.4+/− and Kv1.4−/− myocytes, respectively. At +30 mV, they were 35.5 ± 2.6, 30.0 ± 2.1 and 28.7 ± 1.6 ms, respectively. The time constants for the rapid phase of recovery from inactivation at -80 mV were 32.5 ± 8.2, 23.3 ± 1.8 and 39.0 ± 3.7 ms, respectively.Nearly the entire inactivating component as well as more than 60 % of the steady-state outward current was eliminated by 1 mm 4-aminopyridine in Kv1.4+/+, Kv1.4+/− and Kv1.4−/− myocytes.Western blot analysis of heart membrane extracts showed no significant

  12. Moderate hypoxia influences potassium outward currents in adipose-derived stem cells.

    Directory of Open Access Journals (Sweden)

    Mayuri Prasad

    Full Text Available Moderate hypoxic preconditioning of adipose-derived stem cells (ASCs enhances properties such as proliferation and secretion of growth factors, representing a valuable strategy to increase the efficiency of cell-based therapies. In a wide variety of cells potassium (K+ channels are key elements involved in the cellular responses to hypoxia, suggesting that ASCs cultured under low oxygen conditions may display altered electrophysiological properties. Here, the effects of moderate hypoxic culture on proliferation, whole-cell currents, and ion channel expression were investigated using human ASCs cultured at 5% and 20% oxygen. Although cell proliferation was greatly enhanced, the dose-dependent growth inhibition by the K+ channel blocker tetraethylammonium (TEA was not significantly affected by hypoxia. Under both normoxic and hypoxic conditions, ASCs displayed outward K+ currents composed by Ca2+-activated, delayed rectifier, and transient components. Hypoxic culture reduced the slope of the current-voltage curves and caused a negative shift in the voltage activation threshold of the whole-cell currents. However, the TEA-mediated shift of voltage activation threshold was not affected by hypoxia. Semiquantitative real-time RT-PCR revealed that expression of genes encoding for various ion channels subunits related to oxygen sensing and proliferation remained unchanged after hypoxic culture. In conclusion, outward currents are influenced by moderate hypoxia in ASCs through a mechanism that is not likely the result of modulation of TEA-sensitive K+ channels.

  13. Decreased inward rectifier potassium current IK1 in dystrophin-deficient ventricular cardiomyocytes.

    Science.gov (United States)

    Rubi, Lena; Koenig, Xaver; Kubista, Helmut; Todt, Hannes; Hilber, Karlheinz

    2017-03-04

    Kir2.x channels in ventricular cardiomyocytes (most prominently Kir2.1) account for the inward rectifier potassium current I K1 , which controls the resting membrane potential and the final phase of action potential repolarization. Recently it was hypothesized that the dystrophin-associated protein complex (DAPC) is important in the regulation of Kir2.x channels. To test this hypothesis, we investigated potential I K1 abnormalities in dystrophin-deficient ventricular cardiomyocytes derived from the hearts of Duchenne muscular dystrophy mouse models. We found that I K1 was substantially diminished in dystrophin-deficient cardiomyocytes when compared to wild type myocytes. This finding represents the first functional evidence for a significant role of the DAPC in the regulation of Kir2.x channels.

  14. Low-threshold potassium currents stabilize IID-sensitivity in the inferior colliculus.

    Directory of Open Access Journals (Sweden)

    Anita eKarcz

    2012-08-01

    Full Text Available The inferior colliculus (IC is a midbrain nucleus that exhibits sensitivity to differences in interaural time and intensity (ITDs and IIDs and integrates information from the auditory brainstem to provide an unambiguous representation of sound location across the azimuth. Further upstream, in the lateral superior olive (LSO, absence of low-threshold potassium currents in Kcna1-/- mice interfered with response onset timing and restricted IID-sensitivity to the hemifield of the excitatory ear. Assuming the IID-sensitivity in the IC to be at least partly inherited from LSO neurons, the IC IID-encoding was compared between wild-type (Kcna1+/+ and Kcna1-/- mice. We asked whether the effect observed in the Kcna1-/- LSO was (I simply propagated into the IC, (II is enhanced and amplified or, (III alternatively, was compensated and so no longer detectable. Our results show that general IC response properties as well as the distribution of IID-functions were comparable in Kcna1-/- and Kcna1+/+ mice. In agreement with the literature IC neurons exhibited a higher level-invariance of IID-sensitivity compared to LSO neurons. However, manipulating the timing between the inputs of the two ears caused significantly larger shifts of IID-sensitivity in Kcna1-/- mice, whereas in the wild-type IC the IID functions were stable and less sensitive to changes of the temporal relationship between the binaural inputs. We conclude that the IC not only inherits IID-sensitivity from the LSO, but that the convergence with other, non-olivary inputs in the wild-type IC acts to quality-control, consolidate and stabilize IID representation; this necessary integration of inputs is impaired in the absence of the low-threshold potassium currents mediated by Kv1.1.

  15. Inhibition of the cardiac inward rectifier potassium currents by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Alekseeva, Eugenia I; Vornanen, Matti

    2013-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, KB-R7943 is shown to be a potent blocker of several ion currents including inward and delayed rectifier K(+) currents of cardiomyocytes. To further characterize KB-R7943 as a blocker of the cardiac inward rectifiers we compared KB-R7943 sensitivity of the background inward rectifier (IK1) and the carbacholine-induced inward rectifier (IKACh) currents in mammalian (Rattus norvegicus; rat) and fish (Carassius carassius; crucian carp) cardiac myocytes. The basal IK1 of ventricular myocytes was blocked with apparent IC50-values of 4.6×10(-6) M and 3.5×10(-6) M for rat and fish, respectively. IKACh was almost an order of magnitude more sensitive to KB-R7943 than IK1 with IC50-values of 6.2×10(-7) M for rat and 2.5×10(-7) M for fish. The fish cardiac NCX current was half-maximally blocked at the concentration of 1.9-3×10(-6) M in both forward and reversed mode of operation. Thus, the sensitivity of three cardiac currents to KB-R7943 block increases in the order IK1~INCXrectifier potassium currents, in particular IKACh, should be taken into account when interpreting the data with this inhibitor from in vivo and in vitro experiments in both mammalian and fish models. © 2013.

  16. Nicotine at clinically relevant concentrations affects atrial inward rectifier potassium current sensitive to acetylcholine.

    Science.gov (United States)

    Bébarová, Markéta; Matejovič, Peter; Švecová, Olga; Kula, Roman; Šimurdová, Milena; Šimurda, Jiří

    2017-05-01

    Nicotine abuse is associated with variety of diseases including arrhythmias, most often atrial fibrillation (AF). Altered inward rectifier potassium currents including acetylcholine-sensitive current I K(Ach) are known to be related to AF pathogenesis. Since relevant data are missing, we aimed to investigate I K(Ach) changes at clinically relevant concentrations of nicotine. Experiments were performed by the whole cell patch clamp technique at 23 ± 1 °C on isolated rat atrial myocytes. Nicotine was applied at following concentrations: 4, 40 and 400 nM; ethanol at 20 mM (∼0.09%). Nicotine at 40 and 400 nM significantly activated constitutively active component of I K(Ach) with the maximum effect at 40 nM (an increase by ∼100%); similar effect was observed at -110 and -50 mV. Changes at 4 nM nicotine were negligible on average. Coapplication of 40 nM nicotine and 20 mM ethanol (which is also known to activate this current) did not show cumulative effect. In the case of acetylcholine-induced component of I K(Ach) , a dual effect of nicotine and its correlation with the current magnitude in control were apparent: the current was increased by nicotine in the cells showing small current in control and vice versa. The effect of 40 and 400 nM nicotine on acetylcholine-induced component of I K(Ach) was significantly different at -110 and -50 mV. We conclude that nicotine at clinically relevant concentrations significantly increased constitutively active component of I K(Ach) and showed a dual effect on its acetylcholine-induced component, similarly as ethanol. Synchronous application of nicotine and ethanol did not cause additive effect.

  17. G-protein-coupled inward rectifier potassium current contributes to ventricular repolarization

    DEFF Research Database (Denmark)

    Liang, Bo; Nissen, Jakob D; Laursen, Morten

    2014-01-01

    The purpose of this study was to investigate the functional role of G-protein-coupled inward rectifier potassium (GIRK) channels in the cardiac ventricle.......The purpose of this study was to investigate the functional role of G-protein-coupled inward rectifier potassium (GIRK) channels in the cardiac ventricle....

  18. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  19. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  20. Pharmacological activation of rapid delayed rectifier potassium current suppresses bradycardia-induced triggered activity in the isolated guinea pig heart

    DEFF Research Database (Denmark)

    Hansen, Rie Schultz; Olesen, Søren-Peter; Grunnet, Morten

    2007-01-01

    arrhythmias. We present here data that support that NS3623 affects native I(Kr) and report the effects that activating this potassium current have in the intact guinea pig heart. In Langendorff-perfused hearts, the compound showed a concentration-dependent shortening of action potential duration, which...

  1. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  2. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  3. Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Vornanen, Matti

    2014-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  5. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  6. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  7. Aldosterone down-regulates the slowly activated delayed rectifier potassium current in adult guinea pig cardiomyocytes.

    Science.gov (United States)

    Lv, Yankun; Bai, Song; Zhang, Hua; Zhang, Hongxue; Meng, Jing; Li, Li; Xu, Yanfang

    2015-12-01

    There is emerging evidence that the mineralocorticoid hormone aldosterone is associated with arrhythmias in cardiovascular disease. However, the effect of aldosterone on the slowly activated delayed rectifier potassium current (IK s ) remains poorly understood. The present study was designed to investigate the modulation of IK s by aldosterone. Adult guinea pigs were treated with aldosterone for 28 days via osmotic pumps. Standard glass microelectrode recordings and whole-cell patch-clamp techniques were used to record action potentials in papillary muscles and IK s in ventricular cardiomyocytes. The aldosterone-treated animals exhibited a prolongation of the QT interval and action potential duration with a higher incidence of early afterdepolarizations. Patch-clamp recordings showed a significant down-regulation of IK s density in the ventricular myocytes of these treated animals. These aldosterone-induced electrophysiological changes were fully prevented by a combined treatment with spironolactone, a mineralocorticoid receptor (MR) antagonist. In addition, in in vitro cultured ventricular cardiomyocytes, treatment with aldosterone (sustained exposure for 24 h) decreased the IK s density in a concentration-dependent manner. Furthermore, a significant corresponding reduction in the mRNA/protein expression of IKs channel pore and auxiliary subunits, KCNQ1 and KCNE1 was detected in ventricular tissue from the aldosterone-treated animals. Aldosterone down-regulates IK s by inhibiting the expression of KCNQ1 and KCNE1, thus delaying the ventricular repolarization. These results provide new insights into the mechanism underlying K(+) channel remodelling in heart disease and may explain the highly beneficial effects of MR antagonists in HF. © 2015 The British Pharmacological Society.

  8. Arachidonic acid-mediated inhibition of a potassium current in the giant neurons of Aplysia

    International Nuclear Information System (INIS)

    Carlson, R.O.

    1990-01-01

    Biochemical and electrophysiological approaches were used to investigate the role of arachidonic acid (AA) in the modulation of an inwardly rectifying potassium current (I R ) in the giant neurons of the marine snail, Aplysia californica. Using [ 3 H]AA as tracer, the intracellular free AA pool in Aplysia ganglia was found to be in a state of constant and rapid turnover through deacylation and reacylation of phospholipid, primarily phosphatidyl-inositol. This constant turnover was accompanied by a constant release of free AA and eicosanoids into the extracellular medium. The effects of three pharmacological agents were characterized with regard to AA metabolism in Aplysia ganglia. 4-O-tetra-decanoylphorbol 13-acetate (TPA), an activator of protein kinase C, stimulated liberation of AA from phospholipid, and 4-bromophenacylbromide (BPB), an inhibitor of phospholipate A 2 , inhibited this liberation. Indomethacin at 250 μM was found to inhibit uptake of AA, likely through inhibition of acyl-CoA synthetase. These agents were also found to modulate I R in ways which were consistent with their biological effects: TPA inhibited I R , and both BPB and indomethacin stimulated I R . Modulation of I R by these substances was found not to involve cAMP metabolism. Acute application of exogenous AA did not affect I R ; however, I R in giant neurons was found to be inhibited after dialysis with AA or other unsaturated fatty acids. Also, after perfusion with BSA overnight, a treatment which strips the giant neurons of AA in lipid storage, I R was found to have increased over 2-fold. This perfusion-induced increase was inhibited by the presence of AA or by pretreatment of the giant neurons with BPB. These results suggest AA, provided through constant turnover from phospholipid, mediates constitutive inhibition of I R

  9. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  10. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  11. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  12. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  13. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  14. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  15. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  16. Estrogen modulates potassium currents and expression of the Kv4.2 subunit in GT1-7 cells.

    Science.gov (United States)

    Farkas, Imre; Varju, Patricia; Liposits, Zsolt

    2007-03-01

    The proper maintenance of reproduction requires the pulsatile secretion of gonadotropin-releasing hormone (GnRH), which is ensured by synchronized periodic firing of multiple GnRH neurons. Both hormone secretion and electrophysiological properties of GnRH cells are influenced by estrogen. The impact of 17beta-estradiol treatment on the function of voltage gated A- and K-type potassium channels, known modulators of firing rate, was therefore examined in our experiments using immortalized GnRH-producing GT1-7 neurons. Whole cell patch clamp recordings showed the absence of the A-type current in GT1-7 cells cultured in estrogen-free medium and after 8h 17beta-estradiol treatment. Exposure of the cells to 17beta-estradiol for 24 and 48 h, respectively, resulted in the appearance of the A-type current. The induction of the A-type current by 17beta-estradiol was dose-related (50 pM to 15 nM range). In contrast, the K-type potassium current was apparent in the estrogen-free environment and 17beta-estradiol administration significantly decreased its amplitude. Co-administration of 17beta-estradiol and estrogen receptor blocker, Faslodex (ICI 182,780; 1 microM) abolished the occurrence of the A-type current. Real-time PCR data demonstrated that expression of the Kv4.2 subunit of the A-type channel was low at 0, 0.5, 2 and 8h, peaked at 24h and diminished at 48 h 17beta-estradiol treatment (15 nM). These data indicate that potassium channels of GT1-7 neurons are regulated by estrogen a mechanism that might contribute to modulation of firing rate and hormone secretion in GnRH neurons.

  17. EFFECT OF ETHANOL AND ACETALDEHYDE AT CLINICALLY RELEVANT CONCENTRATIONS ON ATRIAL INWARD RECTIFIER POTASSIUM CURRENT I-K1 SEPARATE AND COMBINED EFFECT

    Czech Academy of Sciences Publication Activity Database

    Hořáková, Z.; Matejovič, P.; Pásek, Michal; Hošek, J.; Šimurdová, M.; Šimurda, J.; Bébarová, M.

    2016-01-01

    Roč. 67, č. 3 (2016), s. 339-351 ISSN 0867-5910 Institutional support: RVO:61388998 Keywords : arrhythmias * cardiomyocyte * inward rectifier potassium current * ethanol * mathematical model Subject RIV: BO - Biophysics Impact factor: 2.883, year: 2016

  18. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  19. Inhibitory Effect of Vascular Endothelial Growth Factor on the Slowly Activating Delayed Rectifier Potassium Current in Guinea Pig Ventricular Myocytes.

    Science.gov (United States)

    Lin, Zhenhao; Xing, Wenlu; Gao, Chuanyu; Wang, Xianpei; Qi, Datun; Dai, Guoyou; Zhao, Wen; Yan, Ganxin

    2018-01-26

    Vascular endothelial growth factor (VEGF) exerts a number of beneficial effects on ischemic myocardium via its angiogenic properties. However, little is known about whether VEGF has a direct effect on the electrical properties of cardiomyocytes. In the present study, we investigated the effects of different concentrations of VEGF on delayed rectifier potassium currents (I K ) in guinea pig ventricular myocytes and their effects on action potential (AP) parameters. I K and AP were recorded by the whole-cell patch clamp method in ventricular myocytes. Cells were superfused with control solution or solution containing VEGF at different concentrations for 10 minutes before recording. Some ventricular myocytes were pretreated with a phosphatidylinositol 3-kinase inhibitor for 1 hour before the addition of VEGF. We found that VEGF inhibited the slowly activating delayed rectifier potassium current (I K s ) in a concentration-dependent manner (18.13±1.04 versus 12.73±0.34, n=5, P =0.001; 12.73±0.34 versus 9.05±1.20, n=5, P =0.036) and prolonged AP duration (894.5±36.92 versus 746.3±33.71, n=5, P =0.021). Wortmannin, a phosphatidylinositol 3-kinase inhibitor, eliminated these VEGF-induced effects. VEGF had no significant effect on the rapidly activating delayed rectifier potassium current (I K r ), resting membrane potential, AP amplitude, or maximal velocity of depolarization. VEGF inhibited I K s in a concentration-dependent manner through a phosphatidylinositol 3-kinase-mediated signaling pathway, leading to AP prolongation. The results indicate a promising therapeutic potential of VEGF in prevention of ventricular tachyarrhythmias under conditions of high sympathetic activity and ischemia. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  20. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  1. The Outwardly Rectifying Current of Layer 5 Neocortical Neurons that was Originally Identified as "Non-Specific Cationic" Is Essentially a Potassium Current.

    Directory of Open Access Journals (Sweden)

    Omer Revah

    Full Text Available In whole-cell patch clamp recordings from layer 5 neocortical neurons, blockade of voltage gated sodium and calcium channels leaves a cesium current that is outward rectifying. This current was originally identified as a "non-specific cationic current", and subsequently it was hypothesized that it is mediated by TRP channels. In order to test this hypothesis, we used fluorescence imaging of intracellular sodium and calcium indicators, and found no evidence to suggest that it is associated with influx of either of these ions to the cell body or dendrites. Moreover, the current is still prominent in neurons from TRPC1-/- and TRPC5-/- mice. The effects on the current of various blocking agents, and especially its sensitivity to intracellular tetraethylammonium, suggest that it is not a non-specific cationic current, but rather that it is generated by cesium-permeable delayed rectifier potassium channels.

  2. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  3. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  4. Modification of sodium and potassium channel kinetics by diethyl ether and studies on sodium channel inactivation in the crayfish giant axon membrane

    Energy Technology Data Exchange (ETDEWEB)

    Bean, Bruce Palmer [Univ. of Rochester, NY (United States)

    1979-01-01

    The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in the hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.

  5. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  6. Short- and long-term inhibition of cardiac inward-rectifier potassium channel current by an antiarrhythmic drug bepridil.

    Science.gov (United States)

    Ma, Fangfang; Takanari, Hiroki; Masuda, Kimiko; Morishima, Masaki; Ono, Katsushige

    2016-07-01

    Bepridil is an effective antiarrhythmic drug on supraventricular and ventricular arrhythmias, and inhibitor of calmodulin. Recent investigations have been elucidating that bepridil exerts antiarrhythmic effects through its acute and chronic application for patients. The aim of this study was to identify the efficacy and the potential mechanism of bepridil on the inward-rectifier potassium channel in neonatal rat cardiomyocytes in acute- and long-term conditions. Bepridil inhibited inward-rectifier potassium current (I K1) as a short-term effect with IC50 of 17 μM. Bepridil also reduced I K1 of neonatal cardiomyocytes when applied for 24 h in the culture medium with IC50 of 2.7 μM. Both a calmodulin inhibitor (W-7) and an inhibitor of calmodulin-kinase II (KN93) reduced I K1 when applied for 24 h as a long-term effect in the same fashion, suggesting that the long-term application of bepridil inhibits I K1 more potently than that of the short-term application through the inhibition of calmodulin kinase II pathway in cardiomyocytes.

  7. Dynamic, nonlinear feedback regulation of slow pacemaking by A-type potassium current in ventral tegmental area neurons.

    Science.gov (United States)

    Khaliq, Zayd M; Bean, Bruce P

    2008-10-22

    We analyzed ionic currents that regulate pacemaking in dopaminergic neurons of the mouse ventral tegmental area by comparing voltage trajectories during spontaneous firing with ramp-evoked currents in voltage clamp. Most recordings were made in brain slice, with key experiments repeated using acutely dissociated neurons, which gave identical results. During spontaneous firing, net ionic current flowing between spikes was calculated from the time derivative of voltage multiplied by cell capacitance, signal-averaged over many firing cycles to enhance resolution. Net inward interspike current had a distinctive nonmonotonic shape, reaching a minimum (generally current that peaked near -55 mV. This current was undetectable with 5 mV/s ramps and increased steeply with depolarization rate over the range (10-50 mV/s) typical of natural pacemaking. Ramp-evoked subthreshold current was resistant to alpha-dendrotoxin, paxilline, apamin, and tetraethylammonium but sensitive to 4-aminopyridine and 0.5 mM Ba2+, consistent with A-type potassium current (I(A)). Same-cell comparison of currents elicited by various ramp speeds with natural spontaneous depolarization showed how the steep dependence of I(A) on depolarization rate results in small net inward currents during pacemaking. These results reveal a mechanism in which subthreshold I(A) is near zero at steady state, but is engaged at depolarization rates >10 mV/s to act as a powerful, supralinear feedback element. This feedback mechanism explains how net ionic current can be constrained to <1-2 pA but reliably inward, thus enabling slow, regular firing.

  8. [Current Perspective on Voltage-gated Potassium Channel Complex Antibody Associated Diseases].

    Science.gov (United States)

    Watanabe, Osamu

    2018-04-01

    Voltage-gated potassium channel (VGKC) complex auto-antibodies were initially identified in Isaacs' syndrome (IS), which is characterized by muscle cramps and neuromyotonia. These antibodies were subsequently identified in patients with Morvan's syndrome (MoS), which includes IS in conjunction with psychosis, insomnia, and dysautonomia. The antibodies have also been detected in a patient with limbic encephalopathy (LE) presenting with prominent amnesia and frequent seizures. Typical cases of LE have adult-onset, with frequent, brief dystonic seizures that predominantly affect the arms and ipsilateral face, and has recently been termed faciobrachial dystonic seizures. Autoantibodies against the extracellular domains of VGKC complex proteins, leucine-rich glioma-inactivated 1 (LGI1), and contactin-associated protein-2 (Caspr2), occur in patients with IS, MoS, and LE. However, routine testing has detected VGKC complex antibodies without LGI1 or Caspr2 reactivities (double-negative) in patients with other diseases, such as Creutzfeldt-Jakob disease and amyotrophic lateral sclerosis. Furthermore, double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits. Therefore, these antibodies should no longer be classified as neuronal-surface antibodies and lacking pathogenic potential. Novel information has been generated regarding autoantibody disruption of the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, thereby reducing the synaptic AMPA receptors. It may be that the main action is on inhibitory neurons, explaining why the loss of AMPA receptors causes amnesia, neuronal excitability and seizures.

  9. Contribution of delayed rectifier potassium currents to the electrical activity of murine colonic smooth muscle

    Science.gov (United States)

    Koh, S D; Ward, S M; Dick, G M; Epperson, A; Bonner, H P; Sanders, K M; Horowitz, B; Kenyon, J L

    1999-01-01

    We used intracellular microelectrodes to record the membrane potential (Vm) of intact murine colonic smooth muscle. Electrical activity consisted of spike complexes separated by quiescent periods (Vm≈−60 mV). The spike complexes consisted of about a dozen action potentials of approximately 30 mV amplitude. Tetraethylammonium (TEA, 1–10 mM) had little effect on the quiescent periods but increased the amplitude of the action potential spikes. 4-Aminopyridine (4-AP, ⋧ 5 mM) caused continuous spiking.Voltage clamp of isolated myocytes identified delayed rectifier K+ currents that activated rapidly (time to half-maximum current, 11.5 ms at 0 mV) and inactivated in two phases (τf = 96 ms, τs = 1.5 s at 0 mV). The half-activation voltage of the permeability was −27 mV, with significant activation at −50 mV.TEA (10 mM) reduced the outward current at potentials positive to 0 mV. 4-AP (5 mM) reduced the early current but increased outward current at later times (100–500 ms) consistent with block of resting channels relieved by depolarization. 4-AP inhibited outward current at potentials negative to −20 mV, potentials where TEA had no effect.Qualitative PCR amplification of mRNA identified transcripts encoding delayed rectifier K+ channel subunits Kv1.6, Kv4.1, Kv4.2, Kv4.3 and the Kvβ1.1 subunit in murine colon myocytes. mRNA encoding Kv 1.4 was not detected.We find that TEA-sensitive delayed rectifier currents are important determinants of action potential amplitude but not rhythmicity. Delayed rectifier currents sensitive to 4-AP are important determinants of rhythmicity but not action potential amplitude. PMID:10050014

  10. Differential roles of two delayed rectifier potassium currents in regulation of ventricular action potential duration and arrhythmia susceptibility.

    Science.gov (United States)

    Devenyi, Ryan A; Ortega, Francis A; Groenendaal, Willemijn; Krogh-Madsen, Trine; Christini, David J; Sobie, Eric A

    2017-04-01

    Arrhythmias result from disruptions to cardiac electrical activity, although the factors that control cellular action potentials are incompletely understood. We combined mathematical modelling with experiments in heart cells from guinea pigs to determine how cellular electrical activity is regulated. A mismatch between modelling predictions and the experimental results allowed us to construct an improved, more predictive mathematical model. The balance between two particular potassium currents dictates how heart cells respond to perturbations and their susceptibility to arrhythmias. Imbalances of ionic currents can destabilize the cardiac action potential and potentially trigger lethal cardiac arrhythmias. In the present study, we combined mathematical modelling with information-rich dynamic clamp experiments to determine the regulation of action potential morphology in guinea pig ventricular myocytes. Parameter sensitivity analysis was used to predict how changes in ionic currents alter action potential duration, and these were tested experimentally using dynamic clamp, a technique that allows for multiple perturbations to be tested in each cell. Surprisingly, we found that a leading mathematical model, developed with traditional approaches, systematically underestimated experimental responses to dynamic clamp perturbations. We then re-parameterized the model using a genetic algorithm, which allowed us to estimate ionic current levels in each of the cells studied. This unbiased model adjustment consistently predicted an increase in the rapid delayed rectifier K + current and a drastic decrease in the slow delayed rectifier K + current, and this prediction was validated experimentally. Subsequent simulations with the adjusted model generated the clinically relevant prediction that the slow delayed rectifier is better able to stabilize the action potential and suppress pro-arrhythmic events than the rapid delayed rectifier. In summary, iterative coupling of

  11. TWIK-1 two-pore domain potassium channels change ion selectivity and conduct inward leak sodium currents in hypokalemia.

    Science.gov (United States)

    Ma, Liqun; Zhang, Xuexin; Chen, Haijun

    2011-06-07

    Background potassium (K+) channels, which are normally selectively permeable to K+, maintain the cardiac resting membrane potential at around -80 mV. In subphysiological extracellular K+ concentrations ([K+]o), which occur in pathological hypokalemia, the resting membrane potential of human cardiomyocytes can depolarize to around -50 mV, whereas rat and mouse cardiomyocytes become hyperpolarized, consistent with the Nernst equation for K+. This paradoxical depolarization of cardiomyocytes in subphysiological [K+]o, which may contribute to cardiac arrhythmias, is thought to involve an inward leak sodium (Na+) current. Here, we show that human cardiac TWIK-1 (also known as K2P1) two-pore domain K+ channels change ion selectivity, becoming permeable to external Na+, and conduct inward leak Na+ currents in subphysiological [K+]o. A specific threonine residue (Thr118) within the pore selectivity sequence TxGYG was required for this altered ion selectivity. Mouse cardiomyocyte-derived HL-1 cells exhibited paradoxical depolarization with ectopic expression of TWIK-1 channels, whereas TWIK-1 knockdown in human spherical primary cardiac myocytes eliminated paradoxical depolarization. These findings indicate that ion selectivity of TWIK-1 K+ channels changes during pathological hypokalemia, elucidate a molecular basis for inward leak Na+ currents that could trigger or contribute to cardiac paradoxical depolarization in lowered [K+]o, and identify a mechanism for regulating cardiac excitability.

  12. Effect of ethanol at clinically relevant concentrations on atrial inward rectifier potassium current sensitive to acetylcholine

    Czech Academy of Sciences Publication Activity Database

    Bébarová, M.; Matejovič, P.; Pásek, Michal; Hořáková, Z.; Hošek, J.; Šimurdová, M.; Šimurda, J.

    2016-01-01

    Roč. 389, č. 10 (2016), s. 1049-1058 ISSN 0028-1298 Institutional support: RVO:61388998 Keywords : arrhythmias * atrial cardiomyocyte * inward rectifier potasssium current * ethanol * rat atrial cell model Subject RIV: BO - Biophysics Impact factor: 2.558, year: 2016

  13. Update on the slow delayed rectifier potassium current (I(Ks)): role in modulating cardiac function.

    Science.gov (United States)

    Liu, Zhenzhen; Du, Lupei; Li, Minyong

    2012-01-01

    The slow delayed rectifier current (I(Ks)) is the slow component of cardiac delayed rectifier current and is critical for the late phase repolarization of cardiac action potential. This current is also an important target for Sympathetic Nervous System (SNS) to regulate the cardiac electivity to accommodate to heart rate alterations in response to exercise or emotional stress and can be up-regulated by β- adrenergic or other signal molecules. I(Ks) channel is originated by the co-assembly of pore-forming KCNQ1 α-subunit and accessory KCNE1 β-subunit. Mutations in any subunit can bring about severe long QT syndrome (LQT-1, LQT-5) as characterized by deliquium, seizures and sudden death. This review summarizes the normal physiological functions and molecular basis of I(Ks) channels, as well as illustrates up-to-date development on its blockers and activators. Therefore, the current extensive survey should generate fundamental understanding of the role of I(Ks) channel in modulating cardiac function and donate some instructions to the progression of I(Ks) blockers and activators as potential antiarrhythmic agents or pharmacological tools to determine the physiological and pathological function of I(Ks).

  14. Antinociceptive action of oxytocin involves inhibition of potassium channel currents in lamina II neurons of the rat spinal cord

    Directory of Open Access Journals (Sweden)

    Darbon Pascal

    2009-11-01

    Full Text Available Abstract Background Growing evidence in the literature shows that oxytocin (OT has a strong spinal anti-nociceptive action. Oxytocinergic axons originating from a subpopulation of paraventricular hypothalamic neurons establish synaptic contacts with lamina II interneurons but little is known about the functional role of OT with respect to neuronal firing and excitability. Results Using the patch-clamp technique, we have recorded lamina II interneurons in acute transverse lumbar spinal cord slices of rats (15 to 30 days old and analyzed the OT effects on action potential firing ability. In the current clamp mode, we found that bath application of a selective OT-receptor agonist (TGOT reduced firing in the majority of lamina II interneurons exhibiting a bursting firing profile, but never in those exhibiting a single spike discharge upon depolarization. Interestingly, OT-induced reduction in spike frequency and increase of firing threshold were often observed, leading to a conversion of the firing profile from repetitive and delayed profiles into phasic ones and sometimes further into single spike profile. The observed effects following OT-receptor activation were completely abolished when the OT-receptor agonist was co-applied with a selective OT-receptor antagonist. In current and voltage clamp modes, we show that these changes in firing are strongly controlled by voltage-gated potassium currents. More precisely, transient IA currents and delayed-rectifier currents were reduced in amplitude and transient IA current was predominantly inactivated after OT bath application. Conclusion This effect of OT on the firing profile of lamina II neurons is in good agreement with the antinociceptive and analgesic properties of OT described in vivo.

  15. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  16. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  17. Photoperiod Modulates Fast Delayed Rectifier Potassium Currents in the Mammalian Circadian Clock.

    Science.gov (United States)

    Farajnia, Sahar; Meijer, Johanna H; Michel, Stephan

    2016-10-01

    One feature of the mammalian circadian clock, situated in the suprachiasmatic nucleus (SCN), is its ability to measure day length and thereby contribute to the seasonal adaptation of physiology and behavior. The timing signal from the SCN, namely the 24 hr pattern of electrical activity, is adjusted according to the photoperiod being broader in long days and narrower in short days. Vasoactive intestinal peptide and gamma-aminobutyric acid play a crucial role in intercellular communication within the SCN and contribute to the seasonal changes in phase distribution. However, little is known about the underlying ionic mechanisms of synchronization. The present study was aimed to identify cellular mechanisms involved in seasonal encoding by the SCN. Mice were adapted to long-day (light-dark 16:8) and short-day (light-dark 8:16) photoperiods and membrane properties as well as K + currents activity of SCN neurons were measured using patch-clamp recordings in acute slices. Remarkably, we found evidence for a photoperiodic effect on the fast delayed rectifier K + current, that is, the circadian modulation of this ion channel's activation reversed in long days resulting in 50% higher peak values during the night compared with the unaltered day values. Consistent with fast delayed rectifier enhancement, duration of action potentials during the night was shortened and afterhyperpolarization potentials increased in amplitude and duration. The slow delayed rectifier, transient K + currents, and membrane excitability were not affected by photoperiod. We conclude that photoperiod can change intrinsic ion channel properties of the SCN neurons, which may influence cellular communication and contribute to photoperiodic phase adjustment. © The Author(s) 2016.

  18. Photoperiod Modulates Fast Delayed Rectifier Potassium Currents in the Mammalian Circadian Clock

    Directory of Open Access Journals (Sweden)

    Sahar Farajnia

    2016-09-01

    Full Text Available One feature of the mammalian circadian clock, situated in the suprachiasmatic nucleus (SCN, is its ability to measure day length and thereby contribute to the seasonal adaptation of physiology and behavior. The timing signal from the SCN, namely the 24 hr pattern of electrical activity, is adjusted according to the photoperiod being broader in long days and narrower in short days. Vasoactive intestinal peptide and gamma-aminobutyric acid play a crucial role in intercellular communication within the SCN and contribute to the seasonal changes in phase distribution. However, little is known about the underlying ionic mechanisms of synchronization. The present study was aimed to identify cellular mechanisms involved in seasonal encoding by the SCN. Mice were adapted to long-day (light–dark 16:8 and short-day (light–dark 8:16 photoperiods and membrane properties as well as K+ currents activity of SCN neurons were measured using patch-clamp recordings in acute slices. Remarkably, we found evidence for a photoperiodic effect on the fast delayed rectifier K+ current, that is, the circadian modulation of this ion channel’s activation reversed in long days resulting in 50% higher peak values during the night compared with the unaltered day values. Consistent with fast delayed rectifier enhancement, duration of action potentials during the night was shortened and afterhyperpolarization potentials increased in amplitude and duration. The slow delayed rectifier, transient K+ currents, and membrane excitability were not affected by photoperiod. We conclude that photoperiod can change intrinsic ion channel properties of the SCN neurons, which may influence cellular communication and contribute to photoperiodic phase adjustment.

  19. Modulation of membrane potential by an acetylcholine-activated potassium current in trout atrial myocytes

    DEFF Research Database (Denmark)

    Molina, C.E.; Gesser, Hans; Llach, A.

    2007-01-01

    mV from 4.3 pA/pF to 27 pA/pF with an EC50 of 45 nM in atrial myocytes. Moreover, 3 nM ACh increased the slope conductance of Im fourfold, shifted its reversal potential from -78 ± 3 to -84 ± 3 mV, and stabilized the resting membrane potential at -92 ± 4 mV. ACh also shortened the action potential...... hypothesized that this is at least partly due to a small slope conductance of Im around the resting membrane potential in atrial myocytes. In accordance with this hypothesis, the slope conductance of Im was about sevenfold smaller in atrial than in ventricular myocytes. Interestingly, ACh increased Im at -120...... of an inwardly rectifying K+ current can modulate the membrane potential in the trout atrial myocytes and stabilize the resting membrane potential. teleost heart; IK,ACh; cholinergic modulation; action potential...

  20. Evidences of the ultrarapid delayed rectifier potassium current (IKur on pacemaker activity in sinoatrial and atrioventricular nodes of Rat

    Directory of Open Access Journals (Sweden)

    Mohammad reza Nikmaram

    2008-09-01

    Full Text Available Background: Sinoatrial node (SAN is the primary pacemaker of the heart. If the SAN activity fails in any way, then the atrioventricular node (AVN immediately starts to regulate the activities of the heart. The aim of this study was to assess the existence or non existence of ultrarapid delayed rectifier potassium current (Ikur and its role on pacemaker activity of two intact SAN and AVN of rat. Methods: The pacemaker activities of distinct intact SAN and AVN by two separate metal microelectrodes that contact the endothelial surface of nodes were recorded and cycle length (CL of action potential was measured. The recording was done before and during 50µM 4-Aminopyridine (4-AP as an Ikur blocker. Results: Compared to control condition, CL of action potentials of SAN and VAN preparations had increased by 17.60 +/-2.9% and 35.90 +/-2.9%, respectively (P<0.05. Conclusion: It is possible to conclude that the Ikur was present in AVN and SAN and the effect of 4-AP on CL of action potential nodes was significantly different.

  1. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  2. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  3. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  4. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  5. Changes in the action potential and transient outward potassium current in cardiomyocytes during acute cardiac rejection in rats.

    Science.gov (United States)

    Luo, Wenqi; Jia, Yixin; Zheng, Shuai; Li, Yan; Han, Jie; Meng, Xu

    2017-01-01

    Acute cardiac rejection contributes to the changes in the electrophysiological properties of grafted hearts. However, the electrophysiological changes of cardiomyocytes during acute cardiac rejection are still unknown. An understanding of the electrophysiological mechanisms of cardiomyocytes could improve the diagnosis and treatment of acute cardiac rejection. So it is important to characterize the changes in the action potential ( AP ) and the transient outward potassium current ( I to ) in cardiomyocytes during acute cardiac rejection. Heterotopic heart transplantation was performed in allogeneic [Brown Norway (BN)-to-Lewis] and isogeneic (BN-to-BN) rats. Twenty models were established in each group. Ten recipients were sacrificed at the 2nd day and the other ten recipients were sacrificed at the 4 th day after the operation in each group. Histopathological examinations of the grafted hearts were performed in half of the recipients in each group randomly. The other half of the grafted hearts were excised rapidly and enzymatically dissociated to obtain single cardiomyocytes. The AP and I to current were recorded using the whole cell patch-clamp technique. Forty grafted hearts were successfully harvested and used in experiments. Histologic examination showed mild rejection at the 2 nd day and moderate rejection at the 4 th day in the allogeneic group after cardiac transplantation, while no evidence of histologic lesions of rejection were observed in the isogeneic group. Compared with the isogeneic group, the action potential duration ( APD ) of cardiomyocytes in the allogeneic group was significantly prolonged ( APD 90 was 49.28±5.621 mV in the isogeneic group and 88.08±6.445 mV in the allogeneic group at the 2 nd day, P=0.0016; APD 90 was 59.34±5.183 mV in the isogeneic group and 104.0±9.523 mV in the allogeneic group at the 4 th day, P=0.0064). The current density of I to was significantly decreased at the 4 th day after cardiac transplantation. The APD of

  6. Sex differences in repolarization and slow delayed rectifier potassium current and their regulation by sympathetic stimulation in rabbits.

    Science.gov (United States)

    Zhu, Yujie; Ai, Xun; Oster, Robert A; Bers, Donald M; Pogwizd, Steven M

    2013-06-01

    Slow delayed rectifier potassium current (IKs) is important in action potential (AP) repolarization and repolarization reserve. We tested the hypothesis that there are sex-specific differences in IKs, AP, and their regulation by β-adrenergic receptors (β-AR's) using whole-cell patch-clamp. AP duration (APD90) was significantly longer in control female (F) than in control male (M) myocytes. Isoproterenol (ISO, 500 nM) shortened APD90 comparably in M and F, and was largely reversed by β1-AR blocker CGP 20712A (CGP, 300 nM). Inhibition of IKs with chromanol 293B (10 μM) resulted in less APD prolongation in F at baseline (3.0 vs 8.9 %, p < 0.05 vs M) and even in the presence of ISO (5.4 vs 20.9 %, p < 0.05). This suggests that much of the ISO-induced APD abbreviation in F is independent of IKs. In F, baseline IKs was 42 % less and was more weakly activated by ISO (19 vs 68 % in M, p < 0.01). ISO enhancement of IKs was comparably attenuated by CGP in M and F. After ovariectomy, IKs in F had greater enhancement by ISO (72 %), now comparable to control M. After orchiectomy, IKs in M was only slightly enhanced by ISO (23 %), comparable to control F. Pretreatment with thapsigargin (to block SR Ca release) had bigger impact on ISO-induced APD shortening in F than that in M (p < 0.01). In conclusion, we found that there are sex differences in IKs, AP, and their regulation by β-AR's that are modulated by sex hormones, suggesting the potential for sex-specific antiarrhythmic therapy.

