WorldWideScience

Sample records for voltage-dependent ionic currents

  1. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  2. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  3. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  4. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  5. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  6. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  7. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  8. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  10. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  11. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  12. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  13. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  14. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  15. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  16. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  17. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  18. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  19. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  20. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  1. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  2. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  3. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  4. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  5. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  6. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  7. A computational model of the ionic currents, Ca2+ dynamics and action potentials underlying contraction of isolated uterine smooth muscle.

    Directory of Open Access Journals (Sweden)

    Wing-Chiu Tong

    2011-04-01

    Full Text Available Uterine contractions during labor are discretely regulated by rhythmic action potentials (AP of varying duration and form that serve to determine calcium-dependent force production. We have employed a computational biology approach to develop a fuller understanding of the complexity of excitation-contraction (E-C coupling of uterine smooth muscle cells (USMC. Our overall aim is to establish a mathematical platform of sufficient biophysical detail to quantitatively describe known uterine E-C coupling parameters and thereby inform future empirical investigations of physiological and pathophysiological mechanisms governing normal and dysfunctional labors. From published and unpublished data we construct mathematical models for fourteen ionic currents of USMCs: Ca2+ currents (L- and T-type, Na+ current, an hyperpolarization-activated current, three voltage-gated K+ currents, two Ca2+-activated K+ current, Ca2+-activated Cl current, non-specific cation current, Na+-Ca2+ exchanger, Na+-K+ pump and background current. The magnitudes and kinetics of each current system in a spindle shaped single cell with a specified surface area:volume ratio is described by differential equations, in terms of maximal conductances, electrochemical gradient, voltage-dependent activation/inactivation gating variables and temporal changes in intracellular Ca2+ computed from known Ca2+ fluxes. These quantifications are validated by the reconstruction of the individual experimental ionic currents obtained under voltage-clamp. Phasic contraction is modeled in relation to the time constant of changing [Ca2+]i. This integrated model is validated by its reconstruction of the different USMC AP configurations (spikes, plateau and bursts of spikes, the change from bursting to plateau type AP produced by estradiol and of simultaneous experimental recordings of spontaneous AP, [Ca2+]i and phasic force. In summary, our advanced mathematical model provides a powerful tool to

  8. Static gas-liquid interfacial direct current discharge plasmas using ionic liquid cathode

    International Nuclear Information System (INIS)

    Kaneko, T.; Baba, K.; Hatakeyama, R.

    2009-01-01

    Due to the unique properties of ionic liquids such as their extremely low vapor pressure and high heat capacity, we have succeeded in creating the static and stable gas (plasmas)-liquid (ionic liquids) interfacial field using a direct current discharge under a low gas pressure condition. It is clarified that the ionic liquid works as a nonmetal liquid electrode, and furthermore, a secondary electron emission coefficient of the ionic liquid is larger than that of conventional metal electrodes. The plasma potential structure of the gas-liquid interfacial region, and resultant interactions between the plasma and the ionic liquid are revealed by changing a polarity of the electrode in the ionic liquid. By utilizing the ionic liquid as a cathode electrode, the positive ions in the plasma region are found to be irradiated to the ionic liquid. This ion irradiation causes physical and chemical reactions at the gas-liquid interfacial region without the vaporization of the ionic liquid.

  9. Reconstruction of electrocardiogram using ionic current models for heart muscles.

    Science.gov (United States)

    Yamanaka, A; Okazaki, K; Urushibara, S; Kawato, M; Suzuki, R

    1986-11-01

    A digital computer model is presented for the simulation of the electrocardiogram during ventricular activation and repolarization (QRS-T waves). The part of the ventricular septum and the left ventricular free wall of the heart are represented by a two dimensional array of 730 homogeneous functional units. Ionic currents models are used to determine the spatial distribution of the electrical activities of these units at each instant of time during simulated cardiac cycle. In order to reconstruct the electrocardiogram, the model is expanded three-dimensionally with equipotential assumption along the third axis and then the surface potentials are calculated using solid angle method. Our digital computer model can be used to improve the understanding of the relationship between body surface potentials and intracellular electrical events.

  10. Quantifying short-lived events in multistate ionic current measurements.

    Science.gov (United States)

    Balijepalli, Arvind; Ettedgui, Jessica; Cornio, Andrew T; Robertson, Joseph W F; Cheung, Kin P; Kasianowicz, John J; Vaz, Canute

    2014-02-25

    We developed a generalized technique to characterize polymer-nanopore interactions via single channel ionic current measurements. Physical interactions between analytes, such as DNA, proteins, or synthetic polymers, and a nanopore cause multiple discrete states in the current. We modeled the transitions of the current to individual states with an equivalent electrical circuit, which allowed us to describe the system response. This enabled the estimation of short-lived states that are presently not characterized by existing analysis techniques. Our approach considerably improves the range and resolution of single-molecule characterization with nanopores. For example, we characterized the residence times of synthetic polymers that are three times shorter than those estimated with existing algorithms. Because the molecule's residence time follows an exponential distribution, we recover nearly 20-fold more events per unit time that can be used for analysis. Furthermore, the measurement range was extended from 11 monomers to as few as 8. Finally, we applied this technique to recover a known sequence of single-stranded DNA from previously published ion channel recordings, identifying discrete current states with subpicoampere resolution.

  11. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  12. Molecular simulation of ionic liquids: current status and future opportunities

    International Nuclear Information System (INIS)

    Maginn, E J

    2009-01-01

    Ionic liquids are salts that are liquid near ambient conditions. Interest in these unusual compounds has exploded in the last decade, both at the academic and commercial level. Molecular simulations based on classical potentials have played an important role in helping researchers understand how condensed phase properties of these materials are linked to chemical structure and composition. Simulations have also predicted many properties and unexpected phenomena that have subsequently been confirmed experimentally. The beneficial impact molecular simulations have had on this field is due in large part to excellent timing. Just when computing power and simulation methods matured to the point where complex fluids could be studied in great detail, a new class of materials virtually unknown to experimentalists came on the scene and demanded attention. This topical review explores some of the history of ionic liquid molecular simulations, and then gives examples of the recent use of molecular dynamics and Monte Carlo simulation in understanding the structure of ionic liquids, the sorption of small molecules in ionic liquids, the nature of ionic liquids in the vapor phase and the dynamics of ionic liquids. This review concludes with a discussion of some of the outstanding problems facing the ionic liquid modeling community and how condensed phase molecular simulation experts not presently working on ionic liquids might help advance the field. (topical review)

  13. Ionic current devices-Recent progress in the merging of electronic, microfluidic, and biomimetic structures.

    Science.gov (United States)

    Koo, Hyung-Jun; Velev, Orlin D

    2013-05-09

    We review the recent progress in the emerging area of devices and circuits operating on the basis of ionic currents. These devices operate at the intersection of electrochemistry, electronics, and microfluidics, and their potential applications are inspired by essential biological processes such as neural transmission. Ionic current rectification has been demonstrated in diode-like devices containing electrolyte solutions, hydrogel, or hydrated nanofilms. More complex functions have been realized in ionic current based transistors, solar cells, and switching memory devices. Microfluidic channels and networks-an intrinsic component of the ionic devices-could play the role of wires and circuits in conventional electronics.

  14. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  15. High Current Ionic Diode Using Homogeneously Charged Asymmetric Nanochannel Network Membrane.

    Science.gov (United States)

    Choi, Eunpyo; Wang, Cong; Chang, Gyu Tae; Park, Jungyul

    2016-04-13

    A high current ionic diode is achieved using an asymmetric nanochannel network membrane (NCNM) constructed by soft lithography and in situ self-assembly of nanoparticles with uniform surface charge. The asymmetric NCNM exhibits high rectified currents without losing a rectification ratio because of its ionic selectivity gradient and differentiated electrical conductance. Asymmetric ionic transport is analyzed with diode-like I-V curves and visualized via fluorescent dyes, which is closely correlated with ionic selectivity and ion distribution according to variation of NCNM geometries.

  16. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  17. Theoretical and experimental studies on ionic currents in nanopore-based biosensors.

    Science.gov (United States)

    Liu, Lei; Li, Chu; Ma, Jian; Wu, Yingdong; Ni, Zhonghua; Chen, Yunfei

    2014-12-01

    Novel generation of analytical technology based on nanopores has provided possibilities to fabricate nanofluidic devices for low-cost DNA sequencing or rapid biosensing. In this paper, a simplified model was suggested to describe DNA molecule's translocation through a nanopore, and the internal potential, ion concentration, ionic flowing speed and ionic current in nanopores with different sizes were theoretically calculated and discussed on the basis of Poisson-Boltzmann equation, Navier-Stokes equation and Nernst-Planck equation by considering several important parameters, such as the applied voltage, the thickness and the electric potential distributions in nanopores. In this way, the basic ionic currents, the modulated ionic currents and the current drops induced by translocation were obtained, and the size effects of the nanopores were carefully compared and discussed based on the calculated results and experimental data, which indicated that nanopores with a size of 10 nm or so are more advantageous to achieve high quality ionic current signals in DNA sensing.

  18. Direct current dielectrophoretic manipulation of the ionic liquid droplets in water.

    Science.gov (United States)

    Zhao, Kai; Li, Dongqing

    2018-07-13

    The ionic liquids (ILs) as the environmentally benign solvents show great potentials in microemulsion carrier systems and have been widely used in the biochemical and pharmaceutical fields. In the work, the ionic liquid-in-water microemulsions were fabricated by using two kinds of hydrophobic ionic liquid, 1-Butyl-3-methylimidazolium hexafluorophosphate [Bmim][PF 6 ] and 1-Hexyl-3-methylimidazolium hexafluorophosphate [Hmim][PF 6 ] with Tween 20. The ionic liquid droplets in water experience the dielectrophoretic (DEP) forces induced by applying electrical field via a nano-orifice and a micron orifice on the opposite channel walls of a microchannel. The dielectrophoretic behaviors of the ionic liquid-in-water emulsion droplets were investigated under direct current (DC) electric field. The positive and negative DEP behaviors of the ionic liquid-in-water droplets varying with the electrical conductivity of the suspending medium were investigated and two kinds of the ionic liquid droplets of similar sizes were separated by their different DEP behaviors. In addition, the separation of the ionic liquid-in-water droplets by size was conducted. This paper, for the first time to our knowledge, presents the DC-DEP manipulation of the ionic liquid-in-water emulsion droplets by size and by type. This method provides a platform to manipulate the ionic liquid droplets individually. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  20. Ionic screening effect on low-frequency drain current fluctuations in liquid-gated nanowire FETs

    International Nuclear Information System (INIS)

    Lu, Ming-Pei; Vire, Eric; Montès, Laurent

    2015-01-01

    The ionic screening effect plays an important role in determining the fundamental surface properties within liquid–semiconductor interfaces. In this study, we investigated the characteristics of low-frequency drain current noise in liquid-gated nanowire (NW) field effect transistors (FETs) to obtain physical insight into the effect of ionic screening on low-frequency current fluctuation. When the NW FET was operated close to the gate voltage corresponding to the maximum transconductance, the magnitude of the low-frequency noise for the NW exposed to a low-ionic-strength buffer (0.001 M) was approximately 70% greater than that when exposed to a high-ionic-strength buffer (0.1 M). We propose a noise model, considering the charge coupling efficiency associated with the screening competition between the electrolyte buffer and the NW, to describe the ionic screening effect on the low-frequency drain current noise in liquid-gated NW FET systems. This report not only provides a physical understanding of the ionic screening effect behind the low-frequency current noise in liquid-gated FETs but also offers useful information for developing the technology of NW FETs with liquid-gated architectures for application in bioelectronics, nanosensors, and hybrid nanoelectronics. (paper)

  1. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  3. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  4. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  5. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  6. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  7. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  8. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  9. CO2 capture technologies: current status and new directions using supported ionic liquid phase (SILP) absorbers

    DEFF Research Database (Denmark)

    Kolding, Helene; Fehrmann, Rasmus; Riisager, Anders

    2012-01-01

    Current state-of-the-art techniques for CO2 capture are presented and discussed. Post-combustion capture of CO2 by absorption is the technology most easily retrofitted to existing installations, but at present this is not economically viable to install and run. Using ionic liquids instead...... of aqueous amine solutions overcomes the major thermodynamic issues. By applying SILP technology further advances, in terms of ease of handling and sorption dynamics, are obtained. Initial experimental studies showed that ionic liquids such as tetrahexylammonium prolinate, [N6666][Pro], provide a good...... candidate for CO2 absorption using SILP technology. Thus a solid SILP absorber comprised of 40 wt% [N6666][Pro] loaded on precalcined silica quantitatively takes up about 1.2 mole CO2 per mole of ionic liquid in consecutive absorption-desorption cycles in a flow-experiment performed with 0.09 bar of CO2 (9...

  10. Multilevel Molecular Modeling Approach for a Rational Design of Ionic Current Sensors for Nanofluidics.

    Science.gov (United States)

    Kirch, Alexsandro; de Almeida, James M; Miranda, Caetano R

    2018-05-10

    The complexity displayed by nanofluidic-based systems involves electronic and dynamic aspects occurring across different size and time scales. To properly model such kind of system, we introduced a top-down multilevel approach, combining molecular dynamics simulations (MD) with first-principles electronic transport calculations. The potential of this technique was demonstrated by investigating how the water and ionic flow through a (6,6) carbon nanotube (CNT) influences its electronic transport properties. We showed that the confinement on the CNT favors the partially hydrated Na, Cl, and Li ions to exchange charge with the nanotube. This leads to a change in the electronic transmittance, allowing for the distinguishing of cations from anions. Such an ionic trace may handle an indirect measurement of the ionic current that is recorded as a sensing output. With this case study, we are able to show the potential of this top-down multilevel approach, to be applied on the design of novel nanofluidic devices.

  11. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  12. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  13. Multichannel detection of ionic currents through two nanopores fabricated on integrated Si3N4 membranes.

    Science.gov (United States)

    Yanagi, Itaru; Akahori, Rena; Aoki, Mayu; Harada, Kunio; Takeda, Ken-Ichi

    2016-08-16

    Integration of solid-state nanopores and multichannel detection of signals from each nanopore are effective measures for realizing high-throughput nanopore sensors. In the present study, we demonstrated fabrication of Si3N4 membrane arrays and the simultaneous measurement of ionic currents through two nanopores formed in two adjacent membranes. Membranes with thicknesses as low as 6.4 nm and small nanopores with diameters of less than 2 nm could be fabricated using the poly-Si sacrificial-layer process and multilevel pulse-voltage injection. Using the fabricated nanopore membranes, we successfully achieved simultaneous detection of clear ionic-current blockades when single-stranded short homopolymers (poly(dA)60) passed through two nanopores. In addition, we investigated the signal crosstalk and leakage current among separated chambers. When two nanopores were isolated on the front surface of the membrane, there was no signal crosstalk or leakage current between the chambers. However, when two nanopores were isolated on the backside of the Si substrate, signal crosstalk and leakage current were observed owing to high-capacitance coupling between the chambers and electrolysis of water on the surface of the Si substrate. The signal crosstalk and leakage current could be suppressed by oxidizing the exposed Si surface in the membrane chip. Finally, the observed ionic-current blockade when poly(dA)60 passed through the nanopore in the oxidized chip was approximately half of that observed in the non-oxidized chip.

  14. Instrumentation for low noise nanopore-based ionic current recording under laser illumination

    Science.gov (United States)

    Roelen, Zachary; Bustamante, José A.; Carlsen, Autumn; Baker-Murray, Aidan; Tabard-Cossa, Vincent

    2018-01-01

    We describe a nanopore-based optofluidic instrument capable of performing low-noise ionic current recordings of individual biomolecules under laser illumination. In such systems, simultaneous optical measurements generally introduce significant parasitic noise in the electrical signal, which can severely reduce the instrument sensitivity, critically hindering the monitoring of single-molecule events in the ionic current traces. Here, we present design rules and describe simple adjustments to the experimental setup to mitigate the different noise sources encountered when integrating optical components to an electrical nanopore system. In particular, we address the contributions to the electrical noise spectra from illuminating the nanopore during ionic current recording and mitigate those effects through control of the illumination source and the use of a PDMS layer on the SiNx membrane. We demonstrate the effectiveness of our noise minimization strategies by showing the detection of DNA translocation events during membrane illumination with a signal-to-noise ratio of ˜10 at 10 kHz bandwidth. The instrumental guidelines for noise minimization that we report are applicable to a wide range of nanopore-based optofluidic systems and offer the possibility of enhancing the quality of synchronous optical and electrical signals obtained during single-molecule nanopore-based analysis.

  15. A four-diode full-wave ionic current rectifier based on bipolar membranes: overcoming the limit of electrode capacity.

    Science.gov (United States)

    Gabrielsson, Erik O; Janson, Per; Tybrandt, Klas; Simon, Daniel T; Berggren, Magnus

    2014-08-13

    Full-wave rectification of ionic currents is obtained by constructing the typical four-diode bridge out of ion conducting bipolar membranes. Together with conjugated polymer electrodes addressed with alternating current, the bridge allows for generation of a controlled ionic direct current for extended periods of time without the production of toxic species or gas typically arising from electrode side-reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. [Atomic/ionic fluorescence in microwave plasma torch discharge with excitation of high current and microsecond pulsed hollow cathode lamp: Ca atomic/ionic fluorescence spectrometry].

    Science.gov (United States)

    Gong, Zhen-bin; Liang, Feng; Yang, Peng-yuan; Jin, Qin-han; Huang, Ben-li

    2002-02-01

    A system of atomic and ionic fluorescence spectrometry in microwave plasma torch (MPT) discharge excited by high current microsecond pulsed hollow cathode lamp (HCMP HCL) has been developed. The operation conditions for Ca atomic and ionic fluorescence spectrometry have been optimized. Compared with atomic fluorescence spectrometry (AFS) in argon microwave induced plasma (MIP) and MPT with the excitation of direct current and conventional pulsed HCL, the system with HCMP HCL excitation can improve AFS and ionic fluorescence spectrometry (IFS) detection limits in MPT atomizer and ionizer. Detection limits (3 sigma) with HCMP HCL-MPT-AFS/IFS are 10.1 ng.mL-1 for Ca I 422.7 nm, 14.6 ng.mL-1 for Ca II 393.4 nm, and 37.4 ng.mL-1 for Ca II 396.8 nm, respectively.

  17. Geometrical control of ionic current rectification in a configurable nanofluidic diode.

    Science.gov (United States)

    Alibakhshi, Mohammad Amin; Liu, Binqi; Xu, Zhiping; Duan, Chuanhua

    2016-09-01

    Control of ionic current in a nanofluidic system and development of the elements analogous to electrical circuits have been the subject of theoretical and experimental investigations over the past decade. Here, we theoretically and experimentally explore a new technique for rectification of ionic current using asymmetric 2D nanochannels. These nanochannels have a rectangular cross section and a stepped structure consisting of a shallow and a deep side. Control of height and length of each side enables us to obtain optimum rectification at each ionic strength. A 1D model based on the Poisson-Nernst-Planck equation is derived and validated against the full 2D numerical solution, and a nondimensional concentration is presented as a function of nanochannel dimensions, surface charge, and the electrolyte concentration that summarizes the rectification behavior of such geometries. The rectification factor reaches a maximum at certain electrolyte concentration predicted by this nondimensional number and decays away from it. This method of fabrication and control of a nanofluidic diode does not require modification of the surface charge and facilitates the integration with lab-on-a-chip fluidic circuits. Experimental results obtained from the stepped nanochannels are in good agreement with the 1D theoretical model.

  18. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  19. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  20. Mechanisms of generation of membrane potential resonance in a neuron with multiple resonant ionic currents.

    Directory of Open Access Journals (Sweden)

    David M Fox

    2017-06-01

    Full Text Available Neuronal membrane potential resonance (MPR is associated with subthreshold and network oscillations. A number of voltage-gated ionic currents can contribute to the generation or amplification of MPR, but how the interaction of these currents with linear currents contributes to MPR is not well understood. We explored this in the pacemaker PD neurons of the crab pyloric network. The PD neuron MPR is sensitive to blockers of H- (IH and calcium-currents (ICa. We used the impedance profile of the biological PD neuron, measured in voltage clamp, to constrain parameter values of a conductance-based model using a genetic algorithm and obtained many optimal parameter combinations. Unlike most cases of MPR, in these optimal models, the values of resonant- (fres and phasonant- (fϕ = 0 frequencies were almost identical. Taking advantage of this fact, we linked the peak phase of ionic currents to their amplitude, in order to provide a mechanistic explanation the dependence of MPR on the ICa gating variable time constants. Additionally, we found that distinct pairwise correlations between ICa parameters contributed to the maintenance of fres and resonance power (QZ. Measurements of the PD neuron MPR at more hyperpolarized voltages resulted in a reduction of fres but no change in QZ. Constraining the optimal models using these data unmasked a positive correlation between the maximal conductances of IH and ICa. Thus, although IH is not necessary for MPR in this neuron type, it contributes indirectly by constraining the parameters of ICa.

  1. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  2. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  3. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  4. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  5. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  6. Multifunctional nanopipette for simultaneous ionic current and potential detection of nanoparticles

    Science.gov (United States)

    Panday, Namuna; He, Jin

    Nanopipette has been demonstrated as a nanopore type biosensor for DNA, protein, nanoparticle and virus analysis. In the last two decades, nanopore based technologies have made remarkable progress for single entity detection and analysis. Multifunctional nanopipette for multi-parameter detection is a new trend for nanopore based technique. We have developed a technique to fabricate multifunctional nanopipette which contains both nanopore and carbon nanoelectrode (CNE) at the nanopipette tip. It can be quickly, cheaply and reproducibly fabricated from theta pipettes. We have been able to use this multifunctional nanopieptte for simultaneous detection of ionic current and local electrical potential changes during translocation of charged gold nanoparticles (GNPs) which is used as a model experiment. The CNE functions as a local potential probe. We have demonstrated that it can detect the local potential change during translocation of a single GNP as well as collective potential change due to cluster of GNPs outside the nanopore entrance. From the potential change, we can also have insight of motion of GNPs before entering the nanopore. We have also tested insulating and biological NPs with various size and charge. Observed results have shown correlations between ionic current and potential change during translocation of these NPs. Florida International University.

  7. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  8. Ionic ring current during magnetic disturbances according to observations at geostationary orbit

    International Nuclear Information System (INIS)

    Vlasova, N.A.; Kovtyukh, A.S.; Panasyuk, M.I.; Sosnovets, Eh.N.; Grafodanskij, O.S.; Islyaev, Sh.N.; Kozlov, A.G.