  7. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  8. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  9. Effect of lycium barbarum polysaccharides on high glucose-induced retinal ganglion cell apoptosis, gene expression and delayed rectifier potassium current

    Directory of Open Access Journals (Sweden)

    Xiao-Fei Ma

    2017-05-01

    Full Text Available Objective: To study the effect of lycium barbarum polysaccharides (LBP on high glucoseinduced retinal ganglion cell apoptosis, gene expression and delayed rectifier potassium current. Methods: RGC-5 retinal ganglion cell lines were cultured and divided into control group, high glucose group and LBP group that were treated with normal DMEM, highglucose DMEM as well as high-glucose DMEM containing 500 ng/mL LBP respectively. After treatment, the Annexin V-FITC/PI kits were used to measure the number of apoptotic cells, fluorescence quantitative PCR kits were used to determine the expression of apoptosis genes and antioxidant genes, and patch clamp was used to test delayed rectifier potassium current. Results: 12, 24, 36 and 48 h after intervention, the number of apoptotic cells of high glucose group was significantly higher than that of control group, and the number of apoptotic cells of LBP group was significantly lower than that of high glucose group (P<0.05; 24 and 48 h after intervention, c-fos, c-jun, caspase-3, caspase-9, Nrf-2, NQO1 and HO-1 mRNA expression as well as potassium current amplitude (IK and maximum conductance (Gmax of high glucose group were significantly higher than those of control group while half maximum activation voltage (V1/2 was significantly lower than that of control group (P<0.05; c-fos, c-jun, caspase-3 and caspase-9 mRNA expression as well as IK and Gmax of LBP group were significantly lower than those of high glucose group, while Nrf-2, NQO1 and HO-1 mRNA expression as well as V1/2 of LBP group were significantly higher than those of high glucose group (P<0.05. Conclusions: LBP can reduce the high glucose-induced retinal ganglion cell apoptosis and inhibit the delayed rectifier potassium current amplitude.

  10. The KCNQ5 potassium channel from mouse: a broadly expressed M-current like potassium channel modulated by zinc, pH, and volume changes

    DEFF Research Database (Denmark)

    Jensen, Henrik Sindal; Callø, Kirstine; Jespersen, Thomas

    2005-01-01

    H-dependent potentiation by Zn2+ (EC50 = 21.8 microM at pH 7.4), inhibition by acidification (IC50 = 0.75 microM; pKa = 6.1), and regulation by small changes in cell volume. Furthermore, the channels are activated by the anti-convulsant drug retigabine (EC50 = 2.0 microM) and inhibited by the M-current blockers...... and hippocampus. This study shows that murine KCNQ5 channels, in addition to sharing biophysical and pharmacological characteristics with the human ortholog, are tightly regulated by physiological stimuli such as changes in extracellular Zn2+, pH, and tonicity, thus adding to the complex regulation...

  11. Potassium iodide (KI) to block the thyroid from exposure to I-131: current questions and answers to be discussed

    Energy Technology Data Exchange (ETDEWEB)

    Reiners, Christoph; Schneider, Rita [Hospital of the University of Wuerzburg, Department of Nuclear Medicine, German WHO-REMPAN Collaboration Center, Wuerzburg (Germany)

    2013-05-15

    Thyroid cancer in children and adolescents has to be considered as the most severe health consequence of a nuclear reactor emergency with release of radioiodine into the atmosphere. High doses of potassium iodide are effective to block radioiodine thyroid uptake and to prevent development of thyroid cancer years later. However, there are controversies concerning thyroid cancer risk induced by radioiodine exposure in adults. Further, the interaction of nutritional supply of potassium iodide and radioiodine uptake as well as the interaction of radioiodine with certain drugs has not been addressed properly in existing guidelines and recommendations. How to proceed in case of repeated release of radioiodine is an open, very important question which came up again recently during the Fukushima accident. Lastly, the side effects of iodine thyroid blocking and alternatives of this procedure have not been addressed systematically up to now in guidelines and recommendations. These questions can be answered as follows: in adults, the risk to develop thyroid cancer is negligible. In countries, where nutritional iodine deficiency is still an issue, the risk to develop thyroid cancer after a nuclear reactor emergency has to be considered higher because the thyroid takes up more radioiodine as in the replete condition. Similarly, in patients suffering from thyrotoxicosis, hypothyroidism or endemic goitre not being adequately treated radioiodine uptake is higher than in healthy people. In case of repeated or continued radioiodine release, more than one dose of potassium iodide may be necessary and be taken up to 1 week. Repeated iodine thyroid blocking obviously is not harmful. Side effects of iodine thyroid blocking should not be overestimated; there is little evidence for adverse effects in adults. Newborns and babies, however, may be more sensitive to side effects. In the rare case of iodine hypersensitivity, potassium perchlorate may be applied as an alternative to iodine for

  12. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  13. 21 CFR 184.1622 - Potassium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium chloride. 184.1622 Section 184.1622 Food... Specific Substances Affirmed as GRAS § 184.1622 Potassium chloride. (a) Potassium chloride (KCl, CAS Reg... levels not to exceed current good manufacturing practice. Potassium chloride may be used in infant...

  14. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  15. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  16. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  17. Neurovascular coupling protects neurons against hypoxic injury via inhibition of potassium currents by generation of nitric oxide in direct neuron and endothelium cocultures.

    Science.gov (United States)

    Wu, Kun-Wei; Kou, Zeng-Wei; Mo, Jia-Lin; Deng, Xu-Xu; Sun, Feng-Yan

    2016-10-15

    This study examined the effect of neuron-endothelial coupling on the survival of neurons after ischemia and the possible mechanism underlying that effect. Whole-cell patch-clamp experiments were performed on cortical neurons cultured alone or directly cocultured with brain microvascular endothelial cells (BMEC). Propidium iodide (PI) and NeuN staining were performed to examine neuronal death following oxygen and glucose deprivation (OGD). We found that the neuronal transient outward potassium currents (I A ) decreased in the coculture system, whereas the outward delayed-rectifier potassium currents (I K ) did not. Sodium nitroprusside, a NO donor, enhanced BMEC-induced I A inhibition and nitro-l-arginine methylester, a NOS inhibitor, partially prevented this inhibition. Moreover, the neurons directly cocultured with BMEC showed more resistance to OGD-induced injury compared with the neurons cultured alone, and that neuroprotective effect was abolished by treatment with NS5806, an activator of the I A . These results indicate that vascular endothelial cells assist neurons to prevent hypoxic injury via inhibiting neuronal I A by production of NO in the direct neuron-BMEC coculture system. These results further provide direct evidence of functional coupling between neurons and vascular endothelial cells. This study clearly demonstrates that vascular endothelial cells play beneficial roles in the pathophysiological processes of neurons after hypoxic injury, suggesting that the improvement of neurovascular coupling or functional remodeling may become an important therapeutic target for preventing brain injury. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  18. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  19. Intracellular mediators of potassium-induced aldosterone secretion

    International Nuclear Information System (INIS)

    Ganguly, A.; Chiou, S.; Davis, J.S.

    1990-01-01

    We have investigated the intracellular messengers of potassium in eliciting aldosterone secretion in calf adrenal glomerulosa cells since there were unresolved issues relating to the role of phosphoinositides, cAMP and protein kinases. We observed no evidence of hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP 2 ) in 3 H-inositol labeled alf adrenal cells or increase of cAMP in response to potassium. Addition of calcium channel blocker, nitrendipine after stimulating adrenal glomerulosa cells with potassium, markedly inhibited aldosterone secretion. A calmodulin inhibitor (W-7) produced greater reduction of aldosterone secretion than an inhibitor of protein kinase C (H-7). These results suggest that a rise in cytosolic free calcium concentration through voltage-dependent calcium channel and calmodulin are the critical determinants of aldosterone secretion stimulated by potassium

  20. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  2. Protein kinase A and C regulate leak potassium currents in freshly isolated vascular myocytes from the aorta.

    Directory of Open Access Journals (Sweden)

    Sébastien Hayoz

    Full Text Available We tested the hypothesis that protein kinase A (PKA inhibits K2P currents activated by protein kinase C (PKC in freshly isolated aortic myocytes. PDBu, the PKC agonist, applied extracellularly, increased the amplitude of the K2P currents in the presence of the "cocktail" of K(+ channel blockers. Gö 6976 significantly reduced the increase of the K2P currents by PDBu suggesting the involvement of either α or β isoenzymes of PKC. We found that forskolin, or membrane permeable cAMP, did not inhibit K2P currents activated by the PKC. However, when PKA agonists were added prior to PDBu, they produced a strong decrease in the K2P current amplitudes activated by PKC. Inhibition of PDBu-elicited K2P currents by cAMP agonists was not prevented by the treatment of vascular smooth muscle cells with PKA antagonists (H-89 and Rp-cAMPs. Zn(2+ and Hg(2+ inhibited K2P currents in one population of cells, produced biphasic responses in another population, and increased the amplitude of the PDBu-elicited K(+ currents in a third population of myocytes, suggesting expression of several K2P channel types. We found that cAMP agonists inhibited biphasic responses and increase of amplitude of the PDBu-elicited K2P currents produced by Zn(2+ and Hg(2. 6-Bnz-cAMp produced a significantly altered pH sensitivity of PDBu-elicited K2P-currents, suggesting the inhibition of alkaline-activated K2P-currents. These results indicate that 6-Bnz-cAMP and other cAMP analogs may inhibit K2P currents through a PKA-independent mechanism. cAMP analogs may interact with unidentified proteins involved in K2P channel regulation. This novel cellular mechanism could provide insights into the interplay between PKC and PKA pathways that regulate vascular tone.

  3. Potassium test

    Science.gov (United States)

    ... hyperkalemia ) may be due to: Addison disease (rare) Blood transfusion Certain medicines Crushed tissue injury Hyperkalemic periodic paralysis ... released. This may cause a falsely high result. Alternative Names Hypokalemia test; K+ Images Blood test References Mount DB. Disorders of potassium balance. ...

  4. Potassium Iodide

    Science.gov (United States)

    ... certain other liquids including low-fat white or chocolate milk, flat soda, orange juice, raspberry syrup, or ... Potassium iodide may cause side effects. Tell your doctor if any of these symptoms are severe or do not go away: swollen glands metallic taste in the ...

  5. Low Potassium (Hypokalemia)

    Science.gov (United States)

    Symptoms Low potassium (hypokalemia) By Mayo Clinic Staff Low potassium (hypokalemia) refers to a lower than normal potassium level ... 2 millimoles per liter (mmol/L). A very low potassium level (less than 2.5 mmol/L) ...

  6. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  7. The RF voltage dependence of the electron sheath heating in low pressure capacitively coupled rf discharges

    International Nuclear Information System (INIS)

    Buddemeier, U.; Kortshagen, U.; Pukropski, I.

    1995-01-01

    In low pressure capacitively coupled RF discharges two competitive electron heating mechanisms have been discussed for some time now. At low pressures the stochastic sheath heating and for somewhat higher pressures the Joule heating in the bulk plasma have been proposed. When the pressure is increased at constant RF current density a transition from concave electron distribution functions (EDF) with a pronounced cold electron group to convex EDFs with a missing strong population of cold electrons is found. This transition was interpreted as the transition from dominant stochastic to dominant Joule heating. However, a different interpretation has been given by Kaganovich and Tsendin, who attributed the concave shaped EDFs to the spatially inhomogeneous RF field in combination with the nonlocality of the EDF

  8. The effects of deoxyelephantopin on the cardiac delayed rectifier potassium channel current (IKr) and human ether-a-go-go-related gene (hERG) expression.

    Science.gov (United States)

    Teah, Yi Fan; Abduraman, Muhammad Asyraf; Amanah, Azimah; Adenan, Mohd Ilham; Sulaiman, Shaida Fariza; Tan, Mei Lan

    2017-09-01

    Elephantopus scaber Linn and its major bioactive component, deoxyelephantopin are known for their medicinal properties and are often reported to have various cytotoxic and antitumor activities. This plant is widely used as folk medicine for a plethora of indications although its safety profile remains unknown. Human ether-a-go-go-related gene (hERG) encodes the cardiac I Kr current which is a determinant of the duration of ventricular action potentials and QT interval. The hERG potassium channel is an important antitarget in cardiotoxicity evaluation. This study investigated the effects of deoxyelephantopin on the current, mRNA and protein expression of hERG channel in hERG-transfected HEK293 cells. The hERG tail currents following depolarization pulses were insignificantly affected by deoxyelephantopin in the transfected cell line. Current reduction was less than 40% as compared with baseline at the highest concentration of 50 μM. The results were consistent with the molecular docking simulation and hERG surface protein expression. Interestingly, it does not affect the hERG expression at both transcriptional and translational level at most concentrations, although higher concentration at 10 μM caused protein accumulation. In conclusion, deoxyelephantopin is unlikely a clinically significant hERG channel and I kr blocker. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Effects of KCNQ channel modulators on the M-type potassium current in primate retinal pigment epithelium.

    Science.gov (United States)

    Pattnaik, Bikash R; Hughes, Bret A

    2012-03-01

    Recently, we demonstrated the expression of KCNQ1, KCNQ4, and KCNQ5 transcripts in monkey retinal pigment epithelium (RPE) and showed that the M-type current in RPE cells is blocked by the specific KCNQ channel blocker XE991. Using patch-clamp electrophysiology, we investigated the pharmacological sensitivity of the M-type current in isolated monkey RPE cells to elucidate the subunit composition of the channel. Most RPE cells exhibited an M-type current with a voltage for half-maximal activation of approximately -35 mV. The M-type current activation followed a double-exponential time course and was essentially complete within 1 s. The M-type current was inhibited by micromolar concentrations of the nonselective KCNQ channel blockers linopirdine and XE991 but was relatively insensitive to block by 10 μM chromanol 293B or 135 mM tetraethylammonium (TEA), two KCNQ1 channel blockers. The M-type current was activated by 1) 10 μM retigabine, an opener of all KCNQ channels except KCNQ1, 2) 10 μM zinc pyrithione, which augments all KCNQ channels except KCNQ3, and 3) 50 μM N-ethylmaleimide, which activates KCNQ2, KCNQ4, and KCNQ5, but not KCNQ1 or KCNQ3, channels. Application of cAMP, which activates KCNQ1 and KCNQ4 channels, had no significant effect on the M-type current. Finally, diclofenac, which activates KCNQ2/3 and KCNQ4 channels but inhibits KCNQ5 channels, inhibited the M-type current in the majority of RPE cells but activated it in others. The results indicate that the M-type current in monkey RPE is likely mediated by channels encoded by KCNQ4 and KCNQ5 subunits.

  10. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  11. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Inhibitory effects of psychotropic drugs on the acetylcholine receptor-operated potassium current (IK.ACh) in guinea-pig atrial myocytes.

    Science.gov (United States)

    Okada, Muneyoshi; Watanabe, Shinya; Matada, Takashi; Asao, Yoko; Hamatani, Ramu; Yamawaki, Hideyuki; Hara, Yukio

    2013-01-01

    Influences of psychotropic drugs, six antipsychotics and three antidepressants, on acetylcholine receptor-operated potassium current (IK.ACh) were examined by a whole-cell patch clamp method in freshly isolated guinea-pig atrial myocyte. IK.ACh was induced by a superfusion of carbachol (CCh) or by an intracellular application of guanosine 5'-[thio] triphosphate (GTPγS). To elucidate mechanism for anticholinergic action, IC50 ratio, the ratio of IC50 for GTPγS-activated IK.ACh to CCh-induced IK.ACh, was calculated. Antipsychotics and antidepressants inhibited CCh-induced IK.ACh in a concentration-dependent manner. The IC50 values were as follows; chlorpromazine 0.53 μM, clozapine 0.06 μM, fluphenazine 2.69 μM, haloperidol 2.66 μM, sulpiride 42.3 μM, thioridazine 0.07 μM, amitriptyline 0.03 μM, imipramine 0.22 μM and maprotiline 1.81 μM. The drugs, except for sulpiride, inhibited GTPγS-activated IK.ACh with following IC50 values; chlorpromazine 1.71 μM, clozapine 14.9 μM, fluphenazine 3.55 μM, haloperidol 2.73 μM, thioridazine 1.90 μM, amitriptyline 7.55 μM, imipramine 7.09 μM and maprotiline 5.93 μM. The IC50 ratio for fluphenazine and haloperidol was close to unity. The IC50 ratio for chlorpromazine, clozapine, thioridazine, amitriptyline, imipramine and maprotiline was much higher than unity. The present findings suggest that the psychotropics studied suppress IK.ACh. Chlorpromazine, clozapine, thioridazine, amitriptyline, imipramine, maprotiline and sulpiride are preferentially acting on muscarinic receptor. Fluphenazine and haloperidol may act on G protein and/or potassium channel.

  13. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  14. Pharmacological Conversion of a Cardiac Inward Rectifier into an Outward Rectifier Potassium Channel.

    Science.gov (United States)

    Moreno-Galindo, Eloy G; Sanchez-Chapula, Jose A; Tristani-Firouzi, Martin; Navarro-Polanco, Ricardo A

    2016-09-01

    Potassium (K(+)) channels are crucial for determining the shape, duration, and frequency of action-potential firing in excitable cells. Broadly speaking, K(+) channels can be classified based on whether their macroscopic current outwardly or inwardly rectifies, whereby rectification refers to a change in conductance with voltage. Outwardly rectifying K(+) channels conduct greater current at depolarized membrane potentials, whereas inward rectifier channels conduct greater current at hyperpolarized membrane potentials. Under most circumstances, outward currents through inwardly rectifying K(+) channels are reduced at more depolarized potentials. However, the acetylcholine-gated K(+) channel (KACh) conducts current that inwardly rectifies when activated by some ligands (such as acetylcholine), and yet conducts current that outwardly rectifies when activated by other ligands (for example, pilocarpine and choline). The perplexing and paradoxical behavior of KACh channels is due to the intrinsic voltage sensitivity of the receptor that activates KACh channels, the M2 muscarinic receptor (M2R). Emerging evidence reveals that the affinity of M2R for distinct ligands varies in a voltage-dependent and ligand-specific manner. These intrinsic receptor properties determine whether current conducted by KACh channels inwardly or outwardly rectifies. This review summarizes the most recent concepts regarding the intrinsic voltage sensitivity of muscarinic receptors and the consequences of this intriguing behavior on cardiac physiology and pharmacology of KACh channels. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  15. Slick (Kcnt2 Sodium-Activated Potassium Channels Limit Peptidergic Nociceptor Excitability and Hyperalgesia

    Directory of Open Access Journals (Sweden)

    Danielle L Tomasello

    2017-09-01

    Full Text Available The Slick (Kcnt2 sodium-activated potassium (K Na channel is a rapidly gating and weakly voltage-dependent and sodium-dependent potassium channel with no clearly defined physiological function. Within the dorsal root ganglia (DRGs, we show Slick channels are exclusively expressed in small-sized and medium-sized calcitonin gene–related peptide (CGRP-containing DRG neurons, and a pool of channels are localized to large dense-core vesicles (LDCV-containing CGRP. We stimulated DRG neurons for CGRP release and found Slick channels contained within CGRP-positive LDCV translocated to the neuronal membrane. Behavioral studies in Slick knockout (KO mice indicated increased basal heat detection and exacerbated thermal hyperalgesia compared with wild-type littermate controls during neuropathic and chronic inflammatory pain. Electrophysiologic recordings of DRG neurons from Slick KO mice revealed that Slick channels contribute to outward current, propensity to fire action potentials (APs, and to AP properties. Our data suggest that Slick channels restrain the excitability of CGRP-containing neurons, diminishing pain behavior after inflammation and injury.

  16. Adenosine A₂A receptors inhibit delayed rectifier potassium currents and cell differentiation in primary purified oligodendrocyte cultures.

    Science.gov (United States)

    Coppi, Elisabetta; Cellai, Lucrezia; Maraula, Giovanna; Pugliese, Anna Maria; Pedata, Felicita

    2013-10-01

    Oligodendrocyte progenitor cells (OPCs) are a population of cycling cells which persist in the adult central nervous system (CNS) where, under opportune stimuli, they differentiate into mature myelinating oligodendrocytes. Adenosine A(2A) receptors are Gs-coupled P1 purinergic receptors which are widely distributed throughout the CNS. It has been demonstrated that OPCs express A(2A) receptors, but their functional role in these cells remains elusive. Oligodendrocytes express distinct voltage-gated ion channels depending on their maturation. Here, by electrophysiological recordings coupled with immunocytochemical labeling, we studied the effects of adenosine A(2A) receptors on membrane currents and differentiation of purified primary OPCs isolated from the rat cortex. We found that the selective A(2A) agonist, CGS21680, inhibits sustained, delayed rectifier, K(+) currents (I(K)) without modifying transient (I(A)) conductances. The effect was observed in all cells tested, independently from time in culture. CGS21680 inhibition of I(K) current was concentration-dependent (10-200 nM) and blocked in the presence of the selective A(2A) antagonist SCH58261 (100 nM). It is known that I(K) currents play an important role during OPC development since their block decreases cell proliferation and differentiation. In light of these data, our further aim was to investigate whether A(2A) receptors modulate these processes. CGS21680, applied at 100 nM in the culture medium of oligodendrocyte cultures, inhibits OPC differentiation (an effect prevented by SCH58261) without affecting cell proliferation. Data demonstrate that cultured OPCs express functional A(2A) receptors whose activation negatively modulate I(K) currents. We propose that, by this mechanism, A(2A) adenosine receptors inhibit OPC differentiation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Left-to-Right Atrial Inward Rectifier Potassium Current Gradients in Patients With Paroxysmal Versus Chronic Atrial Fibrillation

    Science.gov (United States)

    Voigt, Niels; Trausch, Anne; Knaut, Michael; Matschke, Klaus; Varró, András; Van Wagoner, David R.; Nattel, Stanley; Ravens, Ursula; Dobrev, Dobromir

    2018-01-01

    Background Recent evidence suggests that atrial fibrillation (AF) is maintained by high-frequency reentrant sources with a left-to-right–dominant frequency gradient, particularly in patients with paroxysmal AF (pAF). Unequal left-to-right distribution of inward rectifier K+ currents has been suggested to underlie this dominant frequency gradient, but this hypothesis has never been tested in humans. Methods and Results Currents were measured with whole-cell voltage-clamp in cardiomyocytes from right atrial (RA) and left (LA) atrial appendages of patients in sinus rhythm (SR) and patients with AF undergoing cardiac surgery. Western blot was used to quantify protein expression of IK1 (Kir2.1 and Kir2.3) and IK,ACh (Kir3.1 and Kir3.4) subunits. Basal current was ≈2-fold larger in chronic AF (cAF) versus SR patients, without RA-LA differences. In pAF, basal current was ≈2-fold larger in LA versus RA, indicating a left-to-right atrial gradient. In both atria, Kir2.1 expression was ≈2-fold greater in cAF but comparable in pAF versus SR. Kir2.3 levels were unchanged in cAF and RA-pAF but showed a 51% decrease in LA-pAF. In SR, carbachol-activated (2 μmol/L) IK,ACh was 70% larger in RA versus LA. This right-to-left atrial gradient was decreased in pAF and cAF caused by reduced IK,ACh in RA only. Similarly, in SR, Kir3.1 and Kir3.4 proteins were greater in RA versus LA and decreased in RA of pAF and cAF. Kir3.1 and Kir3.4 expression was unchanged in LA of pAF and cAF. Conclusions Our results support the hypothesis that a left-to-right gradient in inward rectifier background current contributes to high-frequency sources in LA that maintain pAF. These findings have potentially important implications for development of atrial-selective therapeutic approaches. PMID:20657029

  18. Octopamine increases the excitability of neurons in the snail feeding system by modulation of inward sodium current but not outward potassium currents

    Directory of Open Access Journals (Sweden)

    Szabó Henriette

    2005-12-01

    Full Text Available Abstract Background Although octopamine has long been known to have major roles as both transmitter and modulator in arthropods, it has only recently been shown to be functionally important in molluscs, playing a role as a neurotransmitter in the feeding network of the snail Lymnaea stagnalis. The synaptic potentials cannot explain all the effects of octopamine-containing neurons on the feeding network, and here we test the hypothesis that octopamine is also a neuromodulator. Results The excitability of the B1 and B4 motoneurons in the buccal ganglia to depolarising current clamp pulses is significantly (P IA current and a sustained IK delayed-rectifier current, but neither was modulated by octopamine in any of these three buccal neurons. The fast inward current was eliminated in sodium – free saline and so is likely to be carried by sodium ions. 10 μM octopamine enhanced this current by 33 and 45% in the B1 and B4 motoneurons respectively (P Conclusion We conclude that octopamine is also a neuromodulator in snails, changing the excitability of the buccal neurons. This is supported by the close relationship from the voltage clamp data, through the quantitative simulation, to the action potential threshold, changing the properties of neurons in a rhythmic network. The increase in inward sodium current provides an explanation for the polycyclic modulation of the feeding system by the octopamine-containing interneurons, making feeding easier to initiate and making the feeding bursts more intense.

  19. Inward rectifier potassium current (I K1) and Kir2 composition of the zebrafish (Danio rerio) heart.

    Science.gov (United States)

    Hassinen, Minna; Haverinen, Jaakko; Hardy, Matt E; Shiels, Holly A; Vornanen, Matti

    2015-12-01

    Electrophysiological properties and molecular background of the zebrafish (Danio rerio) cardiac inward rectifier current (IK1) were examined. Ventricular myocytes of zebrafish have a robust (-6.7 ± 1.2 pA pF(-1) at -120 mV) strongly rectifying and Ba(2+)-sensitive (IC50 = 3.8 μM) IK1. Transcripts of six Kir2 channels (drKir2.1a, drKir2.1b, drKir2.2a, drKir2.2b, drKir2.3, and drKir2.4) were expressed in the zebrafish heart. drKir2.4 and drKir2.2a were the dominant isoforms in both the ventricle (92.9 ± 1.5 and 6.3 ± 1.5%) and the atrium (28.9 ± 2.9 and 64.7 ± 3.0%). The remaining four channels comprised together less than 1 and 7 % of the total transcripts in ventricle and atrium, respectively. The four main gene products (drKir2.1a, drKir2.2a, drKir2.2b, drKir2.4) were cloned, sequenced, and expressed in HEK cells for electrophysiological characterization. drKir2.1a was the most weakly rectifying (passed more outward current) and drKir2.2b the most strongly rectifying (passed less outward current) channel, whilst drKir2.2a and drKir2.4 were intermediate between the two. In regard to sensitivity to Ba(2+) block, drKir2.4 was the most sensitive (IC50 = 1.8 μM) and drKir2.1a the least sensitive channel (IC50 = 132 μM). These findings indicate that the Kir2 isoform composition of the zebrafish heart markedly differs from that of mammalian hearts. Furthermore orthologous Kir2 channels (Kir2.1 and Kir2.4) of zebrafish and mammals show striking differences in Ba(2+)-sensitivity. Structural and functional differences needs to be taken into account when zebrafish is used as a model for human cardiac electrophysiology, cardiac diseases, and in screening cardioactive substances.

  20. Low Resting Membrane Potential and Low Inward Rectifier Potassium Currents Are Not Inherent Features of hiPSC-Derived Cardiomyocytes.

    Science.gov (United States)

    Horváth, András; Lemoine, Marc D; Löser, Alexandra; Mannhardt, Ingra; Flenner, Frederik; Uzun, Ahmet Umur; Neuber, Christiane; Breckwoldt, Kaja; Hansen, Arne; Girdauskas, Evaldas; Reichenspurner, Hermann; Willems, Stephan; Jost, Norbert; Wettwer, Erich; Eschenhagen, Thomas; Christ, Torsten

    2018-03-13

    Human induced pluripotent stem cell (hiPSC) cardiomyocytes (CMs) show less negative resting membrane potential (RMP), which is attributed to small inward rectifier currents (I K1 ). Here, I K1 was measured in hiPSC-CMs (proprietary and commercial cell line) cultured as monolayer (ML) or 3D engineered heart tissue (EHT) and, for direct comparison, in CMs from human right atrial (RA) and left ventricular (LV) tissue. RMP was measured in isolated cells and intact tissues. I K1 density in ML- and EHT-CMs from the proprietary line was similar to LV and RA, respectively. I K1 density in EHT-CMs from the commercial line was 2-fold smaller than in the proprietary line. RMP in EHT of both lines was similar to RA and LV. Repolarization fraction and I K,ACh response discriminated best between RA and LV and indicated predominantly ventricular phenotype in hiPSC-CMs/EHT. The data indicate that I K1 is not necessarily low in hiPSC-CMs, and technical issues may underlie low RMP in hiPSC-CMs. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Biphasic response of action potential duration to metabolic inhibition in rabbit and human ventricular myocytes: role of transient outward current and ATP-regulated potassium current

    NARCIS (Netherlands)

    Verkerk, A. O.; Veldkamp, M. W.; van Ginneken, A. C.; Bouman, L. N.

    1996-01-01

    Inhibition of cell metabolism is associated with significant changes in action potential duration. The aim of this study was to investigate the time course of the changes in action potential duration during metabolic inhibition and to determine what changes in membrane currents are responsible. The

  2. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  3. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  4. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  5. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  6. Preparation of potassium-reduced tantalum powders

    International Nuclear Information System (INIS)

    Kolosov, V.N.; Miroshnichenko, M.N.; Orlov, V.M.; Prokhorova, T.Yu.

    2005-01-01

    Characteristics of tantalum powders prepared by reduction of molten potassium heptafluorotantalate with liquid potassium are studied in a temperature range of 750 - 850 deg C using potassium chloride as a flux at a ratio of K 2 TaF 7 : KCl = 1, 2, and 3. The use of potassium as a reducing agent facilitates washing of tantalum powders for impurity salt removal, reduces sodium content and leakage currents in the anodes. As compared to sodium process, the potassium reduction results in a high yield of sponge material, a decrease in the specific surface area and yield of tantalum powder suitable for manufacture of capacitor anodes [ru

  7. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  8. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  9. Attenuation of ischemia/reperfusion-induced inhibition of the rapid component of delayed rectifier potassium current by Isosteviol through scavenging reactive oxygen species.

    Science.gov (United States)

    Yin, Chunxia; Chen, Yaoxu; Wu, Huanlin; Xu, Danping; Tan, Wen

    2017-12-01

    Isosteviol has been demonstrated to play a protective role during ischemia reperfusion (I/R) myocardial infarction. However, the underlying electrophysiological mechanisms of isosteviol are still unknown. Our previous study showed that the rapid component of the delayed rectifier potassium channel (I Kr ) plays an important role in the prolongation of I/R-induced QT interval-related arrhythmia. This study aimed to investigate whether isosteviol could attenuate I/R-induced prolongation of the action potential duration (APD) along with inhibition of I Kr , and we aimed to clarify the electrophysiological mechanism of isosteviol to determine its cardioprotective effects in guinea pigs. We observed that the APD 90 were 298.5±41.6ms in control, 528.6±56.7ms during I/R, and reduced to 327.8±40.5ms after 10μmol/L of isosteviol treatment. The I Kr currents were 1.44±0.06 pA·pF -1 in the control group, 0.50±0.07pA·pF -1 during I/R, and recovered to 1.20±0.12pA·pF -1 after 10μmol/L of isoteviol treatment. Moreover, isosteviol reduced the over-production of reactive oxygen species (ROS) during I/R. Importantly, isosteviol does not affect the I Kr and human ether-a-go-go-related gene currents of normal cardiomyocytes. It attenuated the I/R-induced inhibition of I Kr due to reduced over-production of ROS. Furthermore, isosteviol is safe and has no cardiotoxicity, and it might be beneficial for coronary reperfusion therapy. Copyright © 2017. Published by Elsevier B.V.

  10. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  11. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Potassium channels in brain mitochondria.

    Science.gov (United States)

    Bednarczyk, Piotr

    2009-01-01

    Potassium channels are the most widely distributed class of ion channels. These channels are transmembrane proteins known to play important roles in both normal and pathophysiological functions in all cell types. Various potassium channels are recognised as potential therapeutic targets in the treatment of Parkinson's disease, Alzheimer's disease, brain/spinal cord ischaemia and sepsis. In addition to their importance as therapeutic targets, certain potassium channels are known for their beneficial roles in anaesthesia, cardioprotection and neuroprotection. Some types of potassium channels present in the plasma membrane of various cells have been found in the inner mitochondrial membrane as well. Potassium channels have been proposed to regulate mitochondrial membrane potential, respiration, matrix volume and Ca(+) ion homeostasis. It has been proposed that mitochondrial potassium channels mediate ischaemic preconditioning in various tissues. However, the specificity of a pharmacological agents and the mechanisms underlying their effects on ischaemic preconditioning remain controversial. The following potassium channels from various tissues have been identified in the inner mitochondrial membrane: ATP-regulated (mitoK(ATP)) channel, large conductance Ca(2+)-regulated (mitoBK(Ca)) channel, intermediate conductance Ca(2+)-regulated (mitoIK(Ca)) channel, voltage-gated (mitoKv1.3 type) channel, and twin-pore domain (mitoTASK-3) channel. It has been shown that increased potassium flux into brain mitochondria induced by either the mitoK(ATP) channel or mitoBK(Ca) channel affects the beneficial effects on neuronal cell survival under pathological conditions. Recently, differential distribution of mitoBK(Ca) channels has been observed in neuronal mitochondria. These findings may suggest a neuroprotective role for the mitoBK(Ca) channel in specific brain structures. This minireview summarises current data on brain mitochondrial potassium channels and the efforts to identify

  14. Effect of trimetazidine treatment on the transient outward potassium current of the left ventricular myocytes of rats with streptozotocin-induced type 1 diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Xiang, Yu-luan; He, Li [Department of Cardiology, the Second Affiliated Hospital, Chongqing Medical University, Chongqing (China); Xiao, Jun [Department of Cardiology, Chongqing Emergency Medical Center, Chongqing (China); Xia, Shuang; Deng, Song-bai [Department of Cardiology, the Second Affiliated Hospital, Chongqing Medical University, Chongqing (China); Xiu, Yun [Institute of Life Science, Chongqing Medical University, Chongqing (China); She, Qiang [Department of Cardiology, the Second Affiliated Hospital, Chongqing Medical University, Chongqing (China)

    2012-02-17

    Cardiovascular complications are a leading cause of mortality in patients with diabetes mellitus (DM). The present study was designed to investigate the effects of trimetazidine (TMZ), an anti-angina drug, on transient outward potassium current (I{sub to}) remodeling in ventricular myocytes and the plasma contents of free fatty acid (FFA) and glucose in DM. Sprague-Dawley rats, 8 weeks old and weighing 200-250 g, were randomly divided into three groups of 20 animals each. The control group was injected with vehicle (1 mM citrate buffer), the DM group was injected with 65 mg/kg streptozotocin (STZ) for induction of type 1 DM, and the DM+TMZ group was injected with the same dose of STZ followed by a 4-week treatment with TMZ (60 mg·kg{sup −1}·day{sup −1}). All animals were then euthanized and their hearts excised and subjected to electrophysiological measurements or gene expression analyses. TMZ exposure significantly reversed the increased plasma FFA level in diabetic rats, but failed to change the plasma glucose level. The amplitude of I{sub to} was significantly decreased in left ventricular myocytes from diabetic rats relative to control animals (6.25 ± 1.45 vs 20.72 ± 2.93 pA/pF at +40 mV). The DM-associated I{sub to} reduction was attenuated by TMZ. Moreover, TMZ treatment reversed the increased expression of the channel-forming alpha subunit Kv1.4 and the decreased expression of Kv4.2 and Kv4.3 in diabetic rat hearts. These data demonstrate that TMZ can normalize, or partially normalize, the increased plasma FFA content, the reduced I{sub to} of ventricular myocytes, and the altered expression Kv1.4, Kv4.2, and Kv4.3 in type 1 DM.

  15. Effect of trimetazidine treatment on the transient outward potassium current of the left ventricular myocytes of rats with streptozotocin-induced type 1 diabetes mellitus

    International Nuclear Information System (INIS)

    Xiang, Yu-luan; He, Li; Xiao, Jun; Xia, Shuang; Deng, Song-bai; Xiu, Yun; She, Qiang

    2012-01-01

    Cardiovascular complications are a leading cause of mortality in patients with diabetes mellitus (DM). The present study was designed to investigate the effects of trimetazidine (TMZ), an anti-angina drug, on transient outward potassium current (I to ) remodeling in ventricular myocytes and the plasma contents of free fatty acid (FFA) and glucose in DM. Sprague-Dawley rats, 8 weeks old and weighing 200-250 g, were randomly divided into three groups of 20 animals each. The control group was injected with vehicle (1 mM citrate buffer), the DM group was injected with 65 mg/kg streptozotocin (STZ) for induction of type 1 DM, and the DM+TMZ group was injected with the same dose of STZ followed by a 4-week treatment with TMZ (60 mg·kg −1 ·day −1 ). All animals were then euthanized and their hearts excised and subjected to electrophysiological measurements or gene expression analyses. TMZ exposure significantly reversed the increased plasma FFA level in diabetic rats, but failed to change the plasma glucose level. The amplitude of I to was significantly decreased in left ventricular myocytes from diabetic rats relative to control animals (6.25 ± 1.45 vs 20.72 ± 2.93 pA/pF at +40 mV). The DM-associated I to reduction was attenuated by TMZ. Moreover, TMZ treatment reversed the increased expression of the channel-forming alpha subunit Kv1.4 and the decreased expression of Kv4.2 and Kv4.3 in diabetic rat hearts. These data demonstrate that TMZ can normalize, or partially normalize, the increased plasma FFA content, the reduced I to of ventricular myocytes, and the altered expression Kv1.4, Kv4.2, and Kv4.3 in type 1 DM

  16. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  17. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  18. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  19. Functional identification of a GORK potassium channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f.

    Science.gov (United States)

    Li, Junlin; Zhang, Huanchao; Lei, Han; Jin, Man; Yue, Guangzhen; Su, Yanhua

    2016-04-01

    A GORK homologue K(+) channel from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. shows the functional conservation of the GORK channels among plant species. Guard cell K(+) release through the outward potassium channels eventually enables the closure of stomata which consequently prevents plant water loss from severe transpiration. Early patch-clamp studies with the guard cells have revealed many details of such outward potassium currents. However, genes coding for these potassium-release channels have not been sufficiently characterized from species other than the model plant Arabidopsis thaliana. We report here the functional identification of a GORK (for Gated or Guard cell Outward Rectifying K(+) channels) homologue from the ancient desert shrub Ammopiptanthus mongolicus (Maxim.) Cheng f. AmGORK was primary expressed in shoots, where the transcripts were regulated by stress factors simulated by PEG, NaCl or ABA treatments. Patch-clamp measurements on isolated guard cell protoplasts revealed typical depolarization voltage gated outward K(+) currents sensitive to the extracelluar K(+) concentration and pH, resembling the fundamental properties previously described in other species. Two-electrode voltage-clamp analysis in Xenopus lavies oocytes with AmGORK reconstituted highly similar characteristics as assessed in the guard cells, supporting that the function of AmGORK is consistent with a crucial role in mediating stomatal closure in Ammopiptanthus mongolicus. Furthermore, a single amino acid mutation D297N of AmGORK eventually abolishes both the voltage-gating and its outward rectification and converts the channel into a leak-like channel, indicating strong involvement of this residue in the gating and voltage dependence of AmGORK. Our results obtained from this anciently originated plant support a strong functional conservation of the GORK channels among plant species and maybe also along the progress of revolution.

  20. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  1. A novel 13 residue acyclic peptide from the marine snail, Conus monile, targets potassium channels.

    Science.gov (United States)

    Sudarslal, Sadasivannair; Singaravadivelan, Govindaswamy; Ramasamy, Palanisamy; Ananda, Kuppanna; Sarma, Siddhartha P; Sikdar, Sujit K; Krishnan, K S; Balaram, Padmanabhan

    2004-05-07

    A novel 13-residue peptide Mo1659 has been isolated from the venom of a vermivorous cone snail, Conus monile. HPLC fractions of the venom extract yielded an intense UV absorbing fraction with a mass of 1659Da. De novo sequencing using both matrix assisted laser desorption and ionization and electrospray MS/MS methods together with analysis of proteolytic fragments successfully yielded the amino acid sequence, FHGGSWYRFPWGY-NH(2). This was further confirmed by comparison with the chemically synthesized peptide and by conventional Edman sequencing. Mo1659 has an unusual sequence with a preponderance of aromatic residues and the absence of apolar, aliphatic residues like Ala, Val, Leu, and Ile. Mo1659 has no disulfide bridges distinguishing it from the conotoxins and bears no sequence similarity with any of the acyclic peptides isolated thus far from the venom of cone snails. Electrophysiological studies on the effect of Mo1659 on measured currents in dorsal root ganglion neurons suggest that the peptide targets non-inactivating voltage-dependent potassium channels.

  2. Penicillin V Potassium

    Science.gov (United States)

    Penicillin V potassium is used to treat certain infections caused by bacteria such as pneumonia and other ... heart valves and other symptoms) from coming back. Penicillin V potassium is in a class of medications ...

  3. Potassium maldistribution revisited

    African Journals Online (AJOL)

    Background:This study investigated maldistribution of concentrated 15% potassium chloride after injection into .... and latter experiments referred to for example as “Control 1” ..... be further investigated as a reliable, simple method of potassium.

  4. A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.

    Science.gov (United States)

    Kajma, Anna; Szewczyk, Adam

    2012-10-01

    Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

  5. KV7 potassium channels

    DEFF Research Database (Denmark)

    Stott, Jennifer B; Jepps, Thomas Andrew; Greenwood, Iain A

    2014-01-01

    Potassium channels are key regulators of smooth muscle tone, with increases in activity resulting in hyperpolarisation of the cell membrane, which acts to oppose vasoconstriction. Several potassium channels exist within smooth muscle, but the KV7 family of voltage-gated potassium channels have been...

  6. 4-Aminopyridine: a pan voltage-gated potassium channel inhibitor that enhances K7.4 currents and inhibits noradrenaline-mediated contraction of rat mesenteric small arteries

    DEFF Research Database (Denmark)

    Khammy, Makhala M; Kim, Sukhan; Bentzen, Bo H

    2018-01-01

    has not been systematically studied. The aim of this study was to investigate the pharmacological activity of 4-AP on Kv7.4 and Kv7.5 channels and characterize the effect of 4-AP on rat resistance arteries. EXPERIMENTAL APPROACH: Voltage clamp experiments were performed on Xenopus laevis oocytes......BACKGROUND AND PURPOSE: Kv7.4 and Kv7.5 channels are regulators of vascular tone. 4-Aminopyridine (4-AP) is considered a broad inhibitor of voltage-gated potassium (KV) channels, with little inhibitory effect on Kv7 family members at mmol concentrations. However, the effect of 4-AP on Kv7 channels...

  7. Potassium fluorotitanate preparation

    International Nuclear Information System (INIS)

    Perillo, Patricia; Ares, Osvaldo; Botbol, Jose.

    1989-01-01

    In order to determine the best conditions for potassium fluotitanate preparation as intermediate step in the electrolytic production of metalic titanium, the effects of a number of experimental variables have been studied. This method is a process of sintering titanium dioxide with potassium fluosilicate and potassium chloride, followed by leaching with boiling water and further crystallization by cooling the solution. An overall yield of 90% has been attained under the following conditions: working temperature: 750 deg C; heating time for sintering: 3 hours; molar ratio: titanium dioxide: potassium fluosilicate: potassium chloride: 1 : 2 : 0.4; number of leachings: 6. (Author) [es

  8. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  9. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  10. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  11. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  12. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  13. Potassium-argon technology

    International Nuclear Information System (INIS)

    Cassignol, Charles; Cornette, Yves; David, Benjamin; Gillot, P.-Y.

    1978-04-01

    The main features of the method of processing rocks and minerals and measuring the extracted argon, for the purpose of potassium-argon dating are described. It differs in several respects from the conventional one, as described, f.i., in Dalrymple and Lanphere's monography. Principally it was established that the continual purification of the gases in the mass spectrometer cell during the measurement, stops the peaks of current drift, and renders them representative of the introduced argon. This allows on the one hand to improve the reliability and accuracy of measurements, on the other hand to get rid of the isotopic dilution method, with 38 A as a spike. Moreover the reliability of the radiogenic argon is improved by taking into account the mislinearness of the M.S. response. All this results in a higher performance of the K/Ar dating method, especially in the recent ages range. The technological side of the problem was only dealt with [fr

  14. Cardiac potassium channel subtypes

    DEFF Research Database (Denmark)

    Schmitt, Nicole; Grunnet, Morten; Olesen, Søren-Peter

    2014-01-01

    About 10 distinct potassium channels in the heart are involved in shaping the action potential. Some of the K(+) channels are primarily responsible for early repolarization, whereas others drive late repolarization and still others are open throughout the cardiac cycle. Three main K(+) channels...... drive the late repolarization of the ventricle with some redundancy, and in atria this repolarization reserve is supplemented by the fairly atrial-specific KV1.5, Kir3, KCa, and K2P channels. The role of the latter two subtypes in atria is currently being clarified, and several findings indicate...... that they could constitute targets for new pharmacological treatment of atrial fibrillation. The interplay between the different K(+) channel subtypes in both atria and ventricle is dynamic, and a significant up- and downregulation occurs in disease states such as atrial fibrillation or heart failure...

  15. Chloride is essential for contraction of afferent arterioles after agonists and potassium

    DEFF Research Database (Denmark)

    Jensen, B L; Ellekvist, Peter; Skøtt, O

    1997-01-01

    to norepinephrine, angiotensin II (ANG II), and potassium were measured after chloride depletion and compared with controls. Chloride depletion did not change arteriolar diameters, but the response to norepinephrine was markedly reduced when chloride was substituted with gluconate (n = 6) or isethionate (n = 6......). Reintroduction of chloride fully restored the sensitivity to norepinephrine. Contractions after ANG II and potassium were totally abolished in the absence of chloride (n = 6). In additional experiments (n = 7), the arteriolar contraction to 100 mM potassium was abolished only 1 min after removal of extracellular......A depolarizing chloride efflux has been suggested to activate voltage-dependent calcium channels in renal afferent arteriolar smooth muscle cells in response to vasoconstrictors. To test this proposal, rabbit afferent arterioles were microperfused, and the contractile dose responses...

  16. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  17. Handling of potassium

    International Nuclear Information System (INIS)

    Schwarz, N.; Komurka, M.

    1983-03-01

    As a result for the Fast Breeder Development extensive experience is available worldwide with respect to Sodium technology. Due to the extension of the research program to topping cycles with Potassium as the working medium, test facilities with Potassium have been designed and operated in the Institute of Reactor Safety. The different chemical properties of Sodium and Potassium give rise in new safety concepts and operating procedures. The handling problems of Potassium are described in the light of theoretical properties and own experiences. Selected literature on main safety and operating problems complete this report. (Author) [de

  18. Polarized axonal surface expression of neuronal KCNQ potassium channels is regulated by calmodulin interaction with KCNQ2 subunit.

    Directory of Open Access Journals (Sweden)

    John P Cavaretta

    Full Text Available KCNQ potassium channels composed of KCNQ2 and KCNQ3 subunits give rise to the M-current, a slow-activating and non-inactivating voltage-dependent potassium current that limits repetitive firing of action potentials. KCNQ channels are enriched at the surface of axons and axonal initial segments, the sites for action potential generation and modulation. Their enrichment at the axonal surface is impaired by mutations in KCNQ2 carboxy-terminal tail that cause benign familial neonatal convulsion and myokymia, suggesting that their correct surface distribution and density at the axon is crucial for control of neuronal excitability. However, the molecular mechanisms responsible for regulating enrichment of KCNQ channels at the neuronal axon remain elusive. Here, we show that enrichment of KCNQ channels at the axonal surface of dissociated rat hippocampal cultured neurons is regulated by ubiquitous calcium sensor calmodulin. Using immunocytochemistry and the cluster of differentiation 4 (CD4 membrane protein as a trafficking reporter, we demonstrate that fusion of KCNQ2 carboxy-terminal tail is sufficient to target CD4 protein to the axonal surface whereas inhibition of calmodulin binding to KCNQ2 abolishes axonal surface expression of CD4 fusion proteins by retaining them in the endoplasmic reticulum. Disruption of calmodulin binding to KCNQ2 also impairs enrichment of heteromeric KCNQ2/KCNQ3 channels at the axonal surface by blocking their trafficking from the endoplasmic reticulum to the axon. Consistently, hippocampal neuronal excitability is dampened by transient expression of wild-type KCNQ2 but not mutant KCNQ2 deficient in calmodulin binding. Furthermore, coexpression of mutant calmodulin, which can interact with KCNQ2/KCNQ3 channels but not calcium, reduces but does not abolish their enrichment at the axonal surface, suggesting that apo calmodulin but not calcium-bound calmodulin is necessary for their preferential targeting to the axonal

  19. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  20. Bone morphogenetic protein 4 inhibits insulin secretion from rodent beta cells through regulation of calbindin1 expression and reduced voltage-dependent calcium currents

    DEFF Research Database (Denmark)

    Christensen, Gitte L.; Jacobsen, Maria L. B.; Wendt, Anna

    2015-01-01

    AIMS/HYPOTHESIS: Type 2 diabetes is characterised by progressive loss of pancreatic beta cell mass and function. Therefore, it is of therapeutic interest to identify factors with the potential to improve beta cell proliferation and insulin secretion. Bone morphogenetic protein 4 (BMP4) expression...

  1. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  2. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  3. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  4. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  5. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  6. Diclofenac distinguishes among homomeric and heteromeric potassium channels composed of KCNQ4 and KCNQ5 subunits.

    Science.gov (United States)

    Brueggemann, Lioubov I; Mackie, Alexander R; Martin, Jody L; Cribbs, Leanne L; Byron, Kenneth L

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V(0.5) values: -31, -44, and -38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels.

  7. Biophysical characterization of inwardly rectifying potassium currents (I(K1) I(K,ACh), I(K,Ca)) using sinus rhythm or atrial fibrillation action potential waveforms

    DEFF Research Database (Denmark)

    Tang, Chuyi; Skibsbye, Lasse; Yuan, Lei

    2015-01-01

    Although several physiological, pathophysiological and regulatory properties of classical inward rectifier K+ current I(K1), G-protein coupled inwardly-rectifying K+ current I(K,ACh) and the small-conductance Ca2+ activated K+ current I(K,Ca) have been identified, quantitative biophysical details...

  8. Potassium and Your CKD Diet

    Science.gov (United States)

    ... vegetable in your diet, leach them before using. Leaching is a process by which some potassium can be pulled out ... out of my favorite high-potassium vegetables? The process of leaching will help pull potassium out of some high- ...

  9. Regulation of inward rectifier potassium current ionic channel remodeling by AT1 -Calcineurin-NFAT signaling pathway in stretch-induced hypertrophic atrial myocytes.

    Science.gov (United States)

    He, Jionghong; Xu, Yanan; Yang, Long; Xia, Guiling; Deng, Na; Yang, Yongyao; Tian, Ye; Fu, Zenan; Huang, Yongqi

    2018-05-02

    Previous studies have shown that the activation of angiotensin II receptor type I (AT 1 ) is attributed to cardiac remodeling stimulated by increased heart load, and that it is followed by the activation of the calcineurin-nuclear factor of activated T-cells (NFAT) signaling pathway. Additionally, AT 1 has been found to be a regulator of cardiocyte ionic channel remodeling, and calcineurin-NFAT signals participate in the regulation of cardiocyte ionic channel expression. A hypothesis therefore follows that stretch stimulation may regulate cardiocyte ionic channel remodeling by activating the AT 1 -calcineurin-NFAT pathway. Here, we investigated the role of the AT 1 -calcineurin-NFAT pathway in the remodeling of inward rectifier potassium (I k1 ) channel, in addition to its role in changing action potential, in stretch-induced hypertrophic atrial myocytes of neonatal rats. Our results showed that increased stretch significantly led to atrial myocytes hypertrophy; it also increased the activity of calcineurin enzymatic activity, which was subsequently attenuated by telmisartan or cyclosporine-A. The level of NFAT 3 protein in nuclear extracts, the mRNA and protein expression of Kir2.1 in whole cell extracts, and the density of I k1 were noticeably increased in stretched samples. Stretch stimulation significantly shortened the action potential duration (APD) of repolarization at the 50% and 90% level. Telmisartan, cyclosporine-A, and 11R-VIVIT attenuated stretch-induced alterations in the levels of NFAT 3 , mRNA and protein expression of Kir2.1, the density of I k1 , and the APD. Our findings suggest that the AT 1 -calcineurin-NFAT signaling pathway played an important role in regulating I k1 channel remodeling and APD change in stretch-induced hypertrophic atrial myocytes of neonatal rats. This article is protected by copyright. All rights reserved.

  10. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J

    2004-01-01

    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.

  11. Multistability in a neuron model with extracellular potassium dynamics

    Science.gov (United States)

    Wu, Xing-Xing; Shuai, J. W.

    2012-06-01

    Experiments show a primary role of extracellular potassium concentrations in neuronal hyperexcitability and in the generation of epileptiform bursting and depolarization blocks without synaptic mechanisms. We adopt a physiologically relevant hippocampal CA1 neuron model in a zero-calcium condition to better understand the function of extracellular potassium in neuronal seizurelike activities. The model neuron is surrounded by interstitial space in which potassium ions are able to accumulate. Potassium currents, Na+-K+ pumps, glial buffering, and ion diffusion are regulatory mechanisms of extracellular potassium. We also consider a reduced model with a fixed potassium concentration. The bifurcation structure and spiking frequency of the two models are studied. We show that, besides hyperexcitability and bursting pattern modulation, the potassium dynamics can induce not only bistability but also tristability of different firing patterns. Our results reveal the emergence of the complex behavior of multistability due to the dynamical [K+]o modulation on neuronal activities.

  12. The delayed rectifier potassium conductance in the sarcolemma and the transverse tubular system membranes of mammalian skeletal muscle fibers

    Science.gov (United States)

    DiFranco, Marino; Quinonez, Marbella

    2012-01-01

    A two-microelectrode voltage clamp and optical measurements of membrane potential changes at the transverse tubular system (TTS) were used to characterize delayed rectifier K currents (IKV) in murine muscle fibers stained with the potentiometric dye di-8-ANEPPS. In intact fibers, IKV displays the canonical hallmarks of KV channels: voltage-dependent delayed activation and decay in time. The voltage dependence of the peak conductance (gKV) was only accounted for by double Boltzmann fits, suggesting at least two channel contributions to IKV. Osmotically treated fibers showed significant disconnection of the TTS and displayed smaller IKV, but with similar voltage dependence and time decays to intact fibers. This suggests that inactivation may be responsible for most of the decay in IKV records. A two-channel model that faithfully simulates IKV records in osmotically treated fibers comprises a low threshold and steeply voltage-dependent channel (channel A), which contributes ∼31% of gKV, and a more abundant high threshold channel (channel B), with shallower voltage dependence. Significant expression of the IKV1.4 and IKV3.4 channels was demonstrated by immunoblotting. Rectangular depolarizing pulses elicited step-like di-8-ANEPPS transients in intact fibers rendered electrically passive. In contrast, activation of IKV resulted in time- and voltage-dependent attenuations in optical transients that coincided in time with the peaks of IKV records. Normalized peak attenuations showed the same voltage dependence as peak IKV plots. A radial cable model including channels A and B and K diffusion in the TTS was used to simulate IKV and average TTS voltage changes. Model predictions and experimental data were compared to determine what fraction of gKV in the TTS accounted simultaneously for the electrical and optical data. Best predictions suggest that KV channels are approximately equally distributed in the sarcolemma and TTS membranes; under these conditions, >70% of IKV

  13. Potassium Blood Test

    Science.gov (United States)

    ... K. Brunner & Suddarth's Handbook of Laboratory and Diagnostic Tests. 2 nd Ed, Kindle. Philadelphia: Wolters Kluwer Health, Lippincott Williams & Wilkins; c2014. Potassium, Serum; 426–27 p. Lab ...

  14. High potassium level

    Science.gov (United States)

    ... level is very high, or if you have danger signs, such as changes in an ECG . Emergency ... Seifter JL. Potassium disorders. In: Goldman L, Schafer AI, eds. Goldman-Cecil Medicine . 25th ed. Philadelphia, PA: ...

  15. Low potassium level

    Science.gov (United States)

    ... treat and prevent low level of potassium. These foods include: Avocados Baked potato Bananas Bran Carrots Cooked lean beef Milk Oranges Peanut butter Peas and beans Salmon Seaweed Spinach Tomatoes Wheat germ

  16. Characterization of hERG1a and hERG1b potassium channels-a possible role for hERG1b in the I (Kr) current

    DEFF Research Database (Denmark)

    Larsen, Anders Peter; Olesen, Søren-Peter; Grunnet, Morten

    2008-01-01

    I (Kr) is the fast component of the delayed rectifier potassium currents responsible for the repolarization of the cardiac muscle. The molecular correlate underlying the I (Kr) current has been identified as the hERG1 channel. Recently, two splice variants of the hERG1 alpha-subunit, hERG1a and hERG......1b, have been shown to be co-expressed in human cardiomyocytes. In this paper, we present the electrophysiological characterization of hERG1a, hERG1b, and co-expressed hERG1a/b channels in a mammalian expression system using the whole-cell patch clamp technique. We also quantified the messenger RNA...... (mRNA) levels of hERG1a and hERG1b in human cardiac tissue, and based on the expressed ratios, we evaluated the resulting currents in Xenopus laevis oocytes. Compared to hERG1a channels, activation was faster for both hERG1b and hERG1a/b channels. The deactivation kinetics was greatly accelerated...

  17. Protein kinase C epsilon mediates the inhibition of angiotensin II on the slowly activating delayed-rectifier potassium current through channel phosphorylation.

    Science.gov (United States)

    Gou, Xiangbo; Wang, Wenying; Zou, Sihao; Qi, Yajuan; Xu, Yanfang

    2018-03-01

    The slowly activating delayed rectifier K + current (I Ks ) is one of the main repolarizing currents in the human heart. Evidence has shown that angiotensin II (Ang II) regulates I Ks through the protein kinase C (PKC) pathway, but the related results are controversial. This study was designed to identify PKC isoenzymes involved in the regulation of I Ks by Ang II and the underlying molecular mechanism. The whole-cell patch-clamp technique was used to record I Ks in isolated guinea pig ventricular cardiomyocytes and in human embryonic kidney (HEK) 293 cells co-transfected with human KCNQ1/KCNE1 genes and Ang II type 1 receptor genes. Ang II inhibited I Ks in a concentration-dependent manner in native cardiomyocytes. A broad PKC inhibitor Gö6983 (not inhibiting PKCε) and a selective cPKC inhibitor Gö6976 did not affect the inhibitory action of Ang II. In contrast, the inhibition was significantly attenuated by PKCε-selective peptide inhibitor εV1-2. However, direct activation of PKC by phorbol 12-myristate 13-acetate (PMA) increased the cloned human I Ks in HEK293 cells. Similarly, the cPKC peptide activator significantly enhanced the current. In contrast, the PKCε peptide activator inhibited the current. Further evidence showed that PKCε knockdown by siRNA antagonized the Ang II-induced inhibition on KCNQ1/KCNE1 current, whereas knockdown of cPKCs (PKCα and PKCβ) attenuated the potentiation of the current by PMA. Moreover, deletion of four putative phosphorylation sites in the C-terminus of KCNQ1 abolished the action of PMA. Mutation of two putative phosphorylation sites in the N-terminus of KCNQ1 and one site in KCNE1 (S102) blocked the inhibition of Ang II. Our results demonstrate that PKCε isoenzyme mediates the inhibitory action of Ang II on I Ks and by phosphorylating distinct sites in KCNQ1/KCNE1, cPKC and PKCε isoenzymes produce the contrary regulatory effects on the channel. These findings have provided new insight into the molecular mechanism

  18. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  19. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. THE INFLUENCE OF THIOSEMICARBAZONE 2,3-DIHYDROXYBENZALDEHYDE ON CATALYTIC CURRENTS IN THE SYSTEM MOLYBDENUM (VI – POTASSIUM CHLORATE IN ACID SULFATE SOLUTIONS

    Directory of Open Access Journals (Sweden)

    Ludmila Chiriac

    2011-06-01

    Full Text Available The polarographic catalytic current in acid solutions of Mo(VI, thiosemicarbazone 2,3-dihydroxybenzaldehyde (TSC 2,3-DHBA and chlorate ions has been investigated. The scheme of reactions, taking place in the solutions and on the electrode, has been proposed. The increase of the catalytic current is explained by the formation of an active intermediate complex [Mo(V×TSC 2,3-DHBA (ClO-3]. The rate constant of this complex formation K = 2.56 × 106 mol-1×dm3×s-1, the activation energy Ea = 15.9 kcal×mol-1 and the reaction activation entropy ∆Sa¹ = -23.5 e.u. have been calculated.

  1. Potassium chloride production by microcline chlorination

    Energy Technology Data Exchange (ETDEWEB)

    Orosco, Pablo, E-mail: porosco@unsl.edu.ar [Instituto de Investigaciones en Tecnología Química (INTEQUI), Chacabuco y Pedernera, San Luis (Argentina); Facultad de Química, Bioquímica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, San Luis (Argentina); Ruiz, María del Carmen [Instituto de Investigaciones en Tecnología Química (INTEQUI), Chacabuco y Pedernera, San Luis (Argentina)

    2015-08-10

    Highlights: • Use of chlorination for the KCl production. • The reagents used were microcline, hydromagnesite and chlorine. • Isothermal and non-isothermal assays were performed in Cl{sub 2}–N{sub 2} mixture. • The chlorination generated KCl at 700 °C. • The chlorination products promote KCl formation. - Abstract: The potassium chloride is one of the most important fertilizers used in agriculture. The current demand of this salt makes interesting the study of potassium chloride production from unconventional potassium resources. In this work the potassium chloride production by chlorination of microcline was investigated. The starting reagents were microcline, hydromagnesite and chlorine. Non-isothermal and isothermal chlorination assays were carried out in a thermogravimetric device adapted to work in corrosive atmospheres. The temperature effect on potassium extraction and the phase transformations produced during chlorination of microcline were studied. The reagents and reaction products were analyzed by X-ray fluorescence (XRF) and X-ray diffraction (XRD). The experimental results indicated that by chlorination of microcline an important extraction of potassium in the temperature range from 800 to 900 °C was produced. Moreover, at 800 °C the forsterite, enstatite and magnesium aluminate spinel phases were generated.

  2. Effects of extracellular potassium diffusion on electrically coupled neuron networks

    Science.gov (United States)

    Wu, Xing-Xing; Shuai, Jianwei

    2015-02-01

    Potassium accumulation and diffusion during neuronal epileptiform activity have been observed experimentally, and potassium lateral diffusion has been suggested to play an important role in nonsynaptic neuron networks. We adopt a hippocampal CA1 pyramidal neuron network in a zero-calcium condition to better understand the influence of extracellular potassium dynamics on the stimulus-induced activity. The potassium concentration in the interstitial space for each neuron is regulated by potassium currents, Na+-K+ pumps, glial buffering, and ion diffusion. In addition to potassium diffusion, nearby neurons are also coupled through gap junctions. Our results reveal that the latency of the first spike responding to stimulus monotonically decreases with increasing gap-junction conductance but is insensitive to potassium diffusive coupling. The duration of network oscillations shows a bell-like shape with increasing potassium diffusive coupling at weak gap-junction coupling. For modest electrical coupling, there is an optimal K+ diffusion strength, at which the flow of potassium ions among the network neurons appropriately modulates interstitial potassium concentrations in a degree that provides the most favorable environment for the generation and continuance of the action potential waves in the network.

  3. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Dietary patterns extracted from the current Japanese diet and their associations with sodium and potassium intakes estimated by repeated 24 h urine collection.

    Science.gov (United States)

    Fujiwara, Aya; Asakura, Keiko; Uechi, Ken; Masayasu, Shizuko; Sasaki, Satoshi

    2016-10-01

    To identify dietary patterns in the current Japanese diet and evaluate the associations between these patterns and Na and K intakes. Dietary patterns were extracted by factor analysis from the intakes of food groups assessed with a validated self-administrated diet history questionnaire. Na and K intakes and urinary Na:K were assessed by repeated 24 h urine collection. Healthy Japanese adults aged 20-69 years (353 men and 349 women). Twenty study areas in twenty-three prefectures in Japan. Result Four dietary patterns were identified in each sex. After adjustment for several confounding factors, the 'Fish and vegetable' pattern was associated with higher urinary Na excretion, but the association was not significant (P=0·37 in men and P=0·06 in women). This pattern was also associated with higher K excretion in both sexes. The 'Noodle' pattern tended to be associated with higher urinary Na excretion (P=0·17 in men and P=0·04 in women) and higher Na:K (P=0·02 in men). The 'Meat, vegetable and oil' (in men)/'Meat and oil' (in women) and 'Bread and confectioneries' patterns were not associated with urinary Na excretion (in men) or were negatively associated (in women). Contrary to the case in Western countries, the 'Fish and vegetable' and 'Noodle' patterns contributed to higher Na intake in Japan. Target foods for salt reduction should be set based on careful consideration of the relationships between dietary patterns and Na and K intakes in the target population.

  5. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  6. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  7. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  8. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  9. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  10. Errors in potassium balance

    International Nuclear Information System (INIS)

    Forbes, G.B.; Lantigua, R.; Amatruda, J.M.; Lockwood, D.H.

    1981-01-01

    Six overweight adult subjects given a low calorie diet containing adequate amounts of nitrogen but subnormal amounts of potassium (K) were observed on the Clinical Research Center for periods of 29 to 40 days. Metabolic balance of potassium was measured together with frequent assays of total body K by 40 K counting. Metabolic K balance underestimated body K losses by 11 to 87% (average 43%): the intersubject variability is such as to preclude the use of a single correction value for unmeasured losses in K balance studies

  11. Diclofenac Distinguishes among Homomeric and Heteromeric Potassium Channels Composed of KCNQ4 and KCNQ5 SubunitsS⃞

    Science.gov (United States)

    Brueggemann, Lioubov I.; Mackie, Alexander R.; Martin, Jody L.; Cribbs, Leanne L.

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V0.5 values: −31, −44, and −38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels. PMID:20876743

  12. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  13. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  14. Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

    Directory of Open Access Journals (Sweden)

    Salvador Valle-Reyes

    2018-05-01

    Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

  15. Potassium toxicity at low serum potassium levels with refeeding syndrome.

    Science.gov (United States)

    Vemula, Praveen; Abela, Oliver G; Narisetty, Keerthy; Rhine, David; Abela, George S

    2015-01-01

    Refeeding syndrome is a life-threatening condition occurring in severely malnourished patients after initiating feeding. Severe hypophosphatemia with reduced adenosine triphosphate production has been implicated, but little data are available regarding electrolyte abnormalities. In this case, we report electrocardiographic changes consistent with hyperkalemia during potassium replacement after a serum level increase from 1.9 to 2.9 mEq/L. This was reversed by lowering serum potassium back to 2.0 mEq/L. In conclusion, the patient with prolonged malnutrition became adapted to low potassium levels and developed potassium toxicity with replacement. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. β-Secretase BACE1 regulates hippocampal and reconstituted M-currents in a β-subunit-like fashion.

    Science.gov (United States)

    Hessler, Sabine; Zheng, Fang; Hartmann, Stephanie; Rittger, Andrea; Lehnert, Sandra; Völkel, Meike; Nissen, Matthias; Edelmann, Elke; Saftig, Paul; Schwake, Michael; Huth, Tobias; Alzheimer, Christian

    2015-02-25

    The β-secretase BACE1 is widely known for its pivotal role in the amyloidogenic pathway leading to Alzheimer's disease, but how its action on transmembrane proteins other than the amyloid precursor protein affects the nervous system is only beginning to be understood. We report here that BACE1 regulates neuronal excitability through an unorthodox, nonenzymatic interaction with members of the KCNQ (Kv7) family that give rise to the M-current, a noninactivating potassium current with slow kinetics. In hippocampal neurons from BACE1(-/-) mice, loss of M-current enhanced neuronal excitability. We relate the diminished M-current to the previously reported epileptic phenotype of BACE1-deficient mice. In HEK293T cells, BACE1 amplified reconstituted M-currents, altered their voltage dependence, accelerated activation, and slowed deactivation. Biochemical evidence strongly suggested that BACE1 physically associates with channel proteins in a β-subunit-like fashion. Our results establish BACE1 as a physiologically essential constituent of regular M-current function and elucidate a striking new feature of how BACE1 impacts on neuronal activity in the intact and diseased brain. Copyright © 2015 the authors 0270-6474/15/353298-14$15.00/0.

  17. Modeling removal of accumulated potassium from T-tubules by inward rectifier potassium channels

    NARCIS (Netherlands)

    Wallinga, W.; Vliek, M.; Wienk, E.D.; Alberink, M.J.; Ypey, D.L.; Ypey, D.L.

    1996-01-01

    The membrane models of Cannon et al. (1993) and Alberink et al. (1995) for mammalian skeletal muscle fibers are based upon Hodgkin-Huxley descriptions of sodium, potassium delayed rectifier and leak conductances and the capacitive current taking into account fast inactivation of sodium channels. Now

  18. 21 CFR 184.1619 - Potassium carbonate.

    Science.gov (United States)

    2010-04-01

    ... solution of potassium hydroxide with excess carbon dioxide to produce potassium carbonate; (3) By treating a solution of potassium hydroxide with carbon dioxide to produce potassium bicarbonate, which is... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium carbonate. 184.1619 Section 184.1619 Food...

  19. Potassium in milk and milk products

    International Nuclear Information System (INIS)

    Sombrito, E.Z.; Nuguid, Z.F.S.; Tangonan, M.C.

    1989-01-01

    The amount of potassium in imported processed milk was determined by gamma spectral analysis. The results show that the potassium content of diluted infant formula milk is closest to the reported mean concentration of potassium in human milk while other milk types have potassium values similar to the potassium content of cow milk. (Auth.). 2 figs., 5 refs

  20. Dietary reference values for potassium

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2016-01-01

    Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for potassium. The Panel decides to set DRVs on the basis of the relationships between potassium intake and blood pressure and stroke...

  1. Neural synchronization via potassium signaling

    DEFF Research Database (Denmark)

    Postnov, Dmitry E; Ryazanova, Ludmila S; Mosekilde, Erik

    2006-01-01

    Using a relatively simple model we examine how variations of the extracellular potassium concentration can give rise to synchronization of two nearby pacemaker cells. With the volume of the extracellular space and the rate of potassium diffusion as control parameters, the dual nature of this reso...

  2. Can Diuretics Decrease Your Potassium Level?

    Science.gov (United States)

    ... of low potassium? Can diuretics decrease your potassium level? Answers from Sheldon G. Sheps, M.D. Yes, ... your urine. This can lead to low potassium levels in your blood (hypokalemia). Signs and symptoms of ...

  3. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  4. Potassium iodide stockpiling

    International Nuclear Information System (INIS)

    Krimm, R.W.

    1983-01-01

    After examination by the Federal Emergency Management Agency (FEMA) and other federal agencies of federal policy on the use and distribution of potassium iodide (KI) as a thyroid-blocking agent for use in off-site preparedness around commercial nuclear powerplants, FEMA believes the present shelf life of KI is too short, that the minimum ordering quantities are an obstacle to efficient procurement, and that the packaging format offered by the drug industry does not meet the wishes of state and local government officials. FEMA has asked assistance from the Food and Drug Administration in making it possible for those states wishing to satisfy appropriate requirements to do so at the minimum cost to the public. Given an appropriate packaging and drug form, there appears to be no reason for the federal government to have further involvement in the stockpiling of KI

  5. Oral potassium supplementation in surgical patients.

    Science.gov (United States)

    Hainsworth, Alison J; Gatenby, Piers A

    2008-08-01

    Hospital inpatients are frequently hypokalaemic. Low plasma potassium levels may cause life threatening complications, such as cardiac arrhythmias. Potassium supplementation may be administered parenterally or enterally. Oral potassium supplements have been associated with oesophageal ulceration, strictures and gastritis. An alternative to potassium salt tablets or solution is dietary modification with potassium rich food stuffs, which has been proven to be a safe and effective method for potassium supplementation. The potassium content of one medium banana is equivalent to a 12 mmol potassium salt tablet. Potassium supplementation by dietary modification has been shown to be equally efficacious to oral potassium salt supplementation and is preferred by the majority of patients. Subsequently, it is our practice to replace potassium using dietary modification, particularly in surgical patients having undergone oesophagogastrectomy or in those with peptic ulcer disease.

  6. KCNE3 is an inhibitory subunit of the Kv4.3 potassium channel

    DEFF Research Database (Denmark)

    Lundby, Alicia; Olesen, Søren-Peter

    2006-01-01

    The mammalian Kv4.3 potassium channel is a fast activating and inactivating K+ channel widely distributed in mammalian tissues. Kv4.3 is the major component of various physiologically important currents ranging from A-type currents in the CNS to the transient outward potassium conductance in the ...

  7. 21 CFR 184.1631 - Potassium hydroxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium hydroxide. 184.1631 Section 184.1631 Food... Specific Substances Affirmed as GRAS § 184.1631 Potassium hydroxide. (a) Potassium hydroxide (KOH, CAS Reg... pellets, flakes, sticks, lumps, and powders. Potassium hydroxide is obtained commercially from the...

  8. 21 CFR 184.1643 - Potassium sulfate.

    Science.gov (United States)

    2010-04-01

    ... hydroxide or potassium carbonate. (b) The ingredient meets the specifications of the “Food Chemicals Codex... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium sulfate. 184.1643 Section 184.1643 Food... Specific Substances Affirmed as GRAS § 184.1643 Potassium sulfate. (a) Potassium sulfate (K2SO4, CAS Reg...

  9. Potassium distribution in sugar cane

    International Nuclear Information System (INIS)

    Medina, N.H.

    2014-01-01

    In this work the distribution of potassium in sugarcane has been studied during its growth in two different conditions. In the first one the sugarcane soil was prepared with natural fertilizers, using sugarcane bagasse and, in another plantation the soil was prepared with commercial fertilizer NPK with a proportion of 10-10-10. For the measurement of potassium concentration in each part of the plant, gamma ray spectrometry techniques have been used to measure gamma-rays emitted from the radioisotope 40 K present in the sugarcane samples. The concentration of potassium in roots, stems and leaves were measured periodically. The results for sugarcane cultivated in soil with natural fertilizer show a higher concentration of potassium at the beginning of plant development and over time there is an oscillatory behavior in this concentration in each part of the plant, reaching a lower concentration in the adult plant. The results for the plant grown in soil with NPK fertilizer, indicate that the potassium concentration is higher in the stem at the beginning of cultivation and remained practically constant over time in various parts of the plant, with higher values in the leaves and stem than at the root. On the other hand, the results obtained using fertilizer NPK shows a lower potassium concentration, since the fertilizer provoked a much higher growth rate. (author)

  10. Potassium supplements for oral diarrhoea regimens.

    Science.gov (United States)

    Clements, M L; Levine, M M; Black, R E; Hughes, T P; Rust, J; Tome, F C

    1980-10-18

    A study is proposed for supplementing potassium loss from diarrhea in rehydration therapies with fresh fruit and other naturally potassium-rich foods. Bananas contain .1 mol of potassium per gm. Freshly squeezed lemon or orange juices were tested for potassium and sodium content and found to have very low potassium concentration. Therefore, the banana was chosen for an upcoming study that will determine if infants and children suffering from diarrhea can ingest the amounts of the fruit necessary to elevate the potassium level sufficiently. Bananas as the potassium source are thought to be well-accepted in developing areas.

  11. 21 CFR 184.1625 - Potassium citrate.

    Science.gov (United States)

    2010-04-01

    ... acid with potassium hydroxide or potassium carbonate. It occurs as transparent crystals or a white... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium citrate. 184.1625 Section 184.1625 Food... Specific Substances Affirmed as GRAS § 184.1625 Potassium citrate. (a) Potassium citrate (C6H5K3O7·H2O, CAS...

  12. Crystallization and preliminary X-ray diffraction studies of the tetramerization domain derived from the human potassium channel Kv1.3

    International Nuclear Information System (INIS)

    Winklmeier, Andreas; Weyand, Michael; Schreier, Christina; Kalbitzer, Hans Robert; Kremer, Werner

    2009-01-01

    The tetramerization domain of human Kv1.3 was cloned, expressed, purified and crystallized. The crystals belonged to space group I4 and diffracted to 1.2 Å resolution using synchrotron radiation. The tetramerization domain (T1 domain) derived from the voltage-dependent potassium channel Kv1.3 of Homo sapiens was recombinantly expressed in Escherichia coli and purified. The crystals were first grown in an NMR tube in 150 mM potassium phosphate pH 6.5 in the absence of additional precipitants. The crystals showed I4 symmetry characteristic of the naturally occurring tetrameric assembly of the single subunits. A complete native data set was collected to 1.2 Å resolution at 100 K using synchrotron radiation

  13. Modulation of the transient outward current (Ito) in rat cardiac myocytes and human Kv4.3 channels by mefloquine

    International Nuclear Information System (INIS)

    Perez-Cortes, E.J.; Islas, A.A.; Arevalo, J.P.; Mancilla, C.; Monjaraz, E.; Salinas-Stefanon, E.M.

    2015-01-01

    The antimalarial drug mefloquine, is known to be a potassium channel blocker, although its mechanism of action has not being elucidated and its effects on the transient outward current (I to ) and the molecular correlate, the K v 4.3 channel has not being studied. Here, we describe the mefloquine-induced inhibition of the rat ventricular I to and of CHO cells co-transfected with human K v 4.3 and its accessory subunit hKChIP2C by whole-cell voltage-clamp. Mefloquine inhibited rat I to and hK v 4.3 + KChIP2C currents in a concentration-dependent manner with a limited voltage dependence and similar potencies (IC 50 = 8.9 μM and 10.5 μM for cardiac myocytes and K v 4.3 channels, respectively). In addition, mefloquine did not affect the activation of either current but significantly modified the hK v 4.3 steady-state inactivation and recovery from inactivation. The effects of this drug was compared with that of 4-aminopyridine (4-AP), a well-known potassium channel blocker and its binding site does not seem to overlap with that of 4-AP. - Highlights: • Mefloquine inhibited ventricular I to and hK v 4.3 channels. IC 50 = 8.9 and 10.5 μM. • Inactivation and recovery from inactivation in the hK v 4.3 channels were modified by mefloquine. • Mefloquine displayed a higher affinity for the inactivated state. • The binding site for mefloquine may be located in the extracellular side of the channel.

  14. Extrarenal potassium adaptation: role of skeletal muscle

    International Nuclear Information System (INIS)

    Blachley, J.D.; Crider, B.P.; Johnson, J.H.

    1986-01-01

    Following the ingestion of a high-potassium-content diet for only a few days, the plasma potassium of rats rises only modestly in response to a previously lethal dose of potassium salts. This acquired tolerance, termed potassium adaptation, is principally the result of increased capacity to excrete potassium into the urine. However, a substantial portion of the acute potassium dose is not immediately excreted and is apparently translocated into cells. Previous studies have failed to show an increase in the content of potassium of a variety of tissues from such animals. Using 86 Rb as a potassium analogue, we have shown that the skeletal muscle of potassium-adapted rats takes up significantly greater amounts of potassium in vivo in response to an acute challenge than does that of control animals. Furthermore, the same animals exhibit greater efflux of 86 Rb following the termination of the acute infusion. We have also shown that the Na+-K+-ATPase activity and ouabain-binding capacity of skeletal muscle microsomes are increased by the process of potassium adaptation. We conclude that skeletal muscle is an important participant in potassium adaptation and acts to temporarily buffer acute increases in the extracellular concentration of potassium

  15. Genetics Home Reference: potassium-aggravated myotonia

    Science.gov (United States)

    ... aggravated by eating potassium-rich foods such as bananas and potatoes. Stiffness occurs in skeletal muscles throughout the body. Potassium-aggravated myotonia ranges in severity from mild episodes ...

  16. The heart and potassium: a banana republic.

    Science.gov (United States)

    Khan, Ehsan; Spiers, Christine; Khan, Maria

    2013-03-01

    The importance of potassium in maintaining stable cardiac function is a clinically understood phenomenon. Physiologically the importance of potassium in cardiac function is described by the large number of different kinds of potassium ions channels found in the heart compared to channels and membrane transport mechanisms for other ions such as sodium and calcium. Potassium is important in physiological homeostatic control of cardiac function, but is also of relevance to the diseased state, as potassium-related effects may stabilize or destabilize cardiac function. This article aims to provide a detailed understanding of potassium-mediated cardiac function. This will help the clinical practitioner evaluate how modulation of potassium ion channels by disease and pharmacological manipulation affect the cardiac patient, thus aiding in decision making when faced with clinical problems related to potassium.

  17. Qualitative Carbohydrate Analysis using Alkaline Potassium ...

    Indian Academy of Sciences (India)

    IAS Admin

    CLASSROOM. 285. RESONANCE | March 2016. Qualitative Carbohydrate Analysis using Alkaline. Potassium Ferricyanide. Keywords. Alkaline potassium ferricyanide, qualitative ... Carbohydrates form a distinct class of organic compounds often .... Laboratory Techniques: A contemporary Approach, W B Saunders Com-.

  18. Status of potassium permanganate - 2008

    Science.gov (United States)

    This is a brief overview of the Technical Sections completed and being worked on for the New Animal Drug Application (NADA) for potassium permanganate will be presented. Initial Label Claim (Columnaris on catfish/HSB): 1) Human Food Safety - Complete for all fin fish (June 1999). A hazard charac...

  19. Increased serum potassium affects renal outcomes

    DEFF Research Database (Denmark)

    Miao, Y; Dobre, D; Heerspink, H J Lambers

    2011-01-01

    To assess the effect of an angiotensin receptor blocker (ARB) on serum potassium and the effect of a serum potassium change on renal outcomes in patients with type 2 diabetes and nephropathy.......To assess the effect of an angiotensin receptor blocker (ARB) on serum potassium and the effect of a serum potassium change on renal outcomes in patients with type 2 diabetes and nephropathy....

  20. Cardiac Delayed Rectifier Potassium Channels in Health and Disease

    Science.gov (United States)

    Chen, Lei; Sampson, Kevin J.; Kass, Robert S.