    1988-01-01

    Experimental data on variations of H + , (N,O) 2+ and (C,N,O) 4+ flows acquired at communication geostationary satellite GORIZONT (1985-07A) during and after weak magnetic disturbances (with amplitudes of D st -variations which are less than a few tens of nT) are analyzed. Dynamics of ion relative content is investigated. Change of ring current ionic composition within ∼ 50-120 keV/c energy range characterized by the increase of relative content of heavy ions of both solar and ionospheric origin was observed after two weak geomagnetic disturbances on 19-20.02 and 07.03.1985. Examples of disturbances where H + ions and (N,O) 2+ ionospheric ions are the main components of the injected ring current are presented along with the disturbances of such type

  9. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  10. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  11. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  12. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  13. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  14. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  15. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  16. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  17. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  18. Ionic currents and charge movements in organ-cultured rat skeletal muscle.

    Science.gov (United States)

    Hollingworth, S; Marshall, M W; Robson, E

    1984-12-01

    The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.

  19. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  20. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  1. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  2. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  3. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  4. Voltage-dependent potassium currents in hypertrophied rat astrocytes after a cortical stab wound

    Czech Academy of Sciences Publication Activity Database

    Anděrová, Miroslava; Antonova, Tatiana; Petřík, David; Neprašová, Helena; Chvátal, Alexandr; Syková, Eva

    2004-01-01

    Roč. 48, - (2004), s. 311-326 ISSN 0894-1491 R&D Projects: GA ČR GA305/03/1172; GA ČR GA305/02/1528; GA MŠk LN00A065 Institutional research plan: CEZ:AV0Z5039906 Keywords : CNS injury * astrogliosis Subject RIV: FH - Neurology Impact factor: 4.781, year: 2004

  5. Thermodynamics, electrostatics, and ionic current in nanochannels grafted with pH-responsive end-charged polyelectrolyte brushes.

    Science.gov (United States)

    Chen, Guang; Das, Siddhartha

    2017-03-01

    In this paper, we study the thermodynamics, electrostatics, and an external electric field driven ionic current in a pH-responsive, end-charged polyelectrolyte (PE) brush grafted nanochannel. By employing a mean field theory, we unravel a highly nonintuitive interplay of pH and electrolyte salt concentration in dictating the height of the end-charged PE brush. Larger pH or weak hydrogen ion concentration leads to maximum ionization of the charge-producing group-as a consequence, the resulting the electric double layer (EDL) energy get maximized causing a maximum deviation of the brush height from the value (d 0 ) of the uncharged brush. This deviation may result in enhancement or lowering of the brush height as compared to d 0 depending on whether the PE end locates lower or higher than h/2 (h is the nanochannel half height) and the salt concentration. Subsequently, we use this combined PE-brush-configuration-EDL-electrostatics framework to compute the ionic current in the nanochannel. We witness that the ionic current for smaller pH is much larger despite the corresponding magnitude of the EDL electrostatic potential being much smaller-this stems from the presence of a much larger concentration of H+ ions at small pH and the fact that H+ ions have very large mobilities. In fact, this ionic current shows a steep variation with pH that can be useful in exploring new designs for applications involving quantification and characterization of ionic current in PE-brush-grafted nanochannels. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  7. Ab-Initio analysis of TlBr: limiting the ionic current without degrading the electronic one

    Science.gov (United States)

    Rocha Leao, Cedric; Lordi, Vincenzo

    2011-03-01

    Although TlBr in principle presents all the theoretical requirements for making high resolution room temperature radiation detectors, practical applications of TlBr have proven to be nonviable due to the polarization that is observed in the crystal after relatively short periods of operation. This polarization, that is believed to be caused by accumulation of oppositely charged ionic species at the ends of the crystal, results in an electric field that opposes that of the applied bias, counter-acting its effect. In this work, we use state of the art quantum modeling to benchmark the theoretical limits for the performance of TlBr as a radiation detector, showing that the best experimental reports demonstrate near-ideal electronic characteristics. We then propose a model to inhibit the detrimental ionic current in the material without impacting the excellent properties of the electronic current. Prepared by LLNL under Contract DE-AC52-07NA27344.

  8. [Atomic/ionic fluorescence in microwave plasma torch discharge excited by high current microsecond pulsed hollow cathode lamp-europium atomic/ionic fluorescence spectrometry].

    Science.gov (United States)

    Gong, Z; Liang, F; Yang, P; Jin, Q; Huang, B

    1999-06-01

    Eu atomic and ionic fluorescence spectrometry in microwave plasma torch discharge excited by high current microsecond pulsed hollow cathode lamp (HCMP HCL-MPT AFS/IFS) was studied. Operating conditions were optimized. The best detection limits for AFS and IFS obtained with a desolvated ultrasonic nebulization system were 42.0 ng/mL for Eu I 462.7 nm and 21.8 ng/mL for Eu II 381.97 nm, respectively, both were better than those given by the instruction manual of a Baird ICP AFS-2000 spectrometer using pneumatic concentric nebulizer with desolvation for AFS, but were significantly higher than those obtained by using the Baird spectrometer with a mini-monochromator and a ultrasonic nebulzer system.

  9. Sequential Vapor Infiltration Treatment Enhances the Ionic Current Rectification Performance of Composite Membranes Based on Mesoporous Silica Confined in Anodic Alumina.

    Science.gov (United States)

    Liang, Yanyan; Liu, Zhengping

    2016-12-20

    Ionic current rectification of nanofluidic diode membranes has been studied widely in recent years because it is analogous to the functionality of biological ion channels in principle. We report a new method to fabricate ionic current rectification membranes based on mesoporous silica confined in anodic aluminum oxide (AAO) membranes. Two types of mesostructured silica nanocomposites, hexagonal structure and nanoparticle stacked structure, were used to asymmetrically fill nanochannels of AAO membranes by a vapor-phase synthesis (VPS) method with aspiration approach and were further modified via sequence vapor infiltration (SVI) treatment. The ionic current measurements indicated that SVI treatment can modulate the asymmetric ionic transport in prepared membranes, which exhibited clear ionic current rectification phenomenon under optimal conditions. The ionic current rectifying behavior is derived from the asymmetry of surface conformations, silica species components, and hydrophobic wettability, which are created by the asymmetrical filling type, silica depositions on the heterogeneous membranes, and the condensation of silanol groups. This article provides a considerable strategy to fabricate composite membranes with obvious ionic current rectification performance via the cooperation of the VPS method and SVI treatment and opens up the potential of mesoporous silica confined in AAO membranes to mimic fluid transport in biological processes.

  10. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  11. Capacitive mixing power production from salinity gradient energy enhanced through exoelectrogen-generated ionic currents

    KAUST Repository

    Hatzell, Marta C.; Cusick, Roland D.; Logan, Bruce E.

    2014-01-01

    Several approaches to generate electrical power directly from salinity gradient energy using capacitive electrodes have recently been developed, but power densities have remained low. By immersing the capacitive electrodes in ionic fields generated by exoelectrogenic microorganisms in bioelectrochemical reactors, we found that energy capture using synthetic river and seawater could be increased ∼65 times, and power generation ∼46 times. Favorable electrochemical reactions due to microbial oxidation of organic matter, coupled to oxygen reduction at the cathode, created an ionic flow field that enabled more effective passive charging of the capacitive electrodes and higher energy capture. This ionic-based approach is not limited to the use of river water-seawater solutions. It can also be applied in industrial settings, as demonstrated using thermolytic solutions that can be used to capture waste heat energy as salinity gradient energy. Forced charging of the capacitive electrodes, using energy generated by the bioelectrochemical system and a thermolytic solution, further increased the maximum power density to 7 W m -2 (capacitive electrode). © 2014 The Royal Society of Chemistry.

  12. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  13. Combination of Cyclodextrin and Ionic Liquid in Analytical Chemistry: Current and Future Perspectives.

    Science.gov (United States)

    Hui, Boon Yih; Raoov, Muggundha; Zain, Nur Nadhirah Mohamad; Mohamad, Sharifah; Osman, Hasnah

    2017-09-03

    The growth in driving force and popularity of cyclodextrin (CDs) and ionic liquids (ILs) as promising materials in the field of analytical chemistry has resulted in an exponentially increase of their exploitation and production in analytical chemistry field. CDs belong to the family of cyclic oligosaccharides composing of α-(1,4) linked glucopyranose subunits and possess a cage-like supramolecular structure. This structure enables chemical reactions to proceed between interacting ions, radical or molecules in the absence of covalent bonds. Conversely, ILs are an ionic fluids comprising of only cation and anion often with immeasurable vapor pressure making them as green or designer solvent. The cooperative effect between CD and IL due to their fascinating properties, have nowadays contributed their footprints for a better development in analytical chemistry nowadays. This comprehensive review serves to give an overview on some of the recent studies and provides an analytical trend for the application of CDs with the combination of ILs that possess beneficial and remarkable effects in analytical chemistry including their use in various sample preparation techniques such as solid phase extraction, magnetic solid phase extraction, cloud point extraction, microextraction, and separation techniques which includes gas chromatography, high-performance liquid chromatography, capillary electrophoresis as well as applications of electrochemical sensors as electrode modifiers with references to recent applications. This review will highlight the nature of interactions and synergic effects between CDs, ILs, and analytes. It is hoped that this review will stimulate further research in analytical chemistry.

  14. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  15. Factors governing dissolution process of lignocellulosic biomass in ionic liquid: current status, overview and challenges.

    Science.gov (United States)

    Badgujar, Kirtikumar C; Bhanage, Bhalchandra M

    2015-02-01

    The utilisation of non-feed lignocellulosic biomass as a source of renewable bio-energy and synthesis of fine chemical products is necessary for the sustainable development. The methods for the dissolution of lignocellulosic biomass in conventional solvents are complex and tedious due to the complex chemical ultra-structure of biomass. In view of this, recent developments for the use of ionic liquid solvent (IL) has received great attention, as ILs can solubilise such complex biomass and thus provides industrial scale-up potential. In this review, we have discussed the state-of-art for the dissolution of lignocellulosic material in representative ILs. Furthermore, various process parameters and their influence for biomass dissolution were reviewed. In addition to this, overview of challenges and opportunities related to this interesting area is presented. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  18. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  19. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  20. Analysis of mobile ionic impurities in polyvinylalcohol thin films by thermal discharge current and dielectric impedance spectroscopy

    Directory of Open Access Journals (Sweden)

    M. Egginger

    2012-12-01

    Full Text Available Polyvinylalcohol (PVA is a water soluble polymer frequently applied in the field of organic electronics for insulating thin film layers. By-products of PVA synthesis are sodium acetate ions which contaminate the polymer material and can impinge on the electronic performance when applied as interlayer dielectrics in thin film transistors. Uncontrollable voltage instabilities and unwanted hysteresis effects are regularly reported with PVA devices. An understanding of these effects require knowledge about the electronic dynamics of the ionic impurities and their influence on the dielectric properties of PVA. Respective data, which are largely unknown, are being presented in this work. Experimental investigations were performed from room temperature to 125°C on drop-cast PVA films of three different quality grades. Data from thermal discharge current (TDC measurements, polarization experiments, and dielectric impedance spectroscopy concurrently show evidence of mobile ionic carriers. Results from TDC measurements indicate the existence of an intrinsic, build-in electric field of pristine PVA films. The field is caused by asymmetric ionic double layer formation at the two different film-interfaces (substrate/PVA and PVA/air. The mobile ions cause strong electrode polarization effects which dominate dielectric impedance spectra. From a quantitative electrode polarization analysis of isothermal impedance spectra temperature dependent values for the concentration, the mobility and conductivity together with characteristic relaxation times of the mobile carriers are given. Also shown are temperature dependent results for the dc-permittivity and the electronic resistivity. The obtained results demonstrate the feasibility to partly remove contaminants from a PVA solution by dialysis cleaning. Such a cleaning procedure reduces the values of ion concentration, conductivity and relaxation frequency.

  1. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  2. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  3. Cell cycle-related fluctuations in transcellular ionic currents and plasma membrane Ca2+/Mg2+ ATPase activity during early cleavages of Lymnaea stagnalis embryos.

    Science.gov (United States)

    Zivkovic, Danica; Créton, Robbert; Dohmen, René

    1991-08-01

    During the first four mitotic division cycles of Lymnaea stagnalis embryos, we have detected cell cycle-dependent changes in the pattern of transcellular ionic currents and membrane-bound Ca 2+ -stimulated ATPase activity. Ionic currents ranging from 0.05 to 2.50 μA/cm 2 have been measured using the vibrating probe technique. Enzyme activity was detected using Ando's cytochemical method (Ando et al. 1981) which reveals Ca 2+ /Mg 2+ ATPase localization at the ultrastructural level, and under high-stringency conditions with respect to calcium availability, it reveals Ca 2+ -stimulated ATPase. The ionic currents and Ca 2+ -stimulated ATPase localization have in common that important changes occur during the M-phase of the cell cycles. Minimal outward current at the vegetal pole coincides with metaphase/anaphase. Maximal inward current at the animal pole coincides with the onset of cytokinesis at that pole. Ca 2+ -stimulated ATPase is absent from one half of the embryo at metaphase/anaphase of the two- and four-cell stage, whereas it is present in all cells during the remaining part of the cell cycle. Since fluctuations of cytosolic free calcium concentrations appear to correlate with both karyokinesis and cytokinesis, we speculate that part of the cyclic pattern of Ca 2+ -stimulated ATPase localization and of the transcellular ionic currents reflects the elevation of cytosolic free calcium concentration during the M-phase.

  4. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  5. In-situ recording of ionic currents in projection neurons and Kenyon cells in the olfactory pathway of the honeybee.

    Directory of Open Access Journals (Sweden)

    Jan Kropf

    Full Text Available The honeybee olfactory pathway comprises an intriguing pattern of convergence and divergence: ~60.000 olfactory sensory neurons (OSN convey olfactory information on ~900 projection neurons (PN in the antennal lobe (AL. To transmit this information reliably, PNs employ relatively high spiking frequencies with complex patterns. PNs project via a dual olfactory pathway to the mushroom bodies (MB. This pathway comprises the medial (m-ALT and the lateral antennal lobe tract (l-ALT. PNs from both tracts transmit information from a wide range of similar odors, but with distinct differences in coding properties. In the MBs, PNs form synapses with many Kenyon cells (KC that encode odors in a spatially and temporally sparse way. The transformation from complex information coding to sparse coding is a well-known phenomenon in insect olfactory coding. Intrinsic neuronal properties as well as GABAergic inhibition are thought to contribute to this change in odor representation. In the present study, we identified intrinsic neuronal properties promoting coding differences between PNs and KCs using in-situ patch-clamp recordings in the intact brain. We found very prominent K+ currents in KCs clearly differing from the PN currents. This suggests that odor coding differences between PNs and KCs may be caused by differences in their specific ion channel properties. Comparison of ionic currents of m- and l-ALT PNs did not reveal any differences at a qualitative level.

  6. In-situ recording of ionic currents in projection neurons and Kenyon cells in the olfactory pathway of the honeybee.

    Science.gov (United States)

    Kropf, Jan; Rössler, Wolfgang

    2018-01-01

    The honeybee olfactory pathway comprises an intriguing pattern of convergence and divergence: ~60.000 olfactory sensory neurons (OSN) convey olfactory information on ~900 projection neurons (PN) in the antennal lobe (AL). To transmit this information reliably, PNs employ relatively high spiking frequencies with complex patterns. PNs project via a dual olfactory pathway to the mushroom bodies (MB). This pathway comprises the medial (m-ALT) and the lateral antennal lobe tract (l-ALT). PNs from both tracts transmit information from a wide range of similar odors, but with distinct differences in coding properties. In the MBs, PNs form synapses with many Kenyon cells (KC) that encode odors in a spatially and temporally sparse way. The transformation from complex information coding to sparse coding is a well-known phenomenon in insect olfactory coding. Intrinsic neuronal properties as well as GABAergic inhibition are thought to contribute to this change in odor representation. In the present study, we identified intrinsic neuronal properties promoting coding differences between PNs and KCs using in-situ patch-clamp recordings in the intact brain. We found very prominent K+ currents in KCs clearly differing from the PN currents. This suggests that odor coding differences between PNs and KCs may be caused by differences in their specific ion channel properties. Comparison of ionic currents of m- and l-ALT PNs did not reveal any differences at a qualitative level.

  7. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  8. Action potential bursts in central snail neurons elicited by paeonol: roles of ionic currents

    Science.gov (United States)

    Chen, Yi-hung; Lin, Pei-lin; Hsu, Hui-yu; Wu, Ya-ting; Yang, Han-yin; Lu, Dah-yuu; Huang, Shiang-suo; Hsieh, Ching-liang; Lin, Jaung-geng

    2010-01-01

    Aim: To investigate the effects of 2′-hydroxy-4′-methoxyacetophenone (paeonol) on the electrophysiological behavior of a central neuron (right parietal 4; RP4) of the giant African snail (Achatina fulica Ferussac). Methods: Intracellular recordings and the two-electrode voltage clamp method were used to study the effects of paeonol on the RP4 neuron. Results: The RP4 neuron generated spontaneous action potentials. Bath application of paeonol at a concentration of ≥500 μmol/L reversibly elicited action potential bursts in a concentration-dependent manner. Immersing the neurons in Co2+-substituted Ca2+-free solution did not block paeonol-elicited bursting. Pretreatment with the protein kinase A (PKA) inhibitor KT-5720 or the protein kinase C (PKC) inhibitor Ro 31-8220 did not affect the action potential bursts. Voltage-clamp studies revealed that paeonol at a concentration of 500 μmol/L had no remarkable effects on the total inward currents, whereas paeonol decreased the delayed rectifying K+ current (IKD) and the fast-inactivating K+ current (IA). Application of 4-aminopyridine (4-AP 5 mmol/L), an inhibitor of IA, or charybdotoxin 250 nmol/L, an inhibitor of the Ca2+-activated K+ current (IK(Ca)), failed to elicit action potential bursts, whereas tetraethylammonium chloride (TEA 50 mmol/L), an IKD blocker, successfully elicited action potential bursts. At a lower concentration of 5 mmol/L, TEA facilitated the induction of action potential bursts elicited by paeonol. Conclusion: Paeonol elicited a bursting firing pattern of action potentials in the RP4 neuron and this activity relates closely to the inhibitory effects of paeonol on the IKD. PMID:21042287

  9. Estimation of Synaptic Conductances in Presence of Nonlinear Effects Caused by Subthreshold Ionic Currents

    Directory of Open Access Journals (Sweden)

    Catalina Vich

    2017-07-01

    Full Text Available Subthreshold fluctuations in neuronal membrane potential traces contain nonlinear components, and employing nonlinear models might improve the statistical inference. We propose a new strategy to estimate synaptic conductances, which has been tested using in silico data and applied to in vivo recordings. The model is constructed to capture the nonlinearities caused by subthreshold activated currents, and the estimation procedure can discern between excitatory and inhibitory conductances using only one membrane potential trace. More precisely, we perform second order approximations of biophysical models to capture the subthreshold nonlinearities, resulting in quadratic integrate-and-fire models, and apply approximate maximum likelihood estimation where we only suppose that conductances are stationary in a 50–100 ms time window. The results show an improvement compared to existent procedures for the models tested here.

  10. Ionic ring current during magnetic disturbances according to observations at a geostationary orbit

    International Nuclear Information System (INIS)

    Vlasova, N.A.; Kovtyuk, A.S.; Panasyuk, M.I.

    1987-01-01

    Experimental data on the measurements of H + and group (C, N, O) ion fluxes with different charges obtained using the ''Gorizont'' geostationary satellite (1985 - 07A) during three moderate magnetic disturbances with the amplitudes of D st -variations of several tens nT, have been analyzed. It is shown that during magnetic storms with clearly pronounced main phases a powerful injection of H + and (N, O) 2+ ion fluxes in the absence of noticeable increases in multicharge (C, N, O) ion fluxes with the energies of tens keV/e takes place. The resuts testify in favour of ionospheric plasma as the main source of ring current particles in the energy range. Indications that the filling of geostationary orbit with solar origin ions takes place at the recovery phase of a storm in nighttime hours are obtained

  11. Estimation of Synaptic Conductances in Presence of Nonlinear Effects Caused by Subthreshold Ionic Currents

    DEFF Research Database (Denmark)

    Vich, Catalina; Berg, Rune W.; Guillamon, Antoni

    2017-01-01

    Subthreshold fluctuations in neuronal membrane potential traces contain nonlinear components, and employing nonlinear models might improve the statistical inference. We propose a new strategy to estimate synaptic conductances, which has been tested using in silico data and applied to in vivo...... recordings. The model is constructed to capture the nonlinearities caused by subthreshold activated currents, and the estimation procedure can discern between excitatory and inhibitory conductances using only one membrane potential trace. More precisely, we perform second order approximations of biophysical...... models to capture the subthreshold nonlinearities, resulting in quadratic integrate-and-fire models, and apply approximate maximum likelihood estimation where we only suppose that conductances are stationary in a 50–100 ms time window. The results show an improvement compared to existent procedures...

  12. Simulation of mechano-electrical transduction in the cochlea considering basilar membrane vibration and the ionic current of the inner hair cells

    Science.gov (United States)

    Lee, Sinyoung; Koike, Takuji

    2018-05-01

    The inner hair cells (IHCs) in the cochlea transduce mechanical vibration of the basilar membrane (BM), caused by sound pressure, to electrical signals that are transported along the acoustic nerve to the brain. The mechanical vibration of the BM and the ionic behaviors of the IHCs have been investigated. However, consideration of the ionic behavior of the IHCs related to mechanical vibration is necessary to investigate the mechano-electrical transduction of the cochlea. In this study, a finite-element model of the BM, which takes into account the non-linear activities of the outer hair cells (OHCs), and an ionic current model of IHC were combined. The amplitudes and phases of the vibration at several points on the BM were obtained from the finite-element model by applying sound pressure. These values were fed into the ionic current model, and changes in membrane potential and calcium ion concentration of the IHCs were calculated. The membrane potential of the IHC at the maximum amplitude point (CF point) was higher than that at the non-CF points. The calcium ion concentration at the CF point was also higher than that at the non-CF points. These results suggest that the cochlea achieves its good frequency discrimination ability through mechano-electrical transduction.