    2016-01-01

    Cardiac delayed rectifier potassium channels conduct outward potassium currents during the plateau phase of action potentials and play pivotal roles in cardiac repolarization. These include IKs, IKr and the atrial specific IKur channels. In this chapter, we will review the molecular identities and biophysical properties of these channels. Mutations in the genes encoding delayed rectifiers lead to loss- or gain-of-function phenotypes, disrupt normal cardiac repolarization and result in various cardiac rhythm disorders, including congenital Long QT Syndrome, Short QT Syndrome and familial atrial fibrillation. We will also discuss the possibility and prospect of using delayed rectifier channels as therapeutic targets to manage cardiac arrhythmia. PMID:27261823

  1. Cardiac Delayed Rectifier Potassium Channels in Health and Disease.

    Science.gov (United States)

    Chen, Lei; Sampson, Kevin J; Kass, Robert S

    2016-06-01

    Cardiac delayed rectifier potassium channels conduct outward potassium currents during the plateau phase of action potentials and play pivotal roles in cardiac repolarization. These include IKs, IKr and the atrial specific IKur channels. In this article, we will review their molecular identities and biophysical properties. Mutations in the genes encoding delayed rectifiers lead to loss- or gain-of-function phenotypes, disrupt normal cardiac repolarization and result in various cardiac rhythm disorders, including congenital Long QT Syndrome, Short QT Syndrome and familial atrial fibrillation. We will also discuss the prospect of using delayed rectifier channels as therapeutic targets to manage cardiac arrhythmia. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Obtaining of potassium dicyan-argentate

    International Nuclear Information System (INIS)

    Sattarova, M.A.; Solojenkin, P.M.

    1997-01-01

    This work is devoted to obtaining of potassium dicyan-argentate. By means of exchange reaction between silver nitrate and potassium cyanide the potassium dicyan-argentate was synthesized. The analysis of obtained samples was carried out by means of titration and potentiometry.

  3. 21 CFR 172.160 - Potassium nitrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium nitrate. 172.160 Section 172.160 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Preservatives § 172.160 Potassium nitrate. The food additive potassium nitrate may be safely used as a curing...

  4. 21 CFR 582.1631 - Potassium hydroxide.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium hydroxide. 582.1631 Section 582.1631 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1631 Potassium hydroxide. (a) Product. Potassium hydroxide. (b) Conditions of use. This...

  5. 21 CFR 582.5622 - Potassium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium chloride. 582.5622 Section 582.5622 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5622 Potassium chloride. (a) Product. Potassium chloride. (b) Conditions of use. This...

  6. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  7. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  8. Membrane Currents in Airway Smooth Muscle: Mechanisms and Therapeutic Implications

    Directory of Open Access Journals (Sweden)

    Luke J Janssen

    1997-01-01

    Full Text Available Electrophysiological and pharmacological techniques were used to characterize the membrane conductance changes underlying spasmogen-evoked depolarization in airway smooth muscle (ASM. Changes included a transient activation of chloride ion channels and prolonged suppression of potassium ion channels; both changes are triggered by release of internally sequestered calcium ion and in turn cause opening of voltage-dependent calcium channels. The resultant influx of calcium ions contributes to contraction as well as to refilling of the internal calcium ion pool. Bronchodilators, on the other hand, act in part through activation of potassium channels, with consequent closure of calcium channels. The tools used to study ion channels in ASM are described, and the investigations of the roles of ion channels in ASM physiology (autacoid-evoked depolarization and hyperpolarization and pathophysiology (airway hyperresponsiveness are summarized. Finally, how the relationship between ion channels and ASM function/dysfunction may relate to the treatment of asthma and related breathing disorders is discussed.

  9. The schizophrenia-associated Kv11.1-3.1 isoform results in reduced current accumulation during repetitive brief depolarizations.

    Directory of Open Access Journals (Sweden)

    Juliane Heide

    Full Text Available Recent genome wide association studies identified a brain and primate specific isoform of a voltage-gated potassium channel, referred to as Kv11.1-3.1, which is significantly associated with schizophrenia. The 3.1 isoform replaces the first 102 amino acids of the most abundant isoform (referred to as Kv11.1-1A with six unique amino acids. Here we show that the Kv11.1-3.1 isoform has faster rates of channel deactivation but a slowing of the rates of inactivation compared to the Kv11.1-1A isoform. The Kv11.1-3.1 isoform also has a significant depolarizing shift in the voltage-dependence of steady-state inactivation. The consequence of the altered gating kinetics is that there is lower current accumulation for Kv11.1-3.1 expressing cells during repetitive action potential firing compared to Kv11.1-1A expressing cells, which in turn will result in longer lasting trains of action potentials. Increased expression of Kv11.1-3.1 channels in the brain of schizophrenia patients might therefore contribute to disorganized neuronal firing.

  10. The inhibitory effects of potassium chloride versus potassium silicate application on 137Cs uptake by rice

    International Nuclear Information System (INIS)

    Fujimura, Shigeto; Yoshioka, Kunio; Ota, Takeshi; Ishikawa, Tetsuya; Sato, Makoto; Satou, Mutsuto

    2016-01-01

    After the accident at the Fukushima Dai-ichi Nuclear Power Plant owned by the Tokyo Electric Power Company on 11 March 2011, potassium fertilizer was applied to agricultural fields in the southern Tohoku and northern Kanto regions of Japan to reduce the uptake of radiocesium by crops. In this study, we examined the effects of two types of potassium fertilizers, potassium chloride (a readily available potassium fertilizer) and potassium silicate (a slow-release potassium fertilizer), as well as a split application of potassium, on the accumulation of 137 Cs by rice plants in two pot experiments. The 137 Cs concentrations in the brown rice and in the above-ground plants were significantly lower after potassium chloride application than after potassium silicate application. The potassium ion (K + ) concentrations in soil solutions sampled 9 and 21 d after transplanting were significantly higher for the potassium chloride application than for the potassium silicate application. The K + concentrations in soil solutions observed in the application of potassium silicate were similar to those in the treatment when no potassium was applied. This finding indicates that the application of potassium silicate did not sufficiently increase the available K + for rice plants in the soil, which led to a greater uptake of 137 Cs after the potassium silicate application than after the application of potassium chloride. The 137 Cs concentration in brown rice was higher in the split application of potassium fertilizer with the second application at the full heading stage than that without split application and the split application with the second application before heading. - Highlights: • Potassium application reduced 137 Cs uptake by rice grown in pot experiments. • Readily available K fertilizer more effectively decreased brown rice 137 Cs concentration. • Potassium should be applied before heading to reduce brown rice 137 Cs concentration.

  11. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  12. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  13. Inhibitory effects of hesperetin on Kv1.5 potassium channels stably expressed in HEK 293 cells and ultra-rapid delayed rectifier K(+) current in human atrial myocytes.

    Science.gov (United States)

    Wang, Huan; Wang, Hong-Fei; Wang, Chen; Chen, Yu-Fang; Ma, Rong; Xiang, Ji-Zhou; Du, Xin-Ling; Tang, Qiang

    2016-10-15

    In the present study, the inhibitory effects of hesperetin (HSP) on human cardiac Kv1.5 channels expressed in HEK 293 cells and the ultra-rapid delayed rectifier K(+) current (Ikur) in human atrial myocytes were examined by using the whole-cell configuration of the patch-clamp techniques. We found that hesperetin rapidly and reversibly suppressed human Kv1.5 current in a concentration dependent manner with a half-maximal inhibition (IC50) of 23.15 μΜ with a Hill coefficient of 0.89. The current was maximally diminished about 71.36% at a concentration of 300μM hesperetin. Hesperetin significantly positive shifted the steady-state activation curve of Kv1.5, while negative shifted the steady-state inactivation curve. Hesperetin also accelerated the inactivation and markedly slowed the recovery from the inactivation of Kv1.5 currents. Block of Kv1.5 currents by hesperetin was in a frequency dependent manner. However, inclusion of 30μM hesperetin in pipette solution produced no effect on Kv1.5 channel current, while the current were remarkable and reversibly inhibited by extracellular application of 30μM hesperetin. We also found that hesperetin potently and reversibly inhibited the ultra-repaid delayed K(+) current (Ikur) in human atrial myocytes, which is in consistent with the effects of hesperetin on Kv1.5 currents in HEK 293 cells. In conclusion, hesperetin is a potent inhibitor of Ikur (which is encoded by Kv1.5), with blockade probably due to blocking of both open state and inactivated state channels from outside of the cell. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. The relation of potassium and sodium intakes to diet cost among U.S. adults.

    Science.gov (United States)

    Drewnowski, A; Rehm, C D; Maillot, M; Monsivais, P

    2015-01-01

    The 2010 Dietary Guidelines recommended that Americans increase potassium and decrease sodium intakes to reduce the burden of hypertension. One reason why so few Americans meet the recommended potassium or sodium goals may be perceived or actual food costs. This study explored the monetary costs associated with potassium and sodium intakes using national food prices and a representative sample of US adults. Dietary intake data from the 2001-2002 National Health and Nutrition Examination Survey were merged with a national food prices database. In a population of 4744 adults, the association between the energy-adjusted sodium and potassium intakes, and the sodium-to-potassium ratio (Na:K) and energy-adjusted diet cost was evaluated. Diets that were more potassium-rich or had lower Na:K ratios were associated with higher diet costs, while sodium intakes were not related to cost. The difference in diet cost between extreme quintiles of potassium intakes was $1.49 (95% confidence interval: 1.29, 1.69). A food-level analysis showed that beans, potatoes, coffee, milk, bananas, citrus juices and carrots are frequently consumed and low-cost sources of potassium. Based on existing dietary data and current American eating habits, a potassium-dense diet was associated with higher diet costs, while sodium was not. Price interventions may be an effective approach to improve potassium intakes and reduce the Na:K ratio of the diet. The present methods helped identify some alternative low-cost foods that were effective in increasing potassium intakes. The identification and promotion of lower-cost foods to help individuals meet targeted dietary recommendations could accompany future dietary guidelines.

  15. The inhibitory effects of potassium chloride versus potassium silicate application on (137)Cs uptake by rice.

    Science.gov (United States)

    Fujimura, Shigeto; Yoshioka, Kunio; Ota, Takeshi; Ishikawa, Tetsuya; Sato, Makoto; Satou, Mutsuto

    2016-03-01

    After the accident at the Fukushima Dai-ichi Nuclear Power Plant owned by the Tokyo Electric Power Company on 11 March 2011, potassium fertilizer was applied to agricultural fields in the southern Tohoku and northern Kanto regions of Japan to reduce the uptake of radiocesium by crops. In this study, we examined the effects of two types of potassium fertilizers, potassium chloride (a readily available potassium fertilizer) and potassium silicate (a slow-release potassium fertilizer), as well as a split application of potassium, on the accumulation of (137)Cs by rice plants in two pot experiments. The (137)Cs concentrations in the brown rice and in the above-ground plants were significantly lower after potassium chloride application than after potassium silicate application. The potassium ion (K(+)) concentrations in soil solutions sampled 9 and 21 d after transplanting were significantly higher for the potassium chloride application than for the potassium silicate application. The K(+) concentrations in soil solutions observed in the application of potassium silicate were similar to those in the treatment when no potassium was applied. This finding indicates that the application of potassium silicate did not sufficiently increase the available K(+) for rice plants in the soil, which led to a greater uptake of (137)Cs after the potassium silicate application than after the application of potassium chloride. The (137)Cs concentration in brown rice was higher in the split application of potassium fertilizer with the second application at the full heading stage than that without split application and the split application with the second application before heading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Potassium Intake, Bioavailability, Hypertension, and Glucose Control

    Directory of Open Access Journals (Sweden)

    Michael S. Stone

    2016-07-01

    Full Text Available Potassium is an essential nutrient. It is the most abundant cation in intracellular fluid where it plays a key role in maintaining cell function. The gradient of potassium across the cell membrane determines cellular membrane potential, which is maintained in large part by the ubiquitous ion channel the sodium-potassium (Na+-K+ ATPase pump. Approximately 90% of potassium consumed (60–100 mEq is lost in the urine, with the other 10% excreted in the stool, and a very small amount lost in sweat. Little is known about the bioavailability of potassium, especially from dietary sources. Less is understood on how bioavailability may affect health outcomes. Hypertension (HTN is the leading cause of cardiovascular disease (CVD and a major financial burden ($50.6 billion to the US public health system, and has a significant impact on all-cause morbidity and mortality worldwide. The relationship between increased potassium supplementation and a decrease in HTN is relatively well understood, but the effect of increased potassium intake from dietary sources on blood pressure overall is less clear. In addition, treatment options for hypertensive individuals (e.g., thiazide diuretics may further compound chronic disease risk via impairments in potassium utilization and glucose control. Understanding potassium bioavailability from various sources may help to reveal how specific compounds and tissues influence potassium movement, and further the understanding of its role in health.

  17. Evaluation of the potassium adsorption capacity of a potassium adsorption filter during rapid blood transfusion.

    Science.gov (United States)

    Matsuura, H; Akatsuka, Y; Muramatsu, C; Isogai, S; Sugiura, Y; Arakawa, S; Murayama, M; Kurahashi, M; Takasuga, H; Oshige, T; Yuba, T; Mizuta, S; Emi, N

    2015-05-01

    The concentration of extracellular potassium in red blood cell concentrates (RCCs) increases during storage, leading to risk of hyperkalemia. A potassium adsorption filter (PAF) can eliminate the potassium at normal blood transfusion. This study aimed to investigate the potassium adsorption capacity of a PAF during rapid blood transfusion. We tested several different potassium concentrations under a rapid transfusion condition using a pressure bag. The adsorption rates of the 70-mEq/l model were 76·8%. The PAF showed good potassium adsorption capacity, suggesting that this filter may provide a convenient method to prevent hyperkalemia during rapid blood transfusion. © 2015 International Society of Blood Transfusion.

  18. Dietary Impact of Adding Potassium Chloride to Foods as a Sodium Reduction Technique

    Directory of Open Access Journals (Sweden)

    Leo van Buren

    2016-04-01

    Full Text Available Potassium chloride is a leading reformulation technology for reducing sodium in food products. As, globally, sodium intake exceeds guidelines, this technology is beneficial; however, its potential impact on potassium intake is unknown. Therefore, a modeling study was conducted using Dutch National Food Survey data to examine the dietary impact of reformulation (n = 2106. Product-specific sodium criteria, to enable a maximum daily sodium chloride intake of 5 grams/day, were applied to all foods consumed in the survey. The impact of replacing 20%, 50% and 100% of sodium chloride from each product with potassium chloride was modeled. At baseline median, potassium intake was 3334 mg/day. An increase in the median intake of potassium of 453 mg/day was seen when a 20% replacement was applied, 674 mg/day with a 50% replacement scenario and 733 mg/day with a 100% replacement scenario. Reformulation had the largest impact on: bread, processed fruit and vegetables, snacks and processed meat. Replacement of sodium chloride by potassium chloride, particularly in key contributing product groups, would result in better compliance to potassium intake guidelines (3510 mg/day. Moreover, it could be considered safe for the general adult population, as intake remains compliant with EFSA guidelines. Based on current modeling potassium chloride presents as a valuable, safe replacer for sodium chloride in food products.

  19. Potassium

    Science.gov (United States)

    ... confusion listlessness tingling, prickling, burning, tight, or pulling sensation of arms, hands, legs, or feet heaviness or weakness of legs cold, pale, gray skin stomach pain unusual stomach bulging ...

  20. Operating experience with potassium systems

    International Nuclear Information System (INIS)

    Schwarz, N.F.

    1984-04-01

    In an international cooperation R and D work for the realization of potassium topping cycles to increase the conversion efficiency of thermal power stations is going on. Feasibility studies show that the realization of such a process can be achieved under economic considerations with existing materials and today's technology. Nevertheless, it has to be shown that the assumptions with respect to material behaviour and component reliability are based on sound technical premises. Therefore, in continuation of design studies, a hardware programme has been initiated in the Austrian Research Centre Seibersdorf. First results with respect to component and material behaviour are described. (Author) [de

  1. Potassium adsorption ratios as an indicator for the fate of agricultural potassium in groundwater

    NARCIS (Netherlands)

    Griffioen, J.

    2001-01-01

    Fertilization of agricultural land in groundwater infiltration areas often causes deterioration of groundwater quality. In addition to nitrogen and phosphorous, potassium deserves attention. The fate of potassium in the subsurface is controlled mainly by cation-exchange. Use of the Potassium

  2. Slack, Slick, and Sodium-Activated Potassium Channels

    Science.gov (United States)

    Kaczmarek, Leonard K.

    2013-01-01

    The Slack and Slick genes encode potassium channels that are very widely expressed in the central nervous system. These channels are activated by elevations in intracellular sodium, such as those that occur during trains of one or more action potentials, or following activation of nonselective cationic neurotransmitter receptors such as AMPA receptors. This review covers the cellular and molecular properties of Slack and Slick channels and compares them with findings on the properties of sodium-activated potassium currents (termed KNa currents) in native neurons. Human mutations in Slack channels produce extremely severe defects in learning and development, suggesting that KNa channels play a central role in neuronal plasticity and intellectual function. PMID:24319675

  3. Convergent and reciprocal modulation of a leak K+ current and Ih by an inhalational anaesthetic and neurotransmitters in rat brainstem motoneurones

    Science.gov (United States)

    Sirois, Jay E; Lynch, Carl; Bayliss, Douglas A

    2002-01-01

    Neurotransmitters and volatile anaesthetics have opposing effects on motoneuronal excitability which appear to reflect contrasting modulation of two types of subthreshold currents. Neurotransmitters increase motoneuronal excitability by inhibiting TWIK-related acid-sensitive K+ channels (TASK) and shifting activation of a hyperpolarization-activated cationic current (Ih) to more depolarized potentials; on the other hand, anaesthetics decrease excitability by activating a TASK-like current and inducing a hyperpolarizing shift in Ih activation. Here, we used whole-cell recording from motoneurones in brainstem slices to test if neurotransmitters (serotonin (5-HT) and noradrenaline (NA)) and an anaesthetic (halothane) indeed compete for modulation of the same ion channels - and we determined which prevails. When applied together under current clamp conditions, 5-HT reversed anaesthetic-induced membrane hyperpolarization and increased motoneuronal excitability. Under voltage clamp conditions, 5-HT and NA overcame most, but not all, of the halothane-induced current. When Ih was blocked with ZD 7288, the neurotransmitters completely inhibited the K+ current activated by halothane; the halothane-sensitive neurotransmitter current reversed at the equilibrium potential for potassium (EK) and displayed properties expected of acid-sensitive, open-rectifier TASK channels. To characterize modulation of Ih in relative isolation, effects of 5-HT and halothane were examined in acidified bath solutions that blocked TASK channels. Under these conditions, 5-HT and halothane each caused their characteristic shift in voltage-dependent gating of Ih. When tested concurrently, however, halothane decreased the neurotransmitter-induced depolarizing shift in Ih activation. Thus, halothane and neurotransmitters converge on TASK and Ih channels with opposite effects; transmitter action prevailed over anaesthetic effects on TASK channels, but not over effects on Ih. These data suggest that

  4. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel.

    Science.gov (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen

    2018-02-01

    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  5. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel

    Science.gov (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen

    2018-02-01

    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  6. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  7. 21 CFR 582.1613 - Potassium bicarbonate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Potassium bicarbonate. 582.1613 Section 582.1613 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE General Purpose Food Additives § 582.1613 Potassium bicarbonate. (a)...

  8. Potassium doped MWCNTs for hydrogen storage enhancement

    International Nuclear Information System (INIS)

    Adabi Qomi, S.; Gashtasebi, M.; Khoshnevisan, B.

    2012-01-01

    Here we have used potassium doped MWCNTs for enhancement of hydrogen storage process. XRD and SEM images have confirmed the doping of potassium. For studying the storage process a hydrogenic battery set up has been used. In the battery the working electrode has been made of the silver foam deposited by the doped MWCNTs electrophoretically.

  9. 75 FR 23298 - Potassium Permanganate From China

    Science.gov (United States)

    2010-05-03

    ... Permanganate From China AGENCY: United States International Trade Commission. ACTION: Institution of a five-year review concerning the antidumping duty order on potassium permanganate from China. SUMMARY: The... on potassium permanganate from China would be likely to lead to continuation or recurrence of...

  10. 75 FR 51112 - Potassium Permanganate From China

    Science.gov (United States)

    2010-08-18

    ... Permanganate From China AGENCY: United States International Trade Commission. ACTION: Scheduling of an expedited five-year review concerning the antidumping duty order on potassium permanganate from China... of the antidumping duty order on potassium permanganate from China would be likely to lead to...

  11. 21 CFR 172.375 - Potassium iodide.

    Science.gov (United States)

    2010-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.375 Potassium iodide. The food additive potassium iodide may be...

  12. Ammonium nitrate-potassium nitrate system

    Energy Technology Data Exchange (ETDEWEB)

    Cady, H.H.

    1981-01-01

    A portion of the binary phase diagram for the system ammonium nitrate-potassium nitrate has been determined from -55/sup 0/C to 185/sup 0/C. Results are presented for the ammonium-nitrate-rich end of the system up to 30 wt% potassium nitrate.

  13. 21 CFR 184.1610 - Potassium alginate.

    Science.gov (United States)

    2010-04-01

    ...: Category of food Maximum level of use in food (as served) (percent) Functional use Confections and...) of this chapter 0.25 Do. All other food categories 0.01 Do. (d) Prior sanctions for potassium... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium alginate. 184.1610 Section 184.1610 Food...

  14. Leaching of potassium in a lysimeter experiment

    International Nuclear Information System (INIS)

    Gerzabek, M.H.

    1996-11-01

    Leaching of potassium was studied in the lysimeter plant in Seibersdorf/Austria (Pannonian climate). Averaged over three years, gravitational water amounted to 15.7% of the sum of precipitation (mean 485 mm) and irrigation (mean 138 mm). Differences between the four soils with respect to drainage were explained by the specific percentage of the soil skeleton. The average yearly potassium leaching ranged from 3.64 kg K/ha·yr (Dystric-Cambisol) to 22.7 kg K/ha·yr (drained Gleysol). Correlation between gravitational water volume and potassium leaching were only significant for one out of four soil types. No correlation was observed between extractable potassium in the soil profiles and potassium leaching. (author)

  15. Chronic potassium depletion increases adrenal progesterone production that is necessary for efficient renal retention of potassium.

    Science.gov (United States)

    Elabida, Boutaïna; Edwards, Aurélie; Salhi, Amel; Azroyan, Anie; Fodstad, Heidi; Meneton, Pierre; Doucet, Alain; Bloch-Faure, May; Crambert, Gilles

    2011-08-01

    Modern dietary habits are characterized by high-sodium and low-potassium intakes, each of which was correlated with a higher risk for hypertension. In this study, we examined whether long-term variations in the intake of sodium and potassium induce lasting changes in the plasma concentration of circulating steroids by developing a mathematical model of steroidogenesis in mice. One finding of this model was that mice increase their plasma progesterone levels specifically in response to potassium depletion. This prediction was confirmed by measurements in both male mice and men. Further investigation showed that progesterone regulates renal potassium handling both in males and females under potassium restriction, independent of its role in reproduction. The increase in progesterone production by male mice was time dependent and correlated with decreased urinary potassium content. The progesterone-dependent ability to efficiently retain potassium was because of an RU486 (a progesterone receptor antagonist)-sensitive stimulation of the colonic hydrogen, potassium-ATPase (known as the non-gastric or hydrogen, potassium-ATPase type 2) in the kidney. Thus, in males, a specific progesterone concentration profile induced by chronic potassium restriction regulates potassium balance.

  16. Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-23

    Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

  17. Escitalopram block of hERG potassium channels.

    Science.gov (United States)

    Chae, Yun Ju; Jeon, Ji Hyun; Lee, Hong Joon; Kim, In-Beom; Choi, Jin-Sung; Sung, Ki-Wug; Hahn, Sang June

    2014-01-01

    Escitalopram, a selective serotonin reuptake inhibitor, is the pharmacologically active S-enantiomer of the racemic mixture of RS-citalopram and is widely used in the treatment of depression. The effects of escitalopram and citalopram on the human ether-a-go-go-related gene (hERG) channels expressed in human embryonic kidney cells were investigated using voltage-clamp and Western blot analyses. Both drugs blocked hERG currents in a concentration-dependent manner with an IC50 value of 2.6 μM for escitalopram and an IC50 value of 3.2 μM for citalopram. The blocking of hERG by escitalopram was voltage-dependent, with a steep increase across the voltage range of channel activation. However, voltage independence was observed over the full range of activation. The blocking by escitalopram was frequency dependent. A rapid application of escitalopram induced a rapid and reversible blocking of the tail current of hERG. The extent of the blocking by escitalopram during the depolarizing pulse was less than that during the repolarizing pulse, suggesting that escitalopram has a high affinity for the open state of the hERG channel, with a relatively lower affinity for the inactivated state. Both escitalopram and citalopram produced a reduction of hERG channel protein trafficking to the plasma membrane but did not affect the short-term internalization of the hERG channel. These results suggest that escitalopram blocked hERG currents at a supratherapeutic concentration and that it did so by preferentially binding to both the open and the inactivated states of the channels and by inhibiting the trafficking of hERG channel protein to the plasma membrane.

  18. On the fusibility of potassium heptafluorotantalate

    International Nuclear Information System (INIS)

    Agulyanskij, A.I.; Bessonova, V.A.

    1983-01-01

    Phase transformations of potassium heptafluorotantalate near the liquidus temperature have been studied. Thermograms and polytherm of the electric condUctivity of potassium heptafluorotantalate, thermogram of the mechanical mixture 0.5 K 2 TaF 7 +0.5 KF and thermogram of K 3 TaF 8 crystallization are plotted. The phase diagram of the K 2 TaF 7 -KF system is presented. In the temperature range 746 to 778 deg, i.e. above K 2 TaF 7 melting point, the melt is shown to remain heterogeneous. A portion of the phase diagram rich in potassium heptafluorotantalate is qualified as an ordinary eutectics

  19. X-ray absorption in atomic potassium

    International Nuclear Information System (INIS)

    Gomilsek, Jana Padeznik; Kodre, Alojz; Arcon, Iztok; Nemanic, Vincenc

    2008-01-01

    A new high-temperature absorption cell for potassium vapor is described. X-ray absorption coefficient of atomic potassium is determined in the energy interval of 600 eV above the K edge where thresholds for simultaneous excitations of 1s and outer electrons, down to [1s2p] excitation, appear. The result represents also the atomic absorption background for XAFS (X-ray absorption fine structure) structure analysis. The K ionization energy in the potassium vapor is determined and compared with theoretical data and with the value for the metal

  20. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  1. Effects of haloperidol on Kv4.3 potassium channels.

    Science.gov (United States)

    Lee, Hong Joon; Sung, Ki-Wug; Hahn, Sang June

    2014-10-05

    Haloperidol is commonly used in clinical practice to treat acute and chronic psychosis, but it also has been associated with adverse cardiovascular events. We investigated the effects of haloperidol on Kv4.3 currents stably expressed in CHO cells using a whole-cell patch-clamp technique. Haloperidol did not significantly inhibit the peak amplitude of Kv4.3, but accelerated the decay rate of inactivation of Kv4.3 in a concentration-dependent manner. Thus, the effects of haloperidol on Kv4.3 were estimated from the integral of the Kv4.3 currents during the depolarization pulse. The Kv4.3 was decreased by haloperidol in a concentration-dependent manner with an IC50 value of 3.6 μM. Haloperidol accelerated the decay rate of Kv4.3 inactivation and activation kinetics in a concentration-dependent manner, thereby decreasing the time-to-peak. Haloperidol shifted the voltage dependence of the steady-state activation and inactivation of Kv4.3 in a hyperpolarizing direction. Haloperidol also caused an acceleration of the closed-state inactivation of Kv4.3. Haloperidol produced a use-dependent block of Kv4.3, which was accompanied by a slowing of recovery from the inactivation of Kv4.3. These results suggest that haloperidol blocks Kv4.3 by both interacting with the open state of Kv4.3 channels during depolarization and accelerating the closed-state inactivation at subthreshold membrane potentials. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Effect of potassium on micromorphological and chemical ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... study the effect of potassium on yield and internal leaf tissues composition of cotton ... Nitrogen (N) and phosphorus (P) were applied at 150 mg N/kg soil and 75 mg ..... Copper enzymes in isolated chloroplasts: Polyphenol.

  3. Crystal structure transformation in potassium acrylate

    Science.gov (United States)

    Pai Verneker, V. R.; Vasanthakumari, R.

    1983-10-01

    Potassium acrylate undergoes a reversible phase transformation around 335°K with an activation energy of 133 kcal/mole. Differential scanning calorimetry and high temperature X-ray powder diffraction techniques have been used to probe this phenomenon.

  4. Thanatochemistry: Study of vitreous humor potassium

    African Journals Online (AJOL)

    Nilesh Keshav Tumram

    2014-02-18

    Feb 18, 2014 ... particularly vitreous potassium has received most attention. It is known that ... respect to different age and sex at different death intervals. The details regarding the ... Analyser by the Ion selective method. The reagents used ...

  5. Photoconductivity and dielectric studies of potassium pentaborate

    Indian Academy of Sciences (India)

    Single crystal of potassium pentaborate (KB5) has been grown by solution growth ... equipped with the Gunn Oscillator guided with rectangular wave-guide. ... its dielectric behaviour with the change of frequency has also been investigated.

  6. Suicidal Ingestion of Potassium Permanganate Crystals: A Rare Encounter

    OpenAIRE

    Karthik, Ravikanti; Veerendranath, Hari Prasad Kanakapura; Wali, Siddraj; Mohan, Murali N T; Kumar, Praveen A. C.; Trimurty, Gaganam

    2014-01-01

    Potassium permanganate poisoning is not common. Although Symptoms of potassium permanganate ingestion are gastrointestinal and Complications due to ingestion of potassium permanganate include cardiovascular depression, hepatic and renal damage, upper airway obstruction, bleeding tendency and methemoglobinemia. Gastric damage due to potassium permanganate has rarely been reported previously. We are reporting a 34-year old female patient who presented to our Emergency Department after suicidal ...

  7. The Ketogenic Diet and Potassium Channel Function

    Science.gov (United States)

    2015-11-01

    1 AWARD NUMBER: W81XWH-13-1-0463 TITLE: The Ketogenic Diet and Potassium Channel Function PRINCIPAL INVESTIGATOR: Dr. Geoffrey Murphy...NUMBER The Ketogenic Diet and Potassium Channel Function 5b. GRANT NUMBER W81XWH-13-1-0463 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Geoffrey Murphy...The overall objective of this Discovery Award was to explore the hypothesis the ketogenic diet (KD) regulates neuronal excitability by influencing

  8. Performance analysis of a potassium-base AMTEC cell

    International Nuclear Information System (INIS)

    Huang, C.; Hendricks, T.J.; Hunt, T.K.

    1998-01-01

    Sodium-BASE Alkali-Metal-Thermal-to-Electric-Conversion (AMTEC) cells have been receiving increased attention and funding from the Department of Energy, NASA and the United States Air Force. Recently, sodium-BASE (Na-BASE) AMTEC cells were selected for the Advanced Radioisotope Power System (ARPS) program for the next generation of deep-space missions and spacecraft. Potassium-BASE (K-BASE) AMTEC cells have not received as much attention to date, even though the vapor pressure of potassium is higher than that of sodium at the same temperature. So that, K-BASE AMTEC cells with potentially higher open circuit voltage and higher power output than Na-BASE AMTEC cells are possible. Because the surface tension of potassium is about half of the surface tension of sodium at the same temperature, the artery and evaporator design in a potassium AMTEC cell has much more challenging pore size requirements than designs using sodium. This paper uses a flexible thermal/fluid/electrical model to predict the performance of a K-BASE AMTEC cell. Pore sizes in the artery of K-BASE AMTEC cells must be smaller by an order of magnitude than in Na-BASE AMTEC cells. The performance of a K-BASE AMTEC cell was higher than a Na-BASE AMTEC cell at low voltages/high currents. K-BASE AMTEC cells also have the potential of much better electrode performance, thereby creating another avenue for potentially better performance in K-BASE AMTEC cells

  9. The acrylamide (S)-1 differentially affects Kv7 (KCNQ) potassium channels

    DEFF Research Database (Denmark)

    Bentzen, Bo Hjorth; Schmitt, Nicole; Calloe, Kirstine

    2006-01-01

    The family of Kv7 (KCNQ) potassium channels consists of five members. Kv7.2 and 3 are the primary molecular correlates of the M-current, but also Kv7.4 and Kv7.5 display M-current characteristics. M-channel modulators include blockers (e.g., linopirdine) for cognition enhancement and openers (e.g...

  10. Transverse thermal magnetoresistance of potassium

    International Nuclear Information System (INIS)

    Newrock, R.S.; Maxfield, B.W.

    1976-01-01

    Results are presented of extensive thermal magnetoresistance measurements on single-crystal and polycrystalline specimens of potassium having residual resistance ratios (RRR) ranging from 1100 to 5300. Measurements were made between 2 and 9 0 K for magnetic fields up to 1.8 T. The observed thermal magnetoresistance cannot be understood on the basis of either semiclassical theories or from the electrical magnetoresistance and the Wiedemann-Franz law. A number of relationships are observed between the thermal and electrical magnetoresistances, many of which are not immediately obvious when comparing direct experimental observations. The thermal magnetoresistance W(T,H) is given reasonably well by W(T,H)T = W(T,0)T + AH + BH 2 , where both A and B are temperature-dependent coefficients. Results show that A = A 0 + A 1 T 3 , while B(T) cannot be expressed as any simple power law. A 0 is dependent on the RRR, while A 1 is independent of the RRR. Two relationships are found between corresponding coefficients in the electrical and thermal magnetoresistance: (i) the Wiedmann--Franz law relates A 0 to the Kohler slope of the electrical magnetoresistance and (ii) the temperature-dependent portions of the electrical and thermal Kohler slopes are both proportional to the electron--phonon scattering contribution to the corresponding zero-field resistance. The latter provides evidence that inelastic scattering is very important in determining the temperature-dependent linear magnetoresistances. Part, but by no means all, of the quadratic thermal resistance is accounted for by lattice thermal conduction. It is concluded that at least a portion of the anomalous electrical and thermal magnetoresistances is due to intrinsic causes and not inhomogeneities or other macroscopic defects

  11. Sodium-to-Potassium Ratio and Blood Pressure, Hypertension, and Related Factors12

    Science.gov (United States)

    Perez, Vanessa; Chang, Ellen T.

    2014-01-01

    The potential cost-effectiveness and feasibility of dietary interventions aimed at reducing hypertension risk are of considerable interest and significance in public health. In particular, the effectiveness of restricted sodium or increased potassium intake on mitigating hypertension risk has been demonstrated in clinical and observational research. The role that modified sodium or potassium intake plays in influencing the renin-angiotensin system, arterial stiffness, and endothelial dysfunction remains of interest in current research. Up to the present date, no known systematic review has examined whether the sodium-to-potassium ratio or either sodium or potassium alone is more strongly associated with blood pressure and related factors, including the renin-angiotensin system, arterial stiffness, the augmentation index, and endothelial dysfunction, in humans. This article presents a systematic review and synthesis of the randomized controlled trials and observational research related to this issue. The main findings show that, among the randomized controlled trials reviewed, the sodium-to-potassium ratio appears to be more strongly associated with blood pressure outcomes than either sodium or potassium alone in hypertensive adult populations. Recent data from the observational studies reviewed provide additional support for the sodium-to-potassium ratio as a superior metric to either sodium or potassium alone in the evaluation of blood pressure outcomes and incident hypertension. It remains unclear whether this is true in normotensive populations and in children and for related outcomes including the renin-angiotensin system, arterial stiffness, the augmentation index, and endothelial dysfunction. Future study in these populations is warranted. PMID:25398734

  12. Effect of polacrilin potassium as disintegrant on bioavailability of diclofenac potassium in tablets : a technical note.

    Science.gov (United States)

    Bele, Mrudula H; Derle, Diliprao V

    2012-09-01

    Polacrilin potassium is an ion exchange resin used in oral pharmaceutical formulations as a tablet disintegrant. It is a weakly acidic cation exchange resin. Chemically, it is a partial potassium salt of a copolymer of methacrylic acid with divinyl benzene. It ionizes to an anionic polymer chain and potassium cations. It was hypothesized that polacrilin potassium may be able to improve the permeability of anionic drugs according to the Donnan membrane phenomenon. The effect of polacrilin potassium on the permeability of diclofenac potassium, used as a model anionic drug, was tested in vitro using diffusion cells and in vivo by monitoring serum levels in rats. The amount of drug permeated across a dialysis membrane in vitro was significantly more in the presence of polacrilin potassium. Significant improvement was found in the extent of drug absorption in vivo. It could be concluded that polacrilin potassium may be used as a high-functionality excipient for improving the bioavailability of anionic drugs having poor gastrointestinal permeability.

  13. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    International Nuclear Information System (INIS)

    Long, Yan; Lin, Zuoxian; Xia, Menghang; Zheng, Wei; Li, Zhiyuan

    2013-01-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC 50 values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds

  14. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Long, Yan; Lin, Zuoxian [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China); Xia, Menghang; Zheng, Wei [National Center for Advancing Translational Sciences, National Institutes of Health, Bethesda, MD 20892 (United States); Li, Zhiyuan, E-mail: li_zhiyuan@gibh.ac.cn [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China)

    2013-03-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC{sub 50} values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds.

  15. Electrical properties of the potassium polytitanate compacts

    International Nuclear Information System (INIS)

    Goffman, V.G.; Gorokhovsky, A.V.; Kompan, M.M.; Tretyachenko, E.V.; Telegina, O.S.; Kovnev, A.V.; Fedorov, F.S.

    2014-01-01

    Highlights: • Quasi-static permittivity of potassium polytitanates compacts achieves 10 4 –10 5 . • Observed Maxwell–Wagner polarization attributes to layered structure of polytitanates. • The conductivity varies from 5 × 10 −2 to 10 −6 –10 −7 Sm/m in a wide range of temperatures. - Abstract: Titanates of alkali metals are widely applied materials as they are relatively low in cost and might be easily synthesized. They are utilized as adsorbents, catalysts, solid state electrolytes, superconductors. Here we report our results on electrical properties of the compacted amorphous potassium polytitanates powders. The electrical properties of the compacts were studied by means of complex impedance spectroscopy in a wide range of frequencies at different temperatures using two-electrode configuration. The frequency dependences of conductivity for the investigated potassium polytitanates compacts varies in the range from 5 × 10 −2 Sm/m (high frequencies, ion conductivity) up to 10 −6 –10 −7 Sm/m (low frequencies, electron conductivity) for a wide range of temperatures (19–150 °C). According to the results, at low frequencies quasi-static permittivity of the stabilized PPT compacts achieves high values of 10 4 –10 5 . This might be explained by Maxwell–Wagner polarization attributed to the layered structure of the potassium polytitanates particles containing potassium and hydronium ions together with crystallization water in the interlayer and is very promising for solid state electrolyte applications for moderate temperatures

  16. An Electrochemical Sensor Based on Nanostructured Hollandite-type Manganese Oxide for Detection of Potassium Ions

    Directory of Open Access Journals (Sweden)

    Alex S. Lima

    2009-08-01

    Full Text Available The participation of cations in redox reactions of manganese oxides provides an opportunity for development of chemical sensors for non-electroactive ions. A sensor based on a nanostructured hollandite-type manganese oxide was investigated for voltammetric detection of potassium ions. The detection is based on the measurement of anodic current generated by oxidation of Mn(III to Mn(IV at the surface of the electrode and the subsequent extraction of the potassium ions into the hollandite structure. In this work, an amperometric procedure at an operating potential of 0.80 V (versus SCE is exploited for amperometric monitoring. The current signals are linearly proportional to potassium ion concentration in the range 4.97 × 10−5 to 9.05 × 10−4 mol L−1, with a correlation coefficient of 0.9997.

  17. Potassium permanganate ingestion as a suicide attempt

    Directory of Open Access Journals (Sweden)

    Sebnem Eren Cevik

    2012-02-01

    Full Text Available Potassium permanganate is a highly corrosive, water-soluble oxidizing antiseptic. A 68- year-old female patient was admitted to our Emergency Department after ingestion of 3 tablets of 250 mg potassium permanganate as a suicide attempt. The physical exam revealed brown stained lesions in the oropharynx. Emergency endoscopy was performed by the gastroenterologist after the third hour of ingestion. Emergency endoscopy revealed multiple superficial (Grade I-II lesions on the esophagus and cardia, which were considered secondary to the caustic substance. The mainstay in the treatment of potassium permanganate is supportive and the immediate priority is to secure the airway. Emergency endoscopy is an important tool used to evaluate the location and severity of injury to the esophagus, stomach and duodenum after caustic ingestion. Patients with signs and symptoms of intentional ingestion should undergo endoscopy within 12 to 24 h to define the extent of the disease.

  18. Potassium cardioplegia: early assessment by radionuclide ventriculography

    International Nuclear Information System (INIS)

    Ellis, R.J.; Born, M.; Feit, T.; Ebert, P.A.