  13. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  14. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  16. Measurement and simulation of ionic current as a means of quantifying effects of therapeutic millimeter wave radiation

    Science.gov (United States)

    Slovinsky, William Stanley

    A "millimeter wave" (MMW) is an electromagnetic oscillation with a wavelength between 1 and 10 mm, and a corresponding frequency of 30 to 300 GHz. In the spectrum of electromagnetic radiation, this band falls above the frequencies of radio waves and microwaves, and below that of infrared radiation. Since the 1950s, frequencies in this regime have been used for short range communications and beginning in the 1970s, a form of therapy known as "millimeter wave therapy" (MWT) , or microwave resonance therapy, in some publications. This form of therapy has been widely used in the republics of the former Soviet Union (FSU). As of 1995, it is estimated that more than one thousand medical centers in the FSU have performed MWT and more than three million patients have received this method of treatment. Despite the abundant use of this form of medicine, very little is known about the mechanisms by which it works. Early accounts of use are limited to Soviet government documents, largely unavailable to the scientific public, and limited translations and oral accounts from FSU scientists and literature reviews . This anecdotal body of evidence lacks the scrutiny of peer-reviewed journal publications. In order to gain more widespread acceptance in Western medicine, the pathway through which this regime of the electromagnetic radiation spectrum affects the human body must be rigorously mapped and quantified. Despite the anecdotal nature of a large portion of the existing research on biological MMW effects, a common link is the idea of an interaction occurring at the skin level, which is transduced into a signal used at a remote location in the body. This study explores a possible mechanism for the generation of this signal. The effects of therapeutic frequency MMW on the ionic currents through two different types of ion transport channels were studied, and the results are discussed with emphasis on how they relate to possible changes in nerve signals used by the body for

  17. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  18. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  19. Effects of glycine and current density on the mechanism of electrodeposition, composition and properties of Ni-Mn films prepared in ionic liquid

    Science.gov (United States)

    Guo, Jiacheng; Guo, Xingwu; Wang, Shaohua; Zhang, Zhicheng; Dong, Jie; Peng, Liming; Ding, Wenjiang

    2016-03-01

    The effects of glycine on the mechanism of electrodeposition of Ni-Mn alloy film prepared in ChCl-urea ionic liquid were studied in order to control the composition, microstructure and properties of the film. The cyclic voltammograms revealed that the presence of glycine in the ionic liquid can inhibit the reduction of Ni2+ ions but promote the reduction of Mn2+ ions in the cathodic scan. However, it promoted the dissolution of both Ni and Mn deposits in the ChCl-urea ionic liquids during the reverse scan. Glycine changed the mode of Ni-Mn film growth from Volmer-Weber mode into Stranski-Krastanov mode. The Mn content in the Ni-Mn film increased with the increase of concentration of glycine and current density. The Ni-Mn alloy film with 3.1 at.% Mn exhibited the lowest corrosion current density of 3 × 10-7 A/cm2 compared with other films prepared and exhibited better corrosion resistance than pure Ni film in 3.5 wt.% NaCl solution.

  20. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  1. The RF voltage dependence of the electron sheath heating in low pressure capacitively coupled rf discharges

    International Nuclear Information System (INIS)

    Buddemeier, U.; Kortshagen, U.; Pukropski, I.

    1995-01-01

    In low pressure capacitively coupled RF discharges two competitive electron heating mechanisms have been discussed for some time now. At low pressures the stochastic sheath heating and for somewhat higher pressures the Joule heating in the bulk plasma have been proposed. When the pressure is increased at constant RF current density a transition from concave electron distribution functions (EDF) with a pronounced cold electron group to convex EDFs with a missing strong population of cold electrons is found. This transition was interpreted as the transition from dominant stochastic to dominant Joule heating. However, a different interpretation has been given by Kaganovich and Tsendin, who attributed the concave shaped EDFs to the spatially inhomogeneous RF field in combination with the nonlocality of the EDF

  2. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  3. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  4. Comparison between the Gauss' law method and the zero current method to calculate multi-species ionic diffusion in saturated uncharged porous materials

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2010-01-01

    There exist, mainly, two different continuum approaches to calculate transient multi species ionic diffusion. One of them is based on explicitly assuming a zero current in the diffusing mixture together with an introduction of a streaming electrical potential in the constitutive equations...... of the coupled set of equation in favor of the staggering approach. A one step truly implicit time stepping scheme is adopted together with an implementation of a modified Newton-Raphson iterational scheme for search of equilibrium at each considered time step calculation. Results from the zero current case...... difference of the two types of potentials, that is, the streaming electrical potential and the electrical field is carefully examined. A novel numerical method based on the finite element approach is established for the zero current method case. The proposed numerical method uses the direct calculation...

  5. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  6. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  7. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  8. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  9. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  10. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  11. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  12. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Learning Ionic

    CERN Document Server

    Ravulavaru, Arvind

    2015-01-01

    This book is intended for those who want to learn how to build hybrid mobile applications using Ionic. It is also ideal for people who want to explore theming for Ionic apps. Prior knowledge of AngularJS is essential to complete this book successfully.

  15. Ionic Liquids in Tribology

    Directory of Open Access Journals (Sweden)

    Ichiro Minami

    2009-06-01

    Full Text Available Current research on room-temperature ionic liquids as lubricants is described. Ionic liquids possess excellent properties such as non-volatility, non-flammability, and thermo-oxidative stability. The potential use of ionic liquids as lubricants was first proposed in 2001 and approximately 70 articles pertaining to fundamental research on ionic liquids have been published through May 2009. A large majority of the cations examined in this area are derived from 1,3-dialkylimidazolium, with a higher alkyl group on the imidazolium cation being beneficial for good lubrication, while it reduces the thermo-oxidative stability. Hydrophobic anions provide both good lubricity and significant thermo-oxidative stability. The anions decompose through a tribochemical reaction to generate metal fluoride on the rubbed surface. Additive technology to improve lubricity is also explained. An introduction to tribology as an interdisciplinary field of lubrication is also provided.

  16. Ionic liquids in tribology.

    Science.gov (United States)

    Minami, Ichiro

    2009-06-24

    Current research on room-temperature ionic liquids as lubricants is described. Ionic liquids possess excellent properties such as non-volatility, non-flammability, and thermo-oxidative stability. The potential use of ionic liquids as lubricants was first proposed in 2001 and approximately 70 articles pertaining to fundamental research on ionic liquids have been published through May 2009. A large majority of the cations examined in this area are derived from 1,3-dialkylimidazolium, with a higher alkyl group on the imidazolium cation being beneficial for good lubrication, while it reduces the thermo-oxidative stability. Hydrophobic anions provide both good lubricity and significant thermo-oxidative stability. The anions decompose through a tribochemical reaction to generate metal fluoride on the rubbed surface. Additive technology to improve lubricity is also explained. An introduction to tribology as an interdisciplinary field of lubrication is also provided.

  17. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  18. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  19. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  20. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  1. Magnetic field effects on the vestibular system: calculation of the pressure on the cupula due to ionic current-induced Lorentz force

    International Nuclear Information System (INIS)

    Antunes, A; Glover, P M; Li, Y; Mian, O S; Day, B L

    2012-01-01

    Large static magnetic fields may be employed in magnetic resonance imaging (MRI). At high magnetic field strengths (usually from about 3 T and above) it is possible for humans to perceive a number of effects. One such effect is mild vertigo. Recently, Roberts et al (2011 Current Biology 21 1635–40) proposed a Lorentz-force mechanism resulting from the ionic currents occurring naturally in the endolymph of the vestibular system. In the present work a more detailed calculation of the forces and resulting pressures in the vestibular system is carried out using a numerical model. Firstly, realistic 3D finite element conductivity and fluid maps of the utricle and a single semi-circular canal containing the current sources (dark cells) and sinks (hair cells) of the utricle and ampulla were constructed. Secondly, the electrical current densities in the fluid are calculated. Thirdly, the developed Lorentz force is used directly in the Navier–Stokes equation and the trans-cupular pressure is computed. Since the driving force field is relatively large in comparison with the advective acceleration, we demonstrate that it is possible to perform an approximation in the Navier–Stokes equations that reduces the problem to solving a simpler Poisson equation. This simplification allows rapid and easy calculation for many different directions of applied magnetic field. At 7 T a maximum cupula pressure difference of 1.6 mPa was calculated for the combined ampullar (0.7 µA) and utricular (3.31 µA) distributed current sources, assuming a hair-cell resting current of 100 pA per unit. These pressure values are up to an order of magnitude lower than those proposed by Roberts et al using a simplistic model and calculation, and are in good agreement with the estimated pressure values for nystagmus velocities in caloric experiments. This modeling work supports the hypothesis that the Lorentz force mechanism is a significant contributor to the perception of magnetic field induced

  2. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  3. Anti-addiction drug ibogaine inhibits voltage-gated ionic currents: A study to assess the drug's cardiac ion channel profile

    International Nuclear Information System (INIS)

    Koenig, Xaver; Kovar, Michael; Rubi, Lena; Mike, Agnes K.; Lukacs, Peter; Gawali, Vaibhavkumar S.; Todt, Hannes; Hilber, Karlheinz; Sandtner, Walter

    2013-01-01

    The plant alkaloid ibogaine has promising anti-addictive properties. Albeit not licenced as a therapeutic drug, and despite hints that ibogaine may perturb the heart rhythm, this alkaloid is used to treat drug addicts. We have recently reported that ibogaine inhibits human ERG (hERG) potassium channels at concentrations similar to the drugs affinity for several of its known brain targets. Thereby the drug may disturb the heart's electrophysiology. Here, to assess the drug's cardiac ion channel profile in more detail, we studied the effects of ibogaine and its congener 18-Methoxycoronaridine (18-MC) on various cardiac voltage-gated ion channels. We confirmed that heterologously expressed hERG currents are reduced by ibogaine in low micromolar concentrations. Moreover, at higher concentrations, the drug also reduced human Na v 1.5 sodium and Ca v 1.2 calcium currents. Ion currents were as well reduced by 18-MC, yet with diminished potency. Unexpectedly, although blocking hERG channels, ibogaine did not prolong the action potential (AP) in guinea pig cardiomyocytes at low micromolar concentrations. Higher concentrations (≥ 10 μM) even shortened the AP. These findings can be explained by the drug's calcium channel inhibition, which counteracts the AP-prolonging effect generated by hERG blockade. Implementation of ibogaine's inhibitory effects on human ion channels in a computer model of a ventricular cardiomyocyte, on the other hand, suggested that ibogaine does prolong the AP in the human heart. We conclude that therapeutic concentrations of ibogaine have the propensity to prolong the QT interval of the electrocardiogram in humans. In some cases this may lead to cardiac arrhythmias. - Highlights: • We study effects of anti-addiction drug ibogaine on ionic currents in cardiomyocytes. • We assess the cardiac ion channel profile of ibogaine. • Ibogaine inhibits hERG potassium, sodium and calcium channels. • Ibogaine’s effects on ion channels are a potential

  4. Anti-addiction drug ibogaine inhibits voltage-gated ionic currents: A study to assess the drug's cardiac ion channel profile

    Energy Technology Data Exchange (ETDEWEB)

    Koenig, Xaver; Kovar, Michael; Rubi, Lena; Mike, Agnes K.; Lukacs, Peter; Gawali, Vaibhavkumar S.; Todt, Hannes [Center for Physiology and Pharmacology, Department of Neurophysiology and -pharmacology, Medical University of Vienna, 1090 Vienna (Austria); Hilber, Karlheinz, E-mail: karlheinz.hilber@meduniwien.ac.at [Center for Physiology and Pharmacology, Department of Neurophysiology and -pharmacology, Medical University of Vienna, 1090 Vienna (Austria); Sandtner, Walter [Center for Physiology and Pharmacology, Institute of Pharmacology, Medical University of Vienna, 1090 Vienna (Austria)

    2013-12-01

    The plant alkaloid ibogaine has promising anti-addictive properties. Albeit not licenced as a therapeutic drug, and despite hints that ibogaine may perturb the heart rhythm, this alkaloid is used to treat drug addicts. We have recently reported that ibogaine inhibits human ERG (hERG) potassium channels at concentrations similar to the drugs affinity for several of its known brain targets. Thereby the drug may disturb the heart's electrophysiology. Here, to assess the drug's cardiac ion channel profile in more detail, we studied the effects of ibogaine and its congener 18-Methoxycoronaridine (18-MC) on various cardiac voltage-gated ion channels. We confirmed that heterologously expressed hERG currents are reduced by ibogaine in low micromolar concentrations. Moreover, at higher concentrations, the drug also reduced human Na{sub v}1.5 sodium and Ca{sub v}1.2 calcium currents. Ion currents were as well reduced by 18-MC, yet with diminished potency. Unexpectedly, although blocking hERG channels, ibogaine did not prolong the action potential (AP) in guinea pig cardiomyocytes at low micromolar concentrations. Higher concentrations (≥ 10 μM) even shortened the AP. These findings can be explained by the drug's calcium channel inhibition, which counteracts the AP-prolonging effect generated by hERG blockade. Implementation of ibogaine's inhibitory effects on human ion channels in a computer model of a ventricular cardiomyocyte, on the other hand, suggested that ibogaine does prolong the AP in the human heart. We conclude that therapeutic concentrations of ibogaine have the propensity to prolong the QT interval of the electrocardiogram in humans. In some cases this may lead to cardiac arrhythmias. - Highlights: • We study effects of anti-addiction drug ibogaine on ionic currents in cardiomyocytes. • We assess the cardiac ion channel profile of ibogaine. • Ibogaine inhibits hERG potassium, sodium and calcium channels. • Ibogaine’s effects on

  5. Ionic thermometers

    International Nuclear Information System (INIS)

    Strnad, M.

    1975-01-01

    An original method of temperature measurement based on conductivity changes near the phase transition point of ionic compounds and suitable for the range from 200 to 700 0 C according to the thermometric compound used, is given. By choosing between two approaches it is posible to evaluate either a discrete value of temperature or continuous measurement in a range to about 50 0 C below the phase transition point of thermometric compounds. The extreme nonlinearity of conductivity of the chosen group of ionic crystals used as well as the technical applications developed in the laboratories have not previously been published. The aim of the research is the application of this measuring method for temperature indication in nuclear reactors. Preliminary tests in radiation fields in an experimental reactor are yielding a real hope in this direction. (author)

  6. Ionic polarization

    International Nuclear Information System (INIS)

    Mahan, G.D.

    1992-01-01

    Ferroelectricity occurs in many different kinds of materials. Many of the technologically important solids, which are ferroelectric, can be classified as ionic. Any microscopic theory of ferroelectricity must contain a description of local polarization forces. We have collaborated in the development of a theory of ionic polarization which is quite successful. Its basic assumption is that the polarization is derived from the properties of the individual ions. We have applied this theory successfully to diverse subjects as linear and nonlinear optical response, phonon dispersion, and piezoelectricity. We have developed numerical methods using the local Density approximation to calculate the multipole polarizabilities of ions when subject to various fields. We have also developed methods of calculating the nonlinear hyperpolarizability, and showed that it can be used to explain light scattering experiments. This paper elaborates on this polarization theory

  7. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  8. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  9. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  10. Nanosecond electric pulses differentially affect inward and outward currents in patch clamped adrenal chromaffin cells.

    Directory of Open Access Journals (Sweden)

    Lisha Yang

    Full Text Available This study examined the effect of 5 ns electric pulses on macroscopic ionic currents in whole-cell voltage-clamped adrenal chromaffin cells. Current-voltage (I-V relationships first established that the early peak inward current was primarily composed of a fast voltage-dependent Na+ current (INa, whereas the late outward current was composed of at least three ionic currents: a voltage-gated Ca2+ current (ICa, a Ca2+-activated K+ current (IK(Ca, and a sustained voltage-dependent delayed rectifier K+ current (IKV. A constant-voltage step protocol was next used to monitor peak inward and late outward currents before and after cell exposure to a 5 ns pulse. A single pulse applied at an electric (E-field amplitude of 5 MV/m resulted in an instantaneous decrease of ~4% in peak INa that then declined exponentially to a level that was ~85% of the initial level after 10 min. Increasing the E-field amplitude to 8 or 10 MV/m caused a twofold greater inhibitory effect on peak INa. The decrease in INa was not due to a change in either the steady-state inactivation or activation of the Na+ channel but instead was associated with a decrease in maximal Na+ conductance. Late outward current was not affected by a pulse applied at 5 MV/m. However, for a pulse applied at the higher E-field amplitudes of 8 and 10 MV/m, late outward current in some cells underwent a progressive ~22% decline over the course of the first 20 s following pulse exposure, with no further decline. The effect was most likely concentrated on ICa and IK(Ca as IKV was not affected. The results of this study indicate that in whole-cell patch clamped adrenal chromaffin cells, a 5 ns pulse differentially inhibits specific voltage-gated ionic currents in a manner that can be manipulated by tuning E-field amplitude.

  11. Transport-limited current and micro-sono-reactor characterization at 3 low frequencies in the presence of water, acetonitrile and imidazolium-based ionic liquids

    International Nuclear Information System (INIS)

    Costa, C.; Hihn, J. Y.; Rebetez, M.; Doche, M. L.; Bisel, I.; Moisy, P.

    2008-01-01

    A micro-sono-reactor, specially designed to carry out electrochemical tests in a room-temperature ionic liquid medium (RTIL), was studied. The cell, based on a particular design consisting of off-setting the ultrasonic probe out of the reaction volume, was characterized by several methods such as calorimetry, dosimetry and mass transfer measurements. The main result concerns the specific behaviour of the ionic liquid under ultrasonic irradiation. For example, the mass-transfer enhancement is particularly high, characterized by an average Sherwood number of 6500 while the value obtained with an electrode rotating at 4500 rpm is only 1200. (authors)

  12. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  13. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  14. Bone morphogenetic protein 4 inhibits insulin secretion from rodent beta cells through regulation of calbindin1 expression and reduced voltage-dependent calcium currents

    DEFF Research Database (Denmark)

    Christensen, Gitte L.; Jacobsen, Maria L. B.; Wendt, Anna

    2015-01-01

    AIMS/HYPOTHESIS: Type 2 diabetes is characterised by progressive loss of pancreatic beta cell mass and function. Therefore, it is of therapeutic interest to identify factors with the potential to improve beta cell proliferation and insulin secretion. Bone morphogenetic protein 4 (BMP4) expression...

  15. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  16. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  17. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  18. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  19. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  20. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  1. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  2. Course on Ionic Channels

    CERN Document Server

    1986-01-01

    This book is based on a series of lectures for a course on ionic channels held in Santiago, Chile, on November 17-20, 1984. It is intended as a tutorial guide on the properties, function, modulation, and reconstitution of ionic channels, and it should be accessible to graduate students taking their first steps in this field. In the presentation there has been a deliberate emphasis on the spe­ cific methodologies used toward the understanding of the workings and function of channels. Thus, in the first section, we learn to "read" single­ channel records: how to interpret them in the theoretical frame of kinetic models, which information can be extracted from gating currents in re­ lation to the closing and opening processes, and how ion transport through an open channel can be explained in terms of fluctuating energy barriers. The importance of assessing unequivocally the origin and purity of mem­ brane preparations and the use of membrane vesicles and optical tech­ niques in the stUGY of ionic channels a...

  3. Thermotropic Ionic Liquid Crystals

    Science.gov (United States)

    Axenov, Kirill V.; Laschat, Sabine

    2011-01-01

    The last five years’ achievements in the synthesis and investigation of thermotropic ionic liquid crystals are reviewed. The present review describes the mesomorphic properties displayed by organic, as well as metal-containing ionic mesogens. In addition, a short overview on the ionic polymer and self-assembled liquid crystals is given. Potential and actual applications of ionic mesogens are also discussed. PMID:28879986

  4. Thermotropic Ionic Liquid Crystals.

    Science.gov (United States)

    Axenov, Kirill V; Laschat, Sabine

    2011-01-14

    The last five years' achievements in the synthesis and investigation of thermotropic ionic liquid crystals are reviewed. The present review describes the mesomorphic properties displayed by organic, as well as metal-containing ionic mesogens. In addition, a short overview on the ionic polymer and self-assembled liquid crystals is given. Potential and actual applications of ionic mesogens are also discussed.

  5. Thermotropic Ionic Liquid Crystals

    OpenAIRE

    Axenov, Kirill V.; Laschat, Sabine

    2011-01-01

    The last five years’ achievements in the synthesis and investigation of thermotropic ionic liquid crystals are reviewed. The present review describes the mesomorphic properties displayed by organic, as well as metal-containing ionic mesogens. In addition, a short overview on the ionic polymer and self-assembled liquid crystals is given. Potential and actual applications of ionic mesogens are also discussed.

  6. Thermodynamic estimation: Ionic materials

    International Nuclear Information System (INIS)

    Glasser, Leslie

    2013-01-01

    Thermodynamics establishes equilibrium relations among thermodynamic parameters (“properties”) and delineates the effects of variation of the thermodynamic functions (typically temperature and pressure) on those parameters. However, classical thermodynamics does not provide values for the necessary thermodynamic properties, which must be established by extra-thermodynamic means such as experiment, theoretical calculation, or empirical estimation. While many values may be found in the numerous collected tables in the literature, these are necessarily incomplete because either the experimental measurements have not been made or the materials may be hypothetical. The current paper presents a number of simple and relible estimation methods for thermodynamic properties, principally for ionic materials. The results may also be used as a check for obvious errors in published values. The estimation methods described are typically based on addition of properties of individual ions, or sums of properties of neutral ion groups (such as “double” salts, in the Simple Salt Approximation), or based upon correlations such as with formula unit volumes (Volume-Based Thermodynamics). - Graphical abstract: Thermodynamic properties of ionic materials may be readily estimated by summation of the properties of individual ions, by summation of the properties of ‘double salts’, and by correlation with formula volume. Such estimates may fill gaps in the literature, and may also be used as checks of published values. This simplicity arises from exploitation of the fact that repulsive energy terms are of short range and very similar across materials, while coulombic interactions provide a very large component of the attractive energy in ionic systems. Display Omitted - Highlights: • Estimation methods for thermodynamic properties of ionic materials are introduced. • Methods are based on summation of single ions, multiple salts, and correlations. • Heat capacity, entropy

  7. Part-II: Exchange current density and ionic diffusivity studies on the ordered and disordered spinel LiNi0.5Mn1.5O4 cathode

    Science.gov (United States)

    Amin, Ruhul; Belharouak, Ilias

    2017-04-01

    Additive-free pellets of Li1-xNi0.5Mn1.5O4 have been prepared for the purpose of performing ionic diffusivity and exchange current density studies. Here we report on the characterization of interfacial charge transfer kinetics and ionic diffusivity of ordered (P4332) and disordered (Fd 3 bar m) Li1-xNi0.5Mn1.5O4 as a function of lithium content at ambient temperature. The exchange current density at the electrode/electrolyte interface is found to be continuously increased with increasing the degree of delithiation for ordered phase (∼0.21-6.5 mA/cm2) at (x = 0.01-0.60), in contrast the disordered phase exhibits gradually decrease of exchange current density in the initial delithiation at the 4 V plateau regime (x = 0.01-0.04) and again monotonously increases (0.65-6.8 mA/cm2) with further delithiation at (x = 0.04-0.60). The ionic diffusivity of ordered and disordered phase is found to be ∼5 × 10-10cm2s-1 and ∼10-9cm2s-1, respectively, and does not vary much with the degree of delithiation. From the obtained results it appears that the chemical diffusivity during electrochemical use is limited by lithium transport, but is fast enough over the entire state-of-charge range to allow charge/discharge of micron-scale particles at practical C-rates.