    1978-01-01

    Left ventricular function was evaluated by single pass /sup 99m/Tc radionuclide ventriculography when potassium cardioplegia was combined with hypothermia. In 35 patients undergoing myocardial revascularization (3 CABG/patient) in which potassium cardioplegia at 4 0 C was used, no patient developed a myocardial infarction either by electrocardiogram or /sup 99m/Tc pyrophosphate imaging in the postoperative period. In 22 patients, aortic cross-clamp time was greater than 60 min, and the ejection fraction by the single pass radionuclide technique was 50% preoperatively and 53% postoperatively (NS). Wall motion in the single RAO view was not worse postoperatively. No patient required any inotropic agents in the immediate postoperative period. It appears that no significant ventricular impairment occurred in the immediate postoperative period (48 to 72 hours) when potassium cardioplegia combined with hypothermia was used for a 60-minute period

  19. Potassium permanganate ingestion as a suicide attempt

    Directory of Open Access Journals (Sweden)

    Tuba Cimilli Ozturk

    2012-01-01

    Full Text Available Potassium permanganate is a highly corrosive, water-soluble oxidizing antiseptic. A 68- year-old female patient was admitted to our Emergency Department after ingestion of 3 tablets of 250 mg potassium permanganate as a suicide attempt. The physical exam revealed brown stained lesions in the oropharynx. Emergency endoscopy was performed by the gastroenterologist after the third hour of ingestion. Emergency endoscopy revealed multiple superficial (Grade I-II lesions on the esophagus and cardia, which were considered secondary to the caustic substance. The mainstay in the treatment of potassium permanganate is supportive and the immediate priority is to secure the airway. Emergency endoscopy is an important tool used to evaluate the location and severity of injury to the esophagus, stomach and duodenum after caustic ingestion. Patients with signs and symptoms of intentional ingestion should undergo endoscopy within 12 to 24 h to define the extent of the disease.

  20. Suicidal ingestion of potassium permanganate crystals: a rare encounter.

    Science.gov (United States)

    Karthik, Ravikanti; Veerendranath, Hari Prasad Kanakapura; Wali, Siddraj; Mohan, Murali N T; Kumar, Praveen A C; Trimurty, Gaganam

    2014-01-01

    Potassium permanganate poisoning is not common. Although Symptoms of potassium permanganate ingestion are gastrointestinal and Complications due to ingestion of potassium permanganate include cardiovascular depression, hepatic and renal damage, upper airway obstruction, bleeding tendency and methemoglobinemia. Gastric damage due to potassium permanganate has rarely been reported previously. We are reporting a 34-year old female patient who presented to our Emergency Department after suicidal ingestion of potassium permanganate crystals. After treatment, the patient was discharged home on the 8(th) day after admission. So we conclude that Emergency endoscopy has a significant role in diagnosis and management of potassium permanganate ingestion.

  1. Skin decontamination efficacy of potassium ketoxime on rabbits exposed to sulfur mustard.

    Science.gov (United States)

    Sun, Jing-Hai; Sun, Pei-Pei; Zheng, Wei; Han, Song; Ying, Ying; Liu, Hong-Yan; Zhang, Cheng; Zhao, Bao-Quan; Zuo, Guo-Min; Lu, Hong; Zhong, Yu-Xu

    2015-03-01

    The chemical weapon sulfur mustard (SM) is a blister agent, and currently, there is no effective antidote. To evaluate the decontamination efficacy of potassium ketoxime against SM and preliminarily elucidate its decontamination mechanism. Potassium ketoxime reacted with SM, and SM residues were tested at different time intervals by T-135 colorimetry after the reaction. Rabbit skin was topically exposed to 2 mg/cm(2) SM, treated with potassium ketoxime 1 min later, and observed after 6, 12, and 24 h. Gas chromatography-mass spectroscopy was employed to screen and identify the main products of potassium ketoxime decontamination of SM. Potassium ketoxime had a great effect against SM contamination. With a mass ratio of decontaminant: SM of 50:1, decontamination rates against SM were 87.5% after 30 s, 95.9% after 1 min, and 99.0% after 5 min. Fifteen minutes after exposure to SM, the untreated group showed clear erythema lesions, whereas the experimental group showed no clear erythema lesions within 6 h. After 12 and 24 h, the areas of damaged skin in the experimental group were 0.038 and 0.125 cm(2), respectively, compared with 2.21 and 2.65 cm(2) in the control group. Histopathological analysis revealed that treatment with potassium ketoxime also reduced inflammation-induced damage. The results of this study indicate that potassium ketoxime reacted rapidly and completely with SM, and thus, it was found to be a suitable and effective skin decontaminant against SM. The decontamination reaction mechanism is mainly related to nucleophilic substitution.

  2. 21 CFR 862.1600 - Potassium test system.

    Science.gov (United States)

    2010-04-01

    ... potassium in serum, plasma, and urine. Measurements obtained by this device are used to monitor electrolyte balance in the diagnosis and treatment of diseases conditions characterized by low or high blood potassium levels. (b) Classification. Class II. ...

  3. The existence of the potassium dioxodifluorobromate

    International Nuclear Information System (INIS)

    Tantot, Georges; Bougon, Roland

    1975-01-01

    The reaction of liquid bromine pentafluoride with potassium bromate allows the formation of an oxyfluorinated complex ion of bromine V: the dioxodifluorobromate ion BrO 2 F 2 - . From Raman spectroscopy data this ion has a structure related to those of the chlorine and iodine corresponding ions [fr

  4. 21 CFR 184.1613 - Potassium bicarbonate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium bicarbonate. 184.1613 Section 184.1613 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) DIRECT FOOD SUBSTANCES AFFIRMED AS GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS §...

  5. Resonant second harmonic generation in potassium vapor

    International Nuclear Information System (INIS)

    Kim, D.; Mullin, C.S.; Shen, Y.R.; Lawrence Berkeley Lab., CA

    1995-06-01

    Picosecond pulses are used to study resonant second harmonic generation in potassium vapor. Although the process is both microscopically and macroscopically forbidden, it can readily be observed. The results can be quantitatively understood by a multiphoton-ionization-initiated, dc-field-induced, coherent transient model

  6. Computational study on potassium picrate crystal

    Energy Technology Data Exchange (ETDEWEB)

    Ju, Xue-Hai; Lu, Ya-Lin; Ma, Xiu-Fang; Xiao, He-Ming [Department of Chemistry, Nanjing University of Science and Technology, Nanjing, 210094 (China)

    2006-08-15

    DFT calculation at the B3LYP level was performed on crystalline potassium picrate. The frontier bands are slightly fluctuant. The energy gap between the highest occupied crystal orbital (HOCO) and the lowest unoccupied crystal orbital (LUCO) is 0.121 a.u. (3.29 eV). The carbon atoms that are connected with the nitro groups make up the narrow lower energy bands, with small contributions from nitro oxygen and phenol oxygen. The higher energy bands consist of orbitals from the nitro groups and carbon atom. The potassium bears almost 1 a.u. positive charge. The potassium forms ionic bonding with the phenol oxygen and the nitro oxygen at the same time. The crystal lattice energy is predicted to be -574.40 kJ/mol at the B3LYP level determined with the effective core pseudopotential HAYWSC-31G basis set for potassium and 6-31G** basis set for other atoms. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  7. Altered potassium homeostasis in Crohn's disease

    International Nuclear Information System (INIS)

    Schober, O.; Hundeshagen, H.; Bosaller, C.; Lehr, L.

    1983-01-01

    The total body potassium (TBK), serum potassium, and the number of red blood cell ouabain-binding sites was studied in 94 patients with Crohn's diease. TBK was measured by counting the endogenous 40 K in a whole body counter. TBK was 87%+-13% in 94 patients was Crohn's disease, while in control subjects, it was 97%+-12% (n=24). This significant reduction in TBK was accompanied by normal serum potassium levels (4.4+-0.5 mM). TBK was significantly correlated with the Crohn's disease activity index (r=0.79, n=113, P 3 H-ouabain showed a significant increse in the number of Na-K pumps in Crohn's disease (396+-65, n=27) compared with the control group. 290+-45 (n=24). These results support the suggestion that changes in TBK may regulate the synthesis of Na-K pump molecules. The total body potassium depletion and the need for a preoperative nutritional support in Crohn's disease are discussed. (orig.)

  8. Nutritional potassium requirement for laying Japanese quails

    Directory of Open Access Journals (Sweden)

    Fernando Guilherme Perazzo Costa

    2011-12-01

    Full Text Available The objective of this study was to evaluate the potassium requirement for laying Japanese quails. Two hundred and forty quails were distributed in a randomized block design, with five treatments and six replicates, with eight birds each. The treatments consisted of a basal diet deficient in potassium (K (2.50 g/kg, supplemented with potassium carbonate, to replace the inert, to reach levels of 2.50, 3.50, 4.50, 5.50 and 6.50 (g/kg of K in the diet. There was a quadratic effect of K levels on feed intake, egg production, egg mass and feed conversion per egg mass and per egg dozen, estimating the requirements of 4.26, 4.41, 4.38, 4.43 and 4.48 (g/kg of K diet, respectively. There was no significant effect on the levels of K in the diet on egg weight, albumen weight, percentage of yolk or shell and yolk color. However, yolk and shell weights reduced and the albumen percentage increased linearly with increasing levels of K in the diet. Despite the reduction of shell weight, the increased levels of K did not influence the specific gravity and shell thickness. The use of 4.41 g/kg of potassium is recommended in the diet for laying Japanese quails.

  9. Rheological properties of potassium barium borate glasses

    NARCIS (Netherlands)

    Szwejda, K.A.; Vogel, D.L.; Stevels, J.M.

    1973-01-01

    Several series of potassium barium borate glasses have been investigated as to their rheological properties. It has been found, that all these glasses show deviations from ‘Newtonian’ behaviour below temperatures corresponding to viscosities of 1010 poises. The activation energies of viscous flow

  10. Potassium ferrate treatment of RFETS' contaminated groundwater

    International Nuclear Information System (INIS)

    1995-01-01

    The potassium ferrate treatment study of Rocky Flats Environmental Technology Site (RFETS) groundwater was performed under the Sitewide Treatability Studies Program (STSP). This study was undertaken to determine the effectiveness of potassium ferrate in a water treatment system to remove the contaminants of concern (COCS) from groundwater at the RFETS. Potassium ferrate is a simple salt where the iron is in the plus six valence state. It is the iron at the plus six valence state (Fe +6 ) that makes it an unique water treatment chemical, especially in waters where the pH is greater than seven. In basic solutions where the solubility of the oxides/hydroxides of many of the COCs is low, solids are formed as the pH is raised. By using ferrate these solids are agglomerated so they can be effectively removed by sedimentation in conventional water treatment equipment. The objective of this study was to determine the quality of water after treatment with potassium ferrate and to determine if the Colorado Water Quality Control Commission (CWQCC) discharge limits for the COCs listed in Table 1.0-1 could be met. Radionuclides in the groundwater were of special concern

  11. Acute Renal Failure following Accidental Potassium Bromate ...

    African Journals Online (AJOL)

    Accidental poisoning is common in children. Potassium bromate is a commonly used additive and raising agent in many edibles particularly bread, a staple food worldwide, yet its accidental poisoning has hitherto, not been documented in Nigeria. We report an unusual case of acute renal failure following accidental ...

  12. Palytoxin and the sodium/potassium pump—phosphorylation and potassium interaction

    International Nuclear Information System (INIS)

    Rodrigues, Antônio M; De Almeida, Antônio-Carlos G; Infantosi, Antonio F C

    2009-01-01

    We proposed a reaction model for investigating interactions between K + and the palytoxin–sodium–potassium (PTX–Na + /K + ) pump complex under conditions where enzyme phosphorylation may occur. The model is composed of (i) the Albers–Post model for Na + /K + –ATPase, describing Na + and K + pumping; (ii) the reaction model proposed for Na + /K + –ATPase interactions with its ligands (Na + , K + , ATP, ADP and P) and with PTX. A mathematical model derived for representing the reactions was used to simulate experimental studies of the PTX-induced current, in different concentrations for the pump ligands. The simulations allow interpretation of the simultaneous action of Na + /K + –ATPase phosphorylation and K + on the PTX-induced channels. The results suggest that (i) phosphorylation increases the PTX toxic effect, increasing its affinity and reducing the K + occlusion rate, and (ii) K + causes channel blockage, increases the toxin dissociation rate and impedes the induced channel phosphorylation, implying reduction of the PTX toxic effect

  13. PKC and AMPK regulation of Kv1.5 potassium channels

    DEFF Research Database (Denmark)

    Andersen, Martin Nybo; Skibsbye, Lasse; Tang, Chuyi

    2015-01-01

    The voltage-gated Kv1.5 potassium channel, conducting the ultra-rapid rectifier K(+) current (IKur), is regulated through several pathways. Here we investigate if Kv1.5 surface expression is controlled by the 2 kinases PKC and AMPK, using Xenopus oocytes, MDCK cells and atrial derived HL-1 cells....

  14. Preliminary Evaluation of Potassium Extraction from Bamboo Ash

    Directory of Open Access Journals (Sweden)

    Samadhi Tjokorde W.

    2018-01-01

    Full Text Available Bamboo is a potentially economical fuel crop that has not been utilized at a substantial extent for energy generation in Indonesia. As a thermal conversion waste, bamboo ash is particularly interesting due to its high potassium content. This paper discusses the determination of several key parameters of a simple batchwise extraction process to recover potassium in the form of weak solution from bamboo ash. To produce the ash, black bamboo (Gigantochloa atroviolaceae is charred in a fixed bed combustor. The bamboo char is ground and ashed at 500 °C in an electric furnace. The ash yield is 3.3 %-mass relative to as-received ash, with an ash K2O content of 12.9 %-mass. The ash is ground until passing 100-mesh standard sieve, and extracted by deionized water on a 2-stage laboratory-scale batchwise extractor battery. Process variables include extractror battery configuration (counter-current and co-current, temperature (nominal setting at 45-80 °C, and contact period of 1-6 hours. The concentration of extracted K2O increases asymptotically with temperature and contact time. Counter-current extraction yields more than twice the extract K2O concentration compared to cross-current extraction. The optimum conditions for the counter-current extraction is identified as a temperature of 78 °C and contact time of 4 hours, resulting in a 0.70 %-mass K2O solution concentration. Spot sampling of commercial liquid fertilizer products in Indonesia indicates an equivalent K2O content of 0.08-13.6 %-mass, suggesting the potential of the bamboo ash extract as an intermediate for fertilizer product.

  15. Electrical properties of the potassium polytitanate compacts

    Energy Technology Data Exchange (ETDEWEB)

    Goffman, V.G.; Gorokhovsky, A.V. [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation); Kompan, M.M. [Physico-Technical Institute of the Russian Academy of Science, St. Petersburg (Russian Federation); Tretyachenko, E.V.; Telegina, O.S.; Kovnev, A.V. [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation); Fedorov, F.S., E-mail: fedorov_fs@daad-alumni.de [NanoTechProm Ltd., Saratov (Russian Federation); Saratov State Technical University, Saratov (Russian Federation)

    2014-12-05

    Highlights: • Quasi-static permittivity of potassium polytitanates compacts achieves 10{sup 4}–10{sup 5}. • Observed Maxwell–Wagner polarization attributes to layered structure of polytitanates. • The conductivity varies from 5 × 10{sup −2} to 10{sup −6}–10{sup −7} Sm/m in a wide range of temperatures. - Abstract: Titanates of alkali metals are widely applied materials as they are relatively low in cost and might be easily synthesized. They are utilized as adsorbents, catalysts, solid state electrolytes, superconductors. Here we report our results on electrical properties of the compacted amorphous potassium polytitanates powders. The electrical properties of the compacts were studied by means of complex impedance spectroscopy in a wide range of frequencies at different temperatures using two-electrode configuration. The frequency dependences of conductivity for the investigated potassium polytitanates compacts varies in the range from 5 × 10{sup −2} Sm/m (high frequencies, ion conductivity) up to 10{sup −6}–10{sup −7} Sm/m (low frequencies, electron conductivity) for a wide range of temperatures (19–150 °C). According to the results, at low frequencies quasi-static permittivity of the stabilized PPT compacts achieves high values of 10{sup 4}–10{sup 5}. This might be explained by Maxwell–Wagner polarization attributed to the layered structure of the potassium polytitanates particles containing potassium and hydronium ions together with crystallization water in the interlayer and is very promising for solid state electrolyte applications for moderate temperatures.

  16. Determinants of renal potassium excretion in critically ill patients : The role of insulin therapy

    NARCIS (Netherlands)

    Hoekstra, Miriam; Yeh, Lu; Oude Lansink, Annemieke; Vogelzang, Mathijs; Stegeman, Coen A.; Rodgers, Michael G. G.; van der Horst, Iwan C. C.; Wietasch, Gotz; Zijlstra, Felix; Nijsten, Maarten W. N.

    Objectives: Insulin administration lowers plasma potassium concentration by augmenting intracellular uptake of potassium. The effect of insulin administration on renal potassium excretion is unclear. Some studies suggest that insulin has an antikaliuretic effect although plasma potassium levels were

  17. 21 CFR 181.33 - Sodium nitrate and potassium nitrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium nitrate and potassium nitrate. 181.33...-Sanctioned Food Ingredients § 181.33 Sodium nitrate and potassium nitrate. Sodium nitrate and potassium nitrate are subject to prior sanctions issued by the U.S. Department of Agriculture for use as sources of...

  18. A novel potassium deficiency-induced stimulon in Anabaena torulosa

    Indian Academy of Sciences (India)

    Unknown

    torulosa and of nine proteins in Escherichia coli. These were termed potassium deficiency-induced proteins or. PDPs and constitute hitherto unknown potassium deficiency–induced stimulons. Potassium deficiency also enhanced the synthesis of certain osmotic stress-induced proteins. Addition of K+ repressed the ...

  19. 21 CFR 520.1696d - Penicillin V potassium tablets.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin V potassium tablets. 520.1696d Section... Penicillin V potassium tablets. (a) Specifications. Each tablet contains penicillin V potassium equivalent to 125 milligrams (200,000 units) or 250 milligrams (400,000 units) of penicillin V. (b) Sponsors. See...

  20. Relationship between potassium intake and radiocesium retention in the reindeer

    International Nuclear Information System (INIS)

    Holleman, D.F.; Luick, J.R.

    1975-01-01

    The effect of dietary potassium on radiocesium retention was studied in reindeer fed winter diets of lichens. Potassium added to the diet markedly decreased radiocesium retention; this suggests that seasonal changes in cesium retention observed earlier in reindeer might be caused largely by nutritional factors. Data indicate that a 20-fold increase in dietary potassium results in a 2-fold decrease in radiocesium retention

  1. Electrolytic coloration and spectral properties of hydroxyl-doped potassium chloride single crystals

    International Nuclear Information System (INIS)

    Gu Hongen; Wu Yanru

    2011-01-01

    Hydroxyl-doped potassium chloride single crystals are colored electrolytically at various temperatures and voltages using a pointed cathode and a flat anode. Characteristic OH - spectral band is observed in the absorption spectrum of uncolored single crystal. Characteristic O - , OH - , U, V 2 , V 3 , O 2- -V a + , F, R 2 and M spectral bands are observed simultaneously in absorption spectra of colored single crystals. Current-time curve for electrolytic coloration of hydroxyl-doped potassium chloride single crystal and its relationship with electrolytic coloration process are given. Production and conversion of color centers are explained. - Highlights: → Expanded the traditional electrolysis method. → Hydroxyl-doped potassium chloride crystals were colored electrolytically for the first time. → Useful V, F and F-aggregate color centers were produced in colored crystals. → V color centers were produced directly and F and F-aggregate color centers indirectly.

  2. The effect of serum potassium level on in-hospital and long-term mortality in ST elevation myocardial infarction.

    Science.gov (United States)

    Keskin, Muhammed; Kaya, Adnan; Tatlısu, Mustafa Adem; Hayıroğlu, Mert İlker; Uzman, Osman; Börklü, Edibe Betül; Çinier, Göksel; Çakıllı, Yasin; Yaylak, Barış; Eren, Mehmet

    2016-10-15

    Current studies evaluating the effect of serum potassium levels on mortality in patients with ST elevation myocardial infarction (STEMI) are lacking. We analyzed retrospectively 3760 patients diagnosed with STEMI. Mean serum potassium levels were categorized accordingly: <3.0, 3.0 to <3.5, 3.5 to <4.0, 4.0 to <4.5, 4.5 to <5.0, 5.0 to <5.5, and ≥5.5mEq/L. The lowest mortality was determined in patients with serum potassium level of 4 to <4.5mEq/L whereas mortality was higher in patients with serum potassium levels of ≥5.0 and <3.5mEq/L. In a multivariable Cox-proportional regression analysis, the mortality risk was higher for patients with serum potassium levels of ≥5mEq/L [hazard ratio (HR), 2.11; 95% confidence interval (CI) 1.23-4.74 and HR, 4.20; 95% CI 1.08-8.23, for patients with potassium levels of 5 to <5.5mEq/L and ≥5.5mEq/L, respectively]. In-hospital and long-term mortality risks were also higher for patients with serum potassium levels of ≤3.5mEq/L. Conversely, ventricular arrhythmias were higher only for patients with serum potassium level of ≤3.5mEq/L. Furthermore, a significant relationship was found between the patient with serum potassium levels of ≤3.5mEq/L and ventricular arrhythmias. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

    International Nuclear Information System (INIS)

    Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

    2014-01-01

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

  4. Analysis of bias voltage dependent spectral response in Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)

    2014-02-21

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.

  5. Effect of Potassium Channel Modulators on Morphine Withdrawal in Mice

    Directory of Open Access Journals (Sweden)

    Vikas Seth

    2010-01-01

    Full Text Available The present study was conducted to investigate the effect of potassium channel openers and blockers on morphine withdrawal syndrome. Mice were rendered dependent on morphine by subcutaneous injection of morphine; four hours later, withdrawal was induced by using an opioid antagonist, naloxone. Mice were observed for 30 minutes for the withdrawal signs ie, the characteristic jumping, hyperactivity, urination and diarrhea. ATP-dependent potassium (K + ATP channel modulators were injected intraperitoneally (i.p. 30 minutes before the naloxone. It was found that a K + ATP channel opener, minoxidil (12.5–50 mg/kg i.p., suppressed the morphine withdrawal significantly. On the other hand, the K + ATP channel blocker glibenclamide (12.5–50 mg/kg i.p. caused a significant facilitation of the withdrawal. Glibenclamide was also found to abolish the minoxidil's inhibitory effect on morphine withdrawal. The study concludes that K + ATP channels play an important role in the genesis of morphine withdrawal and K + ATP channel openers could be useful in the management of opioid withdrawal. As morphine opens K + ATP channels in neurons, the channel openers possibly act by mimicking the effects of morphine on neuronal K + currents.

  6. Scanning Tunneling Spectroscopy of Potassium on Graphene

    Science.gov (United States)

    Cormode, Daniel; Leroy, Brian; Yankowitz, Matthew

    2012-02-01

    We investigate the effect of charged impurities on the electronic properties of large single crystal CVD grown graphene using scanning tunneling microscopy. Mono- and multilayer crystals were prepared by transferring graphene from copper onto exfoliated boron nitride flakes on 300 nm SiO2 substrates. The boron nitride provides an ultra flat surface for the graphene. Potassium atoms are controllably deposited on the graphene at low temperature by heating a nearby getter source. Scanning tunneling spectroscopy and transport measurements were performed in ultra high vacuum at 4.5 K. Transport measurements demonstrate the shifting of the Dirac point as the samples are doped, while STM measurements demonstrate the size, arrangement and local electronic influence of the potassium atoms.

  7. Potassium tetracyanidoaurate(III monohydrate: a redetermination

    Directory of Open Access Journals (Sweden)

    Nobuyuki Matsushita

    2017-03-01

    Full Text Available The structure of the title metal complex salt, K[Au(CN4]·H2O, has been redetermined using X-ray diffraction data at 173 K in order to improve the precision. The previous determination was based on neutron diffraction data [Bertinotti & Bertinotti (1970. Acta Cryst. B26, 422–428]. The title compound crystallizes in the space group P212121 with one potassium cation, one [Au(CN4]− anion and one water molecule in the asymmetric unit. The AuIII atom lies on a general position and has an almost square-planar coordination sphere defined by four cyanide ligands. Interactions between the potassium cation and N atoms of the complex anion, as well as O—H...N hydrogen bonds, lead to the formation of a three-dimensional framework structure.

  8. Behaviour of potassium hexabromoruthenate (4) in solutions

    International Nuclear Information System (INIS)

    Rudnitskaya, O.V.; Miroshnichenko, I.V.; Pichkov, V.N.

    1989-01-01

    Behaviour of potassium hexabromoruthenate in HBr, H 2 O-acetone, dimethylformamide, dimetnylsulfoxide (DMSO) solutions is investigated by means of absorption and ESR specroscopy. Complex is shown to be labile, interacts easily with solvents forming ruthenium complexes in more low oxidation degrees. Hexabromoruthenate-ion is formed in concentrated HBr, while in DMSO the formation of ruthenium (3) and (2) bromide-dimethylsulfoxide complexes occurs gradually, final product is trans-[Ru(DMSO) 4 Br 2

  9. Potassium sensing histidine kinase in Bacillus subtilis.

    Science.gov (United States)

    López, Daniel; Gontang, Erin A; Kolter, Roberto

    2010-01-01

    The soil-dwelling organism Bacillus subtilis is able to form multicellular aggregates known as biofilms. It was recently reported that the process of biofilm formation is activated in response to the presence of various, structurally diverse small-molecule natural products. All of these small-molecule natural products made pores in the membrane of the bacterium, causing the leakage of potassium cations from the cytoplasm of the cell. The potassium cation leakage was sensed by the membrane histidine kinase KinC, triggering the genetic pathway to the production of the extracellular matrix that holds cells within the biofilm. This chapter presents the methodology used to characterize the leakage of cytoplasmic potassium as the signal that induces biofilm formation in B. subtilis via activation of KinC. Development of novel techniques to monitor activation of gene expression in microbial populations led us to discover the differentiation of a subpopulation of cells specialized to produce the matrix that holds all cells together within the biofilm. This phenomenon of cell differentiation was previously missed by conventional techniques used to monitor transcriptional gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. Potassium iodide capsule treatment of feline sporotrichosis.

    Science.gov (United States)

    Reis, Erica G; Gremião, Isabella D F; Kitada, Amanda A B; Rocha, Raphael F D B; Castro, Verônica S P; Barros, Mônica B L; Menezes, Rodrigo C; Pereira, Sandro A; Schubach, Tânia M P

    2012-06-01

    Sporotrichosis is a mycosis caused by Sporothrix schenckii. The most affected animal is the cat; it has played an important role in the zoonotic transmission of this disease, especially in Rio de Janeiro, Brazil, since 1998. In order to evaluate the treatment of feline sporotrichosis with potassium iodide, an observational cohort was conducted in 48 cats with sporotrichosis at Instituto de Pesquisa Clínica Evandro Chagas, Fiocruz. All cats received potassium iodide capsules, 2.5 mg/kg to 20 mg/kg q24h. The cure rate was 47.9%, treatment failure was 37.5%, treatment abandonment was 10.4% and death was 4.2%. Clinical adverse effects were observed in 52.1% of the cases. Thirteen cats had a mild increase in hepatic transaminase levels during the treatment, six of them presented clinical signs suggestive of hepatotoxicity. Compared to previous studies with itraconazole and iodide in saturated solution, potassium iodide capsules are an alternative for feline sporotrichosis treatment.

  11. Potassium Permanganate Poisoning: A Nonfatal Outcome

    Directory of Open Access Journals (Sweden)

    Suzan M. Eteiwi

    2015-07-01

    Full Text Available Acute poisoning by potassium permanganate is a rare condition with high morbidity and mortality. Diagnosis of the condition relies on a history of exposure or ingestion and a high degree of clinical suspicion. Oxygen desaturation and the presence of methemoglobin are also helpful indicators. Since no specific antidote is available, treatment is mainly supportive. Few cases have been reported in the literature following potassium permanganate ingestion, whether intentional or accidental, and most of the patients in these cases had unfavorable outcomes, which was not the case in our patient. Our patient, a 73-year-old male, purchased potassium permanganate over the counter mistaking it for magnesium salt, which he frequently used as a laxative. Several hours after he ingested it, he was admitted to the endocrine department at King Hussein Medical Center, Jordan, with acute rapidly evolving shortness of breath. During hospitalization, his liver function tests deteriorated. Since he was diagnosed early and managed promptly he had a favorable outcome.

  12. A novel potassium channel in photosynthetic cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Manuela Zanetti

    Full Text Available Elucidation of the structure-function relationship of a small number of prokaryotic ion channels characterized so far greatly contributed to our knowledge on basic mechanisms of ion conduction. We identified a new potassium channel (SynK in the genome of the cyanobacterium Synechocystis sp. PCC6803, a photosynthetic model organism. SynK, when expressed in a K(+-uptake-system deficient E. coli strain, was able to recover growth of these organisms. The protein functions as a potassium selective ion channel when expressed in Chinese hamster ovary cells. The location of SynK in cyanobacteria in both thylakoid and plasmamembranes was revealed by immunogold electron microscopy and Western blotting of isolated membrane fractions. SynK seems to be conserved during evolution, giving rise to a TPK (two-pore K(+ channel family member which is shown here to be located in the thylakoid membrane of Arabidopsis. Our work characterizes a novel cyanobacterial potassium channel and indicates the molecular nature of the first higher plant thylakoid cation channel, opening the way to functional studies.

  13. Cesium immobilization into potassium magnesium phosphate matrix

    International Nuclear Information System (INIS)

    Sayenko, S.Y.; Shkuropatenko, V.A.; Bereznyak, O.P.; Hodyreva, Y.S.; Tarasov, R.V.; Virych, V.D.; Ulybkina, E.A.; Pylypenko, O.V.; Kholomeev, G.O.; Zykova, A.V.; Wagh, Arun S.

    2017-01-01

    The possibility of isomorphous substitution of potassium ions by cesium ions in the structure of potassium magnesium phosphate KMgPO 4 centred dot 6H 2 O (PMP) was shown. It was established, that the Cs included into the PMP matrix does not transfer to the environment during high temperatures heating process (1176 deg C, 3 hours). Analysis of the IR absorption spectrum of the PMP sample has demonstrated that an increase in the amount of additive of the cesium chloride resulted in the shift of the main bands in the spectrum to the low-frequency region with average shift value 10 cm -1 , which indicates the strengthening of bonds in the crystal lattice of matter. The calculated degree of substitution of potassium by cesium during energy release process in the PMP matrix at the level of vitrified high level wastes is about 4%, i. e. the PMP matrix should correspond to the formula K 0.96 Cs 0.04 MgPO 4 centred dot 6H 2 O.

  14. Race, Serum Potassium, and Associations With ESRD and Mortality.

    Science.gov (United States)

    Chen, Yan; Sang, Yingying; Ballew, Shoshana H; Tin, Adrienne; Chang, Alex R; Matsushita, Kunihiro; Coresh, Josef; Kalantar-Zadeh, Kamyar; Molnar, Miklos Z; Grams, Morgan E

    2017-08-01

    Recent studies suggest that potassium levels may differ by race. The basis for these differences and whether associations between potassium levels and adverse outcomes differ by race are unknown. Observational study. Associations between race and potassium level and the interaction of race and potassium level with outcomes were investigated in the Racial and Cardiovascular Risk Anomalies in Chronic Kidney Disease (RCAV) Study, a cohort of US veterans (N=2,662,462). Associations between African ancestry and potassium level were investigated in African Americans in the Atherosclerosis Risk in Communities (ARIC) Study (N=3,450). Race (African American vs non-African American and percent African ancestry) for cross-sectional analysis; serum potassium level for longitudinal analysis. Potassium level for cross-sectional analysis; mortality and end-stage renal disease for longitudinal analysis. The RCAV cohort was 18% African American (N=470,985). Potassium levels on average were 0.162mmol/L lower in African Americans compared with non-African Americans, with differences persisting after adjustment for demographics, comorbid conditions, and potassium-altering medication use. In the ARIC Study, higher African ancestry was related to lower potassium levels (-0.027mmol/L per each 10% African ancestry). In both race groups, higher and lower potassium levels were associated with mortality. Compared to potassium level of 4.2mmol/L, mortality risk associated with lower potassium levels was lower in African Americans versus non-African Americans, whereas mortality risk associated with higher levels was slightly greater. Risk relationships between potassium and end-stage renal disease were weaker, with no difference by race. No data for potassium intake. African Americans had slightly lower serum potassium levels than non-African Americans. Consistent associations between potassium levels and percent African ancestry may suggest a genetic component to these differences. Higher and

  15. Proapoptotic Role of Potassium Ions in Liver Cells

    Directory of Open Access Journals (Sweden)

    Zhenglin Xia

    2016-01-01

    Full Text Available Potassium channels are transmembrane proteins that selectively promote the infiltration of potassium ions. The significance of these channels for tumor biology has become obvious. However, the effects of potassium ions on the tumor or normal cells have seldom been studied. To address this problem, we studied the biological effects of L02 and HepG2 cells with ectogenous potassium ions. Cell proliferation, cell cycle, and apoptosis rate were analyzed. Our results indicated that potassium ions inhibited proliferation of L02 and HepG2 cells and promoted their apoptosis. Potassium ions induced apoptosis through regulating Bcl-2 family members and depolarized the mitochondrial membrane, especially for HepG2 cell. These biological effects were associated with channel protein HERG. By facilitating expression of channel protein HERG, potassium ions may prevent it from being shunted to procancerous pathways by inducing apoptosis. These results demonstrated that potassium ions may be a key regulator of liver cell function. Thus, our findings suggest that potassium ions could inhibit tumorigenesis through inducing apoptosis of hepatoma cells by upregulating potassium ions transport channel proteins HERG and VDAC1.

  16. Molecular Basis of Cardiac Delayed Rectifier Potassium Channel Function and Pharmacology.

    Science.gov (United States)

    Wu, Wei; Sanguinetti, Michael C

    2016-06-01

    Human cardiomyocytes express 3 distinct types of delayed rectifier potassium channels. Human ether-a-go-go-related gene (hERG) channels conduct the rapidly activating current IKr; KCNQ1/KCNE1 channels conduct the slowly activating current IKs; and Kv1.5 channels conduct an ultrarapid activating current IKur. Here the authors provide a general overview of the mechanistic and structural basis of ion selectivity, gating, and pharmacology of the 3 types of cardiac delayed rectifier potassium ion channels. Most blockers bind to S6 residues that line the central cavity of the channel, whereas activators interact with the channel at 4 symmetric binding sites outside the cavity. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Drug utilization review of potassium chloride injection formulations available in a private hospital in kuching, sarawak, malaysia.

    Science.gov (United States)

    Melissa, Mohammad Hirman; Azmi, Sarriff

    2013-07-01

    The concentrated potassium chloride injection is a high-alert medication and replacing it with a pre-mixed formulation can reduce the risks associated with its use. The aim of this study was to determine the clinical characteristics of patients receiving different potassium chloride formulations available at a private institution. The study also assessed the effectiveness and safety of pre-mixed formulations in the correction of hypokalaemia. This was a retrospective observational study consisting of 296 cases using concentrated and pre-mixed potassium chloride injections in 2011 in a private hospital in Kuching, Sarawak, Malaysia. There were 135 (45.6%) cases that received concentrated potassium chloride, and 161 (54.4%) cases that received pre-mixed formulations. The patients' clinical characteristics that were significantly related to the utilization of the different formulations were diagnosis (P < 0.001), potassium serum blood concentration (P < 0.05), and fluid overload risk (P < 0.05). The difference observed for the cases that achieved or maintained normokalaemia was statistically insignificant (P = 0.172). Infusion-related adverse effects were seen more in pre-mixes compared to concentrated formulations (6.8% versus 2.2%, P < 0.05). This study provides insight into the utilization of potassium chloride injections at this specific institution. The results support current recommendations to use pre-mixed formulations whenever possible.

  18. Adaptation of Bacillus subtilis to Life at Extreme Potassium Limitation.

    Science.gov (United States)

    Gundlach, Jan; Herzberg, Christina; Hertel, Dietrich; Thürmer, Andrea; Daniel, Rolf; Link, Hannes; Stülke, Jörg

    2017-07-05

    Potassium is the most abundant metal ion in every living cell. This ion is essential due to its requirement for the activity of the ribosome and many enzymes but also because of its role in buffering the negative charge of nucleic acids. As the external concentrations of potassium are usually low, efficient uptake and intracellular enrichment of the ion is necessary. The Gram-positive bacterium Bacillus subtilis possesses three transporters for potassium, KtrAB, KtrCD, and the recently discovered KimA. In the absence of the high-affinity transporters KtrAB and KimA, the bacteria were unable to grow at low potassium concentrations. However, we observed the appearance of suppressor mutants that were able to overcome the potassium limitation. All these suppressor mutations affected amino acid metabolism, particularly arginine biosynthesis. In the mutants, the intracellular levels of ornithine, citrulline, and arginine were strongly increased, suggesting that these amino acids can partially substitute for potassium. This was confirmed by the observation that the supplementation with positively charged amino acids allows growth of B. subtilis even at the extreme potassium limitation that the bacteria experience if no potassium is added to the medium. In addition, a second class of suppressor mutations allowed growth at extreme potassium limitation. These mutations result in increased expression of KtrAB, the potassium transporter with the highest affinity and therefore allow the acquisition and accumulation of the smallest amounts of potassium ions from the environment. IMPORTANCE Potassium is essential for every living cell as it is required for the activity for many enzymes and for maintaining the intracellular pH by buffering the negative charge of the nucleic acids. We have studied the adaptation of the soil bacterium Bacillus subtilis to life at low potassium concentrations. If the major high-affinity transporters are missing, the bacteria are unable to grow

  19. Possible potassium chlorate nephrotoxicity associated with chronic matchstick ingestion*

    OpenAIRE

    Thurlow, John S.; Little, Dustin J.; Baker, Thomas P.; Yuan, Christina M.

    2013-01-01

    We present a case of a 48-year-old active duty male soldier with a history of chronic exposure to potassium chlorate, later diagnosed with chronic interstitial nephritis. He reported regular matchstick consumption to prevent chigger (Trombicula autumnalis) bites, amounting to ?5.8 g of potassium chlorate over 3 years. Potassium chlorate can cause anuric renal failure within days of a toxic dose. Its slow excretion and mechanism of action suggest that renal toxicity may result from lower-dose ...

  20. Hydrogen and helium adsorption on potassium

    International Nuclear Information System (INIS)

    Garcia, R.; Mulders, N.; Hess, G.

    1995-01-01

    A previous quartz microbalance study of adsorption of helium on sodium indicates that the inert layer is surprisingly small. Similar experiments with hydrogen on sodium show layer by layer growth below a temperature of 7K. These results motivated the authors to extend the experiments to lower temperatures. A suitable apparatus, capable of reaching 0.45 K, while still enabling them to do in situ alkali evaporation, has been constructed. The authors will report on the results of microbalance adsorption experiments of helium and hydrogen on potassium

  1. Sound velocity in potassium hydroxide aqueous solution

    International Nuclear Information System (INIS)

    Tsapuryan, Kh.D.; Aleksandrov, A.A.; Kochetkov, A.I.

    1992-01-01

    Measurements of ultrasonic velocities in potassium hydroxide aqueous solutions are carried out within the frames of studies on improvement of water chemistry in NPP cooling systems. Method of echo pulses superposition with acoustic path length of 41.447 mm is used for measurements. The measurements are performed at 2.6 MHz frequency. Complex temperature dependence of ultrasonic velocity is determined. Ultrasonic velocity dependence on pressure is close to linear one. The formula for calculation of thermodynamic properties of the studied solutions on the basis of experimental data obtained is proposed

  2. Natural potassium as a teaching material

    International Nuclear Information System (INIS)

    Akatsu, Eiko

    1993-07-01

    An experience of an educational experiment is presented with results and discussion. It was performed in the introductory course of nuclear energy in the Nuclear Education Center of Japan Atomic Energy Research Institute. Purpose of the experiment is understanding disintegration rate (Bq, radioactivity or λN) through measurement of low radioactivity of natural potassium. It was accomplished through calculation of the radioactivity of a measuring known sample and counting efficiency during measurement. The students in the training course had great variety and most students did not have preliminary knowledge. But they said in the questionnaire having almost understood the experiment; and some students enjoyed it. (author)

  3. Poisoning of vanadia based SCR catalysts by potassium:influence of catalyst composition and potassium mobility

    DEFF Research Database (Denmark)

    Olsen, Brian Kjærgaard; Kügler, Frauke; Jensen, Anker Degn

    2016-01-01

    exposure temperatures slowdown the deactivation. K2SO4 causes a lower rate of deactivation compared to KCl. This may be related to a faster transfer of potassium from the solid KCl matrix to the catalyst, however, it cannot be ruled out toalso be caused by a significantly larger particle size of the K2SO4...

  4. Possible potassium chlorate nephrotoxicity associated with chronic matchstick ingestion.

    Science.gov (United States)

    Thurlow, John S; Little, Dustin J; Baker, Thomas P; Yuan, Christina M

    2013-06-01

    We present a case of a 48-year-old active duty male soldier with a history of chronic exposure to potassium chlorate, later diagnosed with chronic interstitial nephritis. He reported regular matchstick consumption to prevent chigger (Trombicula autumnalis) bites, amounting to ∼5.8 g of potassium chlorate over 3 years. Potassium chlorate can cause anuric renal failure within days of a toxic dose. Its slow excretion and mechanism of action suggest that renal toxicity may result from lower-dose chronic exposure. This case represents possible sequelae of chronic potassium chlorate ingestion.