  8. Regulation of inward rectifier potassium current ionic channel remodeling by AT1 -Calcineurin-NFAT signaling pathway in stretch-induced hypertrophic atrial myocytes.

    Science.gov (United States)

    He, Jionghong; Xu, Yanan; Yang, Long; Xia, Guiling; Deng, Na; Yang, Yongyao; Tian, Ye; Fu, Zenan; Huang, Yongqi

    2018-05-02

    Previous studies have shown that the activation of angiotensin II receptor type I (AT 1 ) is attributed to cardiac remodeling stimulated by increased heart load, and that it is followed by the activation of the calcineurin-nuclear factor of activated T-cells (NFAT) signaling pathway. Additionally, AT 1 has been found to be a regulator of cardiocyte ionic channel remodeling, and calcineurin-NFAT signals participate in the regulation of cardiocyte ionic channel expression. A hypothesis therefore follows that stretch stimulation may regulate cardiocyte ionic channel remodeling by activating the AT 1 -calcineurin-NFAT pathway. Here, we investigated the role of the AT 1 -calcineurin-NFAT pathway in the remodeling of inward rectifier potassium (I k1 ) channel, in addition to its role in changing action potential, in stretch-induced hypertrophic atrial myocytes of neonatal rats. Our results showed that increased stretch significantly led to atrial myocytes hypertrophy; it also increased the activity of calcineurin enzymatic activity, which was subsequently attenuated by telmisartan or cyclosporine-A. The level of NFAT 3 protein in nuclear extracts, the mRNA and protein expression of Kir2.1 in whole cell extracts, and the density of I k1 were noticeably increased in stretched samples. Stretch stimulation significantly shortened the action potential duration (APD) of repolarization at the 50% and 90% level. Telmisartan, cyclosporine-A, and 11R-VIVIT attenuated stretch-induced alterations in the levels of NFAT 3 , mRNA and protein expression of Kir2.1, the density of I k1 , and the APD. Our findings suggest that the AT 1 -calcineurin-NFAT signaling pathway played an important role in regulating I k1 channel remodeling and APD change in stretch-induced hypertrophic atrial myocytes of neonatal rats. This article is protected by copyright. All rights reserved.

  9. Ionic and Molecular Liquids

    DEFF Research Database (Denmark)

    Chaban, Vitaly V.; Prezhdo, Oleg

    2013-01-01

    Because of their outstanding versatility, room-temperature ionic liquids (RTILs) are utilized in an ever increasing number of novel and fascinating applications, making them the Holy Grail of modern materials science. In this Perspective, we address the fundamental research and prospective...... applications of RTILs in combination with molecular liquids, concentrating on three significant areas: (1) the use of molecular liquids to decrease the viscosity of RTILs; (2) the role of RTIL micelle formation in water and organic solvents; and (3) the ability of RTILs to adsorb pollutant gases. Current...

  10. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  11. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Ionic Liquids as Extraction Media for Metal Ions

    Science.gov (United States)

    Hirayama, Naoki

    In solvent extraction separation of metal ions, recently, many researchers have investigated possible use of hydrophobic ionic liquids as extraction media instead of organic solvents. Ionic liquids are salts of liquid state around room temperature and can act not only as solvents but also as ion-exchangers. Therefore, the extraction mechanism of metal ions into ionic liquids is complicated. This review presents current overview and perspective on evaluation of nature of hydrophobic ionic liquids as extraction media for metal ions.

  13. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Ionic propulsion

    International Nuclear Information System (INIS)

    Velarde, G.

    1972-01-01

    The inner parameters (electrons and ions velocity, current, thrust, power; specific impulse) and the outer parameters (velocity and operating time] of an ion propellant rocket are studied. The components (chamber dimensions, weights, propellants,) are also described. (Author) 5 refs

  15. Acidic Ionic Liquids.

    Science.gov (United States)

    Amarasekara, Ananda S

    2016-05-25

    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition.

  16. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  17. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  18. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  19. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  20. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  1. Thermotropic Ionic Liquid Crystals

    Directory of Open Access Journals (Sweden)

    Sabine Laschat

    2011-01-01

    Full Text Available The last five years’ achievements in the synthesis and investigation of thermotropic ionic liquid crystals are reviewed. The present review describes the mesomorphic properties displayed by organic, as well as metal-containing ionic mesogens. In addition, a short overview on the ionic polymer and self-assembled liquid crystals is given. Potential and actual applications of ionic mesogens are also discussed.

  2. Fullerol ionic fluids

    KAUST Repository

    Fernandes, Nikhil; Dallas, Panagiotis; Rodriguez, Robert; Bourlinos, Athanasios B.; Georgakilas, Vasilios; Giannelis, Emmanuel P.

    2010-01-01

    ®). The ionic fluid was compared to a control synthesized by mixing the partially protonated form (sodium form) of the fullerols with the same oligomeric amine in the same ratio as in the ionic fluids (20 wt% fullerol). In the fullerol fluid the ionic bonding

  3. Ionic conducting poly-benzimidazoles

    International Nuclear Information System (INIS)

    Jouanneau, J.

    2006-11-01

    Over the last years, many research works have been focused on new clean energy systems. Hydrogen fuel cell seems to be the most promising one. However, the large scale development of this technology is still limited by some key elements. One of them is the polymer electrolyte membrane 'Nafion' currently used, for which the ratio performance/cost is too low. The investigations we carried out during this thesis work are related to a new class of ionic conducting polymer, the sulfonated poly-benzimidazoles (sPBI). Poly-benzimidazoles (PBI) are aromatic heterocyclic polymers well-known for their excellent thermal and chemical stability. Ionic conduction properties are obtained by having strong acid groups (sulfonic acid SO 3 H) on the macromolecular structure. For that purpose, we first synthesized sulfonated monomers. Their poly-condensation with an appropriate non-sulfonated co-monomer yields to sPBI with sulfonation range from 0 to 100 per cent. Three different sPBI structures were obtained, and verified by appropriate analytical techniques. We also showed that the protocol used for the synthesis resulted in high molecular weights polymers. We prepared ionic conducting membrane by casting sPBI solutions on glass plates. Their properties of stability, water swelling and ionic conductivity were investigated. Surprisingly, the behaviour of sPBI was quite different from the other sulfonated aromatic polymers with same amount of SO 3 H, their stability was much higher, but their water swelling and ionic conductivity were quite low. We attributed these differences to strong ionic interactions between the sulfonic acid groups and the basic benzimidazole groups of our polymers. However, we managed to solve this problem synthesizing very highly sulfonated PBI, obtaining membranes with a good balance between all the properties necessary. (author)

  4. Polar localization of plasma membrane Ca2+/Mg2+ ATPase correlates with the pattern of steady ionic currents in eggs ofLymnaea stagnalis andBithynia tentaculata (Mollusca).

    Science.gov (United States)

    Zivkovic, Danica; Créton, Robbert; Zwaan, Gideon; de Bruijn, Willem C; Dohmen, M René

    1990-11-01

    During extrusion of the first polar body in eggs ofLymnaea stagnalis andBithynia tentaculata a localized Ca 2+ /Mg 2+ ATPase activity was detected, using Ando's enzyme-cytochemical method for electron microscopy [Ando et al. (1981) Acta Histochem Cytochem 14:705-726]. The enzyme activity was distributed in a polar fashion, along the cytoplasmic face of the plasma membrane. In the eggs ofLymnaea it was found only in the vegetal hemisphere, whereas inBithynia eggs it was localized both in the vegetal hemisphere and at the animal pole. This pattern of enzyme activity corresponds to the polar pattern of transcellular ionic currents measured with the vibrating probe, which we showed to be partially carried or regulated by calcium [Zivkovic and Dohmen (1989) Biol Bull (Woods Hole) 176 (Suppl):103-109]. The characteristics of the ATPase were studied using a variety of approaches such as ion and substrate depletions and substitutions, addition of specific inhibitors of ATPase activity, treatment with EDTA/EGTA and electron energy-loss spectrometry. The results indicate that, inLymnaea, there are at least two enzymatic entities. The first one is a Ca 2+ /Mg 2+ ATPase localized along the membrane and in the cortex of the vegetal hemisphere. The second one is a Ca 2+ -stimulated ATPase (calcium pump of the plasma membrane) localized in a small region of the membrane at the vegetal pole. We speculate that in the eggs ofLymnaea andBithynia a functional relationship exists between the plasma-membrane-associated ATPase activity and the transcellular ionic currents measured in the same region.

  5. MarkoLAB: A simulator to study ionic channel's stochastic behavior.

    Science.gov (United States)

    da Silva, Robson Rodrigues; Goroso, Daniel Gustavo; Bers, Donald M; Puglisi, José Luis

    2017-08-01

    Mathematical models of the cardiac cell have started to include markovian representations of the ionic channels instead of the traditional Hodgkin & Huxley formulations. There are many reasons for this: Markov models are not restricted to the idea of independent gates defining the channel, they allow more complex description with specific transitions between open, closed or inactivated states, and more importantly those states can be closely related to the underlying channel structure and conformational changes. We used the LabVIEW ® and MATLAB ® programs to implement the simulator MarkoLAB that allow a dynamical 3D representation of the markovian model of the channel. The Monte Carlo simulation was used to implement the stochastic transitions among states. The user can specify the voltage protocol by setting the holding potential, the step-to voltage and the duration of the stimuli. The most studied feature of a channel is the current flowing through it. This happens when the channel stays in the open state, but most of the time, as revealed by the low open probability values, the channel remains on the inactive or closed states. By focusing only when the channel enters or leaves the open state we are missing most of its activity. MarkoLAB proved to be quite useful to visualize the whole behavior of the channel and not only when the channel produces a current. Such dynamic representation provides more complete information about channel kinetics and will be a powerful tool to demonstrate the effect of gene mutations or drugs on the channel function. MarkoLAB provides an original way of visualizing the stochastic behavior of a channel. It clarifies concepts, such as recovery from inactivation, calcium- versus voltage-dependent inactivation, and tail currents. It is not restricted to ionic channels only but it can be extended to other transporters, such as exchangers and pumps. This program is intended as a didactical tool to illustrate the dynamical behavior of a

  6. Fullerol ionic fluids

    Science.gov (United States)

    Fernandes, Nikhil; Dallas, Panagiotis; Rodriguez, Robert; Bourlinos, Athanasios B.; Georgakilas, Vasilios; Giannelis, Emmanuel P.

    2010-09-01

    We report for the first time an ionic fluid based on hydroxylated fullerenes (fullerols). The ionic fluid was synthesized by neutralizing the fully protonated fullerol with an amine terminated polyethylene/polypropylene oxide oligomer (Jeffamine®). The ionic fluid was compared to a control synthesized by mixing the partially protonated form (sodium form) of the fullerols with the same oligomeric amine in the same ratio as in the ionic fluids (20 wt% fullerol). In the fullerol fluid the ionic bonding significantly perturbs the thermal transitions and melting/crystallization behavior of the amine. In contrast, both the normalized heat of fusion and crystallization of the amine in the control are similar to those of the neat amine consistent with a physical mixture of the fullerols/amine with minimal interactions. In addition to differences in thermal behavior, the fullerol ionic fluid exhibits a complex viscoelastic behavior intermediate between the neat Jeffamine® (liquid-like) and the control (solid-like).

  7. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  8. Nanoscale Ionic Liquids

    Science.gov (United States)

    2006-11-01

    Technical Report 11 December 2005 - 30 November 2006 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Nanoscale Ionic Liquids 5b. GRANT NUMBER FA9550-06-1-0012...Title: Nanoscale Ionic Liquids Principal Investigator: Emmanuel P. Giannelis Address: Materials Science and Engineering, Bard Hall, Cornell University...based fluids exhibit high ionic conductivity. The NFs are typically synthesized by grafting a charged, oligomeric corona onto the nanoparticle cores

  9. Lipid processing in ionic liquids

    DEFF Research Database (Denmark)

    Lue, Bena-Marie; Guo, Zheng; Xu, Xuebing

    2007-01-01

    Ionic liquids (ILs) have been touted as “green” alternatives to traditional molecular solvents and have many unique properties which make them extremely desirable substitutes. Among their most attractive properties are their lack of vapour pressure, broad liquid range, strong solvating power and ...... and the ability to tailor properties of individual ILs to meet specific requirements. This article highlights current research as well as the vast potential of ILs for use as media for reactions, separation and processing in the lipid area....

  10. A new process for desalination and electrodeionization of water by means of electrostatic shielding zones – ionic current sinks. Study of optical sensors of the form Al/a-SiC:H/c-Si(n with high sensitivity.

    Directory of Open Access Journals (Sweden)

    A. Dermentzi

    2009-01-01

    Full Text Available We constructed electrostatic shielding zones made of electrode graphite powder and used them as a new type of ionic and electronic current sinks. Because of the local elimination of the applied electric field, voltage and current within the current sinks, ions are led inside them and accumulate there. The sinks become ion concentrating compartments whereas the adjacent compartments become ion depleting compartments. The proposed electrodeionization process uses no permselective ion exchange membranes. We implemented it in electrodialysis desalination of a synthetic brackish 0.03 M NaCl solution and obtained potable water with a NaCl concentration <500 mg L-1. Furthermore, we performed electrodialysis of 0.002 M NiSO4 and electrodeionization of 0.001 M NiSO4 solutions with simultaneous electrochemical regeneration of the used ion exchange resin beds. By the continuous mode of electrodeionization of the 0.001 M NiSO4 solution we obtained pure water with a Ni2+ ion concentration of less than 0.5 mg L-1 at a flow rate of 2.3 x10-4 L s-1 diluate stream

  11. Multiple Actions of Rotenone, an Inhibitor of Mitochondrial Respiratory Chain, on Ionic Currents and Miniature End-Plate Potential in Mouse Hippocampal (mHippoE-14 Neurons

    Directory of Open Access Journals (Sweden)

    Chin-Wei Huang

    2018-05-01

    Full Text Available Background/Aims: Rotenone (Rot is known to suppress the activity of complex I in the mitochondrial chain reaction; however, whether this compound has effects on ion currents in neurons remains largely unexplored. Methods: With the aid of patch-clamp technology and simulation modeling, the effects of Rot on membrane ion currents present in mHippoE-14 cells were investigated. Results: Addition of Rot produced an inhibitory action on the peak amplitude of INa with an IC50 value of 39.3 µM; however, neither activation nor inactivation kinetics of INa was changed during cell exposure to this compound. Addition of Rot produced little or no modifications in the steady-state inactivation curve of INa. Rot increased the amplitude of Ca2+-activated Cl- current in response to membrane depolarization with an EC50 value of 35.4 µM; further addition of niflumic acid reversed Rot-mediated stimulation of this current. Moreover, when these cells were exposed to 10 µM Rot, a specific population of ATP-sensitive K+ channels with a single-channel conductance of 18.1 pS was measured, despite its inability to alter single-channel conductance. Under current clamp condition, the frequency of miniature end-plate potentials in mHippoE-14 cells was significantly raised in the presence of Rot (10 µM with no changes in their amplitude and time course of rise and decay. In simulated model of hippocampal neurons incorporated with chemical autaptic connection, increased autaptic strength to mimic the action of Rot was noted to change the bursting pattern with emergence of subthreshold potentials. Conclusions: The Rot effects presented herein might exert a significant action on functional activities of hippocampal neurons occurring in vivo.

  12. Ionic Liquids in Biomass Processing

    Science.gov (United States)

    Tan, Suzie Su Yin; Macfarlane, Douglas R.

    Ionic liquids have been studied for their special solvent properties in a wide range of processes, including reactions involving carbohydrates such as cellulose and glucose. Biomass is a widely available and renewable resource that is likely to become an economically viable source of starting materials for chemical and fuel production, especially with the price of petroleum set to increase as supplies are diminished. Biopolymers such as cellulose, hemicellulose and lignin may be converted to useful products, either by direct functionalisation of the polymers or depolymerisation to monomers, followed by microbial or chemical conversion to useful chemicals. Major barriers to the effective conversion of biomass currently include the high crystallinity of cellulose, high reactivity of carbohydrates and lignin, insolubility of cellulose in conventional solvents, as well as heterogeneity in the native lignocellulosic materials and in lignin itself. This combination of factors often results in highly heterogeneous depolymerisation products, which make efficient separation difficult. Thus the extraction, depolymerisation and conversion of biopolymers will require novel reaction systems in order to be both economically attractive and environmentally benign. The solubility of biopolymers in ionic liquids is a major advantage of their use, allowing homogeneous reaction conditions, and this has stimulated a growing research effort in this field. This review examines current research involving the use of ionic liquids in biomass reactions, with perspectives on how it relates to green chemistry, economic viability, and conventional biomass processes.

  13. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

    Science.gov (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

    2012-06-06

    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  14. Simultaneous mapping of membrane voltage and calcium in zebrafish heart in vivo reveals chamber-specific developmental transitions in ionic currents

    Directory of Open Access Journals (Sweden)

    Jennifer H Hou

    2014-09-01

    Full Text Available The cardiac action potential (AP and the consequent cytosolic Ca2+ transient are key indicators of cardiac function. Natural developmental processes, as well as many drugs and pathologies change the waveform, propagation, or variability (between cells or over time of these parameters. Here we apply a genetically encoded dual-function calcium and voltage reporter (CaViar to study the development of the zebrafish heart in vivo between 1.5 and 4 days post fertilization (dpf. We developed a high-sensitivity spinning disk confocal microscope and associated software for simultaneous three-dimensional optical mapping of voltage and calcium. We produced a transgenic zebrafish line expressing CaViar under control of the heart-specific cmlc2 promoter, and applied ion channel blockers at a series of developmental stages to map the maturation of the action potential in vivo. Early in development, the AP initiated via a calcium current through L-type calcium channels. Between 90 – 102 hours post fertilization (hpf, the ventricular AP switched to a sodium-driven upswing, while the atrial AP remained calcium driven. In the adult zebrafish heart, a sodium current drives the AP in both the atrium and ventricle. Simultaneous voltage and calcium imaging with genetically encoded reporters provides a new approach for monitoring cardiac development, and the effects of drugs on cardiac function.

  15. Ionic liquids as electrolytes

    International Nuclear Information System (INIS)

    Galinski, Maciej; Lewandowski, Andrzej; Stepniak, Izabela

    2006-01-01

    Salts having a low melting point are liquid at room temperature, or even below, and form a new class of liquids usually called room temperature ionic liquids (RTIL). Information about RTILs can be found in the literature with such key words as: room temperature molten salt, low-temperature molten salt, ambient-temperature molten salt, liquid organic salt or simply ionic liquid. Their physicochemical properties are the same as high temperature ionic liquids, but the practical aspects of their maintenance or handling are different enough to merit a distinction. The class of ionic liquids, based on tetraalkylammonium cation and chloroaluminate anion, has been extensively studied since late 1970s of the XX century, following the works of Osteryoung. Systematic research on the application of chloroaluminate ionic liquids as solvents was performed in 1980s. However, ionic liquids based on aluminium halides are moisture sensitive. During the last decade an increasing number of new ionic liquids have been prepared and used as solvents. The general aim of this paper was to review the physical and chemical properties of RTILs from the point of view of their possible application as electrolytes in electrochemical processes and devices. The following points are discussed: melting and freezing, conductivity, viscosity, temperature dependence of conductivity, transport and transference numbers, electrochemical stability, possible application in aluminium electroplating, lithium batteries and in electrochemical capacitors

  16. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  17. Photophysics of ionic biochromophores

    CERN Document Server

    Brøndsted Nielsen, Steen

    2014-01-01

    This concise guide to studying ionic biochromophores features the first integrated overview of the photophysics of differing classes of biomolecules, from single amino acids to DNA. It includes an appraisal of the latest theories and experimental techniques.

  18. Ionic liquids for addressing unmet needs in healthcare

    Science.gov (United States)

    Agatemor, Christian; Ibsen, Kelly N.; Tanner, Eden E. L.

    2018-01-01

    Abstract Advances in the field of ionic liquids have opened new applications beyond their traditional use as solvents into other fields especially healthcare. The broad chemical space, rich with structurally diverse ions, and coupled with the flexibility to form complementary ion pairs enables task‐specific optimization at the molecular level to design ionic liquids for envisioned functions. Consequently, ionic liquids now are tailored as innovative solutions to address many problems in medicine. To date, ionic liquids have been designed to promote dissolution of poorly soluble drugs and disrupt physiological barriers to transport drugs to targeted sites. Also, their antimicrobial activity has been demonstrated and could be exploited to prevent and treat infectious diseases. Metal‐containing ionic liquids have also been designed and offer unique features due to incorporation of metals. Here, we review application‐driven investigations of ionic liquids in medicine with respect to current status and future potential. PMID:29376130

  19. Fullerol ionic fluids

    KAUST Repository

    Fernandes, Nikhil

    2010-01-01

    We report for the first time an ionic fluid based on hydroxylated fullerenes (fullerols). The ionic fluid was synthesized by neutralizing the fully protonated fullerol with an amine terminated polyethylene/polypropylene oxide oligomer (Jeffamine®). The ionic fluid was compared to a control synthesized by mixing the partially protonated form (sodium form) of the fullerols with the same oligomeric amine in the same ratio as in the ionic fluids (20 wt% fullerol). In the fullerol fluid the ionic bonding significantly perturbs the thermal transitions and melting/crystallization behavior of the amine. In contrast, both the normalized heat of fusion and crystallization of the amine in the control are similar to those of the neat amine consistent with a physical mixture of the fullerols/amine with minimal interactions. In addition to differences in thermal behavior, the fullerol ionic fluid exhibits a complex viscoelastic behavior intermediate between the neat Jeffamine® (liquid-like) and the control (solid-like). © 2010 The Royal Society of Chemistry.