  5. Possible potassium chlorate nephrotoxicity associated with chronic matchstick ingestion*

    Science.gov (United States)

    Thurlow, John S.; Little, Dustin J.; Baker, Thomas P.; Yuan, Christina M.

    2013-01-01

    We present a case of a 48-year-old active duty male soldier with a history of chronic exposure to potassium chlorate, later diagnosed with chronic interstitial nephritis. He reported regular matchstick consumption to prevent chigger (Trombicula autumnalis) bites, amounting to ∼5.8 g of potassium chlorate over 3 years. Potassium chlorate can cause anuric renal failure within days of a toxic dose. Its slow excretion and mechanism of action suggest that renal toxicity may result from lower-dose chronic exposure. This case represents possible sequelae of chronic potassium chlorate ingestion. PMID:26064493

  6. Regulation of extrarenal potassium homeostasis by adrenal hormones in rats.

    Science.gov (United States)

    Bia, M J; Tyler, K A; DeFronzo, R A

    1982-06-01

    The effect of chronic (7-10 days) adrenal insufficiency on extrarenal potassium tolerance was examined by infusing potassium into rats after acute nephrectomy. The increment in plasma potassium concentration was significantly higher in glucocorticoid-replaced adrenalectomized rats versus controls (max delta PK 3.59 +/-0.11 vs. 2.93 +/- 0.08 meq/liter; P less than 0.001). The impairment in extrarenal potassium tolerance in adrenalectomized rats could not be attributed to acidemia, hypotension, changes in plasma insulin or glucose concentration, or potassium retention prior to study. Acute replacement with aldosterone resulted in significant improvement in the rise in plasma potassium after KCl (max delta PK 3.18 +/- 0.06 meq/liter; P less than 0.005 compared with aldosterone-deficient adrenalectomized rats but higher than in controls, P less than 0.02). If given on a chronic basis, aldosterone replacement led to a complete correction of the defect (max delta PK = 2.89 +/- 0.08 meq/liter). Acute epinephrine replacement in adrenalectomized rats also returned potassium tolerance to normal (max delta PK = 3.02 +/- 0.10 meq/liter). The results demonstrate that extrarenal potassium tolerance is impaired in chronic adrenal insufficiency and suggest that both aldosterone and epinephrine deficiency may contribute to the defect, since replacement with either hormone returns potassium tolerance toward normal. Accordingly, both aldosterone and epinephrine have important extrarenal mechanisms of action.

  7. Potassium Chloride Versus Voltage Clamp Contractures in Ventricular Muscle

    Science.gov (United States)

    Morad, M.; Reeck, S.; Rao, M.

    1981-01-01

    In frog ventricle, developed tension was markedly larger in response to depolarization caused by a voltage clamp step than to depolarization induced by high concentrations of potassium chloride. Measurement of extracellular potassium activity at the surface and at the depth of muscle during the development of contractures showed that the diffusion of potassium is much slower than the spread of depolarization through the cross section of muscle. These two observations suggest that competition between the depolarizing and the negative inotropic effects of an increase in the extracellular potassium ion concentration may determine the time course and magnitude of contractile tension in heart muscle.

  8. Role of hemolysis in potassium release by iodinated contrast medium

    Energy Technology Data Exchange (ETDEWEB)

    Hayakawa, K.; Nakamura, T.; Shimizu, Y. [Department of Radiology, Kyoto City Hospital (Japan)

    1999-09-01

    It has been demonstrated that an iodinated contrast medium (CM) causes release of potassium into blood vessel lumina, resulting in an increase in serum potassium. The purpose of the present study was to assess whether this potassium release is due to hemolysis. Fresh human blood was mixed in vitro with CM at a ratio of 10:2. Potassium release rates were determined, and serum haptoglobin and free hemoglobin were measured after 30 min of exposure to CM. To compare the potassium release curve between CM exposure and true hemolysis induced by distilled water, fresh human blood was also mixed with distilled water. The level of serum haptoglobin decreased due to hemodilution. Changes in haptoglobin were not correlated with potassium release rates. The serum free hemoglobin level did not increase significantly, and there was no correlation between changes in the free hemoglobin level and the rate of potassium release. Hemolysis caused by water occurred instantaneously, whereas potassium release caused by CM was a slow response, which was linearly correlated with exposure time. Potassium release from blood cannot be explained by hemolysis. (orig.) With 4 figs., 4 tabs., 3 refs.

  9. Brand to brand variation in the disintegrant functionality of Polacrilin Potassium, NF

    Directory of Open Access Journals (Sweden)

    Mrudula H. Bele

    2011-09-01

    Full Text Available The current monograph for Polacrilin Potassium, NF does not specify tests that could assist in distinguishing between different brands of this disintegrant. The objective of this work was to examine the physical characteristics of four brands of Polacrilin Potassium, NF and relate the observed differences to differences in their functionality. Significant differences were observed in the particle size, true density, porosity, surface area and morphology of the samples. Functionality tests, such as settling volume, intrinsic swelling, rate and extent of water uptake were carried out. Significant differences were observed in intrinsic swelling and the initial rate of water uptake. The disintegration times of the tablets were found to be a function of the initial rate of water uptake. Since the disintegration times were shown to be significantly different despite negligible differences in settling volumes, wicking and water uptake, as opposed to the magnitude of swelling, appear to be the major mechanisms that distinguish disintegration performance between different brands of Polacrilin Potassium, NF when incorporated into insoluble tablet matrices. Thus, the measurement of the rate of water uptake may be a useful functionality test for Polacrilin Potassium in particular, and for ion exchange resin type disintegrants in general.

  10. Acid-permanganate oxidation of potassium tetraphenylboron

    International Nuclear Information System (INIS)

    Smith, J.R.

    1993-02-01

    Scoping experiments have been performed which show that potassium tetraphenylboron (KTPB) is rapidly oxidized by permanganate in acidic solutions at room temperature. The main Products are CO 2 , highly oxidized organic compounds related to tartaric and tartronic acids, boric acid, and potassium phosphate (when phosphoric acid is used as the source of acid). One liter of 0.6M NaMnO 4 /2.5M H 3 PO 4 solution will destroy up to 8 grams of KTPB. The residual benzene concentration has been measured to be less than the RCRA limit of 0.5 ppm. Approximately 30% of the organic material is released as CO 2 (trace CO) and 0.16% as benzene vapor. The reaction is well behaved, no foaming or spattering. Tests were performed from .15M to near 1M permanganate. The phosphoric acid concentration was maintained at a concentration at least three times that of the permanganate since an excess of acid was desired and this is the ratio that these two reagents are consumed in the oxidation

  11. Potassium nutrition on lychee (Litchi chinensis Sonn

    Directory of Open Access Journals (Sweden)

    Aburto-González, C.A

    2016-01-01

    Full Text Available The lychee (Litchi chinensis Sonn is a potential alternative crop for areas with subtropical climate. In Mexico, cv. ‘Brewster’ dominates 98 % in terms of established surface; however, it has many problems to maintain stable production through its production cycles. Worldwide, yield per hectare ranges from 1 to 15 t. In Mexico, yields also fluctuate in that range. Researches who have worked with it agree that much of the problem that leads to low yields is the lack of a proper nutrition program. All existing information regarding the fertilization of this crop has been generated in other countries, mainly India, USA and Australia. Its need for K+ is higher compared to N and P. Since K+ is a nutrient that has an impact on yield and fruit quality, this paper review focuses on studies that have been done on potassium nutrition on lychee and concludes that more research is needed to take correct decision about the amount and time for potassium application.

  12. Clofilium inhibits Slick and Slack potassium channels.

    Science.gov (United States)

    de Los Angeles Tejada, Maria; Stolpe, Kathleen; Meinild, Anne-Kristine; Klaerke, Dan A

    2012-01-01

    Slick and Slack high-conductance potassium channels have been recently discovered, and are found in the central nervous system and in the heart. Both channels are activated by Na(+) and Cl(-), and Slick channels are also inhibited by adenosine triphospate (ATP). An important role of setting the resting membrane potential and controlling the basal excitability of neurons has been suggested for these channels. In addition, no specific blockers for these channels are known up to the present. With the purpose of studying the pharmacological characteristics of Slick and Slack channels, the effects of exposure to the antiarrhythmic compound clofilium were evaluated. Clofilium was able to modulate the activity of Slick and Slack channels effectively, with a stronger effect on Slack than Slick channels. In order to evaluate the pharmacological behavior of Slick and Slack channels further, 38 commonly used potassium channel blockers were tested. Screening of these compounds did not reveal any modulators of Slick and Slack channels, except for clofilium. The present study provides a first approach towards elucidating the pharmacological characteristics of Slick and Slack channels and could be the basis for future studies aimed at developing potent and specific blockers and activators for these channels.

  13. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  14. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  15. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  16. Fault current limiter using bulk oxides superconductors

    International Nuclear Information System (INIS)

    Belmont, O.; Ferracci, P.; Porcar, L.; Barbut, J.M.; Tixador, P.; Noudem, J.G.; Bourgault, D.; Tournier, R.

    1998-01-01

    We study the limitation possibilities of bulk Bi high T c materials. For this we test these materials with AC or DC currents above their critical currents. We study particularly the evolution of the voltage with time or with current. The material, the value of the current and the time duration play important parts. For sintered Bi samples the voltage depends only on the current even for values much larger than the critical current. With textured samples the V(I) curves shows an hysteretic behaviour due to a warming up. The textured materials are more interesting than sintered ones in terms of required volume for the current limitation. In both cases the superconductors are in a dissipative state but not in the normal state. This state is nevertheless reached if the dissipated energy inside the sample is sufficient. We have tried to apply a magnetic field on the samples in order to trigger a more effective limitation. The voltage increases but with a limited effect for currents much higher (3-4 times) than the critical zero field current. We think that the dissipative state is due mainly to the grain boundaries which become resistive above the critical current. (orig.)

  17. Impulse-Excited Energy Harvester based on Potassium-Ion- Electret

    Science.gov (United States)

    Ashizawa, H.; Mitsuya, H.; Ishibashi, K.; Ishikawa, T.; Fujita, H.; Hashiguchi, G.; Toshiyoshi, H.

    2015-12-01

    We have developed an energy harvester that is specifically desired for impulse acceleration of infrastructure vibrations such as sudden motion at railway bridges. The energy harvester based on potassium-ion-electret on the sidewalls of 1.8- μm-gap comb electrodes generated a 64 μAp-p current during low impulse acceleration, which was large enough to light a green LED.

  18. Specific residues of the cytoplasmic domains of cardiac inward rectifier potassium channels are effective antifibrillatory targets

    Science.gov (United States)

    Noujaim, Sami F.; Stuckey, Jeanne A.; Ponce-Balbuena, Daniela; Ferrer-Villada, Tania; López-Izquierdo, Angelica; Pandit, Sandeep; Calvo, Conrado J.; Grzeda, Krzysztof R.; Berenfeld, Omer; Sánchez Chapula, José A.; Jalife, José

    2010-01-01

    Atrial and ventricular tachyarrhythmias can be perpetuated by up-regulation of inward rectifier potassium channels. Thus, it may be beneficial to block inward rectifier channels under conditions in which their function becomes arrhythmogenic (e.g., inherited gain-of-function mutation channelopathies, ischemia, and chronic and vagally mediated atrial fibrillation). We hypothesize that the antimalarial quinoline chloroquine exerts potent antiarrhythmic effects by interacting with the cytoplasmic domains of Kir2.1 (IK1), Kir3.1 (IKACh), or Kir6.2 (IKATP) and reducing inward rectifier potassium currents. In isolated hearts of three different mammalian species, intracoronary chloroquine perfusion reduced fibrillatory frequency (atrial or ventricular), and effectively terminated the arrhythmia with resumption of sinus rhythm. In patch-clamp experiments chloroquine blocked IK1, IKACh, and IKATP. Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question. These results open a novel path toward discovering antiarrhythmic pharmacophores that target specific residues of the cytoplasmic domain of inward rectifier potassium channels.—Noujaim, S. F., Stuckey, J. A., Ponce-Balbuena, D., Ferrer-Villada, T., López-Izquierdo, A., Pandit, S., Calvo, C. J., Grzeda, K. R., Berenfeld, O., Sánchez Chapula, J. A., Jalife, J. Specific residues of the cytoplasmic domains of cardiac inward rectifier potassium channels are effective antifibrillatory targets. PMID:20585026

  19. Sodium and potassium concentrations in floral nectars in relation to ...

    African Journals Online (AJOL)

    Sodium and potassium concentrations have been measured in nectar from a variety of flowering plants visited by honey bees (Apis mellifera capensis). In 18 plant species the mean sodium concentration was 9,8 ± 1,4 mmol (± S.E.), and the mean potassium concentration was 18,7 ± 4,3 mmol. These results are compared ...

  20. 75 FR 63856 - Potassium Permanganate From China Determination

    Science.gov (United States)

    2010-10-18

    ... Permanganate From China Determination On the basis of the record \\1\\ developed in the subject five-year review... potassium permanganate from China would be likely to lead to continuation or recurrence of material injury... Commission are contained in USITC Publication 4183 (September 2010), entitled Potassium Permanganate from...

  1. Potassium cycling and losses in grassland systems : a review

    NARCIS (Netherlands)

    Kayser, M; Isselstein, J

    Cycling of potassium in grassland systems has received relatively little attention in research and practice in recent years. Balanced nutrient systems require consideration of nutrients other than nitrogen (N). Potassium (K) is needed in large amounts and is closely related to N nutrition. In

  2. Potassium bromate content of some baked breads sold in Kano ...

    African Journals Online (AJOL)

    Background: Potassium bromate is an additive used by some bakers to make the bread rise rapidly, create a good texture in the finished product and to give bulkiness to the dough. Objective: The main objective of this work was to assess the potassium bromate residues of some baked breads sold in some selected local ...

  3. Potassium vanadate K0.23V2O5 as anode materials for lithium-ion and potassium-ion batteries

    Science.gov (United States)

    Liu, Cailing; Luo, Shaohua; Huang, Hongbo; Wang, Zhiyuan; Wang, Qing; Zhang, Yahui; Liu, Yanguo; Zhai, Yuchun; Wang, Zhaowen

    2018-06-01

    A layered potassium vanadate K0.23V2O5 has been successfully prepared by the hydrothermal method and evaluated as an anode material for lithium-ion and potassium-ion batteries. High structural stability is demonstrated by the ex situ X-ray diffraction (XRD) and ex situ scanning electron microscopy (SEM). When used as an anode material for lithium-ion batteries, the K0.23V2O5 exhibits a reversible capacity of 480.4 mAh g-1 at 20 mA g-1 after 100 cycles and 439.7 mAh g-1 at 200 mA g-1 after 300 cycles as well as good cycling stability. Even at a high current density of 800 mA g-1, a high reversible capacity of 202.5 mAh g-1 can be retained, indicating excellent rate performance. Whereas in potassium-ion batteries, it retains a capacity of 121.6 mAh g-1 after 150 cycles at 20 mA g-1 and 97.6 mAh g-1 at 100 mA g-1 after 100 cycles. Such superior electrochemical performance of K0.23V2O5 can be ascribed to the special flower-like morphology and structure. Overall, the results highlight the great potential of K0.23V2O5 as an anode material for both lithium-ion and potassium-ion batteries.

  4. Potassium sorbate-A new aqueous copper corrosion inhibitor

    International Nuclear Information System (INIS)

    Abelev, Esta; Starosvetsky, David; Ein-Eli, Yair

    2007-01-01

    This work presents the novel nature of 2,4-hexadienoic acid potassium salt (potassium sorbate (KCH 3 CH=CHCH=CHCO 2 )) as an effective copper aqueous corrosion inhibitor. The influence of pH and potassium sorbate concentration on copper corrosion in aerated sulfate and chloride solutions is reported. Degree of copper protection was found to increase with an increase in potassium sorbate concentration; an optimum concentration of this inhibitor in sulfate solutions was found to be 10 g/L. Copper is highly resistant to corrosion attacks by chloride ions in the presence of potassium sorbate. X-ray photoelectron spectroscopy (XPS) studies suggest that copper protection is achieved via the formation of a mixed layer of cuprous oxide, cupric hydroxide and copper(II)-sorbate at the metal surface

  5. Burning characteristics of potassium and lithium

    International Nuclear Information System (INIS)

    Sonntag, K.; Menzenhauer, P.; Peppler, W.

    1982-03-01

    A series of laboratory scale tests has been carried out in which lithium and potassium were burnt in trays in atmospheres of air and nitrogen. The test results are compared with those from literature. The maximum weight of metal in a test was 200 gram. The tests were carried out in a glove box which allowed the atomospheric composition to be varied to some extent. The initial temperature was varied to determine its effect on the course of the reaction. The temperature and the composition of the atmosphere were recorded during the tests. After each test the reaction products were weighed and chemically analysed. A good insight into the course of the reaction was obtained from the results. The main phases of the reaction are illustrated by a series of photographs. (orig.) [de

  6. Electron impact study of potassium hydroxide

    Science.gov (United States)

    Vuskovic, L.; Trajmar, S.

    1979-01-01

    An attempt is made to measure the sum of the elastic, rotational and vibrational scattering of electrons by KOH at low impact energies (5 to 20 eV) at angles from 10 to 120 deg. Energy loss spectra taken in the 0 to 18 eV range using an electron impact spectrometer are used to identify the species contributing to electric scattering. At temperatures between 300 and 500 C, only inelastic spectral features belonging to water are detected, while at temperatures from 500 to 800 C strong atomic K lines, indicative of molecular dissociation, and H2 energy loss features become prominent. No features attributable to KOH, the KOH dimer, O2 or potassium oxides were observed, due to the effects of the dissociation products, and it is concluded that another technique will have to be developed in order to measure electron scattering by KOH.

  7. Potassium-argon dating in archaeology

    Energy Technology Data Exchange (ETDEWEB)

    McDougall, I. (Australian National Univ., Canberra (Australia). Research School of Earth Sciences)

    1990-01-01

    The potassium-argon (K-Ar) isotopic dating method can provide precise and accurate numerical ages on suitable rocks, especially igneous rocks, over a wide range of age from less than 100,000 years old, with no older limit. Together with its variants, the {sup 40}Ar/{sup 39}Ar technique, the K-Ar method is very useful for the numerical age calibration of stratigraphic sequences, including those containing archaeological or fossil material, in cases where appropriate rocks for dating are present. This brief review of the basis of the K-Ar dating method and the underlying assumptions, concludes with an example of its application to the Plio-Pleistocene stratigraphic sequence in the Turkana Basin, northern Kenya. By dating alkali feldspars separated from pumice blocks in tuffaceous beds, excellent age control has been obtained for the wealth of vertebrate fossils, including hominids, as well as archaeological materials that has been found in the sequence. (author).

  8. Electron coincidence spectroscopy of sodium and potassium

    International Nuclear Information System (INIS)

    Frost, L.; Weigold, E.

    1982-03-01

    The Na 3s and K 4s electron momentum distributions have been obtained using the noncoplanar symmetric (e,2e) reaction at total energies of 800 eV and 1200 eV. They show excellent agreement with the results of plane wave impulse approximation calculations using Roothaan-Hartree-Fock functions, after small corrections are made for the finite angular resolution of the apparatus. The potassium valence s momentum profile is a little narrower than that for sodium, implying a correspondingly slightly larger spatial distribution of the outer valence electrons. The ratio between the (n-1)p and ns cross-sections at their respective maxima in q-space were measured to be 0.009 +- 0.003 and 0.019 +- 0.003 for Na and K respectively. These cross-section ratios are in agreement with the PWIA calculations

  9. Potassium Capture by Kaolin, Part 1: KOH

    DEFF Research Database (Denmark)

    Wang, Guoliang; Jensen, Peter Arendt; Wu, Hao

    2018-01-01

    -capture level. The effect of reaction temperature,K-concentration in the flue gas, and, thereby, molar ratio of K/(Al+Si) in reactants, gas residence time, and solid particle size on K-capture reaction was systematically investigated. Corresponding equilibrium calculations were conducted with FactSage 7.......0. The experimental results showed that kaolin reached almost full conversion to K-aluminosilicates under suspension-fired conditions at 1100–1450 °C for a residence time of 1.2 s and a particle size of D50 = 5.47 μm. The amount of potassium captured by kaolin generally followed the equilibrium at temperatures above...

  10. High dose potassium-nitrate chemical dosimeter

    International Nuclear Information System (INIS)

    Dorda de Cancio, E.M.; Munoz, S.S.

    1982-01-01

    This dosimeter is used to control 10 kGY-order doses (1 Mrad). Nitrate suffers a radiolitic reduction phenomena, which is related to the given dose. The method to use potassium nitrate as dosimeter is described, as well as effects of the temperature of irradiation, pH, nitrate concentration and post-irradiation stability. Nitrate powder was irradiated at a Semi-Industrial Plant, at Centro Atomico Ezeiza, and also in a Gammacell-220 irradiator. The dose rates used were 2,60 and 1,80 KGY/hour, and the given doses varied between 1,0 and 150 KGY. The uncertainty was +-3% in all the range. (author) [es

  11. Formation and structural characterization of potassium titanates and the potassium ion exchange property

    International Nuclear Information System (INIS)

    Wang Qiang; Guo Zhanhu; Chung, Jong Shik

    2009-01-01

    In the present work, K 2 Ti 2 O 5 , K 2 Ti 4 O 9 and K 2 Ti 6 O 13 are synthesized by solid state method. Their structures and morphologies are characterized by X-ray diffraction, Raman spectra and scanning electron microscopy. The binding energies of K, Ti and O in potassium titanates were then evaluated by X-ray photoelectron spectroscopy and compared with those in K/TiO 2 . Finally the corresponding K ion exchange properties are investigated by synthesizing NO oxidation catalysts with Co(NO 3 ) 2 precursor. It is found that the binding energy of K in K 2 Ti 2 O 5 is much higher than those in K 2 Ti 4 O 9 and K 2 Ti 6 O 13 , and because of which, it shows quite different catalytic performances. Compared with other potassium titanates, the K in K 2 Ti 2 O 5 is much easier to be exchanged out.

  12. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  13. Potassium recycling pathways in the human cochlea.

    Science.gov (United States)

    Weber, P C; Cunningham, C D; Schulte, B A

    2001-07-01

    Potential pathways for recycling potassium (K+) used in the maintenance of inner ear electrochemical gradients have been elucidated in animal models. However, little is known about K+ transport in the human cochlea. This study was designed to characterize putative K+ recycling pathways in the human ear and to determine whether observations from animal models can be extrapolated to humans. A prospective laboratory study using an immunohistochemical approach to analyze the distribution of key ion transport mediators in the human cochlea. Human temporal bones were fixed in situ within 1 to 6 hours of death and subsequently harvested at autopsy. Decalcification was accomplished with the aid of microwaving. Immunohistochemical staining was then performed to define the presence and cell type-specific distribution of Na,K-ATPase, sodium-potassium-chloride cotransporter (NKCC), and carbonic anhydrase (CA) in the inner ear. Staining patterns visualized in the human cochlea closely paralleled those seen in other species. Anti-Na,K-ATPase stained strongly the basolateral plasma membrane of strial marginal cells and nerve endings underlying hair cells. This antibody also localized Na,K-ATPase to type II, type IV, and type V fibrocytes in the spiral ligament and in limbal fibrocytes. NKCC was present in the basolateral membrane of strial marginal cells as well as in type II, type V, and limbal fibrocytes. Immunoreactive carbonic anhydrase was present in type I and type III fibrocytes and in epithelial cells lining Reissner's membrane and the spiral prominence. The distribution of several major ion transport proteins in the human cochlea is similar but not identical to that described in various rodent models. These results support the presence of a complex system for recycling and regulating K+ homeostasis in the human cochlea, similar to that described in other mammalian species.

  14. Reaction of lithium, sodium and potassium polyphosphates with potassium permanganate at elevated temperatures

    International Nuclear Information System (INIS)

    Paderova, L.V.; Onuchina, T.V.; Kochergin, V.P.

    1996-01-01

    A study was made on destruction of molten polyphosphates of alkaline metals by potassium permanganate during change of KMnO 4 content, test time and temperature. Ortho-, di, tri- and tetraphosphate-anions, as well as manganese compounds with different oxidation degree were revealed in products of component interaction. Empirical equations of the dependence of the value of average molecular mass on change of melt temperature were derived. 11 refs.; 2 figs.; 2 tabs

  15. Enhancement of delayed-rectifier potassium conductance by low concentrations of local anaesthetics in spinal sensory neurones

    Science.gov (United States)

    Olschewski, Andrea; Wolff, Matthias; Bräu, Michael E; Hempelmann, Gunter; Vogel, Werner; Safronov, Boris V

    2002-01-01

    Combining the patch-clamp recordings in slice preparation with the ‘entire soma isolation' method we studied action of several local anaesthetics on delayed-rectifier K+ currents in spinal dorsal horn neurones.Bupivacaine, lidocaine and mepivacaine at low concentrations (1–100 μM) enhanced delayed-rectifier K+ current in intact neurones within the spinal cord slice, while exhibiting a partial blocking effect at higher concentrations (>100 μM). In isolated somata 0.1–10 μM bupivacaine enhanced delayed-rectifier K+ current by shifting its steady-state activation characteristic and the voltage-dependence of the activation time constant to more negative potentials by 10–20 mV.Detailed analysis has revealed that bupivacaine also increased the maximum delayed-rectifier K+ conductance by changing the open probability, rather than the unitary conductance, of the channel.It is concluded that local anaesthetics show a dual effect on delayed-rectifier K+ currents by potentiating them at low concentrations and partially suppressing at high concentrations. The phenomenon observed demonstrated the complex action of local anaesthetics during spinal and epidural anaesthesia, which is not restricted to a suppression of Na+ conductance only. PMID:12055132

  16. Evidence-based management of potassium disorders in the emergency department [digest].

    Science.gov (United States)

    Ashurst, John; Sergent, Shane R; Wagner, Benjamin J; Kim, Jeremy

    2016-11-22

    Hypokalemia and hyperkalemia are the most common electrolyte disorders managed in the emergency department. The diagnosis of these potentially life-threatening disorders is challenging due to the often vague symptomatology a patient may express, and treatment options may be based upon very little data due to the time it may take for laboratory values to return. This review examines the most current evidence with regard to the pathophysiology, diagnosis, and management of potassium disorders. In this review, classic paradigms, such as the use of sodium polystyrene and the routine measurement of serum magnesium, are tested, and an algorithm for the treatment of potassium disorders is discussed. [Points & Pearls is a digest of Emergency Medicine Practice].

  17. Use of potassium-42 in the study of kidney functioning

    International Nuclear Information System (INIS)

    Morel, F.; Guinnebault, M.

    1959-01-01

    Following an intravenous injection of potassium-42 as indicator, an analysis of the specific activity vs. time curve in arterial plasma, in venous plasma efferent from the kidney, in urine and in various regions of the kidney of rabbits reveals that: 1) The turnover rate of potassium in the cortex cells (proximal and distal convoluted tubes) is very large, being limited only by renal blood flow. 2) The turnover rate of potassium in deep regions (Henle loops and collector tubules) is much smaller. 3) Potassium in the urine comes from cells of the convoluted tubes and not from cells of Henle loops, collector ducts, or glomerular filtrate. 4) Any potassium filtered at the level of the glomerules would be entirely reabsorbed at the level of the proximal tube, while total potassium in the urine results from a process of excretion by cells of the distal tube. These results are comparable with the assumption that the movement of potassium between interstitial medium and convoluted tube cells results from entirely passive processes. (author) [fr

  18. Microinjection study on potassium transport of rat kidney

    International Nuclear Information System (INIS)

    Miyamoto, Makoto

    1978-01-01

    Wister rate were divided into the following four groups. (A) control group (B) high-potassium diet group (C) low-potassium diet group (D) nephron population reduction (N.P.R.) group. Microinjection of the artificial solutions containing both 86 Rb and 3 H-inulin were performed into the proximal and distal convoluted tubules as well as cortical peritubular capillaries in rats undergoing mannitol diuresis. Excretory patterns of these substances were analyzed in successive urine samples. 3 H-inulin is entirely recovered in the urine of the experimental kidney following the injection into the proximal and distal tubules. 86 Rb is an adequate tracer for potassium and is absorbed into the potassium pool from either proximal tubular injections or peritubular capillaries. 86 Rb excreted with a time course similar to that of 3 H-inulin is termed as 'direct recovery' and that excreted more slowly, 'delayed recovery'. The 86 Rb recoveries which were obtained after proximal injections were independent of the injection site and averaged 9%. Secretion of 86 Rb into the urine was stimulate during enhanced K secretion and decreased during reduced K secretion along the distal nephron. Distal tubular injections gave 100% direct recovery in control, high-K diet, and N.P.R. rats. It was apparent that the 86 Rb recovery was significantly reduced, although not delayed, in animals deprived of dietary potassium for several weeks. At the collecting duct, the extensive net potassium reabsorption is observed in potassium depleted rats, whereas K absorption might be reduced or even secretion is seemingly taking place in potassium loading rats. In conclution, distal convolution and collecting duct play the major role in the regulation of urinary potassium excretion. (auth.)

  19. Potassium Silicate Foliar Fertilizer Grade from Geothermal Sludge and Pyrophyllite

    Directory of Open Access Journals (Sweden)

    Muljani Srie

    2016-01-01

    Full Text Available Potassium silicate fertilizer grade were successfully produced by direct fusion of silica (SiO2 and potasium (KOH and K2CO3 in furnaces at temperatures up to melting point of mixture. The geothermal sludge (98% SiO2 and the pyrophyllite (95% SiO2 were used as silica sources. The purposes of the study was to synthesise potassium silicate fertilizer grade having solids concentrations in the range of 31-37% K2O, and silica in the range of 48-54% SiO2. The weight ratio of silicon dioxide/potasium solid being 1:1 to 5:1. Silica from geothermal sludge is amorphous, whereas pyrophylite is crystalline phase. The results showed that the amount of raw materials needed to get the appropriate molar ratio of potassium silicate fertilizer grade are different, as well as the fusion temperature of the furnace. Potassium silicate prepared from potassium hydroxide and geothermal sludge produced a low molar ratio (2.5: 1 to 3: 1. The potassium required quite small (4:1 in weight ratio, and on a fusion temperature of about 900 °C. Meanwhile, the potassium silicate prepared from pyrophyllite produced a high molar ratio (1.4 - 9.4 and on a fusion temperature of about 1350 °C, so that potassium needed large enough to meet the required molar ratio for the fertilizer grade. The product potassium silicate solid is amorphous with a little trace of crystalline.

  20. Effects of Long-term Fertilization on Potassium Fixation Capacity in Brown Soil

    Science.gov (United States)

    Li, Na; Guo, Chunlei; Wang, Yue; Gao, Tianyi; Yang, Jinfeng; Han, Xiaori

    2018-01-01

    This study concentrated on the research of features of fixation. The objective of this study was to provide theoretical foundation of rational application of potassium fertilizer along with improving fertilizer availability ratio. A 32 years long-term experiment was conducted to evaluate the effects of fertilizer application on potassium changes and the factors affecting K fixation on brown soil by simulation in laboratory. When the concentration of exogenous potassium was in range of 400∼4000 mg·kg-1, potassium fixation capacity increased along with the rise of concentration of exogenous potassium, whereas K fixation rate reduced; Compared with no-potassium fertilizer, application of potassium fertilizer and organic fertilizer reduced soil potassium fixation capacity. Potassium rate and fixation-release of potassium character in soil should be taken into comprehensive consideration for rational fertilization to maintain or improve soil fertility for increasing potassium fertilizers efficiency in agriculture.

  1. Inhibition of GluR Current in Microvilli of Sensory Neurons via Na+-Microdomain Coupling Among GluR, HCN Channel, and Na+/K+ Pump

    Directory of Open Access Journals (Sweden)

    Yasuhiro Kawasaki

    2018-04-01

    Full Text Available Glutamatergic dendritic EPSPs evoked in cortical pyramidal neurons are depressed by activation of hyperpolarization-activated cyclic nucleotide-gated (HCN channels expressed in dendritic spines. This depression has been attributed to shunting effects of HCN current (Ih on input resistance or Ih deactivation. Primary sensory neurons in the rat mesencephalic trigeminal nucleus (MTN have the somata covered by spine-like microvilli that express HCN channels. In rat MTN neurons, we demonstrated that Ih enhancement apparently diminished the glutamate receptor (GluR current (IGluR evoked by puff application of glutamate/AMPA and enhanced a transient outward current following IGluR (OT-IGluR. This suggests that some outward current opposes inward IGluR. The IGluR inhibition displayed a U-shaped voltage-dependence with a minimal inhibition around the resting membrane potential, suggesting that simple shunting effects or deactivation of Ih cannot explain the U-shaped voltage-dependence. Confocal imaging of Na+ revealed that GluR activation caused an accumulation of Na+ in the microvilli, which can cause a negative shift of the reversal potential for Ih (Eh. Taken together, it was suggested that IGluR evoked in MTN neurons is opposed by a transient decrease or increase in standing inward or outward Ih, respectively, both of which can be caused by negative shifts of Eh, as consistent with the U-shaped voltage-dependence of the IGluR inhibition and the OT-IGluR generation. An electron-microscopic immunohistochemical study revealed the colocalization of HCN channels and glutamatergic synapses in microvilli of MTN neurons, which would provide a morphological basis for the functional interaction between HCN and GluR channels. Mathematical modeling eliminated the possibilities of the involvements of Ih deactivation and/or shunting effect and supported the negative shift of Eh which causes the U-shaped voltage-dependent inhibition of IGluR.

  2. Work Function Characterization of Potassium-Intercalated, Boron Nitride Doped Graphitic Petals

    Directory of Open Access Journals (Sweden)

    Patrick T. McCarthy

    2017-07-01

    Full Text Available This paper reports on characterization techniques for electron emission from potassium-intercalated boron nitride-modified graphitic petals (GPs. Carbon-based materials offer potentially good performance in electron emission applications owing to high thermal stability and a wide range of nanostructures that increase emission current via field enhancement. Furthermore, potassium adsorption and intercalation of carbon-based nanoscale emitters decreases work functions from approximately 4.6 eV to as low as 2.0 eV. In this study, boron nitride modifications of GPs were performed. Hexagonal boron nitride is a planar structure akin to graphene and has demonstrated useful chemical and electrical properties when embedded in graphitic layers. Photoemission induced by simulated solar excitation was employed to characterize the emitter electron energy distributions, and changes in the electron emission characteristics with respect to temperature identified annealing temperature limits. After several heating cycles, a single stable emission peak with work function of 2.8 eV was present for the intercalated GP sample up to 1,000 K. Up to 600 K, the potassium-intercalated boron nitride modified sample exhibited improved retention of potassium in the form of multiple emission peaks (1.8, 2.5, and 3.3 eV resulting in a large net electron emission relative to the unmodified graphitic sample. However, upon further heating to 1,000 K, the unmodified GP sample demonstrated better stability and higher emission current than the boron nitride modified sample. Both samples deintercalated above 1,000 K.

  3. Dielectric properties of a potassium nitrate–ammonium nitrate system

    OpenAIRE

    Alexey Yu. Milinskiy; Anton A. Antonov

    2015-01-01

    Potassium nitrate has a rectangular hysteresis loop and is thought to be a promising material for non-volatile ferroelectric memory. However, its polar phase is observed in a narrow temperature range. This paper deals with an effect of ammonium nitrate NH4NO3 on the dielectric properties of potassium nitrate. Thermal dependencies of the linear dielectric permittivity ε and the third-harmonic coefficient g3 for potassium nitrate and polycrystalline binary (KNO3)1–x(NH4NO3)x system (x = 0.025, ...

  4. The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)

    2016-07-11

    Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.

  5. Thermodynamic properties of potassium chloride aqueous solutions

    Science.gov (United States)

    Zezin, Denis; Driesner, Thomas

    2017-04-01

    Potassium chloride is a ubiquitous salt in natural fluids, being the second most abundant dissolved salt in many geological aqueous solutions after sodium chloride. It is a simple solute and strong electrolyte easily dissociating in water, however the thermodynamic properties of KCl aqueous solutions were never correlated with sufficient accuracy for a wide range of physicochemical conditions. In this communication we propose a set of parameters for a Pitzer-type model which allows calculation of all necessary thermodynamic properties of KCl solution, namely excess Gibbs free energy and derived activity coefficient, apparent molar enthalpy, heat capacity and volume, as well as osmotic coefficient and activity of water in solutions. The system KCl-water is one of the best studied aqueous systems containing electrolytes. Although extensive experimental data were collected for thermodynamic properties of these solutions over the years, the accurate volumetric data became available only recently, thus making possible a complete thermodynamic formulation including a pressure dependence of excess Gibbs free energy and derived properties of the KCl-water liquids. Our proposed model is intended for calculation of major thermodynamic properties of KCl aqueous solutions at temperatures ranging from freezing point of a solution to 623 K, pressures ranging from saturated water vapor up to 150 MPa, and concentrations up to the salt saturation. This parameterized model will be further implemented in geochemical software packages and can facilitate the calculation of aqueous equilibrium for reactive transport codes.

  6. Potassium permanganate for mercury vapor environmental control

    Science.gov (United States)

    Kuivinen, D. E.

    1972-01-01

    Potassium permanganate (KMnO4) was evaluated for application in removing mercury vapor from exhaust air systems. The KMnO4 may be used in water solution with a liquid spray scrubber system or as a solid adsorber bed material when impregnated onto a zeolite. Air samples contaminated with as much as 112 mg/cu m of mercury were scrubbed to 0.06mg/cum with the KMnO4-impregnated zeolite (molecular sieve material). The water spray solution of permanganate was also found to be as effective as the impregnated zeolite. The KMnO4-impregnated zeolite was applied as a solid adsorber material to (1) a hardware decontamination system, (2) a model incinerator, and (3) a high vacuum chamber for ion engine testing with mercury as the propellant. A liquid scrubber system was also applied in an incinerator system. Based on the results of these experiments, it is concluded that the use of KMnO4 can be an effective method for controlling noxious mercury vapor.

  7. Discovery of potassium salts deposits in colombia

    International Nuclear Information System (INIS)

    Gonzalez Oviedo Leopoldo; Espinosa Baquero Armando

    2012-01-01

    The first potassium salts ores found in Colombia are presented and described; they are located in the Santander province, in La Mesa de los Santos area, between Los Santos village and the rio Chicamocha Canyon. From a geological point of view, the mineralization is associated to the sediments of the Paja Formation, Early Cretaceous in age, and is located near the base of the formation. In the study area the main structure is the Villanueva syncline which involves, from bottom to top, Los Santos, Rosablanca, Paja, Tablazo and Simiti formations.The mineralization consists of small veins where the main mineral is singenite (K 2 Ca[SO4] 2- H 2 O) with small amounts of carbonates and accidental minerals. In the host rock, minerals like langbeinite (K 2 Mg 2 [SO4] 3) andrinneite (K 3 Na[Fe,Cl] 6) are present; they show that the rock was formed in an evaporitic environment and that detailed studies of that sequence may lead to the discovery of other mineralizations of economic interest.

  8. Asthma caused by potassium aluminium tetrafluoride: a case series.

    Science.gov (United States)

    Laštovková, Andrea; Klusáčková, Pavlina; Fenclová, Zdenka; Bonneterre, Vincent; Pelclová, Daniela

    2015-01-01

    The objective of this study is to describe a case-series of potassium aluminium tetrafluoride (KAlF(4))-induced occupational asthma (OA) and/or occupational rhinitis (OR). The study involves five patients from a heat-exchanger production line who were examined (including specific inhalation challenge tests) for suspected OA and/or OR caused by a flux containing almost 100% KAlF(4) - with fluorides' workplace air concentrations ranging between 1.7 and 2.8 mg/m(3). No subject had a previous history of asthma. All five patients had a positive specific challenge test (three patients were diagnosed with OA alone, one with OR and one with both OR and OA). At the follow-up visit, after three years on average, all patients needed permanent corticosteroid therapy (four topical, one oral). After elimination from the exposure, only one of the observed subjects gave an indication of an improvement, two subjects stabilized and two worsened. Our case series focuses on the correlation between patients' exposure to fluorides in air-conditioner production and the subsequent occurrence of OR/OA. Currently, it is uncertain whether these OR/OA were caused by hypersensitivity or irritation.

  9. Accounting for potassium and magnesium in irrigation water quality assessment

    Directory of Open Access Journals (Sweden)

    J.D. Oster

    2016-04-01

    Full Text Available Irrigation with treated wastewater is expected to increase significantly in California during the coming decade as a way to reduce the impact of drought and mitigate water transfer issues. To ensure that such wastewater reuse does not result in unacceptable impacts on soil permeability, water quality guidelines must effectively address sodicity hazard. However, current guidelines are based on the sodium adsorption ratio (SAR and thus assume that potassium (K and magnesium (Mg, which often are at elevated concentrations in recycled wastewaters, pose no hazard, despite many past studies to the contrary. Recent research has established that the negative effects of high K and Mg concentrations on soil permeability are substantial and that they can be accounted for by a new irrigation water quality parameter, the cation ratio of structural stability (CROSS, a generalization of SAR. We show that CROSS, when suitably optimized, correlates strongly with a standard measure of soil permeability reduction for an agricultural soil leached with winery wastewater, and that it can be incorporated directly into existing irrigation water quality guidelines by replacing SAR.