  20. Sensitivities of ionic explosives

    Science.gov (United States)

    Politzer, Peter; Lane, Pat; Murray, Jane S.

    2017-03-01

    We have investigated the relevance for ionic explosive sensitivity of three factors that have been demonstrated to be related to the sensitivities of molecular explosives. These are (1) the maximum available heat of detonation, (2) the amount of free space per molecule (or per formula unit) in the crystal lattice and (3) specific features of the electrostatic potential on the molecular or ionic surface. We find that for ionic explosives, just as for molecular ones, there is an overall tendency for impact sensitivity to increase as the maximum detonation heat release is greater. This means that the usual emphasis upon designing explosives with large heats of detonation needs to be tempered somewhat. We also show that a moderate detonation heat release does not preclude a high level of detonation performance for ionic explosives, as was already demonstrated for molecular ones. Relating the free space per formula unit to sensitivity may require a modified procedure for ionic explosives; this will continue to be investigated. Finally, an encouraging start has been made in linking impact sensitivities to the electrostatic potentials on ionic surfaces, although limited so far to ammonium salts.

  1. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  2. Improvement of SOFC electrodes using mixed ionic-electronic conductors

    Energy Technology Data Exchange (ETDEWEB)

    Matsuzaki, Y.; Hishinuma, M. [Tokyo Gas Co., Ltd. (Japan)

    1996-12-31

    Since the electrode reaction of SOFC is limited to the proximity of a triple phase boundary (TPB), the local current density at the electrode and electrolyte interface is larger than mean current density, which causes large ohmic and electrode polarization. This paper describes an application of mixed ionic-electronic conductors to reduce such polarization by means of (1) enhancing ionic conductivity of the electrolyte surface layer by coating a high ionic conductors, and (2) reducing the local current density by increasing the electrochemically active sites.

  3. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó

    2016-03-01

    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  4. Visualization of ionic wind in laminar jet flames

    KAUST Repository

    Park, Daegeun

    2017-07-03

    Electric field, when it is applied to hydrocarbon flames, generates ionic wind due to the electric body force on charge carrying species. Ionic wind has been shown to influence soot emission, propagation speed, and stability of flames; however, a detailed behavior of ionic wind and its effects on flames is still not clear. Here, we investigated the dynamic behaviors of flames and ionic wind in the presence of direct current (DC) and alternating current (AC) electric fields in nonpremixed and premixed jet flames with a jet nozzle placed between two parallel electrodes. We observed a skewed flame toward a lower potential electrode with DC and lower frequency AC (e.g., 10Hz) and a steady flame with higher frequencies AC (1000Hz), while we found that the ionic wind blew toward both the anode and cathode regardless of flame type (nonpremixed or premixed) or the source of the electric field (DC and AC).

  5. Lewis Acidic Ionic Liquids.

    Science.gov (United States)

    Brown, Lucy C; Hogg, James M; Swadźba-Kwaśny, Małgorzata

    2017-08-21

    Until very recently, the term Lewis acidic ionic liquids (ILs) was nearly synonymous with halometallate ILs, with a strong focus on chloroaluminate(III) systems. The first part of this review covers the historical context in which these were developed, speciation of a range of halometallate ionic liquids, attempts to quantify their Lewis acidity, and selected recent applications: in industrial alkylation processes, in supported systems (SILPs/SCILLs) and in inorganic synthesis. In the last decade, interesting alternatives to halometallate ILs have emerged, which can be divided into two sub-sections: (1) liquid coordination complexes (LCCs), still based on halometallate species, but less expensive and more diverse than halometallate ionic liquids, and (2) ILs with main-group Lewis acidic cations. The two following sections cover these new liquid Lewis acids, also highlighting speciation studies, Lewis acidity measurements, and applications.

  6. Functional ionic liquids

    International Nuclear Information System (INIS)

    Baecker, Tobias

    2012-01-01

    In the thesis at hand, new functional ionic liquids were investigated. Main focus was attended to their structure property relations and the structural features leading to a decrease of the melting point. New compounds of the type 1-butyl-3-methylimidazolium tris(N,Ndialkyldithiocarbamato) uranylate with variously substituated dithiocarbamato ligands were synthesized and characterized. Ligands with asymmetrical substitution pattern proved to be most suitable for ionic liquid formation. The single-crystal X-ray structures revealed the interactions in the solid state. Here, the first spectroscopic investigation of the U-S bond in sulfur donated uranyl complexes, up to now only observed in single-crystal X-ray structures, is presented, and the participation of the uranium f-orbitals is shown by theoretical calculations. Electrochemical investigations showed the accessibility of the respective U V O 2 + compounds. As well, ionic liquids with [FeCl 4 ] - and [Cl 3 FeOFeCl 3 ] 2- as anion were synthesized. Both of these anions contain high-spin Fe(III) centres in distorted tetrahedral environment, but exhibit different magnetic behaviour. The tetrachloroferrates show the usual paramagnetism, the m-oxobis(trichloroferrate) exhibits unexpectedly strong antiferromagnetic coupling, as was observed by NMR experiments and susceptibility measurements. To investigate structure-property relations in functionalized ionic liquids, a set of protic, primary alkylammonium and aprotic, quarternary trimethylalkylammonium based ionic liquids was synthesized, and characterized. The length of the alkyl chain was systematically varied, and all compounds were synthesized with and without hydroxyl group, as well as formate and bis(triflyl)amide salts, aiming at getting insight into the influence of the different structure parts on the respective ionic liquid's properties.

  7. Ionic liquids in chemical engineering.

    Science.gov (United States)

    Werner, Sebastian; Haumann, Marco; Wasserscheid, Peter

    2010-01-01

    The development of engineering applications with ionic liquids stretches back to the mid-1990s when the first examples of continuous catalytic processes using ionic liquids and the first studies of ionic liquid-based extractions were published. Ever since, the use of ionic liquids has seen tremendous progress in many fields of chemistry and engineering, and the first commercial applications have been reported. The main driver for ionic liquid engineering applications is to make practical use of their unique property profiles, which are the result of a complex interplay of coulombic, hydrogen bonding and van der Waals interactions. Remarkably, many ionic liquid properties can be tuned in a wide range by structural modifications at their cation and anion. This review highlights specific examples of ionic liquid applications in catalysis and in separation technologies. Additionally, the application of ionic liquids as working fluids in process machines is introduced.

  8. Thermoelectric Generators Based on Ionic Liquids

    Science.gov (United States)

    Laux, Edith; Uhl, Stefanie; Jeandupeux, Laure; López, Pilar Pérez; Sanglard, Pauline; Vanoli, Ennio; Marti, Roger; Keppner, Herbert

    2018-06-01

    Looking at energy harvesting using body or waste heat for portable electronic or on-board devices, Ionic liquids are interesting candidates as thermoactive materials in thermoelectric generators (TEGs) because of their outstanding properties. Two different kinds of ionic liquid, with alkylammonium and choline as cations, were studied, whereby different anions and redox couples were combined. This study focussed on the intention to find non-hazardous and environmentally friendly ionic liquids for TEGs to be selected among the thousands that can potentially be used. Seebeck coefficients (SEs) as high as - 15 mV/K were measured, in a particular case for an electrode temperature difference of 20 K. The bottleneck of our TEG device is still the abundance of negative SE liquids matching the internal resistance with the existing positive SE-liquids at series connections. In this paper, we show further progress in finding increased negative SE liquids. For current extraction from the TEG, the ionic liquid must be blended with a redox couple, allowing carrier exchange in a cyclic process under a voltage which is incuced by the asymmetry of the generator in terms of hot and cold electrodes. In our study, two types of redox pairs were tested. It was observed that a high SE of an ionic liquid/redox blend is not a sufficient condition for high power output. It appears that more complex effects between the ionic liquid and the electrode determine the magnitude of the final current/power output. The physico-chemical understanding of such a TEG cell is not yet available.

  9. Poly (ether imide sulfone) membranes from solutions in ionic liquids

    KAUST Repository

    Kim, Dooli; Nunes, Suzana Pereira

    2017-01-01

    A membrane manufacture method based on non-volatile solvents and a high performance polymer, poly (ether imide sulfone) (EXTEM™), is proposed, as greener alternative to currently industrial process. We dissolved EXTEM™ in pure ionic liquids: 1-ethyl

  10. Positrons in ionic crystals

    International Nuclear Information System (INIS)

    Pareja, R.

    1988-01-01

    Positron annihilation experiments in ionic crystals are reviewed and their results are arranged. A discussion about the positron states in these materials is made in the light of these results and the different proposed models. The positronium in alkali halides is specially considered. (Author)

  11. Ionic smoke detectors

    CERN Document Server

    2002-01-01

    Ionic smoke detectors are products incorporating radioactive material. This article summarises the process for their commercialization and marketing, and how the activity is controlled, according to regulations establishing strict design and production requisites to guarantee the absence of radiological risk associated both with their use and their final handling as conventional waste. (Author)

  12. Thermochemistry of ionic liquid heat-transfer fluids

    International Nuclear Information System (INIS)

    Van Valkenburg, Michael E.; Vaughn, Robert L.; Williams, Margaret; Wilkes, John S.

    2005-01-01

    Large-scale solar energy collectors intended for electric power generation require a heat-transfer fluid with a set of properties not fully met by currently available commercial materials. Ionic liquids have thermophysical and chemical properties that may be suitable for heat transfer and short heat term storage in power plants using parabolic trough solar collectors. Ionic liquids are salts that are liquid at or near room temperature. Thermal properties important for heat transfer applications are melting point, boiling point, liquidus range, heat capacity, heat of fusion, vapor pressure, and thermal conductivity. Other properties needed to evaluate the usefulness of ionic liquids are density, viscosity and chemical compatibility with certain metals. Three ionic liquids were chosen for study based on their range of solvent properties. The solvent properties correlate with solubility of water in the ionic liquids. The thermal and chemical properties listed above were measured or compiled from the literature. Contamination of the ionic liquids by impurities such as water, halides, and metal ions often affect physical properties. The ionic liquids were analyzed for those impurities, and the impact of the contamination was evaluated by standard addition. The conclusion is that the ionic liquids have some very favorable thermal properties compared to targets established by the Department of Energy for solar collector applications

  13. Ionic Structure at Dielectric Interfaces

    Science.gov (United States)

    Jing, Yufei

    The behavior of ions in liquids confined between macromolecules determines the outcome of many nanoscale assembly processes in synthetic and biological materials such as colloidal dispersions, emulsions, hydrogels, DNA, cell membranes, and proteins. Theoretically, the macromolecule-liquid boundary is often modeled as a dielectric interface and an important quantity of interest is the ionic structure in a liquid confined between two such interfaces. The knowledge gleaned from the study of ionic structure in such models can be useful in several industrial applications, such as biosensors, lithium-ion batteries double-layer supercapacitors for energy storage and seawater desalination. Electrostatics plays a critical role in the development of such functional materials. Many of the functions of these materials, result from charge and composition heterogeneities. There are great challenges in solving electrostatics problems in heterogeneous media with arbitrary shapes because electrostatic interactions remains unknown but depend on the particular density of charge distributions. Charged molecules in heterogeneous media affect the media's dielectric response and hence the interaction between the charges is unknown since it depends on the media and on the geometrical properties of the interfaces. To determine the properties of heterogeneous systems including crucial effects neglected in classical mean field models such as the hard core of the ions, the dielectric mismatch and interfaces with arbitrary shapes. The effect of hard core interactions accounts properly for short range interactions and the effect of local dielectric heterogeneities in the presence of ions and/or charged molecules for long-range interactions are both analyzed via an energy variational principle that enables to update charges and the medium's response in the same simulation time step. In particular, we compute the ionic structure in a model system of electrolyte confined by two planar dielectric

  14. Nanoscale Ionic Materials

    KAUST Repository

    Rodriguez, Robert; Herrera, Rafael; Archer, Lynden A.; Giannelis, Emmanuel P.

    2008-01-01

    Polymer nanocomposites (nanoparticles dispersed in a polymer matrix) have been the subject of intense research for almost two decades in both academic and industrial settings. This interest has been fueled by the ability of nanocomposites to not only improve the performance of polymers, but also by their ability to introduce new properties. Yet, there are still challenges that polymer nanocomposites must overcome to reach their full potential. In this Research News article we discuss a new class of hybrids termed nanoparticle ionic materials (NIMS). NIMS are organic-inorganic hybrid materials comprising a nanoparticle core functionalized with a covalently tethered ionic corona. They are facilely engineered to display flow properties that span the range from glassy solids to free flowing liquids. These new systems have unique properties that can overcome some of the challenges facing nanocomosite materials. © 2008 WILEY-VCH Verlag GmbH & Co. KGaA.

  15. Super ionic conductive glass

    Science.gov (United States)

    Susman, S.; Volin, K.J.

    Described is an ionically conducting glass for use as a solid electrolyte in a power or secondary cell containing an alkali metal-containing anode and a cathode separated by an alkali metal ion conducting glass having an ionic transference number of unity and the general formula: A/sub 1 + x/D/sub 2-x/3/Si/sub x/P/sub 3 - x/O/sub 12 - 2x/3/, wherein A is a network modifier for the glass and is an alkali metal of the anode, D is an intermediate for the glass and is selected from the class consisting of Zr, Ti, Ge, Al, Sb, Be, and Zn and X is in the range of from 2.25 to 3.0. Of the alkali metals, Na and Li are preferred and of the intermediate, Zr, Ti and Ge are preferred.

  16. Ionic liquid marbles.

    Science.gov (United States)

    Gao, Lichao; McCarthy, Thomas J

    2007-10-09

    Liquid marbles have been reported during this decade and have been argued to be potentially useful for microfluidic and lab-on-a-chip applications. The liquid marbles described to date have been composed of either water or glycerol as the liquid and hydrophobized lycopodium or silica as the stabilizing particles. Both of these components are potentially reactive and do not permit the use of organic chemistry; the liquids are volatile. We report the use of perfluoroalkyl particles (oligomeric (OTFE) and polymeric (PTFE) tetrafluoroethylene, which are unreactive) to support/stabilize a range of ionic liquid marbles. Ionic liquids are not volatile and have been demonstrated to be versatile solvents for chemical transformations. Water marbles prepared with OTFE are much more robust than those prepared with hydrophobized lycopodium or silica.

  17. Nanoscale Ionic Materials

    KAUST Repository

    Rodriguez, Robert

    2008-11-18

    Polymer nanocomposites (nanoparticles dispersed in a polymer matrix) have been the subject of intense research for almost two decades in both academic and industrial settings. This interest has been fueled by the ability of nanocomposites to not only improve the performance of polymers, but also by their ability to introduce new properties. Yet, there are still challenges that polymer nanocomposites must overcome to reach their full potential. In this Research News article we discuss a new class of hybrids termed nanoparticle ionic materials (NIMS). NIMS are organic-inorganic hybrid materials comprising a nanoparticle core functionalized with a covalently tethered ionic corona. They are facilely engineered to display flow properties that span the range from glassy solids to free flowing liquids. These new systems have unique properties that can overcome some of the challenges facing nanocomosite materials. © 2008 WILEY-VCH Verlag GmbH & Co. KGaA.

  18. POSS Ionic Liquid.

    Science.gov (United States)

    Tanaka, Kazuo; Ishiguro, Fumiyasu; Chujo, Yoshiki

    2010-12-22

    We report the synthesis of a stable room-temperature ionic liquid consisting of an octacarboxy polyhedral oligomeric silsesquioxane (POSS) anion and an imidazolium cation. The introduction of the POSS moiety enhances the thermal stability and reduces the melting temperature. From an evaluation of the thermodynamic parameters during the melting, it was found that the rigidity and cubic structure of POSS can contribute to the enhancement of these thermal properties.

  19. Vibrational Spectroscopy of Ionic Liquids.

    Science.gov (United States)

    Paschoal, Vitor H; Faria, Luiz F O; Ribeiro, Mauro C C

    2017-05-24

    Vibrational spectroscopy has continued use as a powerful tool to characterize ionic liquids since the literature on room temperature molten salts experienced the rapid increase in number of publications in the 1990's. In the past years, infrared (IR) and Raman spectroscopies have provided insights on ionic interactions and the resulting liquid structure in ionic liquids. A large body of information is now available concerning vibrational spectra of ionic liquids made of many different combinations of anions and cations, but reviews on this literature are scarce. This review is an attempt at filling this gap. Some basic care needed while recording IR or Raman spectra of ionic liquids is explained. We have reviewed the conceptual basis of theoretical frameworks which have been used to interpret vibrational spectra of ionic liquids, helping the reader to distinguish the scope of application of different methods of calculation. Vibrational frequencies observed in IR and Raman spectra of ionic liquids based on different anions and cations are discussed and eventual disagreements between different sources are critically reviewed. The aim is that the reader can use this information while assigning vibrational spectra of an ionic liquid containing another particular combination of anions and cations. Different applications of IR and Raman spectroscopies are given for both pure ionic liquids and solutions. Further issues addressed in this review are the intermolecular vibrations that are more directly probed by the low-frequency range of IR and Raman spectra and the applications of vibrational spectroscopy in studying phase transitions of ionic liquids.

  20. Effect of ethanol at clinically relevant concentrations on atrial inward rectifier potassium current sensitive to acetylcholine.

    Science.gov (United States)

    Bébarová, Markéta; Matejovič, Peter; Pásek, Michal; Hořáková, Zuzana; Hošek, Jan; Šimurdová, Milena; Šimurda, Jiří

    2016-10-01

    Alcohol intoxication tends to induce arrhythmias, most often the atrial fibrillation. To elucidate arrhythmogenic mechanisms related to alcohol consumption, the effect of ethanol on main components of the ionic membrane current is investigated step by step. Considering limited knowledge, we aimed to examine the effect of clinically relevant concentrations of ethanol (0.8-80 mM) on acetylcholine-sensitive inward rectifier potassium current I K(Ach). Experiments were performed by the whole-cell patch clamp technique at 23 ± 1 °C on isolated rat and guinea-pig atrial myocytes, and on expressed human Kir3.1/3.4 channels. Ethanol induced changes of I K(Ach) in the whole range of concentrations applied; the effect was not voltage dependent. The constitutively active component of I K(Ach) was significantly increased by ethanol with the maximum effect (an increase by ∼100 %) between 8 and 20 mM. The changes were comparable in rat and guinea-pig atrial myocytes and also in expressed human Kir3.1/3.4 channels (i.e., structural correlate of I K(Ach)). In the case of the acetylcholine-induced component of I K(Ach), a dual ethanol effect was apparent with a striking heterogeneity of changes in individual cells. The effect correlated with the current magnitude in control: the current was increased by eth-anol in the cells showing small current in control and vice versa. The average effect peaked at 20 mM ethanol (an increase of the current by ∼20 %). Observed changes of action potential duration agreed well with the voltage clamp data. Ethanol significantly affected both components of I K(Ach) even in concentrations corresponding to light alcohol consumption.

  1. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  2. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  3. Ionic Liquid-Based Optical and Electrochemical Carbon Dioxide Sensors

    Science.gov (United States)

    Behera, Kamalakanta; Pandey, Shubha; Kadyan, Anu; Pandey, Siddharth

    2015-01-01

    Due to their unusual physicochemical properties (e.g., high thermal stability, low volatility, high intrinsic conductivity, wide electrochemical windows and good solvating ability), ionic liquids have shown immense application potential in many research areas. Applications of ionic liquid in developing various sensors, especially for the sensing of biomolecules, such as nucleic acids, proteins and enzymes, gas sensing and sensing of various important ions, among other chemosensing platforms, are currently being explored by researchers worldwide. The use of ionic liquids for the detection of carbon dioxide (CO2) gas is currently a major topic of research due to the associated importance of this gas with daily human life. This review focuses on the application of ionic liquids in optical and electrochemical CO2 sensors. The design, mechanism, sensitivity and detection limit of each type of sensor are highlighted in this review. PMID:26690155

  4. Ionic Liquid-Based Optical and Electrochemical Carbon Dioxide Sensors.

    Science.gov (United States)

    Behera, Kamalakanta; Pandey, Shubha; Kadyan, Anu; Pandey, Siddharth

    2015-12-04

    Due to their unusual physicochemical properties (e.g., high thermal stability, low volatility, high intrinsic conductivity, wide electrochemical windows and good solvating ability), ionic liquids have shown immense application potential in many research areas. Applications of ionic liquid in developing various sensors, especially for the sensing of biomolecules, such as nucleic acids, proteins and enzymes, gas sensing and sensing of various important ions, among other chemosensing platforms, are currently being explored by researchers worldwide. The use of ionic liquids for the detection of carbon dioxide (CO₂) gas is currently a major topic of research due to the associated importance of this gas with daily human life. This review focuses on the application of ionic liquids in optical and electrochemical CO₂ sensors. The design, mechanism, sensitivity and detection limit of each type of sensor are highlighted in this review.

  5. Ionic Liquid-Based Optical and Electrochemical Carbon Dioxide Sensors

    Directory of Open Access Journals (Sweden)

    Kamalakanta Behera

    2015-12-01

    Full Text Available Due to their unusual physicochemical properties (e.g., high thermal stability, low volatility, high intrinsic conductivity, wide electrochemical windows and good solvating ability, ionic liquids have shown immense application potential in many research areas. Applications of ionic liquid in developing various sensors, especially for the sensing of biomolecules, such as nucleic acids, proteins and enzymes, gas sensing and sensing of various important ions, among other chemosensing platforms, are currently being explored by researchers worldwide. The use of ionic liquids for the detection of carbon dioxide (CO2 gas is currently a major topic of research due to the associated importance of this gas with daily human life. This review focuses on the application of ionic liquids in optical and electrochemical CO2 sensors. The design, mechanism, sensitivity and detection limit of each type of sensor are highlighted in this review.