  10. Piezoelectric excitation of elastic waves in centrosymmetrical potassium tantalate crystal

    International Nuclear Information System (INIS)

    Smolenskij, G.A.; Lemanov, V.V.; Sotnikov, A.V.; Syrnikov, P.P.; Yushin, N.K.

    1981-01-01

    Experiment results on excitation of elastic oscillations in potassium tantalate crystals are considered. The experiment has been conducted by usual for supersonic measurements technique: an impulse of the variable electric field has been applied to one of plane-parallel sample end-faces, at the same end-face signals corresponding to elastic pulses propagating in the crystal have been detected. Basic radiopulses parameters: basic frequency 30 MHz, duration 1-2 μs, pulse recurrence frequency 500 Hz, power 10 W. The investigation carried out has shown that the application to the sample at T=80 K temperature of constant external electrical field parallel to direction of elastic wave propagation leads to hysteresis dependence of elastic waves amplitude on the external voltage value. With temperature increase the hysteresis loop is deformed. It has been found when investigating temperature dependence of elastic wave amplitude that in the absence of external constant electrical field in short-circuited by constant current samples the oxillation excitation effect disappears at T approximately equal to 200 K. An essential influence on the elastic wave amplitude value is exerted by illumination of the crystal surface by light with 360-630 nm wave length. At T 130 K bacaee of photovoltaic effect in illuminated samples [ru

  11. Potassium-phosphorus relationships in cotton (gossypium hirsutum L.) as affected by potassium nutrition

    International Nuclear Information System (INIS)

    Makhdum, M.I.; Ashraf, M.

    2007-01-01

    Field studies were undertaken to determine the interrelationship between potassium (K+) concentration in various organs of plant and phosphorus (P) content as influenced by K-nutrition in cotton. The experiment was conducted on Miani soil series silt loam and classified as Calcaric Cambisols, fine silty, mixed Hyperthermic Fluventic Haplocambids. The treatments consisted .of (a) four cotton (Gossypium hirsutum L.) cultivars (CI.M-448, CIM-IIOO, Karishma, S-12); and (b) four potassium fertilizer doses (0, 62.5, 125.0, 250.0 kg K ha-l). The design of experiment was split plot (main: cultivars, sub-plot: K-doses). The plant samples were collected at five stages of growth, i.e., first flower bud., first flower, peak flowering, first boll split and maturity. The various parts of plants were analyzed for phosphorus and potassium concentration at various stages of growth. Phosphorus concentration in leaves, stems, burs, seed and lint decreased with concurrent increase in K-doses. Crop maintained 0.22% phosphorus concentration in leaf tissues at first flower bud and dropped to 0.11% at maturity. Cultivars differed greatly amongst themselves in terms of maintaining P content in their different parts. Averaged across K-doses, cv. CIM-448 maintained the highest P content in all parts than other cultivars. There was a negative and significant correlation co-efficient between K and P concentration in various parts of the plant. The study demonstrated antagonistic interaction between K+ and P in cotton plant under irrigated conditions. (author)

  12. The Effects of Different Tillage Methods on Available Soil Potassium Measured by Various Extractors in a Soil with High Specific Surface Area

    Directory of Open Access Journals (Sweden)

    M. Hosseini

    2016-02-01

    using sodium tetraphenyl boron at 5 percent level and ammonium acetate at 1 percent level, both before wheat heading. Soil potassium content did not differ significantly in this stage when potassium excess method was used. With all methods of soil potassium determination, soil potassium did not differ significantly at harvest. Soil potassium with moldboard-ploughing was less than all other tillage methods at before plant heading. Thomas et al. (55 and Martin Rhoda et al.(40 also stated that soil potassium was greater with no-tillage method. Lopez Phando & Pardo. (34 similarly stated that soil potassium with no-tillage method was greater than moldboard ploughing. According to results of the current experiment, soil mechanical resistance was further reduced as tillage intensity was increased. Soil mechanical resistance with moldboard ploughing was less than other tillage methods between early heading stage and harvest. Lower mechanical resistance with increased tillage intensity increased root growth and soil potassium uptake by wheat grain and straw, leading to greater yield production in accordance with results by Fakori (16. Conclusions Soil tillage with moldboard ploughing reduced mechanical resistance, increased root density (and possibly soil-root contact surface area and soil potassium uptake which results a greater wheat head density and yield and also a lower soil potassium with different methods (potassium excess determination and bulk soil solution potassium concentration methods and also using soidium tetraphenyl boron, ammonium acetate extractants at before heading which is the stage for maximal growth and nutrient accumulation rate. Soil extractants maybe used for plant nutrient uptake and yield predictions in a plant canopy, when plant nutrient uptake has a positive significant correlation with soil potassium and treatments do not affect root growth and the mentioned correlation.

  13. Dietary reference intakes for water, potassium, sodium, chloride, and sulfate

    National Research Council Canada - National Science Library

    Institute of Medicine (U.S.). Panel on Dietary Reference Intakes for Electrolytes and Water

    2005-01-01

    .... This new report, the sixth in a series of reports presenting dietary reference values for the intakes of nutrients by Americans and Canadians, establishes nutrient recommendations on water, potassium...

  14. Transmission spectra study of sulfate substituted potassium dihydrogen phosphate

    KAUST Repository

    LI, LIANG; Zhang, Jianqin; Sun, Xun; Zhang, Qiang; Zhao, Xian; Zhang, Xixiang

    2013-01-01

    Potassium dihydrogen phosphate (KDP) crystals with different amounts of sulfate concentration were grown and the transmittance spectrum was studied. A crystal with high sulfate replacement density exhibits heavy absorption property

  15. Synthesis and derivatographic investigation of potassium octacyanotungstate (4)

    International Nuclear Information System (INIS)

    Kovbashin, V.I.; Dovgej, V.V.; Chernyak, B.I.

    1983-01-01

    The interaction between the rated quantities of potassium cyanide and WO(OH) 3 hydroxide resulted in preparation of potassium dioxytetracyanotungstate (4), K 4 [WO 2 (CN) 4 ]X6H 2 O. The latter, while interacting with a saturated potassium cyanide solution in a carbon dioxide flow transforms to potassium octacyanotungstate (4). The process of K 4 [W(CH) 8 ]x2H 2 O compound thermolysis in argon atmosphere is studied. It is found that, after dehydration of the complex, there occurs thermal transformation of K 4 [W(CN) 8 ] to K 3 [W(CN) 7 ] and then to K 3 [W(CN) 6 ]. The thermolysis final product is tungsten carbide WC

  16. Effect of Metformin on Potassium-adapted and Non- adapted ...

    African Journals Online (AJOL)

    determined. Results: The blood glucose of the potassium-adapted diabetic group was not significantly reduced on treatment ... whom dietary carbohydrate restriction has not controlled .... significantly different from the metformin-treated group.

  17. Studies on potassium chlorate as a primary oxidimetric reagent.

    Science.gov (United States)

    Murty, C R; Rao, G G

    1972-01-01

    Conditions have been established for the use of potassium chlorate as a primary oxidizing agent in the direct titration of vanadium(III), tin(II) and titanium(III) with visual or potentiometric end-points.

  18. Effects of different cavity‑disinfectants and potassium titanyl ...

    African Journals Online (AJOL)

    disinfectants and potassium titanyl phosphate (KTP) laser on microtensile bond strength to primary dentin. Chlorhexidine (CHX), propolis (PRO), ozonated water (OW), gaseous ozone (OG) and KTP laser were used for this purpose. Methodology: ...

  19. Molecular dynamics simulation of polyacrylamides in potassium montmorillonite clay hydrates

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Junfang [CSIRO Petroleum Resources, Ian Wark Laboratory, Bayview Avenue, Clayton, Victoria 3168 (Australia); Rivero, Mayela [CSIRO Petroleum, PO Box 1130, Bentley, Western Australia, 6102 (Australia); Choi, S K [CSIRO Petroleum Resources, Ian Wark Laboratory, Bayview Avenue, Clayton, Victoria 3168 (Australia)

    2007-02-14

    We present molecular dynamics simulation results for polyacrylamide in potassium montmorillonite clay-aqueous systems. Interlayer molecular structure and dynamics properties are investigated. The number density profile, radial distribution function, root-mean-square deviation (RMSD), mean-square displacement (MSD) and diffusion coefficient are reported. The calculations are conducted in constant NVT ensembles, at T = 300 K and with layer spacing of 40 A. Our simulation results showed that polyacrylamides had little impact on the structure of interlayer water. Density profiles and radial distribution function indicated that hydration shells were formed. In the presence of polyacrylamides more potassium counterions move close to the clay surface while water molecules move away, indicating that potassium counterions are hydrated to a lesser extent than the system in which no polyacrylamides were added. The diffusion coefficients for potassium and water decreased when polyacrylamides were added.

  20. Estimation of Total Body Fat from Potassium-40 Content

    International Nuclear Information System (INIS)

    Taha Mohamed Taha Ahmed, T.M.T.

    2010-01-01

    This paper concerns on estimation of total body fat from potassium 40 content using total body counting technique. The work performed using fast scan whole body counter. Calibration of that system for K-40 was carried out under assumption that uniformity distribution of radioactivity of potassium was distributed in 10 polyethylene bottles phantom. Different body sizes were represented by 2, 4, 6, 8 and 10 polyethylene bottles; each bottle has a volume of 0.04 m3. The counting efficiency for each body size was determined. Lean body weight (LBW) was calculated for ten males and ten females using appropriate mathematical equation. Total Body Potassium, TBK for the same selected group was measured using whole body counter. A mathematical relationship between lean body weight and potassium content was deduced .Fat contents for some individuals were calculated and weight/height ratio was indicated for fatness.

  1. Effect of phosphorus and potassium on seed production of berseem

    African Journals Online (AJOL)

    Jane

    2011-10-17

    Oct 17, 2011 ... 1Department of Agronomy, Khyber Pukhtunkhwa Agricultural University, Peshawar, Pakistan. ... Key words: Berseem, seed production, phosphorus, potassium. ... important forage legumes in Pakistan and India which belongs ...

  2. Potassium Ferrate: A Novel Chemical Warfare Agent Decontaminant

    National Research Council Canada - National Science Library

    Greene, Russell; von Fahnestock, F. M; Monzyk, Bruce

    2004-01-01

    ..., and/or unsatisfactory CWA destruction efficiencies. Potassium ferrate (K2FeO4) addresses all of these issues through its high oxidation potential, stable shelf life, and benign reduced state, namely iron oxide...

  3. Reaction Mechanisms of Magnesium Potassium Phosphate Cement and its Application

    Science.gov (United States)

    Qiao, Fei

    Magnesium potassium phosphate cement (MKPC) is a kind of cementitious binder in which the chemical bond is formed via a heterogeneous acid-base reaction between dead burned magnesia powder and potassium phosphate solution at room temperature. Small amount of boron compounds can be incorporated in the cement as a setting retarder. The final reaction product of MgO-KH2PO4-H 2O ternary system is identified as magnesium potassium phosphate hexahydrate, MgKPO4·6H2O. However, the mechanisms and procedures through which this crystalline product is formed and the conditions under which the crystallization process would be influenced are not yet clear. Understanding of the reaction mechanism of the system is helpful for developing new methodologies to control the rapid reaction process and furthermore, to adjust the phase assemblage of the binder, and to enhance the macroscopic properties. This study is mainly focused on the examination of the reaction mechanism of MKPC. In addition, the formulation optimization, microstructure characterization and field application in rapid repair are also systematically studied. The chemical reactions between magnesia and potassium dihydrogen phosphate are essentially an acid-base reaction with strong heat release, the pH and temperature variation throughout the reaction process could provide useful information to disclose the different stages in the reaction. However, it would be very difficult to conduct such tests on the cement paste due to the limited water content and fast setting. In the current research, the reaction mechanism of MKPC is investigated on the diluted MKPC system through monitoring the pH and temperature development, identification of the solid phase formed, and measurement of the ionic concentration of the solution. The reaction process can be explained as follows: when magnesia and potassium phosphate powder are mixed with water, phosphate is readily dissolved, which is instantly followed by the dissociation of

  4. Final report on the safety assessment of sodium sulfite, potassium sulfite, ammonium sulfite, sodium bisulfite, ammonium bisulfite, sodium metabisulfite and potassium metabisulfite.

    Science.gov (United States)

    Nair, Bindu; Elmore, Amy R

    2003-01-01

    Sodium Sulfite, Ammonium Sulfite, Sodium Bisulfite, Potassium Bisulfite, Ammonium Bisulfite, Sodium Metabisulfite, and Potassium Metabisulfite are inorganic salts that function as reducing agents in cosmetic formulations. All except Sodium Metabisulfite also function as hair-waving/straightening agents. In addition, Sodium Sulfite, Potassium Sulfite, Sodium Bisulfite, and Sodium Metabisulfite function as antioxidants. Although Ammonium Sulfite is not in current use, the others are widely used in hair care products. Sulfites that enter mammals via ingestion, inhalation, or injection are metabolized by sulfite oxidase to sulfate. In oral-dose animal toxicity studies, hyperplastic changes in the gastric mucosa were the most common findings at high doses. Ammonium Sulfite aerosol had an acute LC(50) of >400 mg/m(3) in guinea pigs. A single exposure to low concentrations of a Sodium Sulfite fine aerosol produced dose-related changes in the lung capacity parameters of guinea pigs. A 3-day exposure of rats to a Sodium Sulfite fine aerosol produced mild pulmonary edema and irritation of the tracheal epithelium. Severe epithelial changes were observed in dogs exposed for 290 days to 1 mg/m(3) of a Sodium Metabisulfite fine aerosol. These fine aerosols contained fine respirable particle sizes that are not found in cosmetic aerosols or pump sprays. None of the cosmetic product types, however, in which these ingredients are used are aerosolized. Sodium Bisulfite (tested at 38%) and Sodium Metabisulfite (undiluted) were not irritants to rabbits following occlusive exposures. Sodium Metabisulfite (tested at 50%) was irritating to guinea pigs following repeated exposure. In rats, Sodium Sulfite heptahydrate at large doses (up to 3.3 g/kg) produced fetal toxicity but not teratogenicity. Sodium Bisulfite, Sodium Metabisulfite, and Potassium Metabisulfite were not teratogenic for mice, rats, hamsters, or rabbits at doses up to 160 mg/kg. Generally, Sodium Sulfite, Sodium

  5. Coulomb interaction rules timescales in potassium ion channel tunneling

    Science.gov (United States)

    De March, N.; Prado, S. D.; Brunnet, L. G.

    2018-06-01

    Assuming the selectivity filter of KcsA potassium ion channel may exhibit quantum coherence, we extend a previous model by Vaziri and Plenio (2010 New J. Phys. 12 085001) to take into account Coulomb repulsion between potassium ions. We show that typical ion transit timescales are determined by this interaction, which imposes optimal input/output parameter ranges. Also, as observed in other examples of quantum tunneling in biological systems, the addition of moderate noise helps coherent ion transport.

  6. Degradation behaviour of potassium K-phosphite in apple trees

    OpenAIRE

    Kelderer, Markus; Matteazzi, Aldo; Casera, Claudio

    2008-01-01

    Although potassium phosphite is not registered for organic fruit production in Europe, it has long been regarded as a potential alternative to sulphur- and copper-containing fungicides. In 2005/2006 a field trial was carried out to verify the presence of residues of phosphoric acid over time in apples after applications of potassium phosphite at different time-points. No residues were present on fruits if treatments were applied before flowering, whereas treatments after flower...

  7. Evaluating Status Change of Soil Potassium from Path Model

    Science.gov (United States)

    He, Wenming; Chen, Fang

    2013-01-01

    The purpose of this study is to determine critical environmental parameters of soil K availability and to quantify those contributors by using a proposed path model. In this study, plot experiments were designed into different treatments, and soil samples were collected and further analyzed in laboratory to investigate soil properties influence on soil potassium forms (water soluble K, exchangeable K, non-exchangeable K). Furthermore, path analysis based on proposed path model was carried out to evaluate the relationship between potassium forms and soil properties. Research findings were achieved as followings. Firstly, key direct factors were soil S, ratio of sodium-potassium (Na/K), the chemical index of alteration (CIA), Soil Organic Matter in soil solution (SOM), Na and total nitrogen in soil solution (TN), and key indirect factors were Carbonate (CO3), Mg, pH, Na, S, and SOM. Secondly, path model can effectively determine direction and quantities of potassium status changes between Exchangeable potassium (eK), Non-exchangeable potassium (neK) and water-soluble potassium (wsK) under influences of specific environmental parameters. In reversible equilibrium state of , K balance state was inclined to be moved into β and χ directions in treatments of potassium shortage. However in reversible equilibrium of , K balance state was inclined to be moved into θ and λ directions in treatments of water shortage. Results showed that the proposed path model was able to quantitatively disclose moving direction of K status and quantify its equilibrium threshold. It provided a theoretical and practical basis for scientific and effective fertilization in agricultural plants growth. PMID:24204659

  8. Crystal structure of the sodium-potassium pump

    DEFF Research Database (Denmark)

    Morth, J Preben; Pedersen, Bjørn Panyella; Toustrup-Jensen, Mads S

    2007-01-01

    The Na+,K+-ATPase generates electrochemical gradients for sodium and potassium that are vital to animal cells, exchanging three sodium ions for two potassium ions across the plasma membrane during each cycle of ATP hydrolysis. Here we present the X-ray crystal structure at 3.5 A resolution......-subunit is contained within a pocket between transmembrane helices and seems to be a novel regulatory element controlling sodium affinity, possibly influenced by the membrane potential. Udgivelsesdato: 2007-Dec-13...

  9. Evaluating status change of soil potassium from path model.

    Directory of Open Access Journals (Sweden)

    Wenming He

    Full Text Available The purpose of this study is to determine critical environmental parameters of soil K availability and to quantify those contributors by using a proposed path model. In this study, plot experiments were designed into different treatments, and soil samples were collected and further analyzed in laboratory to investigate soil properties influence on soil potassium forms (water soluble K, exchangeable K, non-exchangeable K. Furthermore, path analysis based on proposed path model was carried out to evaluate the relationship between potassium forms and soil properties. Research findings were achieved as followings. Firstly, key direct factors were soil S, ratio of sodium-potassium (Na/K, the chemical index of alteration (CIA, Soil Organic Matter in soil solution (SOM, Na and total nitrogen in soil solution (TN, and key indirect factors were Carbonate (CO3, Mg, pH, Na, S, and SOM. Secondly, path model can effectively determine direction and quantities of potassium status changes between Exchangeable potassium (eK, Non-exchangeable potassium (neK and water-soluble potassium (wsK under influences of specific environmental parameters. In reversible equilibrium state of [Formula: see text], K balance state was inclined to be moved into β and χ directions in treatments of potassium shortage. However in reversible equilibrium of [Formula: see text], K balance state was inclined to be moved into θ and λ directions in treatments of water shortage. Results showed that the proposed path model was able to quantitatively disclose moving direction of K status and quantify its equilibrium threshold. It provided a theoretical and practical basis for scientific and effective fertilization in agricultural plants growth.

  10. Mechanism of cesium sorption on potassium titanium hexacyanoferrate

    International Nuclear Information System (INIS)

    Sun Yongxia; Xu Shiping; Song Chongli

    1998-01-01

    The mechanism of cesium sorption on potassium titanium hexacyanoferrate is described. The dependence of the sorption speed on temperature, particle granule size, and the stirring speed is studied. The results show that the sorption process is controlled by liquid film diffusion and particle diffusion. An exchange reaction occurs mainly between K + in the exchanger and Cs + in the solution, i.e. potassium titanium hexacyanoferrate, and Cs + of simulated high-level liquid waste

  11. Topical 5% potassium permanganate solution accelerates the healing process in chronic diabetic foot ulcers.

    Science.gov (United States)

    Delgado-Enciso, Iván; Madrigal-Perez, Violeta M; Lara-Esqueda, Agustin; Diaz-Sanchez, Martha G; Guzman-Esquivel, Jose; Rosas-Vizcaino, Luis E; Virgen-Jimenez, Oscar O; Kleiman-Trujillo, Juleny; Lagarda-Canales, Maria R; Ceja-Espiritu, Gabriel; Rangel-Salgado, Viridiana; Lopez-Lemus, Uriel A; Delgado-Enciso, Josuel; Lara-Basulto, Agustin D; Soriano Hernández, Alejandro D

    2018-02-01

    Potassium permanganate has been reported to be an effective treatment for certain types of wounds. The aim of the present study was to evaluate the use of potassium permanganate in the treatment of diabetic foot ulcers. A single-blind, randomized, controlled clinical trial was conducted on patients with type 2 diabetes mellitus that presented with a foot ulcer persisting for >3 months. The control group (n=10) was treated with the current standard treatment, which comprises of measures for reducing pressure in the ulcerated area, daily cleansing of the ulcer with potable water and antiseptic wash solution, and the application of a disinfectant solution on the entire surface area of the ulcer; while the intervention group (n=15) received the standard treatment plus 5% topical potassium permanganate solution applied once a day for 21 days. In the intervention group, 1 patient did not tolerate the treatment and was eliminated from the study on the first day. The remaining patients tolerated the interventions well. At the end of the treatment period, ulcers in the control group had decreased by 38% whereas those in the intervention group decreased by 73% (Ppermanganate is well tolerated and significantly accelerates the healing process of diabetic foot ulcers.

  12. Potassium-doped n-type bilayer graphene

    Science.gov (United States)

    Yamada, Takatoshi; Okigawa, Yuki; Hasegawa, Masataka

    2018-01-01

    Potassium-doped n-type bilayer graphene was obtained. Chemical vapor deposited bilayer and single layer graphene on copper (Cu) foils were used. After etching of Cu foils, graphene was dipped in potassium hydroxide aqueous solutions to dope potassium. Graphene on silicon oxide was characterized by X-ray photoelectron spectroscopy (XPS), energy dispersive X-ray spectroscopy (EDX), and Raman spectroscopy. Both XPS and EDX spectra indicated potassium incorporation into the bilayer graphene via intercalation between the graphene sheets. The downward shift of the 2D peak position of bilayer graphene after the potassium hydroxide (KOH) treatment was confirmed in Raman spectra, indicating that the KOH-treated bilayer graphene was doped with electrons. Electrical properties were measured using Hall bar structures. The Dirac points of bilayer graphene were shifted from positive to negative by the KOH treatment, indicating that the KOH-treated bilayer graphene was n-type conduction. For single layer graphene after the KOH treatment, although electron doping was confirmed from Raman spectra, the peak of potassium in the X-ray photoelectron spectroscopy (XPS) spectrum was not detected. The Dirac points of single layer graphene with and without the KOH treatment showed positive.

  13. Parathyroid hormone impairs extrarenal potassium tolerance in the rat

    International Nuclear Information System (INIS)

    Sugarman, A.; Kahn, T.

    1988-01-01

    The effect of parathyroid hormone (PTH) on the extrarenal disposition of an acute potassium load was examined in acutely nephrectomized rats infused with KCl alone or in combination with PTH, with serial monitoring of plasma potassium every 10 min. The rise in plasma potassium concentration (ΔPK) in the PTH group was higher than control. PTH was then administered along with KCl to two groups of nephrectomized and acutely thyroparathyroidectomized (TPTX) rats in doses of 1 and 0.25 U · kg -1 · min -1 for 90 min. ΔPK with PTH in both groups was higher than TPTX control. The two higher doses of PTH resulted in a decrease in mean arterial pressure from their respective controls. A similar reduction in arterial pressure in three groups of nephrectomized rats by administration of hydralazine or nitroprusside or by acute blood loss did not change ΔPK subsequent to potassium infusion from that in control rats. Furthermore, the lowest dose of PTH did not lower arterial pressure from its respective control. Therefore, hypotension is not a cause for the PTH-induced potassium intolerance. Serum levels of insulin, aldosterone, catecholamines, calcium, plasma HCO 3 concentration, and pH were not different in PTH-infused vs. respective control rats. These data suggest that PTH impairs extrarenal potassium disposal in the rat. The effect of PTH may relate to enhanced calcium entry into cells

  14. Radiolysis of titanium potassium oxalate in aqueous solution. [. gamma. rays

    Energy Technology Data Exchange (ETDEWEB)

    Bundo, Y; Ono, I [Industrial Research Inst. of Kanagawa Prefecture, Yokohama (Japan); Ogawa, T

    1975-01-01

    The dissolution state of titanium potassium oxalate in aqueous solution is different according to the pH. The yellowish brown titanium complex produced by the reaction of titanium potassium oxalate and hydrogen peroxide seems to be different in its structure according to the pH. Considering these points, gamma-ray irradiation was carried out on the sample by dissolving titanium potassium oxalate in purified water under the conditions of oxygen saturation and nitrogen saturation, and the relation between irradiation dose and the production of titanium complex was determined. On the basis of the experimental result, the mechanism of forming hydrogen peroxide was presumed. The radiation source used was 2,000 Ci of /sup 60/Co. For photometric analysis, a 139 type photoelectric spectrophotometer of Hitachi Ltd. was used. From the experimental results, in neutral water, titanium potassium oxalate exists in the state that two oxalic acid ions are coordinated to titanyl ion, while in case of the pH lowered by the addition of sulfuric acid, it can exist in the state that one oxalic acid ion is coordinated to titanyl ion. The yield of hydrogen peroxide produced by irradiating titanium potassium oxalate aqueous solution with gamma-ray is the sum of the molecular product from water and the radiolysis product from titanium potassium oxalate.

  15. Variable Potassium Concentrations: Which Is Right and Which Is Wrong?

    Science.gov (United States)

    Theparee, Talent; Benirschke, Robert C; Lee, Hong-Kee

    2017-05-01

    Reverse pseudohyperkalemia is a term used to describe in vitro, falsely elevated potassium concentrations in plasma specimens that occur in association with extreme leukocytosis and are commonly associated with hematologic malignant neoplasms. Tumor lysis syndrome is an in vivo lysis of tumor cells that leads to elevated levels of potassium, uric acid, phosphate, and lactate dehydrogenase, as well as decreased calcium concentrations. Herein, we report a case of a 66-year-old Caucasian man with stage IV mantle-cell lymphoma who has elevated levels of potassium, uric acid, and phosphorus, as well as a white blood cell (WBC) count greater than 100,000 cells per mm3. The patient initially was diagnosed as having tumor lysis syndrome. His subsequent potassium concentrations in whole blood remained elevated even after hemodialysis; however, his serum potassium concentrations were decreased. The patient then was diagnosed accurately as having reverse pseudohyperkalemia, and accurate potassium measurements were obtained via serum specimens. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Crosstalk between KCNK3-Mediated Ion Current and Adrenergic Signaling Regulates Adipose Thermogenesis and Obesity.

    Science.gov (United States)

    Chen, Yi; Zeng, Xing; Huang, Xuan; Serag, Sara; Woolf, Clifford J; Spiegelman, Bruce M

    2017-11-02

    Adrenergic stimulation promotes lipid mobilization and oxidation in brown and beige adipocytes, where the harnessed energy is dissipated as heat in a process known as adaptive thermogenesis. The signaling cascades and energy-dissipating pathways that facilitate thermogenesis have been extensively described, yet little is known about the counterbalancing negative regulatory mechanisms. Here, we identify a two-pore-domain potassium channel, KCNK3, as a built-in rheostat negatively regulating thermogenesis. Kcnk3 is transcriptionally wired into the thermogenic program by PRDM16, a master regulator of thermogenesis. KCNK3 antagonizes norepinephrine-induced membrane depolarization by promoting potassium efflux in brown adipocytes. This limits calcium influx through voltage-dependent calcium channels and dampens adrenergic signaling, thereby attenuating lipolysis and thermogenic respiration. Adipose-specific Kcnk3 knockout mice display increased energy expenditure and are resistant to hypothermia and obesity. These findings uncover a critical K + -Ca 2+ -adrenergic signaling axis that acts to dampen thermogenesis, maintain tissue homeostasis, and reveal an electrophysiological regulatory mechanism of adipocyte function. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Impact of potassium bromate and potassium iodate in a pound cake system.

    Science.gov (United States)

    Wilderjans, Edith; Lagrain, Bert; Brijs, Kristof; Delcour, Jan A

    2010-05-26

    This study investigates the impact of the oxidants potassium bromate and potassium iodate (8, 16, 32, 64, and 128 micromol/g dry matter of egg white protein) on pound cake making. The impact of the oxidants on egg white characteristics was studied in a model system. Differential scanning calorimetry showed that the oxidants caused egg white to denature later. During heating in a rapid visco analyzer, the oxidants caused the free sulfhydryl (SH) group levels to decrease more intensively and over a smaller temperature range. The oxidants made the proteins more resistant to decreases in protein extractability in sodium dodecyl sulfate containing buffer during cake recipe mixing and less resistant to such decreases during cake baking. We assume that, during baking, the degree to which SH/disulfide exchange and SH oxidation can occur depends on the properties of the protein at the onset of the process. In our view, the prevention of extractability loss during mixing increased the availability of SH groups and caused more such loss during baking. During cooling, all cakes baked with added oxidants showed less collapse. On the basis of the presented data, we put forward that only those protein reactions that occur during baking contribute to the formation of a network that supports final cake structure and prevents collapse.

  18. Tomato yield and potassium concentrations in soil and in plant petioles as affected by potassium fertirrigation

    Directory of Open Access Journals (Sweden)

    FONTES PAULO CEZAR REZENDE

    2000-01-01

    Full Text Available Tomato (Lycopersicon esculentum Mill. cv. Santa Clara was grown on a silt clay soil with 46 mg dm-3 Mehlich 1 extractable K, to evaluate the effects of trickle-applied K rates on fruit yield and to establish K critical concentrations in soil and in plant petioles. Six potassium rates (0, 48, 119, 189, 259 and 400 kg ha-1 K were applied in a randomized complete block design with four replications. Soil and plant K critical levels were determined at two plant growth stages (at the beginning of the second and fourth cluster flowering. Total, marketable and weighted yields increased with K rates, reaching their maximum of 86.4, 73.4, and 54.9 ton ha-1 at 198, 194, and 125 kg ha-1 K , respectively. At the first soil sampling date K critical concentrations in the soil associated with K rates for maximum marketable and weighted yields were 92 and 68 mg dm-3, respectively. Potassium critical concentrations in the dry matter of the petioles sampled by the beginning of the second and fourth cluster flowering time, associated with maximum weighted yield, were 10.30 and 7.30 dag kg-1, respectively.

  19. Ocular Injury due to Potassium Permanganate Granules

    Directory of Open Access Journals (Sweden)

    Chareenun Chirapapaisan

    2018-02-01

    Full Text Available Purpose: We report a rare case of ocular injury due to potassium permanganate (KMnO4 granules in a child. Methods: This is a retrospective case report. Results: A 2-year-old boy was transferred to our emergency room with severe pain in his right eye, inflamed eyelids, and brownish stains on his fingers. Chemical injury was suspected. Copious eye irrigation was immediately performed. Diffuse brownish splotches were then observed at the inferior bulbar conjunctiva. Otherwise, systemic organs were intact. Complete eye exam under general anesthesia revealed a 5-mm epithelial defect at the central cornea, along with generalized conjunctival injection and limbal ischemia, inferiorly. Multiple semi-dissolved granules of KMnO4 trapped in the inferior fornix were identified. The chemical particles were gradually washed out and removed; however, the brownish stains remained. The patient received preservative-free steroid, antibiotic eye drops, and lubricants as regular management for mild to moderate degree of ocular burn. Pseudomembrane developed early and transformed into symblepharon within a few days after the injury. Membrane adhesion was lysed, and more aggressive medications were then substituted. Commercial amniotic membrane (PROKERA® was also applied to promote wound healing and to prevent recurrence of symblepharon. The ocular surface was eventually restored, and corneal transparency was preserved. Conclusion: Ocular injury with the granular form of KMnO4 is rare. Its toxicity is comparable to concentrated KMnO4 solution. However, the dissolved particles that had been absorbed in the stained conjunctiva were continuously released and damaged the ocular surface more than we primarily anticipated. Awareness of this condition and prompt management yield a good treatment outcome.

  20. Ketone deprotonation mediated by mono- and heterobimetallic alkali and alkaline earth metal amide bases: structural characterization of potassium, calcium, and mixed potassium-calcium enolates.

    Science.gov (United States)

    He, Xuyang; Noll, Bruce C; Beatty, Alicia; Mulvey, Robert E; Henderson, Kenneth W

    2004-06-23

    Potassium, calcium, and mixed potassium-calcium amide combinations have been shown to be efficient reagents in enolization reactions, and a set of representative intermediate mono- and heterobimetallic enolates have been successfully isolated and crystallographically characterized.

  1. Inward rectifier potassium channels in the HL-1 cardiomyocyte-derived cell line.

    Science.gov (United States)

    Goldoni, Dana; Zhao, YouYou; Green, Brian D; McDermott, Barbara J; Collins, Anthony

    2010-11-01

    HL-1 is a line of immortalized cells of cardiomyocyte origin that are a useful complement to native cardiomyocytes in studies of cardiac gene regulation. Several types of ion channel have been identified in these cells, but not the physiologically important inward rectifier K(+) channels. Our aim was to identify and characterize inward rectifier K(+) channels in HL-1 cells. External Ba(2+) (100 µM) inhibited 44 ± 0.05% (mean ± s.e.m., n = 11) of inward current in whole-cell patch-clamp recordings. The reversal potential of the Ba(2+)-sensitive current shifted with external [K(+)] as expected for K(+)-selective channels. The slope conductance of the inward Ba(2+)-sensitive current increased with external [K(+)]. The apparent Kd for Ba(2+) was voltage dependent, ranging from 15 µM at -150  mV to 148 µM at -75  mV in 120  mM external K(+). This current was insensitive to 10 µM glybenclamide. A component of whole-cell current was sensitive to 150 µM 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS), although it did not correspond to the Ba(2+)-sensitive component. The effect of external 1 mM Cs(+) was similar to that of Ba(2+). Polymerase chain reaction using HL-1 cDNA as template and primers specific for the cardiac inward rectifier K(ir)2.1 produced a fragment of the expected size that was confirmed to be K(ir)2.1 by DNA sequencing. In conclusion, HL-1 cells express a current that is characteristic of cardiac inward rectifier K(+) channels, and express K(ir)2.1 mRNA. This cell line may have use as a system for studying inward rectifier gene regulation in a cardiomyocyte phenotype. © 2010 Wiley-Liss, Inc.

  2. Influence of Potassium on Sapric Peat under Different Environmental Conditions

    Science.gov (United States)

    Tajuddin, Syafik Akmal Mohd; Rahman, Junita Abdul; Rahim, Nor Haakmal Abd; Saphira Radin Mohamed, Radin Maya; Saeed Abduh Algheethi, Adel Ali, Dr

    2018-04-01

    Potassium is mainly present in soil in the natural form known as the K-bearing mineral. Potassium is also available in fertilizer as a supplement to plants and can be categorized as macronutrient. The application of potassium improves the texture and structure of the soil beside to improves plant growth. The main objective of this study was to determine the concentration of potassium in sapric peat under different conditions. Physical model was used as a mechanism for the analysis of the experimental data using a soil column as an equipment to produce water leaching. In this investigation, there were four outlets in the soil column which were prepared from the top of the column to the bottom with the purpose of identifying the concentration of potassium for each soil level. The water leaching of each outlet was tested using atomic absorption spectroscopy (AAS). The results obtained showed that the highest concentrations of potassium for flush condition at outlet 4 was 13.58 ppm. Similarly, sapric under rainwater condition recorded the highest value of 13.32 and 12.34 ppm respectively at outlet 4 for wet and dry condition. However, the difference in Sapric, rainwater and fertilizer category showed that the highest value for the wet condition was achieved at outlet 2 with 13.99 ppm while highest value of 14.82 ppm was obtained for the dry condition at the outlet 3. It was concluded that the outlets in the soil column gave a detailed analysis of the concentration of potassium in the soil which was influenced by the environmental conditions.

  3. Evaluating the effect of potassium on cellulose pyrolysis reaction kinetics

    International Nuclear Information System (INIS)

    Trendewicz, Anna; Evans, Robert; Dutta, Abhijit; Sykes, Robert; Carpenter, Daniel; Braun, Robert

    2015-01-01

    This paper proposes modifications to an existing cellulose pyrolysis mechanism in order to include the effect of potassium on product yields and composition. The changes in activation energies and pre-exponential factors due to potassium were evaluated based on the experimental data collected from pyrolysis of cellulose samples treated with different levels of potassium (0–1% mass fraction). The experiments were performed in a pyrolysis reactor coupled to a molecular beam mass spectrometer (MBMS). Principal component analysis (PCA) performed on the collected data revealed that cellulose pyrolysis products could be divided into two groups: anhydrosugars and other fragmentation products (hydroxyacetaldehyde, 5-hydroxymethylfurfural, acetyl compounds). Multivariate curve resolution (MCR) was used to extract the time resolved concentration score profiles of principal components. Kinetic tests revealed that potassium apparently inhibits the formation of anhydrosugars and catalyzes char formation. Therefore, the oil yield predicted at 500 ° C decreased from 87.9% from cellulose to 54.0% from cellulose with 0.5% mass fraction potassium treatment. The decrease in oil yield was accompanied by increased yield of char and gases produced via a catalyzed dehydration reaction. The predicted char and gas yield from cellulose were 3.7% and 8.4%, respectively. Introducing 0.5% mass fraction potassium treatment resulted in an increase of char yield to 12.1% and gas yield to 33.9%. The validation of the cellulose pyrolysis mechanism with experimental data from a fluidized-bed reactor, after this correction for potassium, showed good agreement with our results, with differences in product yields of up to 5%

  4. Potassium isotope abundances in Australasian tektites and microtektites.

    Science.gov (United States)

    Herzog, G. F.; O'D. Alexander, C. M.; Berger, E. L.; Delaney, J. S.; Glass, B. P.

    2008-10-01

    We report electron microprobe determinations of the elemental compositions of 11 Australasian layered tektites and 28 Australasian microtektites; and ion microprobe determinations of the 41K/39K ratios of all 11 tektites and 13 of the microtektites. The elemental compositions agree well with literature values, although the average potassium concentrations measured here for microtektites, 1.1 1.6 wt%, are lower than published average values, 1.9 2.9 wt%. The potassium isotope abundances of the Australasian layered tektites vary little. The average value of δ41K, 0.02 ± 0.12‰ (1σ mean), is indistinguishable from the terrestrial value (= 0 by definition) as represented by our standard, thereby confirming four earlier tektite analyses of Humayun and Koeberl (2004). In agreement with those authors, we conclude that evaporation has significantly altered neither the isotopic nor the elemental composition of Australasian layered tektites for elements less volatile than potassium. Although the average 41K/39K ratio of the microtektites, 1.1 ± 1.7‰ (1σ mean), is also statistically indistinguishable from the value for the standard, the individual ratios vary over a very large range, from -10.6 ± 1.4‰ to +13.8 ± 1.5‰ and at least three of them are significantly different from zero. We interpret these larger variations in terms of the evaporation of isotopically light potassium; condensation of potassium in the vapor plume; partial or complete stirring and quenching of the melts; and the possible uptake of potassium from seawater. That the average 41K/39K ratio of the microtektites equals the terrestrial value suggests that the microtektite-forming system was compositionally closed with respect to potassium and less volatile elements. The possibility remains open that 41K/39K ratios of microtektites vary systematically with location in the strewn field.

  5. Niobium 1 percent zirconium/potassium and titanium/potassium life-test heat pipe design and testing

    Science.gov (United States)

    Sena, J. Tom; Merrigan, Michael A.

    Experimental lifetime performance studies currently in progress use Niobium 1 percent Zirconium (Nb-1Zr) and Titanium (Ti) heat pipes with potassium (K) as the working fluid. A heat pipe life test matrix was developed for testing the heat pipes. Because the corrosion rates in alkali metal heat pipes are affected by temperature and working fluid evaporation flux, the variable parameters of the experimental matrix are established as steady operating temperature and input heat flux density. Total impurity inventory is a factor in corrosion rate so impurity levels are being evaluated in the heat pipe materials before and after testing. Eight Nb-1Zr/K heat pipes were designed, fabricated, and tested. Two of the heat pipes have completed testing whereas the other six are currently in test. These are gravity assist heat pipes operating in a reflux mode. The heat pipes are tested by sets, one set of two and two sets of three heat pipes. Three Ti/K heat pipes are also in life test. These heat pipes are tested as a set in a horizontal position in a capillary pumped annular flow mode. Each of the heat pipes is encapsulated in a quartz vacuum container with a water calorimeter over the vacuum container for power throughput measurements. Thermocouples are attached to the heat pipes for measuring temperature. Heat input to the heat pipes is via an RF coil. The heat pipes are operating at between 800 and 900 K, with heat input fluxes of 13.8 to 30 W/sq cm. Of the Nb-1Zr/K heat pipes, two of the heat pipes have been in operation for 14,000 hours, three over 10,000 hours, and three over 7,000 hours. The Ti/K heat pipes have been in operation for 1,266 hours.

  6. 5-HT modulation of hyperpolarization-activated inward current and calcium- dependent outward current in a crustacean motor neuron

    DEFF Research Database (Denmark)

    Kiehn, O.; Harris-Warrick, R. M.