  6. Graphene-ionic liquid composites

    Energy Technology Data Exchange (ETDEWEB)

    Aksay, Ilhan A.; Korkut, Sibel; Pope, Michael; Punckt, Christian

    2016-11-01

    Method of making a graphene-ionic liquid composite. The composite can be used to make elec-trodes for energy storage devices, such as batteries and supercapacitors. Dis-closed and claimed herein is method of making a graphene-ionic liquid com-posite, comprising combining a graphene source with at least one ionic liquid and heating the combination at a temperature of at least about 130 .degree. C.

  7. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  8. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  9. Ionic liquids, electrolyte solutions including the ionic liquids, and energy storage devices including the ionic liquids

    Science.gov (United States)

    Gering, Kevin L.; Harrup, Mason K.; Rollins, Harry W.

    2015-12-08

    An ionic liquid including a phosphazene compound that has a plurality of phosphorus-nitrogen units and at least one pendant group bonded to each phosphorus atom of the plurality of phosphorus-nitrogen units. One pendant group of the at least one pendant group comprises a positively charged pendant group. Additional embodiments of ionic liquids are disclosed, as are electrolyte solutions and energy storage devices including the embodiments of the ionic liquid.

  10. Ionic liquids comprising heteraromatic anions

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, William F.; Brennecke, Joan F.; Maginn, Edward J.; Mindrup, Elaine; Gurkan, Burcu; Price, Erica; Goodrich, Brett

    2018-04-24

    Some embodiments described herein relate to ionic liquids comprising an anion of a heteraromatic compound such as optionally substituted pyrrolide, optionally substituted pyrazolide, optionally substituted indolide, optionally substituted phospholide, or optionally substituted imidazolide. Methods and devices for gas separation or gas absorption related to these ionic liquids are also described herein.

  11. Supercritical fluids in ionic liquids

    NARCIS (Netherlands)

    Kroon, M.C.; Peters, C.J.; Plechkova, N.V.; Seddon, K.R.

    2014-01-01

    Ionic liquids and supercritical fluids are both alternative environmentally benign solvents, but their properties are very different. Ionic liquids are non-volatile but often considered highly polar compounds, whereas supercritical fluids are non-polar but highly volatile compounds. The combination

  12. Cellulose ionics: switching ionic diode responses by surface charge in reconstituted cellulose films.

    Science.gov (United States)

    Aaronson, Barak D B; Wigmore, David; Johns, Marcus A; Scott, Janet L; Polikarpov, Igor; Marken, Frank

    2017-09-25

    Cellulose films as well as chitosan-modified cellulose films of approximately 5 μm thickness, reconstituted from ionic liquid media onto a poly(ethylene-terephthalate) (PET, 6 μm thickness) film with a 5, 10, 20, or 40 μm diameter laser-drilled microhole, show significant current rectification in aqueous NaCl. Reconstituted α-cellulose films provide "cationic diodes" (due to predominant cation conductivity) whereas chitosan-doped cellulose shows "anionic diode" effects (due to predominant anion conductivity). The current rectification, or "ionic diode" behaviour, is investigated as a function of NaCl concentration, pH, microhole diameter, and molecular weight of the chitosan dopant. Future applications are envisaged exploiting the surface charge induced switching of diode currents for signal amplification in sensing.

  13. Ionic liquids in drug delivery.

    Science.gov (United States)

    Shamshina, Julia L; Barber, Patrick S; Rogers, Robin D

    2013-10-01

    To overcome potential problems with solid-state APIs, such as polymorphism, solubility and bioavailability, pure liquid salt (ionic liquid) forms of active pharmaceutical ingredients (API-ILs) are considered here as a design strategy. After a critical review of the current literature, the recent development of the API-ILs strategy is presented, with a particular focus on the liquefaction of drugs. A variety of IL tools for control over the liquid salt state of matter are discussed including choice of counterion to produce an IL from a given API; the concept of oligomeric ions that enables liquefaction of solid ILs by changing the stoichiometry or complexity of the ions; formation of 'liquid co-crystals' where hydrogen bonding is the driving force in the liquefaction of a neutral acid-base complex; combining an IL strategy with the prodrug strategy to improve the delivery of solid APIs; using ILs as delivery agents via trapping a drug in a micelle and finally ILs designed with tunable hydrophilic-lipophilic balance that matches the structural requirements needed to solubilize poorly water-soluble APIs. The authors believe that API-IL approaches may save failed lead candidates, extend the patent life of current APIs, lead to new delivery options or even new pharmaceutical action. They encourage the pharmaceutical industry to invest more research into the API-IL platform as it could lead to fast-tracked approval based on similarities to the APIs already approved.

  14. CADDIS Volume 2. Sources, Stressors and Responses: Ionic Strength

    Science.gov (United States)

    Introduction to the ionic strength module, when to list ionic strength as a candidate cause, ways to measure ionic strength, simple and detailed conceptual diagrams for ionic strength, ionic strength module references and literature reviews.

  15. Possibilities and limitations of ionic liquids in electrochemical and electroanalytical measurements (a review)

    OpenAIRE

    Weidlich, Tomáš; Stočes, Matěj; Švancara, Ivan

    2010-01-01

    A review (with 155 refs.) concerning the current achievements and typical trends in the chemistry of (room temperature) ionic liquids, (RT)ILs, with particular emphasis on their applicability in electrochemical and electroanalytical measurements. The latter is documented on a rapid progress of ionic liquid-modified carbon paste electrodes (IL-CPEs), the so-called carbon ionic liquid electrodes (CILEs), and related configurations in the last half-decade, within the period of 200...

  16. Hydrogen bonding in ionic liquids.

    Science.gov (United States)

    Hunt, Patricia A; Ashworth, Claire R; Matthews, Richard P

    2015-03-07

    Ionic liquids (IL) and hydrogen bonding (H-bonding) are two diverse fields for which there is a developing recognition of significant overlap. Doubly ionic H-bonds occur when a H-bond forms between a cation and anion, and are a key feature of ILs. Doubly ionic H-bonds represent a wide area of H-bonding which has yet to be fully recognised, characterised or explored. H-bonds in ILs (both protic and aprotic) are bifurcated and chelating, and unlike many molecular liquids a significant variety of distinct H-bonds are formed between different types and numbers of donor and acceptor sites within a given IL. Traditional more neutral H-bonds can also be formed in functionalised ILs, adding a further level of complexity. Ab initio computed parameters; association energies, partial charges, density descriptors as encompassed by the QTAIM methodology (ρBCP), qualitative molecular orbital theory and NBO analysis provide established and robust mechanisms for understanding and interpreting traditional neutral and ionic H-bonds. In this review the applicability and extension of these parameters to describe and quantify the doubly ionic H-bond has been explored. Estimating the H-bonding energy is difficult because at a fundamental level the H-bond and ionic interaction are coupled. The NBO and QTAIM methodologies, unlike the total energy, are local descriptors and therefore can be used to directly compare neutral, ionic and doubly ionic H-bonds. The charged nature of the ions influences the ionic characteristics of the H-bond and vice versa, in addition the close association of the ions leads to enhanced orbital overlap and covalent contributions. The charge on the ions raises the energy of the Ylp and lowers the energy of the X-H σ* NBOs resulting in greater charge transfer, strengthening the H-bond. Using this range of parameters and comparing doubly ionic H-bonds to more traditional neutral and ionic H-bonds it is clear that doubly ionic H-bonds cover the full range of weak

  17. Lattice dynamics of ionic crystals

    International Nuclear Information System (INIS)

    Mahan, G.D.

    1990-01-01

    The theory of lattice dynamics for ionic and rare-gas crystals is derived in the harmonic approximation. We start from a Hamiltonian and average over electron coordinates in order to obtain an effective interaction between ion displacements. We assume that electronic excitations are localized on a single ion, which limits the theory to ionic crystals. The deformation-dipole model and the indirect-ionic-interaction model are derived. These two contributions are closely linked, and together provide an accurate description of short-range forces

  18. Ionic Liquid Catalyzed Electrolyte for Electrochemical Polyaniline Supercapacitors

    Science.gov (United States)

    Inamdar, A. I.; Im, Hyunsik; Jung, Woong; Kim, Hyungsang; Kim, Byungchul; Yu, Kook-Hyun; Kim, Jin-Sang; Hwang, Sung-Min

    2013-05-01

    The effect of different wt.% of ionic liquid "1,6-bis (trimethylammonium-1-yl) hexane tetrafluoroborate" in 0.5 M LiClO4+PC electrolyte on the supercapacitor properties of polyaniline (PANI) thin film are investigated. The PANI film is synthesized using electropolymerization of aniline in the presence of sulfuric acid. The electrochemical properties of the PANI thin film are studied by cyclic voltammetry, galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) measurements. The optimum amount of the ionic liquid is found to be 2 wt.% which provides better ionic conductivity of the electrolyte. The highest specific capacitance of 259 F/g is obtained using the 2 wt.% electrolyte. This capacitance remains at up to 208 F/g (80% capacity retention) after 1000 charge-discharge cycles at a current density of 0.5 mA/g. The PANI film in the 2 wt.% ionic liquid catalyzed 0.5 M LiClO4+PC electrolyte shows small electrochemical resistance, better rate performance and higher cyclability. The increased ionic conductivity of the 2 wt.% ionic liquid catalyzed electrolyte causes a reduction in resistance at the electrode/electrolyte interface, which can be useful in electrochemically-preferred power devices for better applicability.

  19. Phytoremediation of Ionic and Methyl Mercury Pollution

    Energy Technology Data Exchange (ETDEWEB)

    Meagher, Richard B.

    2005-06-01

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to

  20. Ionic Liquid Crystals: Versatile Materials.

    Science.gov (United States)

    Goossens, Karel; Lava, Kathleen; Bielawski, Christopher W; Binnemans, Koen

    2016-04-27

    This Review covers the recent developments (2005-2015) in the design, synthesis, characterization, and application of thermotropic ionic liquid crystals. It was designed to give a comprehensive overview of the "state-of-the-art" in the field. The discussion is focused on low molar mass and dendrimeric thermotropic ionic mesogens, as well as selected metal-containing compounds (metallomesogens), but some references to polymeric and/or lyotropic ionic liquid crystals and particularly to ionic liquids will also be provided. Although zwitterionic and mesoionic mesogens are also treated to some extent, emphasis will be directed toward liquid-crystalline materials consisting of organic cations and organic/inorganic anions that are not covalently bound but interact via electrostatic and other noncovalent interactions.

  1. Hyperpolarization-activated current (I(h)) in vestibular calyx terminals: characterization and role in shaping postsynaptic events.

    Science.gov (United States)

    Meredith, Frances L; Benke, Tim A; Rennie, Katherine J

    2012-12-01

    Calyx afferent terminals engulf the basolateral region of type I vestibular hair cells, and synaptic transmission across the vestibular type I hair cell/calyx is not well understood. Calyces express several ionic conductances, which may shape postsynaptic potentials. These include previously described tetrodotoxin-sensitive inward Na(+) currents, voltage-dependent outward K(+) currents and a K(Ca) current. Here, we characterize an inwardly rectifying conductance in gerbil semicircular canal calyx terminals (postnatal days 3-45), sensitive to voltage and to cyclic nucleotides. Using whole-cell patch clamp, we recorded from isolated calyx terminals still attached to their type I hair cells. A slowly activating, noninactivating current (I(h)) was seen with hyperpolarizing voltage steps negative to the resting potential. External Cs(+) (1-5 mM) and ZD7288 (100 μM) blocked the inward current by 97 and 83 %, respectively, confirming that I(h) was carried by hyperpolarization-activated, cyclic nucleotide gated channels. Mean half-activation voltage of I(h) was -123 mV, which shifted to -114 mV in the presence of cAMP. Activation of I(h) was well described with a third order exponential fit to the current (mean time constant of activation, τ, was 190 ms at -139 mV). Activation speeded up significantly (τ=136 and 127 ms, respectively) when intracellular cAMP and cGMP were present, suggesting that in vivo I(h) could be subject to efferent modulation via cyclic nucleotide-dependent mechanisms. In current clamp, hyperpolarizing current steps produced a time-dependent depolarizing sag followed by either a rebound afterdepolarization or an action potential. Spontaneous excitatory postsynaptic potentials (EPSPs) became larger and wider when I(h) was blocked with ZD7288. In a three-dimensional mathematical model of the calyx terminal based on Hodgkin-Huxley type ionic conductances, removal of I(h) similarly increased the EPSP, whereas cAMP slightly decreased simulated EPSP size

  2. Arterial and venous blood pressure and blood flow following femoral angiography with a new non-ionic contrast medium

    International Nuclear Information System (INIS)

    Nyman, U.; Almen, T.

    1978-01-01

    At femoral angiography in dogs the effects of a new non-ionic contrast medium (C29) were compared with those of one non-ionic medium (metrizamide) and one ionic medium (meglumine/sodium diatrizoate) in current use. In the leg subjected to angiography the pressure gradient over the peripheral vessels decreased and the femoral blood flow increased. The changes induced by the ionic medium were significantly greater than those induced by metrizamide and C29, whereas no significant difference between the two non-ionic media was recorded. (Auth.)

  3. Fast Measurement of Methanol Concentration in Ionic Liquids by Potential Step Method

    Directory of Open Access Journals (Sweden)

    Michael L. Hainstock

    2015-01-01

    Full Text Available The development of direct methanol fuel cells required the attention to the electrolyte. A good electrolyte should not only be ionic conductive but also be crossover resistant. Ionic liquids could be a promising electrolyte for fuel cells. Monitoring methanol was critical in several locations in a direct methanol fuel cell. Conductivity could be used to monitor the methanol content in ionic liquids. The conductivity of 1-butyl-3-methylimidazolium tetrafluoroborate had a linear relationship with the methanol concentration. However, the conductivity was significantly affected by the moisture or water content in the ionic liquid. On the contrary, potential step could be used in sensing methanol in ionic liquids. This method was not affected by the water content. The sampling current at a properly selected sampling time was proportional to the concentration of methanol in 1-butyl-3-methylimidazolium tetrafluoroborate. The linearity still stood even when there was 2.4 M water present in the ionic liquid.

  4. Ionic Liquid Epoxy Resin Monomers

    Science.gov (United States)

    Paley, Mark S. (Inventor)

    2013-01-01

    Ionic liquid epoxide monomers capable of reacting with cross-linking agents to form polymers with high tensile and adhesive strengths. Ionic liquid epoxide monomers comprising at least one bis(glycidyl) N-substituted nitrogen heterocyclic cation are made from nitrogen heterocycles corresponding to the bis(glycidyl) N-substituted nitrogen heterocyclic cations by a method involving a non-nucleophilic anion, an alkali metal cation, epichlorohydrin, and a strong base.

  5. Studies in solid state ionics

    International Nuclear Information System (INIS)

    Jakes, D.; Rosenkranz, J.

    1987-01-01

    Studies performed over 10 years by the high temperature chemistry group are reviewed. Attention was paid to different aspects of ionic solids from the point of view of practical as well as theoretical needs of nuclear technology. Thus ceramic fuel compound like uranates, urania-thoria system, solid electrolytes based on oxides and ionics transformations were studied under reactor irradiation. (author) 13 figs., 3 tabs., 46 refs

  6. Fluctuating hydrodynamics for ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Lazaridis, Konstantinos [Department of Mathematics and Statistics, Washington State University, Pullman, 99163 (United States); Wickham, Logan [Department of Computer Science, Washington State University, Richland, 99354 (United States); Voulgarakis, Nikolaos, E-mail: n.voulgarakis@wsu.edu [Department of Mathematics and Statistics, Washington State University, Pullman, 99163 (United States)

    2017-04-25

    We present a mean-field fluctuating hydrodynamics (FHD) method for studying the structural and transport properties of ionic liquids in bulk and near electrified surfaces. The free energy of the system consists of two competing terms: (1) a Landau–Lifshitz functional that models the spontaneous separation of the ionic groups, and (2) the standard mean-field electrostatic interaction between the ions in the liquid. The numerical approach used to solve the resulting FHD-Poisson equations is very efficient and models thermal fluctuations with remarkable accuracy. Such density fluctuations are sufficiently strong to excite the experimentally observed spontaneous formation of liquid nano-domains. Statistical analysis of our simulations provides quantitative information about the properties of ionic liquids, such as the mixing quality, stability, and the size of the nano-domains. Our model, thus, can be adequately parameterized by directly comparing our prediction with experimental measurements and all-atom simulations. Conclusively, this work can serve as a practical mathematical tool for testing various theories and designing more efficient mixtures of ionic liquids. - Highlights: • A new fluctuating hydrodynamics method for ionic liquids. • Description of ionic liquid morphology in bulk and near electrified surfaces. • Direct comparison with experimental measurements.

  7. Novel applications of ionic liquids in materials processing

    International Nuclear Information System (INIS)

    Reddy, Ramana G

    2009-01-01

    Ionic liquids are mixtures of organic and inorganic salts which are liquids at room temperature. Several potential applications of ionic liquids in the field of materials processing are electrowinning and electrodeposition of metals and alloys, electrolysis of active metals at low temperature, liquid-liquid extraction of metals. Results using 1-butyl-3-methylimidazolium chloride with AlCl 3 at low temperatures yielded high purity aluminium deposits (>99.9% pure) and current efficiencies >98%. Titanium and aluminium were co-deposited with/without the addition of TiCl 4 with up to 27 wt% Ti in the deposit with current efficiencies in the range of 78-85 %. Certain ionic liquids are potential replacements for thermal oils and molten salts as heat transfer fluids in solar energy applications due to high thermal stability, very low corrosivity and substantial sensible heat retentivity. The calculated storage densities for several chloride and fluoride ionic liquids are in the range of 160-210 MJ/m 3 . A 3-D mathematical model was developed to simulate the large scale electrowinning of aluminium. Since ionic liquids processing results in their low energy consumption, low pollutant emissions many more materials processing applications are expected in future.

  8. Ionic Conductivity of Polyelectrolyte Hydrogels.

    Science.gov (United States)

    Lee, Chen-Jung; Wu, Haiyan; Hu, Yang; Young, Megan; Wang, Huifeng; Lynch, Dylan; Xu, Fujian; Cong, Hongbo; Cheng, Gang

    2018-02-14

    Polyelectrolytes have many important functions in both living organisms and man-made applications. One key property of polyelectrolytes is the ionic conductivity due to their porous networks that allow the transport of water and small molecular solutes. Among polyelectrolytes, zwitterionic polymers have attracted huge attention for applications that involve ion transport in a polyelectrolyte matrix; however, it is still unclear how the functional groups of zwitterionic polymer side chains affect their ion transport and swelling properties. In this study, zwitterionic poly(carboxybetaine acrylamide), poly(2-methacryloyloxyethyl phosphorylcholine), and poly(sulfobetaine methacrylate) hydrogels were synthesized and their ionic conductivity was studied and compared to cationic, anionic, and nonionic hydrogels. The change of the ionic conductivity of zwitterionic and nonionic hydrogels in different saline solutions was investigated in detail. Zwitterionic hydrogels showed much higher ionic conductivity than that of the widely used nonionic poly(ethylene glycol) methyl ether methacrylate hydrogel in all tested solutions. For both cationic and anionic hydrogels, the presence of mobile counterions led to high ionic conductivity in low salt solutions; however, the ionic conductivity of zwitterionic hydrogels surpassed that of cationic and ionic hydrogels in high salt solutions. Cationic and anionic hydrogels showed much higher water content than that of zwitterionic hydrogels in deionized water; however, the cationic hydrogels shrank significantly with increasing saline concentration. This work provides insight into the effects of polyelectrolyte side chains on ion transport. This can guide us in choosing better polyelectrolytes for a broad spectrum of applications, including bioelectronics, neural implants, battery, and so on.

  9. Picosecond radiolysis of ionic liquids

    International Nuclear Information System (INIS)

    Funston, A.M.; Wishart, J.F.; Neta, P.; Lall, S.I.; Engel, R.

    2003-01-01

    Ionic liquids (ILs) are a rapidly expanding family of condensed-phase media with important applications in nuclear fuel and waste processing, energy production, improving the efficiency and safety of industrial chemical processes, and pollution prevention. Ionic liquids are completely nonvolatile, noncombustible, highly conductive, recyclable and capable of dissolving a wide variety of materials. An understanding of the radiation chemistry of ionic liquids is important for development of their applications in radioactive material processing and for the application of pulse radiolysis techniques to the general study of chemical reactivity in ionic liquids. Kinetic studies with a picosecond electron accelerator, such as the BNL Laser-Electron Accelerator Facility (LEAF), allow one to observe primary radiation products and their reactions on short time scales. For example, the solvated electron lifetime in neat methyltributylammonium bis(trifluoromethylsulfonyl)imide is ∼300 ns and its absorption maximum is ∼1400 nm. Kinetic studies of primary radiolytic products and their reactivities will be described for several types of ionic liquids. Supported in part by the U.S. Department of Energy, Division of Chemical Sciences, Office of Basic Energy Sciences, under contract DE-AC02-98-CH1088

  10. Thermophysical properties of ionic liquids.

    Science.gov (United States)

    Rooney, David; Jacquemin, Johan; Gardas, Ramesh

    2010-01-01

    Low melting point salts which are often classified as ionic liquids have received significant attention from research groups and industry for a range of novel applications. Many of these require a thorough knowledge of the thermophysical properties of the pure fluids and their mixtures. Despite this need, the necessary experimental data for many properties is scarce and often inconsistent between the various sources. By using accurate data, predictive physical models can be developed which are highly useful and some would consider essential if ionic liquids are to realize their full potential. This is particularly true if one can use them to design new ionic liquids which maximize key desired attributes. Therefore there is a growing interest in the ability to predict the physical properties and behavior of ionic liquids from simple structural information either by using group contribution methods or directly from computer simulations where recent advances in computational techniques are providing insight into physical processes within these fluids. Given the importance of these properties this review will discuss the recent advances in our understanding, prediction and correlation of selected ionic liquid physical properties.

  11. Mechanical heterogeneity in ionic liquids

    Science.gov (United States)

    Veldhorst, Arno A.; Ribeiro, Mauro C. C.

    2018-05-01

    Molecular dynamics (MD) simulations of five ionic liquids based on 1-alkyl-3-methylimidazolium cations, [CnC1im]+, have been performed in order to calculate high-frequency elastic moduli and to evaluate heterogeneity of local elastic moduli. The MD simulations of [CnC1im][NO3], n = 2, 4, 6, and 8, assessed the effect of domain segregation when the alkyl chain length increases, and [C8C1im][PF6] assessed the effect of strength of anion-cation interaction. Dispersion curves of excitation energies of longitudinal and transverse acoustic, LA and TA, modes were obtained from time correlation functions of mass currents at different wavevectors. High-frequency sound velocity of LA modes depends on the alkyl chain length, but sound velocity for TA modes does not. High-frequency bulk and shear moduli, K∞ and G∞, depend on the alkyl chain length because of a density effect. Both K∞ and G∞ are strongly dependent on the anion. The calculation of local bulk and shear moduli was accomplished by performing bulk and shear deformations of the systems cooled to 0 K. The simulations showed a clear connection between structural and elastic modulus heterogeneities. The development of nano-heterogeneous structure with increasing length of the alkyl chain in [CnC1im][NO3] implies lower values for local bulk and shear moduli in the non-polar domains. The mean value and the standard deviations of distributions of local elastic moduli decrease when [NO3]- is replaced by the less coordinating [PF6]- anion.

  12. Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

    International Nuclear Information System (INIS)

    Kim, N.; Cheong, Y.; Song, W.

    2010-01-01

    We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

  13. Phytoremediation of Ionic and Methyl Mercury Pollution

    Energy Technology Data Exchange (ETDEWEB)

    Meagher, Richard B.

    2005-06-01

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to

  14. Ionic conductivity in irradiated KCL

    International Nuclear Information System (INIS)

    Vignolo Rubio, J.

    1979-01-01

    The ionic conductivity of X and gamma irradiated KCl single crystals has been studied between room temperature and 600 deg C. The radiation induced damage resulting in a decrease of the conductivity heals by thermal annealing in two steps which are at about 350 and 550 deg C respectively. It has been found that the radiation induced colour centres are not involved in the observed decrease of the ionic conductivity. Howewer, it has been observed that the effects of quenching and plastic deformation on the conductivity of the samples are very similar to the effect induced by irradiation. It is suggested that small radiation induced dislocation loops might cause the ionic conductivity decrease observed in irradiated samples. (auth)

  15. Ionic conductivity in irradiated KCL

    International Nuclear Information System (INIS)

    Vignolo Rubio, J.

    1979-01-01

    The ionic conductivity of X and gamma irradiated KCL single crystals has been studied between room temperature and 600 degree centigree. the radiation induced damage resulting in a decrease of the conductivity heals by thermal annealing in two steps which are at about 350 and 550 degree centigree respectively. It has been found that the radiation induced colour centres are not involved in the observed decrease of the ionic conductivity. However. It has been observed that the effects of quenching and plastic deformation on the conductivity of the samples are very similar to the effect induced by irradiation. It is suggested that, samples radiation induced dislocation loops might cause the ionic conductivity decrease observed in irradiated samples. (Author)

  16. Hydrogen Sulfide and Ionic Liquids: Absorption, Separation, and Oxidation.

    Science.gov (United States)

    Chiappe, Cinzia; Pomelli, Christian Silvio

    2017-06-01

    Economical and environmental concerns are the main motivations for development of energy-efficient processes and new eco-friendly materials for the capture of greenhouse gases. Currently, H 2 S capture is dominated by physical and/or chemical absorption technologies, which are, however, energy intensive and often problematic from an environmental point of view due to emission of volatile solvent components. Ionic liquids have been proposed as a promising alternative to conventional solvents because of their low volatility and other interesting properties. The aim of the present review paper is to provide a detailed overview of the achievements and difficulties that have been encountered in finding suitable ionic liquids for H 2 S capture. The effect of ionic liquid anions, cations, and functional groups on the H 2 S absorption, separation, and oxidation are highlighted. Recent developments on yet scarcely available molecular simulations and on the development of robust predictive methods are also discussed.

  17. Ionic Liquids: An Environmentally Friendly Media for Nucleophilic Substitution Reactions

    International Nuclear Information System (INIS)

    Jorapur, Yogesh R.; Chi, Dae Yoon

    2006-01-01

    Ionic liquids are alternative reaction media of increasing interest and are regarded as an eco-friendly alternatives, of potential use in place of the volatile organic solvents typically used in current chemical processing methods. They are emerging as the smart and excellent solvents, which are made of positive and negative ions that they are liquids near room temperature. The nucleophilic substitution reaction is one of the important method for inserting functional groups into a carbon skeleton. Many nucleophilic substitution reactions have been found with enhanced reactivity and selectivity in ionic liquid. In this review, some recent interesting results of nucleophilic substitution reactions such as hydroxylations, ether cleavages, carbon-X (X = carbon, oxygen, nitrogen, fluorine) bond forming reactions, and ring opening of epoxides in ionic liquids are discussed

  18. Spectrum of antimicrobial activity associated with ionic colloidal silver.

    Science.gov (United States)

    Morrill, Kira; May, Kathleen; Leek, Daniel; Langland, Nicole; Jeane, La Deana; Ventura, Jose; Skubisz, Corey; Scherer, Sean; Lopez, Eric; Crocker, Ephraim; Peters, Rachel; Oertle, John; Nguyen, Krystine; Just, Scott; Orian, Michael; Humphrey, Meaghan; Payne, David; Jacobs, Bertram; Waters, Robert; Langland, Jeffrey

    2013-03-01

    Silver has historically and extensively been used as a broad-spectrum antimicrobial agent. However, the Food and Drug Administration currently does not recognize colloidal silver as a safe and effective antimicrobial agent. The goal of this study was to further evaluate the antimicrobial efficacy of colloidal silver. Several strains of bacteria, fungi, and viruses were grown under multicycle growth conditions in the presence or absence of ionic colloidal silver in order to assess the antimicrobial activity. For bacteria grown under aerobic or anaerobic conditions, significant growth inhibition was observed, although multiple treatments were typically required. For fungal cultures, the effects of ionic colloidal silver varied significantly between different genera. No viral growth inhibition was observed with any strains tested. The study data support ionic colloidal silver as a broad-spectrum antimicrobial agent against aerobic and anaerobic bacteria, while having a more limited and specific spectrum of activity against fungi.

  19. Local fields in ionic crystals

    International Nuclear Information System (INIS)

    Claro, F.

    1981-08-01

    Local fields arising from the electronic distortion in perfect ionic crystals are described in terms of multipolar excitations. Field factors for the alkali halides and chalcogenide ions are found to differ significantly from the Lorentz value of 4π/3, the correction size following an exponential dependence on the difference in ionic radii. Local fields are only slightly modified by these corrections however, and together with the Clausius-Mossotti relation may be regarded as accurate to within 2% if the Lorentz value is adopted. (author)

  20. Ionic propulsion; Propulsion ionica

    Energy Technology Data Exchange (ETDEWEB)

    Velarde, G

    1972-07-01

    The inner parameters (electrons and ions velocity, current, thrust, power; specific impulse) and the outer parameters (velocity and operating time) of an ion propellant rocket are studied. The components (chamber dimensions, weights, propellants,) are also described. (Author) 5 refs.

  1. Ionic liquid-tolerant cellulase enzymes

    Science.gov (United States)

    Gladden, John; Park, Joshua; Singer, Steven; Simmons, Blake; Sale, Ken

    2017-10-31

    The present invention provides ionic liquid-tolerant cellulases and method of producing and using such cellulases. The cellulases of the invention are useful in saccharification reactions using ionic liquid treated biomass.

  2. Nanoparticle enhanced ionic liquid heat transfer fluids

    Science.gov (United States)

    Fox, Elise B.; Visser, Ann E.; Bridges, Nicholas J.; Gray, Joshua R.; Garcia-Diaz, Brenda L.

    2014-08-12

    A heat transfer fluid created from nanoparticles that are dispersed into an ionic liquid is provided. Small volumes of nanoparticles are created from e.g., metals or metal oxides and/or alloys of such materials are dispersed into ionic liquids to create a heat transfer fluid. The nanoparticles can be dispersed directly into the ionic liquid during nanoparticle formation or the nanoparticles can be formed and then, in a subsequent step, dispersed into the ionic liquid using e.g., agitation.

  3. Electrochemical detection of rutin with a carbon ionic liquid electrode modified by Nafion, graphene oxide and ionic liquid composite

    International Nuclear Information System (INIS)

    Hu, S.; Xiang, J.; Zhang, L.; Zhu, H.; Liu, S.; Sun, W.

    2012-01-01

    We report on a carbon ionic liquid electrode modified with a composite made from Nafion, graphene oxide and ionic liquid, and its application to the sensitive determination of rutin. The modified electrode was characterized by cyclic voltammetry and electrochemical impedance spectroscopy. It shows excellent cyclic voltammetric and differential pulse voltammetric performance due to the presence of nanoscale graphene oxide and the ionic liquid, and their interaction. A pair of well-defined redox peaks of rutin appears at pH 3.0, and the reduction peak current is linearly related to its concentration in the range from 0.08 μM to 0.1 mM with a detection limit of 0.016 μM (at 3σ). The modified electrode displays excellent selectivity and good stability, and was successfully applied to the determination of rutin in tablets with good recovery. (author)

  4. Ionic-Liquid-Tethered Nanoparticles: Hybrid Electrolytes

    KAUST Repository

    Moganty, Surya S.

    2010-10-22

    A new class of solventless electrolytes was created by tethering ionic liquids to hard inorganic ZrO2 nanostructures (see picture; NIM=nanoscale ionic material). These hybrid fluids exhibit exceptional redox stability windows, excellent thermal stability, good lithium transference numbers, long-term interfacial stability in the presence of a lithium anode and, when doped with lithium salt, reasonable ionic conductivities.

  5. Continuum electrostatics for ionic solutions with non-uniform ionic sizes

    International Nuclear Information System (INIS)

    Li Bo

    2009-01-01

    This work concerns electrostatic properties of an ionic solution with multiple ionic species of possibly different ionic sizes. Such properties are described by the minimization of an electrostatic free-energy functional of ionic concentrations. Bounds are obtained for ionic concentrations with low electrostatic free energies. Such bounds are used to show that there exists a unique set of equilibrium ionic concentrations that minimizes the free-energy functional. The equilibrium ionic concentrations are found to depend sorely on the equilibrium electrostatic potential, resembling the classical Boltzmann distributions that relate the equilibrium ionic concentrations to the equilibrium electrostatic potential. Unless all the ionic and solvent molecular sizes are assumed to be the same, explicit formulae of such dependence are, however, not available in general. It is nevertheless proved that in equilibrium the ionic charge density is a decreasing function of the electrostatic potential. This determines a variational principle with a convex functional for the electrostatic potential

  6. Ion pairing in ionic liquids

    International Nuclear Information System (INIS)

    Kirchner, Barbara; Malberg, Friedrich; Firaha, Dzmitry S; Hollóczki, Oldamur

    2015-01-01

    In the present article we briefly review the extensive discussion in literature about the presence or absence of ion pair-like aggregates in ionic liquids. While some experimental studies point towards the presence of neutral subunits in ionic liquids, many other experiments cannot confirm or even contradict their existence. Ion pairs can be detected directly in the gas phase, but no direct method is available to observe such association behavior in the liquid, and the corresponding indirect experimental proofs are based on such assumptions as unity charges at the ions. However, we have shown by calculating ionic liquid clusters of different sizes that assuming unity charges for ILs is erroneous, because a substantial charge transfer is taking place between the ionic liquid ions that reduce their total charge. Considering these effects might establish a bridge between the contradicting experimental results on this matter. Beside these results, according to molecular dynamics simulations the lifetimes of ion–ion contacts and their joint motions are far too short to verify the existence of neutral units in these materials. (topical review)

  7. Catalysis in Molten Ionic Media

    DEFF Research Database (Denmark)

    Boghosian, Soghomon; Fehrmann, Rasmus

    2013-01-01

    This chapter deals with catalysis in molten salts and ionic liquids, which are introduced and reviewed briefly, while an in-depth review of the oxidation catalyst used for the manufacturing of sulfuric acid and cleaning of flue gas from electrical power plants is the main topic of the chapter...

  8. Ionic and Molecular Liquids

    DEFF Research Database (Denmark)

    Chaban, Vitaly V.; Prezhdo, Oleg

    2013-01-01

    applications of RTILs in combination with molecular liquids, concentrating on three significant areas: (1) the use of molecular liquids to decrease the viscosity of RTILs; (2) the role of RTIL micelle formation in water and organic solvents; and (3) the ability of RTILs to adsorb pollutant gases. Current...

  9. Ionic liquid-modified materials for solid-phase extraction and separation: a review.

    Science.gov (United States)

    Vidal, Lorena; Riekkola, Marja-Liisa; Canals, Antonio

    2012-02-17

    In recent years, materials science has propelled to the research forefront. Ionic liquids with unique and fascinating properties have also left their footprints to the developments of materials science during the last years. In this review we highlight some of their recent advances and provide an overview at the current status of ionic liquid-modified materials applied in solid-phase extraction, liquid and gas chromatography and capillary electrochromatography with reference to recent applications. In addition, the potential of ionic liquids in the modification of capillary inner wall in capillary electrophoresis is demonstrated. The main target material modified with ionic liquids is silica, but polymers and monoliths have recently joined the studies. Although imidazolium is still clearly the most commonly used ionic liquid for the covalently modification of materials, the exploitation of pyridinium and phosphonium will most probably increase in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Application of Ionic Liquids in Hydrometallurgy

    Science.gov (United States)

    Park, Jesik; Jung, Yeojin; Kusumah, Priyandi; Lee, Jinyoung; Kwon, Kyungjung; Lee, Churl Kyoung

    2014-01-01

    Ionic liquids, low temperature molten salts, have various advantages manifesting themselves as durable and environmentally friendly solvents. Their application is expanding into various fields including hydrometallurgy due to their unique properties such as non-volatility, inflammability, low toxicity, good ionic conductivity, and wide electrochemical potential window. This paper reviews previous literatures and our recent results adopting ionic liquids in extraction, synthesis and processing of metals with an emphasis on the electrolysis of active/light, rare earth, and platinum group metals. Because the research and development of ionic liquids in this area are still emerging, various, more fundamental approaches are expected to popularize ionic liquids in the metal manufacturing industry. PMID:25177864

  11. Quantification of Ionic Diffusion in Lead Halide Perovskite Single Crystals

    KAUST Repository

    Peng, Wei

    2018-05-25

    Lead halide perovskites are mixed electronic/ionic semiconductors that have recently revolutionized the photovoltaics field. The physical characterization of the ionic conductivity has been rather elusive due to the highly intermixing of ionic and electronic current. In this work the synthesis of low defect density monocrystalline MAPbBr3 (MA=Methyl ammonium) solar cells free of hole transport layer (HTL) suppresses the effect of electronic current. Impedance spectroscopy reveals the characteristic signature of ionic diffusion (the Warburg element and transmission line equivalent circuit) and ion accumulation at the MAPbBr3/Au interface. Diffusion coefficients are calculated based on a good correlation between thickness of MAPbBr3 and characteristic diffusion transition frequency. In addition, reactive external interfaces are studied by comparison of polycrystalline MAPbBr3 devices prepared either with or without a HTL. The low frequency response in IS measurements is correlated with the chemical reactivity of moving ions with the external interfaces and diffusion into the HTL.

  12. Ionic conducting poly-benzimidazoles; Polybenzimidazoles conducteurs ioniques

    Energy Technology Data Exchange (ETDEWEB)

    Jouanneau, J

    2006-11-15

    Over the last years, many research works have been focused on new clean energy systems. Hydrogen fuel cell seems to be the most promising one. However, the large scale development of this technology is still limited by some key elements. One of them is the polymer electrolyte membrane 'Nafion' currently used, for which the ratio performance/cost is too low. The investigations we carried out during this thesis work are related to a new class of ionic conducting polymer, the sulfonated poly-benzimidazoles (sPBI). Poly-benzimidazoles (PBI) are aromatic heterocyclic polymers well-known for their excellent thermal and chemical stability. Ionic conduction properties are obtained by having strong acid groups (sulfonic acid SO{sub 3}H) on the macromolecular structure. For that purpose, we first synthesized sulfonated monomers. Their poly-condensation with an appropriate non-sulfonated co-monomer yields to sPBI with sulfonation range from 0 to 100 per cent. Three different sPBI structures were obtained, and verified by appropriate analytical techniques. We also showed that the protocol used for the synthesis resulted in high molecular weights polymers. We prepared ionic conducting membrane by casting sPBI solutions on glass plates. Their properties of stability, water swelling and ionic conductivity were investigated. Surprisingly, the behaviour of sPBI was quite different from the other sulfonated aromatic polymers with same amount of SO{sub 3}H, their stability was much higher, but their water swelling and ionic conductivity were quite low. We attributed these differences to strong ionic interactions between the sulfonic acid groups and the basic benzimidazole groups of our polymers. However, we managed to solve this problem synthesizing very highly sulfonated PBI, obtaining membranes with a good balance between all the properties necessary. (author)

  13. Carbon Dioxide Separation with Supported Ionic Liquid Membranes

    Energy Technology Data Exchange (ETDEWEB)

    Luebke, D.R.; Ilconich, J.B.; Myers, C.R.; Pennline, H.W.

    2007-04-01

    Supported liquid membranes are a class of materials that allow the researcher to utilize the wealth of knowledge available on liquid properties as a direct guide in the development of a capture technology. These membranes also have the advantage of liquid phase diffusivities higher than those observed in polymeric membranes which grant proportionally greater permeabilities. The primary shortcoming of the supported liquid membranes demonstrated in past research has been the lack of stability caused by volatilization of the transport liquid. Ionic liquids, which possess high carbon dioxide solubility relative to light gases such as hydrogen, are an excellent candidate for this type of membrane since they have negligible vapor pressure and are not susceptible to evaporation. A study has been conducted evaluating the use of several ionic liquids, including 1-hexyl-3-methyl-imidazolium bis(trifuoromethylsulfonyl)imide, 1-butyl-3-methyl-imidazolium nitrate, and 1-ethyl-3-methyl-imidazolium sulfate in supported ionic liquid membranes for the capture of carbon dioxide from streams containing hydrogen. In a joint project, researchers at the University of Notre Dame lent expertise in ionic liquid synthesis and characterization, and researchers at the National Energy Technology Laboratory incorporated candidate ionic liquids into supports and evaluated the resulting materials for membrane performance. Initial results have been very promising with carbon dioxide permeabilities as high as 950 barrers and significant improvements in carbon dioxide/hydrogen selectivity over conventional polymers at 37C and at elevated temperatures. Results include a comparison of the performance of several ionic liquids and a number of supports as well as a discussion of innovative fabrication techniques currently under development.

  14. Nanoparticles in ionic liquids: interactions and organization.

    Science.gov (United States)

    He, Zhiqi; Alexandridis, Paschalis

    2015-07-28

    Ionic liquids (ILs), defined as low-melting organic salts, are a novel class of compounds with unique properties and a combinatorially great chemical diversity. Ionic liquids are utilized as synthesis and dispersion media for nanoparticles as well as for surface functionalization. Ionic liquid and nanoparticle hybrid systems are governed by a combined effect of several intermolecular interactions between their constituents. For each interaction, including van der Waals, electrostatic, structural, solvophobic, steric, and hydrogen bonding, the characterization and quantitative calculation methods together with factors affecting these interactions are reviewed here. Various self-organized structures based on nanoparticles in ionic liquids are generated as a result of a balance of these intermolecular interactions. These structures, including colloidal glasses and gels, lyotropic liquid crystals, nanoparticle-stabilized ionic liquid-containing emulsions, ionic liquid surface-functionalized nanoparticles, and nanoscale ionic materials, possess properties of both ionic liquids and nanoparticles, which render them useful as novel materials especially in electrochemical and catalysis applications. This review of the interactions within nanoparticle dispersions in ionic liquids and of the structure of nanoparticle and ionic liquid hybrids provides guidance on the rational design of novel ionic liquid-based materials, enabling applications in broad areas.

  15. Ionic conductivity studies of gel polyelectrolyte based on ionic liquid

    Energy Technology Data Exchange (ETDEWEB)

    Cha, E.H. [The Faculty of Liberal Arts (Chemistry), Hoseo University, Asan Choongnam 336-795 (Korea); Lim, S.A. [Functional Proteomics Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea); Park, J.H. [Department of Herbal Medicine, Hoseo University, Asan Choongnam 336-795 (Korea); Kim, D.W. [Department of Chemical Technology, Han Bat National University, Daejon 305-719 (Korea); Macfarlane, D.R. [School of Chemistry, Monash University, Clayton, Vic. 3800 (Australia)

    2008-04-01

    Novel lithium polyelectrolyte-ionic liquids have been prepared and characterized of their properties. Poly(lithium 2-acrylamido-2-methyl propanesulfonate) (PAMPSLi) and its copolymer with N-vinyl formamide (VF) also has been prepared as a copolymer. 1-Ethyl-3-methylimidazolium tricyanomethanide (emImTCM) and N,N-dimethyl-N-propyl-N-butyl ammonium tricyanomethanide (N{sub 1134}TCM) which are chosen because of the same with the anion of ionic liquid were prepared. The ionic conductivity of copolymer system (PAMPSLi/PVF/emImTCM: 5.43 x 10{sup -3} S cm{sup -1} at 25 C) exhibits about over four times higher than that of homopolymer system (PAMPSLi/emImTCM: 1.28 x 10{sup -3} S cm{sup -1} at 25 C). Introduction of vinyl formamide into the copolymer type can increase the dissociation of the lithium cations from the polymer backbone. The ionic conductivity of copolymer with emImTCM (PAMPSLi/PVF/emImTCM) exhibits the higher conductivity than that of PAMPSLi/PVF/N{sub 1134}TCM (2.48 x 10{sup -3} S cm{sup -1}). Because of using the polymerizable anion it is seen to maintain high flexibility of imidazolium cation effectively to exhibit the higher conductivity. And also the viscosity of emImTCM (19.56 cP) is lower than that of N{sub 1134}TCM (28.61 cP). Low viscosity leads to a fast rate of diffusion of redox species. (author)

  16. Ionic versus nonionic contrast media

    International Nuclear Information System (INIS)

    Zylak, C.J.; Gafni, A.