    1992-01-01

    1. Serotonergic modulation of a hyperpolarization-activated inward current, I(h), and a calcium-dependent outward current, I(o(Ca)), was examined in the dorsal gastric (DG) motor neuron, with the use of intracellular recording techniques in an isolated preparation of the crab stomatogastric....... The time course of activation of I(h) was well fitted by a single exponential function and strongly voltage dependent. 5-HT increased the rate of activation of I(h). 5- HT also slowed the rate of deactivation of the I(h) tail on repolarization to -50 mV. 6. The activation curve for the conductance (G...... reduced or eliminated the 5-HT response in the depolarizing range, suggesting that 5-HT specifically reduces I(o(Ca)). 11. These results demonstrate that 5-HT has dual effects on the DG motor neuron, in the crab stomatogastric ganglion. We suggest that changes in the two conductances are responsible...

  7. Combustion aerosols from potassium-containing fuels

    International Nuclear Information System (INIS)

    Balzer Nielsen, Lars

    1998-01-01

    The scope of the work presented in this thesis is the formation and evolution of aerosol particles in the submicron range during combustion processes, in particular where biomass is used alone or co-fired with coal. An introduction to the formation processes of fly ash in general and submicron aerosol in particular during combustion is presented, along with some known problems related to combustion of biomass for power generation. The work falls in two parts. The first is the design of a laboratory setup for investigation of homogeneous nucleation and particle dynamics at high temperature. The central unit of the setup is a laminar flow aerosol condenser (LFAC), which essentially is a 173 cm long tubular furnace with an externally cooled wall. A mathematical model is presented which describes the formation and evolution of the aerosol in the LFAC, where the rate of formation of new nuclei is calculated using the so-called classical theory. The model includes mass and energy conservation equations and an expression for the description of particle growth by diffusion. The resulting set of nonlinear second-order partial differential equations are solved numerically using the method of orthogonal collocation. The model is implemented in the FORTRAN code MONAERO. The second part of this thesis describes a comprehensive investigation of submicron aerosol formation during co-firing of coal and straw carried out at a 380 MW Th pulverized coal unit at Studstrup Power Plant, Aarhus. Three types of coal are used, and total boiler load and straw input is varied systematically. Straw contains large amounts of potassium, which is released during combustion. Submicron aerosol is sampled between the two banks of the economizer at a flue gas temperature of 350 deg. C using a novel ejector probe. The aerosol is characterized using the SMPS system and a Berner-type low pressure impactor. The chemical composition of the particles collected in the impactor is determined using chemical

  8. Combustion aerosols from potassium-containing fuels

    Energy Technology Data Exchange (ETDEWEB)

    Balzer Nielsen, Lars

    1999-12-31

    The scope of the work presented in this thesis is the formation and evolution of aerosol particles in the submicron range during combustion processes, in particular where biomass is used alone or co-fired with coal. An introduction to the formation processes of fly ash in general and submicron aerosol in particular during combustion is presented, along with some known problems related to combustion of biomass for power generation. The work falls in two parts. The first is the design of a laboratory setup for investigation of homogeneous nucleation and particle dynamics at high temperature. The central unit of the setup is a laminar flow aerosol condenser (LFAC), which essentially is a 173 cm long tubular furnace with an externally cooled wall. A mathematical model is presented which describes the formation and evolution of the aerosol in the LFAC, where the rate of formation of new nuclei is calculated using the so-called classical theory. The model includes mass and energy conservation equations and an expression for the description of particle growth by diffusion. The resulting set of nonlinear second-order partial differential equations are solved numerically using the method of orthogonal collocation. The model is implemented in the FORTRAN code MONAERO. The second part of this thesis describes a comprehensive investigation of submicron aerosol formation during co-firing of coal and straw carried out at a 380 MW{sub Th} pulverized coal unit at Studstrup Power Plant, Aarhus. Three types of coal are used, and total boiler load and straw input is varied systematically. Straw contains large amounts of potassium, which is released during combustion. Submicron aerosol is sampled between the two banks of the economizer at a flue gas temperature of 350 deg. C using a novel ejector probe. The aerosol is characterized using the SMPS system and a Berner-type low pressure impactor. The chemical composition of the particles collected in the impactor is determined using

  9. Combustion aerosols from potassium-containing fuels

    Energy Technology Data Exchange (ETDEWEB)

    Balzer Nielsen, Lars

    1998-12-31

    The scope of the work presented in this thesis is the formation and evolution of aerosol particles in the submicron range during combustion processes, in particular where biomass is used alone or co-fired with coal. An introduction to the formation processes of fly ash in general and submicron aerosol in particular during combustion is presented, along with some known problems related to combustion of biomass for power generation. The work falls in two parts. The first is the design of a laboratory setup for investigation of homogeneous nucleation and particle dynamics at high temperature. The central unit of the setup is a laminar flow aerosol condenser (LFAC), which essentially is a 173 cm long tubular furnace with an externally cooled wall. A mathematical model is presented which describes the formation and evolution of the aerosol in the LFAC, where the rate of formation of new nuclei is calculated using the so-called classical theory. The model includes mass and energy conservation equations and an expression for the description of particle growth by diffusion. The resulting set of nonlinear second-order partial differential equations are solved numerically using the method of orthogonal collocation. The model is implemented in the FORTRAN code MONAERO. The second part of this thesis describes a comprehensive investigation of submicron aerosol formation during co-firing of coal and straw carried out at a 380 MW{sub Th} pulverized coal unit at Studstrup Power Plant, Aarhus. Three types of coal are used, and total boiler load and straw input is varied systematically. Straw contains large amounts of potassium, which is released during combustion. Submicron aerosol is sampled between the two banks of the economizer at a flue gas temperature of 350 deg. C using a novel ejector probe. The aerosol is characterized using the SMPS system and a Berner-type low pressure impactor. The chemical composition of the particles collected in the impactor is determined using

  10. Urinary potassium to urinary potassium plus sodium ratio can accurately identify hypovolemia in nephrotic syndrome: a provisional study.

    Science.gov (United States)

    Keenswijk, Werner; Ilias, Mohamad Ikram; Raes, Ann; Donckerwolcke, Raymond; Walle, Johan Vande

    2018-01-01

    There is evidence pointing to a decrease of the glomerular filtration rate (GFR) in a subgroup of nephrotic children, likely secondary to hypovolemia. The aim of this study is to validate the use of urinary potassium to the sum of potassium plus sodium ratio (UK/UK+UNa) as an indicator of hypovolemia in nephrotic syndrome, enabling detection of those patients who will benefit from albumin infusion. We prospectively studied 44 nephrotic children and compared different parameters to a control group (36 children). Renal perfusion and glomerular permeability were assessed by measuring clearance of para-aminohippurate and inulin. Vaso-active hormones and urinary sodium and potassium were also measured. Subjects were grouped into low, normal, and high GFR groups. In the low GFR group, significantly lower renal plasma flow (p = 0.01), filtration fraction (p = 0.01), and higher UK/UK+UNa (p = 0.03) ratio were noted. In addition, non-significant higher plasma renin activity (p = 0.11) and aldosteron (p = 0.09) were also seen in the low GFR group. A subgroup of patients in nephrotic syndrome has a decrease in glomerular filtration, apparently related to hypovolemia which likely can be detected by a urinary potassium to potassium plus sodium ratio > 0.5-0.6 suggesting benefit of albumin infusion in this subgroup. What is Known: • Volume status can be difficult to assess based on clinical parameters in nephrotic syndrome, and albumin infusion can be associated with development of pulmonary edema and fluid overload in these patients. What is New: • Urinary potassium to the sum of urinary potassium plus sodium ratio can accurately detect hypovolemia in nephrotic syndrome and thus identify those children who would probably respond to albumin infusion.

  11. Soil salinity and yield of mango fertigated with potassium sources

    Directory of Open Access Journals (Sweden)

    Marcio A. Carneiro

    Full Text Available ABSTRACT Irrigated fruit crops have an important role in the economic and social aspects in the region of the Sub-middle São Francisco River Valley. Thus, the aim of this study was to evaluate soil salinity and the productive aspects of the mango crop, cv. Tommy Atkins, fertigated with doses of potassium chloride (KCl and potassium sulfate (K2SO4 during two crop cycles (from January to March 2014 and from January to March 2015. The experiment was carried out in a strip-split-plot design and five potassium doses (50, 75, 100, 125 and 150% of the recommended dose as plots and two potassium sources (KCl and K2SO4 as subplots, with four replicates. Soil electrical conductivity (EC, exchangeable sodium (Na+ and potassium (K+ contents and pH were evaluated. In addition, the number of commercial fruits and yield were determined. The fertilization with KCl resulted in higher soil EC compared with K2SO4 fertigation. Soil Na+ and K+ contents increased with increasing doses of fertilizers. K2SO4 was more efficient for the production per plant and yield than KCl. Thus, under the conditions of this study, the K2SO4 dose of 174.24 g plant-1 (24.89 kg ha-1 or 96.8% of recommendation, spacing of 10 x 7 m was recommended for a yield of 23.1 t ha-1 of mango fruits, cv. Tommy Atkins.

  12. Potassium acceptor doping of ZnO crystals

    Directory of Open Access Journals (Sweden)

    Narendra S. Parmar

    2015-05-01

    Full Text Available ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ∼1 × 1016 cm−3. IR measurements show a local vibrational mode (LVM at 3226 cm−1, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O–H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm−1. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  13. Potassium acceptor doping of ZnO crystals

    Science.gov (United States)

    Parmar, Narendra S.; Corolewski, Caleb D.; McCluskey, Matthew D.; Lynn, K. G.

    2015-05-01

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ˜1 × 1016 cm-3. IR measurements show a local vibrational mode (LVM) at 3226 cm-1, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O-H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm-1. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  14. Potassium acceptor doping of ZnO crystals

    Energy Technology Data Exchange (ETDEWEB)

    Parmar, Narendra S., E-mail: nparmar@wsu.edu; Lynn, K. G. [Center for Materials Research, Washington State University, Pullman, Washington 99164-2711 (United States); Department of Physics and Astronomy, Washington State University, Pullman, Washington 99164-2814 (United States); Corolewski, Caleb D.; McCluskey, Matthew D. [Department of Physics and Astronomy, Washington State University, Pullman, Washington 99164-2814 (United States)

    2015-05-15

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ∼1 × 10{sup 16} cm{sup −3}. IR measurements show a local vibrational mode (LVM) at 3226 cm{sup −1}, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O–H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm{sup −1}. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  15. Cholesterol influences voltage-gated calcium channels and BK-type potassium channels in auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Erin K Purcell

    Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.

  16. Gamma-spectrometric correction in radiometric determination of potassium

    International Nuclear Information System (INIS)

    Gejsler, M.

    1979-01-01

    The method is described of determination of potassium in mixed fertilizers in production conditions on a chemical enterprise in the GDR. Potassium content was determined according to the value of measured radiation from potassium-40. For measurement probes were used with radiation counters. While changing raw material, coming to the enterprise has been established that in raw phosphate, supplied from Morocco, there is low enough concentration of the natural radioactive isotopes of the uranium-radium series. In this connection, the two-cannel gamma-spectroscopy method has been developed taking into account influence of the background from these isotopes. Principles are explained of the method used and descriptions are given of the instruments used and sources of errors are listed. Relative standard deviation of the potassiun determination by this method equals nearly to 5% [ru

  17. Effects of potassium hydroxide post-treatments on the field-emission properties of thermal chemical vapor deposited carbon nanotubes.

    Science.gov (United States)

    Lee, Li-Ying; Lee, Shih-Fong; Chang, Yung-Ping; Hsiao, Wei-Shao

    2011-12-01

    In this study, a simple potassium hydroxide treatment was applied to functionalize the surface and to modify the structure of multi-walled carbon nanotubes grown on silicon substrates by thermal chemical vapor deposition. Scanning electron microscopy, transmission electron microscopy, Raman spectroscopy, and energy dispersive spectrometry were employed to investigate the mechanism causing the modified field-emission properties of carbon nanotubes. From our experimental data, the emitted currents of carbon nanotubes after potassium hydroxide treatment are enhanced by more than one order of magnitude compared with those of untreated carbon nanotubes. The emitted current density of carbon nanotubes increases from 0.44 mA/cm2 to 7.92 mA/cm2 after 30 minutes KOH treatment. This technique provides a simple, economical, and effective way to enhance the field-emission properties of carbon nanotubes.

  18. Test Requirements and Conceptual Design for a Potassium Test Loop to Support an Advanced Potassium Rankine Cycle Power Conversion Systems

    Energy Technology Data Exchange (ETDEWEB)

    Yoder, JR.G.L.

    2006-03-08

    Parameters for continuing the design and specification of an experimental potassium test loop are identified in this report. Design and construction of a potassium test loop is part of the Phase II effort of the project ''Technology Development Program for an Advanced Potassium Rankine Power Conversion System''. This program is supported by the National Aeronautics and Space Administration. Design features for the potassium test loop and its instrumentation system, specific test articles, and engineered barriers for ensuring worker safety and protection of the environment are described along with safety and environmental protection requirements to be used during the design process. Information presented in the first portion of this report formed the basis to initiate the design phase of the program; however, the report is a living document that can be changed as necessary during the design process, reflecting modifications as additional design details are developed. Some portions of the report have parameters identified as ''to be determined'' (TBD), reflecting the early stage of the overall process. In cases where specific design values are presently unknown, the report attempts to document the quantities that remain to be defined in order to complete the design of the potassium test loop and supporting equipment.

  19. Complex N-Glycans Influence the Spatial Arrangement of Voltage Gated Potassium Channels in Membranes of Neuronal-Derived Cells.

    Directory of Open Access Journals (Sweden)

    M Kristen Hall

    proteins to the cell body and outgrowths and thereby can generate different voltage-dependent conductances in these membranes.

  20. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons.

    Science.gov (United States)

    Benhassine, Narimane; Berger, Thomas

    2005-02-01

    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  1. Phencyclidine block of calcium current in isolated guinea-pig hippocampal neurones.

    Science.gov (United States)

    Ffrench-Mullen, J M; Rogawski, M A

    1992-10-01

    1. Phencyclidine (PCP) block of Ca2+ channel current in enzymatically dissociated neurones from the CA1 region of the adult guinea-pig hippocampus was studied using whole-cell voltage clamp techniques. Ca2+ channel current was recorded with 3 mM-Ba2+ as the charge carrier. Na+ currents were blocked with tetrodotoxin and K+ currents were eliminated by using tetraethylammonium and N-methyl-D-glucamine as the predominant extracellular and intracellular cations, respectively. 2. Peak Ca2+ channel current evoked by depolarization from -80 to -10 mV was reduced in a use-dependent fashion by PCP. The apparent forward and reverse rate constants for block at the depolarized voltage were 10(6) s-1 M-1 and 11-14 s-1, respectively. These values were at least 60 times faster than the corresponding rates at the resting voltage. The steady-state block produced by PCP increased in a concentration-dependent fashion with an IC50 of 7 microM. Other dissociative anaesthetic drugs were substantially weaker inhibitors of the current (tiletamine > dizocilpine (MK-801) > ketamine). 3. The Ca2+ channel current recorded under identical conditions in rat dorsal root ganglion neurones was less sensitive to blockade by PCP (IC50, 90 microM). 4. PCP block of the hippocampal Ca2+ channel current occurred in a voltage-dependent fashion with the fractional block decreasing at positive membrane potentials. Analysis indicated that the PCP blocking site senses 56% of the transmembrane electric field. 5. Analysis of tail currents recorded at -80 mV demonstrated that PCP does not affect the voltage-dependent or time-dependent activation or deactivation of the Ca2+ channel current. 6. The rate and extent of inactivation of the Ca2+ channel current was maximal at -10 mV and diminished at more positive potentials. Experiments with Ba(2+)-free external solution demonstrated that inactivation of the Ca2+ channels is largely voltage-dependent and is not affected by Ba2+ influx. 7. PCP markedly increased the

  2. Electrocardiography and serum potassium before and after hemodialysis sessions

    International Nuclear Information System (INIS)

    Tarif, N.; Al-Wakeel, Jamal Saleh; Sulaimani, F.; Memon, Nawaz Ali; Al-Suwaida, Abdul Kareem; Yamani, H.; Bakhsh, Ahmed Jahangir

    2008-01-01

    This study was undertaken to assess potassium level and electrocardiographic (ECG) changes post hemodialysis and whether fall in potassium level during hemodialysis may potentiate cardiac arrythemia. We studied 21 chronic hemodialysis (HD) patients who had their serum electrolytes measured before and after dialysis session and ECG performed at the same time. The patients included 14 females and 7 males with a mean age of 53.1+-15.6 years and range from 26 to 81 years; 9 (43%) patients were diabetics. All the patients had been on dialysis for a minimum of 6 months each Pre-HD serum potassium levels had no correlation with any ECG parameters except a negative correlation with T wave amplitude r=-0.5, p=0.021. ECG parameters significantly changed post-HD; the T wave amplitude decreased and the R wave amplitude increased. A comparatively higher R wave significantly decreased the T to R wave ratio post dialysis. The QRS duration and QTc interval also increased significantly. The patients with post-HD serum potassium of 3.5 mmol/L had a higher R wave amplitude and a significantly less T to R wave ratio (11.8+-9.7 vs 6.4+-5.1, p=0.045 and 0.4+-0.38 vs 1.0+-0.97, p=0.049, respectively. In patients with serum potassium decrement of >2.0 mmol/L, the T to R wave ratio decreased significantly, 0.32+-0.21 vs 0.85+-0.26, p=0.023; The T wave amplitude decreased more than the rise in R wave. Multiple regression analysis did not reveal any relationship of pre or post HD ECG changes and serum potassium, serum calcium or net change in serum potassium post-HD. We conclude that post-HD serum potassium decrement results in a decrease in T to R wave ratio on ECG; this change may have an arrhythmogenic potential. (author)

  3. Changes in plasma potassium concentration during carbon dioxide pneumoperitoneum

    DEFF Research Database (Denmark)

    Perner, A; Bugge, K; Lyng, K M

    1999-01-01

    Hyperkalaemia with ECG changes had been noted during prolonged carbon dioxide pneumoperitoneum in pigs. We have compared plasma potassium concentrations during surgery in 11 patients allocated randomly to undergo either laparoscopic or open appendectomy and in another 17 patients allocated randomly...... to either carbon dioxide pneumoperitoneum or abdominal wall lifting for laparoscopic colectomy. Despite an increasing metabolic acidosis, prolonged carbon dioxide pneumoperitoneum resulted in only a slight increase in plasma potassium concentrations, which was both statistically and clinically insignificant....... Thus hyperkalaemia is unlikely to develop in patients with normal renal function undergoing carbon dioxide pneumoperitoneum for laparoscopic surgery....

  4. Potassium Permanganate as an Alternative for Gold Mining Wastewater Treatment

    Science.gov (United States)

    Ordiales, M.; Fernández, D.; Verdeja, L. F.; Sancho, J.

    2015-09-01

    The feasibility of using potassium permanganate as a reagent for cyanide oxidation in wastewater was experimentally studied. Both artificial and production wastewater from two different gold mines were tested. The experiments had three goals: determine the optimum reagent concentration and reaction time required to achieve total cyanide removal, obtain knowledge of the reaction kinetics, and improve the management of the amount of reagent. The results indicate that potassium permanganate is an effective and reliable oxidizing agent for the removal of cyanide from gold mining wastewater.

  5. Mass-spectrometric study of thermodynamics of molybdate potassium evaporation

    International Nuclear Information System (INIS)

    Kazenas, E.K.; Tsvetkov, Yu.V.; Samojlova, I.O.; Astakhova, G.K.; Petrov, A.A.

    2002-01-01

    One investigated into evaporation of potassium molybdate within 1170-1310 K temperature range using platinum effusion chambers. Evaporation of potassium molybdate within 1170-1310 K temperature range may be described as follows: K 2 MoO 4(s,l) = K 2 MoO 4(g) . Based on method of least squares one calculated equation of K 2 MoO 4(g) vapor pressure (pressure in millimeters of mercury column) dependence on temperature for 1200-1320 K range. One evaluated value of K 2 MoO 4(g) molecule atomization energy [ru

  6. Preparation of potassium tantalum fluoride from tantalum hydroxide

    International Nuclear Information System (INIS)

    Silva, F.T. da; Espinola, A.; Dutra, A.J.B.

    1987-01-01

    Potassium tantalum fluoride (K 2 TaF 7 ) is an intermediary product in the processing of tantaliferous materials; it is the basic raw material for both reduction processes in use presently: reduction by metallic sodium and electrolysis in molten halides. It is normally obtained from a fluorotantalic acid solution to which potassium ions are added the precipitation of white acicular crystals of K 2 TaF 7 . The conditions for precipitation and recrystallization were studied, and crystal characterization were done by scanning electron microscopy, X-ray diffraction and thermogravimetric and thermodifferential analyses. (Author) [pt

  7. Potassium vapor assisted preparation of highly graphitized hierarchical porous carbon for high rate performance supercapacitors

    Science.gov (United States)

    Liu, Zheng; Zeng, Ying; Tang, Qunli; Hu, Aiping; Xiao, Kuikui; Zhang, Shiying; Deng, Weina; Fan, Binbin; Zhu, Yanfei; Chen, Xiaohua

    2017-09-01

    Ultrahigh graphitized carbon microspheres with rich hierarchical pores (AGHPCM-1) have been successfully synthesized through the one-step activation-carbonization strategy (OACS) with porous sulfonated poly-divinylbenzene as the carbon precursor, iron as the hard template and catalyst, and potassium hydroxide (KOH) as activation agent. Through the XRD, TEM, Raman and BET analysis, AGHPCM-1 shows very high graphitization degree and rich micro-, meso- and macro-pores. More importantly, the mechanism for KOH to improve the graphitization degree of carbon materials in OACS has been illustrated by the thermodynamical theory. The tremendous heat releasing from the reaction between the catalyst precursor of Fe2O3 and potassium vapor plays a key role in the formation of graphitized carbon. It may provide a general direction to prepare highly graphitized porous carbon at a moderate temperature. Integrating the advantages of high graphitization degree and rich hierarchical porous structure, the AGHPCM-1 exhibits an excellent rate performance with a response to up to the high current density of 150 A g-1 and high scan rate of 2000 mV s-1. No obvious capacitance decay can be observed after 10000 charge/discharge cycles even at the high current density of 20 A g-1.

  8. Relationship of soil potassium forms with maize potassium contents in soils derived from different parent materials

    Directory of Open Access Journals (Sweden)

    Rashid Mehmood Butt

    2017-06-01

    Full Text Available Understanding of soil potassium (K dynamics is essential for sustainable crop production. Bioavailability of K depends on forms and distribution within the soil profile. The objectives of this research were to determine which soil K forms control the maize (Zea mays K contents and compare the extracting capability of sodium tetraphenylborate (NaTPB with ammonium acetate (NH4OAc method. Nine soils representing three different parent materials, i.e. loess, sandstone and shale were sampled at three surface genetic horizons. Within each parent material, three soils at varying level of development were selected. Besides basic soil parameters, K was fractioned into water soluble K, exchangeable K, non-exchangeable K, and NaTPB-extracted K. The maize was sown in pots having 2 kg soil from each genetic horizon. Crop was harvested at seven weeks and plant was analysed for K contents. Results show that NaTPB-extracted K gave best correlation as compared to NH4OAc method. This conveys that a non-exchangeable K portion that becomes available to plants can be better estimated by NaTPB method than NH4OAc extraction.

  9. Dielectric behaviour of sodium and potassium doped magnesium ...

    Indian Academy of Sciences (India)

    Dielectric behaviour of sodium and potassium doped magnesium titanate. VISHNU SHANKER. ∗. , SANTOSH KUMAR and T SURENDAR. Department of Chemistry, National Institute of Technology, Warangal 506 004, India. MS received 10 November 2011; revised 27 February 2012. Abstract. Pure phase of magnesium ...

  10. Performance Evaluation of Refractory Composite Coatings in Potassium Rich Environment

    Directory of Open Access Journals (Sweden)

    Kristina BRINKIENĖ

    2016-09-01

    Full Text Available A laboratory scale method was used to study the performance of reinforced cement composites in potassium rich environment of biomass combustion. Buckwheat husk (BH was used as potential source of unexploited biomass product applicable as biomass derived fuel. In order to enhance the alkali effect on the properties of the investigated materials, the solution of potassium carbonate (K2CO3 was selected as potassium rich aggressive environment. Two reinforced cement composites as potential repair coatings for restoration of damaged refractory surfaces with different composition of aggregate were used in corrosion tests. Performance of refractory coatings was evaluated by analysing the microstructure of the treated composites as well as mechanical properties. Energy-dispersive X-ray spectroscopy (SEM/EDS and optical microscopy were used to study the microstructure in the corroded region of the refractory coatings. Long term studies in the solution of 1M K2CO3 for 56 months have demonstrated that composite with the additive of fluid cracking catalyst of oil refinery and petrochemical industries is more durable in the potassium rich environment.DOI: http://dx.doi.org/10.5755/j01.ms.22.3.8348

  11. Treatment of amiodarone-induced hypothyroidism with potassium perchlorate

    NARCIS (Netherlands)

    van Dam, E. W.; Prummel, M. F.; Wiersinga, W. M.; Nikkels, R. E.

    1993-01-01

    The antiarrhythmic drug, amiodarone, induces thyroid dysfunction, which is potentially dangerous in cardiac patients. After discontinuation of the drug it takes several months before euthyroidism is restored. The potent antithyroid drug, potassium perchlorate (KClO4), is used successfully to treat

  12. New nonabsorbable potassium-exchange resins in hyperkalaemia

    NARCIS (Netherlands)

    Roscioni, Sara S.; Lambers Heerspink, Hiddo

    New data suggest that treatment with patiromer or sodium zirconium cyclosilicate for up to 8 weeks reduces plasma potassium levels in hyperkalaemic patients. If proven safe and effective for long-term use, these therapies might be administered together with intensive renin-angiotensin-aldosterone

  13. Cranial MR imaging findings of potassium chlorate intoxication.

    Science.gov (United States)

    Mutlu, Hakan; Silit, Emir; Pekkafali, Zekai; Basekim, C Cinar; Kizilkaya, Esref; Ay, Hakan; Karsli, A Fevzi

    2003-08-01

    We present the case of a patient who attempted suicide by ingesting matchstick heads (55% potassium chlorate). The patient presented to the emergency room with loss of consciousness, and MR imaging revealed symmetric hyperintense signal within the deep gray matter and medial temporal lobes. The patient improved after undergoing conventional treatment and hyperbaric oxygen.

  14. Sodium and potassium concentrations in floral nectars in relation to ...

    African Journals Online (AJOL)

    1989-08-03

    Aug 3, 1989 ... techniques (Instrumentation Laboratory Model IL 243). In order to examine ... mmol. Potassium and sugar concentrations were very poorly ... cations that the error in calculating its energy content would be .... mellifica adults (subspecies not named). .... consumption, and thoracic temperature during flight in a.

  15. Determination and comparison of vitamin C, calcium and potassium ...

    African Journals Online (AJOL)

    It is evident that the growing interest in organically grown produce has correspondingly necessitated the debate on the nutritional supremacy between organically and conventionally grown produce. A study was carried out to determine and compare vitamin C, calcium and potassium in organically and conventionally grown ...

  16. How Potassium Can Help Control High Blood Pressure

    Science.gov (United States)

    ... Aneurysm More How Potassium Can Help Control High Blood Pressure Updated:Jan 29,2018 Understanding the heart-healthy ... This content was last reviewed October 2016. High Blood Pressure • Home • Get the Facts About HBP • Know Your ...

  17. The mutagenic potentials of potassium bromate and some ...

    African Journals Online (AJOL)

    Food additives are substances added to preserve flavour or improve the taste and appearance of food. The continuous consumption of these food additives could be hazardous to human health. Food additives including sodium bicarbonate, sodium benzoate, ammonium bicarbonate and potassium bromate were subjected ...

  18. Effect of gibberellic acid and potassium nitrate on seed germination ...

    African Journals Online (AJOL)

    Ramonda serbica and Ramonda nathaliae are rare resurrection plants, endemic and relict species from Balkan Peninsula. The effect of gibberellic acid (GA3) and potassium nitrate (KNO3) were conducted to determine the seed germination response for these two species. An experiment was conducted with four ...

  19. Isotope effect in the Knight shift of potassium

    International Nuclear Information System (INIS)

    Sahm, W.; Schwenk, A.

    1975-01-01

    The Knight shifts of the potassium isotopes 39 K and 41 K were determined with high accuracy: Ksup((39)) = 0.274 35(10)% and Ksup((41)) = 0.274 93(12)%. The relative isotope effect ΔK/K = -0.210 (20)% is in agreement with the hyperfine structure anomaly 39 Δ 41 . (orig.) [de

  20. Mechanism of Proarrhythmic Effects of Potassium Channel Blockers

    DEFF Research Database (Denmark)

    Skibsbye, Lasse; Ravens, Ursula

    2016-01-01

    Any disturbance of electrical impulse formation in the heart and of impulse conduction or action potential (AP) repolarization can lead to rhythm disorders. Potassium (K(+)) channels play a prominent role in the AP repolarization process. In this review we describe the causes and mechanisms...

  1. Formulation and evaluation of sublingual tablets of losartan potassium

    Directory of Open Access Journals (Sweden)

    Nikunj J. Aghera

    2012-05-01

    Full Text Available Objective: Sublingual tablets of Losartan Potassium were prepared to improve its bioavailability, to avoid pre-systemic metabolism in the gastrointestinal tract and hepatic first pass elimination. Methods: The Sublingual tablets were prepared by direct compression procedure using different concentration of Starch 1500 and microcrystalline cellulose. Compatibility studies of drug and polymer were performed by FTIR spectroscopy and DSC. Preformulation property of API was evaluated. Postcompressional parameters such disintegration time, wetting time, water absorption ratio, in vitro drug release and in vivo bioavailability study of optimized formulation were determined. Results: FTIR spectroscopy and DSC study revealed that there was no possible interaction between drug and polymers. The precompression parameters were in acceptable range of pharmacopoeial specification. The disintegration time of optimized formulation (F3 was upto 48 sec. The in vitro release of Losartan Potassium was upto 15 min. The percentage relative bioavailability of Losartan Potassium from optimized sublingual tablets was found to be 144.7 %. Conclusions: Sublingual tablets of Losartan Potassium were successfully prepared with improved bioavailability.

  2. Noise Controlled Synchronization in Potassium Coupled Neural Models

    DEFF Research Database (Denmark)

    Postnov, D. E.; Ryazanova, L. S.; Zhirin, R. A.

    2007-01-01

    The paper applies biologically plausible models to investigate how noise input to small ensembles of neurons, coupled via the extracellular potassium concentration, can influence their firing patterns. Using the noise intensity and the volume of the extracellular space as control parameters, we......-temporal oscillations in neuronal ensembles....

  3. Quaternary system of lithium, potassium, calcium and strontium fluorides

    International Nuclear Information System (INIS)

    Garkushin, I.K.; Voronin, K.Yu.; Dibirov, M.A.; Miftakhov, T.T.

    1996-01-01

    Four-component system of lithium, potassium, calcium and strontium fluorides is studied by differential thermal analysis. A low-melting eutectic composition is revealed, specific fusion heat of the composition is experimentally determined, its thermal properties are calculated. 8 refs., 5 figs., 1 tab

  4. Effect of osmolarity on potassium transport in isolated cerebral microvessels

    International Nuclear Information System (INIS)

    Lin, J.D.

    1988-01-01

    Potassium transport in microvessels isolated from rat brain by a technique involving density gradient centrifugation was studied in HEPES buffer solutions of varying osmolarity from 200 to 420 mosmols, containing different concentration of sodium chloride, choline chloride, or sodium nitrate. The flux of 86 Rb into and out of the endothelial cells was estimated. Potassium influx was very sensitive to the osmolarity of the medium. Ouabain-insensitive K-component was reduced in hypotonic medium and was increased in medium made hypertonic with sodium chloride or mannitol. Choline chloride replacement caused a large reduction in K influx. Potassium influx was significant decrease when nitrate is substituted for chloride ion in isotonic and hypertonic media, whereas a slight decrease was found in hypotonic medium. The decrease of K influx in the ion-replacement medium is due to a decrement of the ouabain-insensitive component. Potassium efflux was unchanged in hypotonic medium but was somewhat reduced in hypertonic medium. The marked effect of medium osmolarity of K fluxes suggests that these fluxes may be responsible for the volume regulatory K movements. The possible mechanism of changes of K flux under anisotonic media is also discussed

  5. Relationship between serum total magnesium and serum potassium ...

    African Journals Online (AJOL)

    Relationship between serum total magnesium and serum potassium in emergency surgical patients in a tertiary hospital in Ghana. Robert Djagbletey, Brenda Phillips, Frank Boni, Christian Owoo, Ebenezer Owusu-Darkwa, Papa Kobina Gyakye deGraft-Johnson, Alfred E. Yawson ...

  6. Structural Determinants of Specific Lipid Binding to Potassium Channels

    NARCIS (Netherlands)

    Weingarth, M.H.|info:eu-repo/dai/nl/330985655; Prokofyev, A.; van der Cruijsen, E.A.W.|info:eu-repo/dai/nl/330826743; Nand, D.|info:eu-repo/dai/nl/337731403; Bonvin, A.M.J.J.|info:eu-repo/dai/nl/113691238; Pongs, O.; Baldus, M.|info:eu-repo/dai/nl/314410864

    2013-01-01

    We have investigated specific lipid binding to the pore domain of potassium channels KcsA and chimeric KcsAKv1.3 on the structural and functional level using extensive coarse-grained and atomistic molecular dynamics simulations, solid-state NMR, and single channel measurements. We show that, while

  7. Synthesis of glycoluril catalyzed by potassium hydroxide under ultrasound irradiation.

    Science.gov (United States)

    Li, Ji-Tai; Liu, Xiao-Ru; Sun, Ming-Xuan

    2010-01-01

    Synthesis of the glycolurils catalyzed by potassium hydroxide was carried out in 17-75% yield at 40 degrees C in EtOH under ultrasound irradiation. Compared to the method using stirring, the main advantage of the present procedure is milder conditions and shorter reaction time.

  8. Consumption of potassium permanganate by impurities in deuterium oxide

    International Nuclear Information System (INIS)

    Anon.

    1981-01-01

    The titrimetric measurement of the consumption of potassium permanganate by impurities in deuterium oxide is one of the required methods intended for use in establishing whether the deuterium oxide is of sufficient purity to meet specifications. The method includes a discussion of reagents, procedure, and calculation

  9. Reaction of iodine oxidation by potassium permanganate in tributyl phosphate

    International Nuclear Information System (INIS)

    Khokhlov, M.L.; Legin, E.K.

    1990-01-01

    Stoichiometry was determined and kinetics of iodine oxidation by potassium permanganate in tributylphosphate was studied. Kinetic scheme, which agrees with stoichiometry and experimental kinetic equation of the reaction, is suggested. A mixture is the reaction product. It is ascertained that when the mixture is heated, thermal decomposition of iodate to iodide occurs without elementary iodine separation, which is catalyzed by polymanganate

  10. Effects of Potassium Iodide on Low Avid Immunological Reactions ...

    African Journals Online (AJOL)

    In identical test conditions keeping appropriate control, the following ... Abstract. Background: Selective in‑vivo anti‑fungal action of potassium iodide (KI) is an enigma, but .... mechanism of action of the drug against selective infections. In fact, if ...

  11. Acute toxicity of potassium permanganate to fingerlings of the ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-07-18

    Jul 18, 2008 ... Key words: Potassium permanganate, acute toxicity, LC50, LT50, behaviour, Clarias gariepinus, Nigeria. ... soft waters where other chemicals, such as copper sulphate, were too .... The temperature (oC) was measured by dipping a dry bulb thermo- .... (KMnO4) interferes with the respiratory mechanisms of.

  12. Potassium evaluation in blood of Brazilian athletes using NAA

    Energy Technology Data Exchange (ETDEWEB)

    Kovacs, L.; Zamboni, C.B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Nunes, L.A.S.; Lourenco, T.F.; Macedo, D. Vaz de [Universidade Estadual de Campinas (UNICAMP), SP (Brazil)

    2010-07-01

    Full text: According to nutrition sources an athlete needs per day at least one gram of potassium for keeping the correct mineral balance in the organism. Its deficiency or even instantaneous low concentration in blood can diminish the athlete performance originating nervous irritability, muscular weakness, and mental disorientation and in more several causes cardiac arrhythmias. In this study the K levels in blood were determined in athletes submitted to constant load exercise at treadmill at LABEX (Laboratorio de Bioquimica do Exercicio - UNICAMP, Brazil) using Neutron Activation Analyses (NAA). The blood samples were collected from male athletes, age 18 to 26 years, before and after the physical training. Immediately after the collection an amount of 10 micro liters of whole blood was transferred to the filter paper and dried for a few minutes using an infrared lamp. To determine the concentration of potassium each sample was irradiated in the nuclear reactor (IEA-R1, 2-4MW, pool type) at IPEN and was gamma counted using an HPGe Spectrometer of High Energy Resolution. The concentrations of the selected element, 1525keV related to the potassium activated {sup 42}K, were calculated using in -house software. The potassium levels were evaluated before and after the physical exercise and the data were compared with the normal range. (author)

  13. Potassium evaluation in blood of Brazilian athletes using NAA

    International Nuclear Information System (INIS)

    Kovacs, L.; Zamboni, C.B.; Nunes, L.A.S.; Lourenco, T.F.; Macedo, D. Vaz de

    2010-01-01

    Full text: According to nutrition sources an athlete needs per day at least one gram of potassium for keeping the correct mineral balance in the organism. Its deficiency or even instantaneous low concentration in blood can diminish the athlete performance originating nervous irritability, muscular weakness, and mental disorientation and in more several causes cardiac arrhythmias. In this study the K levels in blood were determined in athletes submitted to constant load exercise at treadmill at LABEX (Laboratorio de Bioquimica do Exercicio - UNICAMP, Brazil) using Neutron Activation Analyses (NAA). The blood samples were collected from male athletes, age 18 to 26 years, before and after the physical training. Immediately after the collection an amount of 10 micro liters of whole blood was transferred to the filter paper and dried for a few minutes using an infrared lamp. To determine the concentration of potassium each sample was irradiated in the nuclear reactor (IEA-R1, 2-4MW, pool type) at IPEN and was gamma counted using an HPGe Spectrometer of High Energy Resolution. The concentrations of the selected element, 1525keV related to the potassium activated 42 K, were calculated using in -house software. The potassium levels were evaluated before and after the physical exercise and the data were compared with the normal range. (author)

  14. Functional diversity of potassium channel voltage-sensing domains.

    Science.gov (United States)

    Islas, León D

    2016-01-01

    Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology.

  15. Salinity effect on seedling growth, water, sodium and potassium ...

    African Journals Online (AJOL)

    Mature leaves exhibited good adaptative behavior toward salinity stress by increasing succulence due to absorption of large quantities of water and K+ in leaves. Potassium uptake in leaves was not found to be affected by NaCl concentration. As a consequence, monovalent cations adsorption resulted in an increase in the ...

  16. effect of population density and dose of nitrogen and potassium ...

    African Journals Online (AJOL)

    A. Hussein

    2018-01-01

    Jan 1, 2018 ... while, nitrogen consumption increased dry weight resulting in increased plant yield (Hatami et al., 2009). Vorob (2000) ... of this study was to investigate the effect of plant density and dose of nitrogen and potassium on Green bean Cv. ..... biogeochem. cycle., 2008, 22(1), 1022-1041. [11] Moniruzzaman M ...

  17. Apical Membrane Potassium Conductance in Guinea Pig Gallbladder Epithelial Cells

    Science.gov (United States)

    1988-12-01

    did block the accompanying der short-circuit conditions except for brief periods (300 change in fR.. TEA was ineffective when added to the ms) during...toad skin. Biochim. 29. RICHARDS, N. W., AND D. C. DAWSON. Single potassium channelsBiophys. Acta 728: 455-459, 1983. blocked by lidocaine and quinidine

  18. Does Electroconvulsive therapy aggravate the rise in potassium and ...

    African Journals Online (AJOL)

    Background: Potassium and creatine kinase levels increase after the administration of suxamethonium. This rise may be exaggerated by the combination of suxamethonium fasciculation and the modified tonic/clonic convulsion induced by electroconvulsive therapy. This study compared the magnitude of increase in ...

  19. Argon analytical procedures for potassium-argon dating

    International Nuclear Information System (INIS)

    Gabites, J.E.; Adams, C.J.

    1981-01-01

    A manual for the argon analytical methods involved in potassium-argon geochronology, including: i) operating procedures for the ultra-high vacuum argon extraction/purification equipment for the analysis of nanolitre quantities of radiogenic argon in rocks, minerals and gases; ii) operating procedures for the AEI-MS10 gas source mass spectrometer

  20. Potassium and calcium nutrition improves potato production in drip ...

    African Journals Online (AJOL)

    The response of Spunta potato (Solanum tuberosum L.) plants to different rates of potassium (60 and 120 kg Fed-1 ) in presence or absence of Ca nutrition was studied. The study was performed in sandy-loam soil under a drip-irrigation system during fall seasons of 1996 and 1997 years. Plants fertilised with high rate of K ...