    1988-01-01

    The efficacy and effectiveness of the nonionic contrast media have been established. Widespread usage has been hampered because of the approximate tenfold increase in cost compared with the ionic media. An economic evaluation considering costs and consequences of both interventions (ionic vs nonionic contrast media) was performed; it is a cost effectiveness (CEA) and a cost-benefit analysis (CBA) for the Canadian experience. The results of the CEA demonstrate a value per life-year saved within an acceptable range when compared with value for quality-adjusted life years for programs such as treatment of severe (diastolic≥ 105 mm Hg) and mild (diastolic 95-104 mm Hg) hypertension in men aged 40. The CBA showed a net cost to society when benefits were measured as future treatment costs saved plus productivity gained. However, if people are willing to pay a small amount for the comfort of the new intervention, this will result in a break-even situation

  17. Biopolymer Processing Using Ionic Liquids

    Science.gov (United States)

    2014-08-07

    polymerization. Chitin is not only the main component of the shells of crustaceans, but also exists as a structural polysaccharide of insects, mushrooms...combination of the dissolution of the biomass with the acid catlaysts to depolymerize the biomass into feedstock type chemicals. By using an imidazolium...Technical Section Technical Objective Ionic liquids have demonstrated the ability to effectively dissolve biomass ,1,2 including chitin and

  18. Ionic Liquids to Replace Hydrazine

    Science.gov (United States)

    Koelfgen, Syri; Sims, Joe; Forton, Melissa; Allan, Barry; Rogers, Robin; Shamshina, Julia

    2011-01-01

    A method for developing safe, easy-to-handle propellants has been developed based upon ionic liquids (ILs) or their eutectic mixtures. An IL is a binary combination of a typically organic cation and anion, which generally produces an ionic salt with a melting point below 100 deg C. Many ILs have melting points near, or even below, room temperature (room temperature ionic liquids, RTILs). More importantly, a number of ILs have a positive enthalpy of formation. This means the thermal energy released during decomposition reactions makes energetic ILs ideal for use as propellants. In this specific work, to date, a baseline set of energetic ILs has been identified, synthesized, and characterized. Many of the ILs in this set have excellent performance potential in their own right. In all, ten ILs were characterized for their enthalpy of formation, density, melting point, glass transition point (if applicable), and decomposition temperature. Enthalpy of formation was measured using a microcalorimeter designed specifically to test milligram amounts of energetic materials. Of the ten ILs characterized, five offer higher Isp performance than hydrazine, ranging between 10 and 113 seconds higher than the state-of-the-art propellant. To achieve this level of performance, the energetic cations 4- amino-l,2,4-triazolium and 3-amino-1,2,4-triazolium were paired with various anions in the nitrate, dicyanamide, chloride, and 3-nitro-l,2,4-triazole families. Protonation, alkylation, and butylation synthesis routes were used for creation of the different salts.

  19. On the Chemical Stabilities of Ionic Liquids

    Directory of Open Access Journals (Sweden)

    Yen-Ho Chu

    2009-09-01

    Full Text Available Ionic liquids are novel solvents of interest as greener alternatives to conventional organic solvents aimed at facilitating sustainable chemistry. As a consequence of their unusual physical properties, reusability, and eco-friendly nature, ionic liquids have attracted the attention of organic chemists. Numerous reports have revealed that many catalysts and reagents were supported in the ionic liquid phase, resulting in enhanced reactivity and selectivity in various important reaction transformations. However, synthetic chemists cannot ignore the stability data and intermolecular interactions, or even reactions that are directly applicable to organic reactions in ionic liquids. It is becoming evident from the increasing number of reports on use of ionic liquids as solvents, catalysts, and reagents in organic synthesis that they are not totally inert under many reaction conditions. While in some cases, their unexpected reactivity has proven fortuitous and in others, it is imperative that when selecting an ionic liquid for a particular synthetic application, attention must be paid to its compatibility with the reaction conditions. Even though, more than 200 room temperature ionic liquids are known, only a few reports have commented their effects on reaction mechanisms or rate/stability. Therefore, rather than attempting to give a comprehensive overview of ionic liquid chemistry, this review focuses on the non-innocent nature of ionic liquids, with a decided emphasis to clearly illuminate the ability of ionic liquids to affect the mechanistic aspects of some organic reactions thereby affecting and promoting the yield and selectivity.

  20. On the chemical stabilities of ionic liquids.

    Science.gov (United States)

    Sowmiah, Subbiah; Srinivasadesikan, Venkatesan; Tseng, Ming-Chung; Chu, Yen-Ho

    2009-09-25

    Ionic liquids are novel solvents of interest as greener alternatives to conventional organic solvents aimed at facilitating sustainable chemistry. As a consequence of their unusual physical properties, reusability, and eco-friendly nature, ionic liquids have attracted the attention of organic chemists. Numerous reports have revealed that many catalysts and reagents were supported in the ionic liquid phase, resulting in enhanced reactivity and selectivity in various important reaction transformations. However, synthetic chemists cannot ignore the stability data and intermolecular interactions, or even reactions that are directly applicable to organic reactions in ionic liquids. It is becoming evident from the increasing number of reports on use of ionic liquids as solvents, catalysts, and reagents in organic synthesis that they are not totally inert under many reaction conditions. While in some cases, their unexpected reactivity has proven fortuitously advantageous in others is has been a problem, it is imperative that when selecting an ionic liquid for a particular synthetic application, attention be paid to its compatibility with the reaction conditions. Even though, more than 200 room temperature ionic liquids are known, only a few reports have commented their effects on reaction mechanisms or rate/stability. Therefore, rather than attempting to give a comprehensive overview of ionic liquid chemistry, this review focuses on the non-innocent nature of ionic liquids, with a decided emphasis to clearly illuminate the ability of ionic liquids to affect the mechanistic aspects of some organic reactions thereby affecting and promoting the yield and selectivity.

  1. Radiation Chemistry and Photochemistry of Ionic Liquids

    International Nuclear Information System (INIS)

    Wishart, J.F.; Takahaski, K.

    2010-01-01

    As our understanding of ionic liquids and their tunable properties has grown, it is possible to see many opportunities for ionic liquids to contribute to the sustainable use of energy. The potential safety and environmental benefits of ionic liquids, as compared to conventional solvents, have attracted interest in their use as processing media for the nuclear fuel cycle. Therefore, an understanding of the interactions of ionizing radiation and photons with ionic liquids is strongly needed. However, the radiation chemistry of ionic liquids is still a relatively unexplored topic although there has been a significant increase in the number of researchers in the field recently. This article provides a brief introduction to ionic liquids and their interesting properties, and recent advances in the radiation chemistry and photochemistry of ionic liquids. In this article, we will mainly focus on excess electron dynamics and radical reaction dynamics. Because solvation dynamics processes in ionic liquids are much slower than in molecular solvents, one of the distinguishing characteristics is that pre-solvated electrons play an important role in ionic liquid radiolysis. It will be also shown that the reaction dynamics of radical ions is significantly different from that observed in molecular solvents because of the Coulombic screening effects and electrostatic interactions in ionic liquids.

  2. In-situ ionic conductivity measurement of lithium ceramics under high energy heavy ion irradiation

    International Nuclear Information System (INIS)

    Nakazawa, Tetsuya; Noda, Kenji; Ishii, Yoshinobu; Ohno, Hideo; Watanabe, Hitoshi; Matsui, Hisayuki.

    1992-01-01

    To obtain fundamental information regarding the radiation damage in some lithium ceramics, e.g. Li 2 O, Li 4 SiO 4 etc., candidate of breeder materials exposed to severe irradiation environment, an in-situ experiment technique for the ionic conductivity measurement, which allows the specimen temperature control and the beam current monitoring, have been developed. This paper describes the features of an apparatus to measure in situ the ionic conductivity under the irradiation environment and presents some results of ionic conductivity measured for typical ceramic breeders using this apparatus. (J.P.N.)

  3. Atmospheric Pressure Method and Apparatus for Removal of Organic Matter with Atomic and Ionic Oxygen

    Science.gov (United States)

    Banks, Bruce A. (Inventor); Rutledge, Sharon K. (Inventor)

    1997-01-01

    A gas stream containing ionic and atomic oxygen in inert gas is used to remove organic matter from a substrate. The gas stream is formed by flowing a mixture of gaseous oxygen in an inert gas such as helium at atmospheric pressure past a high voltage, current limited, direct current arc which contacts the gas mixture and forms the ionic and atomic oxygen. The arc is curved at the cathode end and the ionic oxygen formed by the arc nearer to the anode end of the arc is accelerated in a direction towards the cathode by virtue of its charge. The relatively high mass to charge ratio of the ionic oxygen enables at least some of it to escape the arc before contacting the cathode and it is directed onto the substrate. This is useful for cleaning delicate substrates such as fine and historically important paintings and delicate equipment and the like.

  4. Novel Fission-Product Separation Based on Room-Temperature Ionic Liquids

    International Nuclear Information System (INIS)

    Rogers, Robin D.

    2004-01-01

    This project has demonstrated that Sr2+ and Cs+ can be selectively extracted from aqueous solutions into ionic liquids using crown ethers and that unprecedented large distribution coefficients can be achieved for these fission products. The volume of secondary wastes can be significantly minimized with this new separation technology. Through the current EMSP funding, the solvent extraction technology based on ionic liquids has been shown to be viable and can potentially provide the most efficient separation of problematic fission products from high level wastes. The key results from the current funding period are the development of highly selective extraction process for cesium ions based on crown ethers and calixarenes, optimization of selectivities of extractants via systematic change of ionic liquids, and investigation of task-specific ionic liquids incorporating both complexant and solvent characteristics

  5. On the Chemical Stabilities of Ionic Liquids

    OpenAIRE

    Yen-Ho Chu; Ming-Chung Tseng; Venkatesan Srinivasadesikan; Subbiah Sowmiah

    2009-01-01

    Ionic liquids are novel solvents of interest as greener alternatives to conventional organic solvents aimed at facilitating sustainable chemistry. As a consequence of their unusual physical properties, reusability, and eco-friendly nature, ionic liquids have attracted the attention of organic chemists. Numerous reports have revealed that many catalysts and reagents were supported in the ionic liquid phase, resulting in enhanced reactivity and selectivity in various important reaction transfor...

  6. Controlling Ionic Transport for Device Design in Synthetic Nanopores

    Science.gov (United States)

    Kalman, Eric Boyd

    Polymer nanopores present a number of behaviors not seen in microscale systems, such as ion current rectification, ionic selectivity, size exclusion and potential dependent ion concentrations in and near the pore. The existence of these effects stems from the small size of nanopores with respect to the characteristic length scales of surface interactions at the interface between the nanopore surface and the solution within it. The large surface-to-volume ratio due to the nanoscale geometry of a nanopore, as well as similarity in scale between geometry and interaction demands the solution interact with the nanopore walls. As surfaces in solution almost always carry residual charge, these surface forces are primarily the electrostatic interactions between the charge groups on the pore surface and the ions in solution. These interactions may be used by the experimentalist to control ionic transport through synthetic nanopores, and use them as a template for the construction of devices. In this research, we present our work on creating a number of ionic analogs to seminal electronic devices, specifically diodes, and transistors, by controlling ionic transport through the electrostatic interactions between a single synthetic nanopore and ions. Control is achieved by "doping" the effective charge carrier concentration in specific regions of the nanopore through manipulation of the pore's surface charge. This manipulation occurs through two mechanisms: chemical modification of the surface charge and electrostatic manipulation of the local internal nanopore potential using a gate electrode. Additionally, the innate selectivity of the charged nanopores walls allows for the separation of charges in solution. This well-known effect, which spawns measureable quantities, the streaming potential and current, has been used to create nanoscale water desalination membranes. We attempt to create a device using membranes with large nanopore densities for the desalination of water

  7. Membrane separation of ionic liquid solutions

    Science.gov (United States)

    Campos, Daniel; Feiring, Andrew Edward; Majumdar, Sudipto; Nemser, Stuart

    2015-09-01

    A membrane separation process using a highly fluorinated polymer membrane that selectively permeates water of an aqueous ionic liquid solution to provide dry ionic liquid. Preferably the polymer is a polymer that includes polymerized perfluoro-2,2-dimethyl-1,3-dioxole (PDD). The process is also capable of removing small molecular compounds such as organic solvents that can be present in the solution. This membrane separation process is suitable for drying the aqueous ionic liquid byproduct from precipitating solutions of biomass dissolved in ionic liquid, and is thus instrumental to providing usable lignocellulosic products for energy consumption and other industrial uses in an environmentally benign manner.

  8. Supported Ionic Liquid Phase (SILP) catalysis

    DEFF Research Database (Denmark)

    Riisager, Anders; Fehrmann, Rasmus; Haumann, Marco

    2006-01-01

    Applications of ionic liquids to replace conventional solvents in homogeneous transition-metal catalysis have increased significantly during the last decade. Biphasic ionic liquid/organic liquid systems offer advantages with regard to product separation, catalyst stability, and recycling...... but utilise in the case of fast chemical reactions only a small amount of expensive ionic liquid and catalyst. The novel Supported Ionic Liquid Phase (SILP) catalysis concept overcomes these drawbacks and allows the use of fixed-bed reactors for continuous reactions. In this Microreview the SILP catalysis...

  9. Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

    Science.gov (United States)

    Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

    2012-01-01

    One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

  10. Carbons, ionic liquids and quinones for electrochemical capacitors

    Directory of Open Access Journals (Sweden)

    Raul eDiaz

    2016-04-01

    Full Text Available Carbons are the main electrode materials used in electrochemical capacitors, which are electrochemical energy storage devices with high power densities and long cycling lifetimes. However, increasing their energy density will improve their potential for commercial implementation. In this regard, the use of high surface area carbons and high voltage electrolytes are well known strategies to increase the attainable energy density, and lately ionic liquids have been explored as promising alternatives to current state of the art acetonitrile-based electrolytes. Also, in terms of safety and sustainability ionic liquids are attractive electrolyte materials for electrochemical capacitors. In addition, it has been shown that the matching of the carbon pore size with the electrolyte ion size further increases the attainable electric double layer (EDL capacitance and energy density.The use of pseudocapacitive reactions can significantly increase the attainable energy density, and quinonic-based materials offer a potentially sustainable and cost effective research avenue for both the electrode and the electrolyte. This perspective will provide an overview of the current state of the art research on electrochemical capacitors based on combinations of carbons, ionic liquids and quinonic compounds, highlighting performances and challenges and discussing possible future research avenues. In this regard, current interest is mainly focused on strategies which may ultimately lead to commercially competitive sustainable high performance electrochemical capacitors for different applications including those requiring mechanical flexibility and biocompatibility.

  11. Application of ionic liquids as an electrolyte additive on the electrochemical behavior of lead acid battery

    Energy Technology Data Exchange (ETDEWEB)

    Rezaei, Behzad; Mallakpour, Shadpour; Taki, Mahmood [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran)

    2009-02-15

    Ionic liquids (ILs) belong to new branch of salts with unique properties which their applications have been increasing in electrochemical systems especially lithium-ion batteries. In the present work, for the first time, the effects of four ionic liquids as an electrolyte additive in battery's electrolyte were studied on the hydrogen and oxygen evolution overpotential and anodic layer formation on lead-antimony-tin grid alloy of lead acid battery. Cyclic and linear sweep voltammetric methods were used for this study in aqueous sulfuric acid solution. The morphology of grid surface after cyclic redox reaction was studied using scanning electron microscopy. The results show that most of added ionic liquids increase hydrogen overpotential and whereas they have no significant effect on oxygen overpotential. Furthermore ionic liquids increase antimony dissolution that might be related to interaction between Sb{sup 3+} and ionic liquids. Crystalline structure of PbSO{sub 4} layer changed with presence of ionic liquids and larger PbSO{sub 4} crystals were formed with some of them. These additives decrease the porosity of PbSO{sub 4} perm selective membrane layer at the surface of electrode. Also cyclic voltammogram on carbon-PbO paste electrode shows that with the presence of ionic liquids, oxidation and reduction peak current intensively increased. (author)

  12. Screening in dense ionic fluids

    International Nuclear Information System (INIS)

    Tosi, M.P.

    1991-01-01

    There has been great progress in recent years in determining and understanding the structure of molten salts. I focus on molten alkali halides and discuss two main points concerning their liquid structure and its relationship with static electrical response in these dense ionic conductors. These are (i) the nature of screening and the related definitions and properties of the screening length and of the dielectric function, and (ii) developments in integral equations techniques for the evaluation of molten salt structure and static screening from given pair potentials. (author). 26 refs, 3 figs, 2 tabs

  13. Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

    International Nuclear Information System (INIS)

    Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

    2014-01-01

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

  14. Analysis of bias voltage dependent spectral response in Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)

    2014-02-21

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.

  15. Regio and stereoselectivity in ionic cycloadditions

    Indian Academy of Sciences (India)

    WINTEC

    Though the reactions have both electrostatic control and frontier orbital control the former dominates in the initial stages of the reaction. Keywords. Stereoselectivity; ionic cycloaddition; density functional theory; acridizinium ion; methyl vinyl ether; 2,3-dimethylisoquinolinium ion. 1. Introduction. In polar or ionic cycloadditions ...

  16. Principle and applications of ionic thermometric detectors

    International Nuclear Information System (INIS)

    Rosenkranz, J.; Jakes, D.

    1989-01-01

    The basic principles of electric conductivity of ionic compounds as well as causes and the character of phase transformation in these systems are briefly explained. The design of ionic thermometric detectors, their function and some applications in thermometry are also described. (author). 3 figs., 1 tab., 7 refs

  17. Improved ionic model of liquid uranium dioxide

    NARCIS (Netherlands)

    Gryaznov, [No Value; Iosilevski, [No Value; Yakub, E; Fortov, [No Value; Hyland, GJ; Ronchi, C

    The paper presents a model for liquid uranium dioxide, obtained by improving a simplified ionic model, previously adopted to describe the equation of state of this substance [1]. A "chemical picture" is used for liquid UO2 of stoichiometric and non-stoichiometric composition. Several ionic species

  18. Aqueous solutions of ionic liquids: microscopic assembly

    NARCIS (Netherlands)

    Vicent-Luna, J.M.; Dubbeldam, D.; Gómez-Álvarez, P.; Calero, S.

    2016-01-01

    Aqueous solutions of ionic liquids are of special interest, due to the distinctive properties of ionic liquids, in particular, their amphiphilic character. A better understanding of the structure-property relationships of such systems is hence desirable. One of the crucial molecular-level

  19. A New Class of Solvents for TRU Dissolution and Separation: Ionic Liquids. Project No. 81891

    International Nuclear Information System (INIS)

    Rogers, Robin D.

    2004-01-01

    Through the current EMSP funding, solvent extraction technologies based on liquid-liquid partitioning of TRU to an Ionic Liquid phase containing conventional complexants has been shown to be viable. The growing understanding of the role that the different components of an ionic liquid can have on the partitioning mechanism, and on the nature of the subsequent dissolved species indicates strongly that ionic liquids are not necessarily direct replacements for volatile or otherwise hazardous organic solvents. Separations and partitioning can be exceptionally complex with competing solvent extraction, cation, anion and sacrificial ion exchange mechanisms are all important, depending on the selection of components for formation of the ionic liquid phase, and that control of these competing mechanisms can be utilized to provide new, alternative separations schemes

  20. Recent advances in the applications of ionic liquids in protein stability and activity: a review.

    Science.gov (United States)

    Patel, Rajan; Kumari, Meena; Khan, Abbul Bashar

    2014-04-01

    Room temperatures ionic liquids are considered as miraculous solvents for biological system. Due to their inimitable properties and large variety of applications, they have been widely used in enzyme catalysis and protein stability and separation. The related information present in the current review is helpful to the researchers working in the field of biotechnology and biochemistry to design or choose an ionic liquid that can serve as a noble and selective solvent for any particular enzymatic reaction, protein preservation and other protein based applications. We have extensively analyzed the methods used for studying the protein-IL interaction which is useful in providing information about structural and conformational dynamics of protein. This can be helpful to develop and understanding about the effect of ionic liquids on stability and activity of proteins. In addition, the affect of physico-chemical properties of ionic liquids, viz. hydrogen bond capacity and hydrophobicity on protein stability are discussed.

  1. Application of Ionic Liquids in Hydrometallurgy

    Directory of Open Access Journals (Sweden)

    Jesik Park

    2014-08-01

    Full Text Available Ionic liquids, low temperature molten salts, have various advantages manifesting themselves as durable and environmentally friendly solvents. Their application is expanding into various fields including hydrometallurgy due to their unique properties such as non-volatility, inflammability, low toxicity, good ionic conductivity, and wide electrochemical potential window. This paper reviews previous literatures and our recent results adopting ionic liquids in extraction, synthesis and processing of metals with an emphasis on the electrolysis of active/light, rare earth, and platinum group metals. Because the research and development of ionic liquids in this area are still emerging, various, more fundamental approaches are expected to popularize ionic liquids in the metal manufacturing industry.

  2. CADDIS Volume 2. Sources, Stressors and Responses: Ionic Strength - Simple Conceptual Diagram

    Science.gov (United States)

    Introduction to the ionic strength module, when to list ionic strength as a candidate cause, ways to measure ionic strength, simple and detailed conceptual diagrams for ionic strength, ionic strength module references and literature reviews.

  3. CADDIS Volume 2. Sources, Stressors and Responses: Ionic Strength - Detailed Conceptual Diagram

    Science.gov (United States)

    Introduction to the ionic strength module, when to list ionic strength as a candidate cause, ways to measure ionic strength, simple and detailed conceptual diagrams for ionic strength, ionic strength module references and literature reviews.

  4. Infrared spectroscopy of ionic clusters

    International Nuclear Information System (INIS)

    Price, J.M.

    1990-11-01

    This thesis describes new experiments wherein the infrared vibrational predissociation spectra of a number of mass-selected ionic cluster systems have been obtained and analyzed in the 2600 to 4000 cm -1 region. The species studied include: the hydrated hydronium ions, H 3 O + (H 2 O) 3 -10 , ammoniated ammonium ions, NH 4 + (NH 3 ) 1 -10 and cluster ions involving both water and ammonia around an ammonium ion core, (mixed clusters) NH 4 + (NH 3 ) n (H 2 O) m (n+m=4). In each case, the spectra reveal well resolved structures that can be assigned to transitions arising from the vibrational motions of both the ion core of the clusters and the surrounding neutral solvent molecules. 154 refs., 19 figs., 8 tabs

  5. Infrared spectroscopy of ionic clusters

    Energy Technology Data Exchange (ETDEWEB)

    Price, J.M. (California Univ., Berkeley, CA (USA). Dept. of Chemistry Lawrence Berkeley Lab., CA (USA))

    1990-11-01

    This thesis describes new experiments wherein the infrared vibrational predissociation spectra of a number of mass-selected ionic cluster systems have been obtained and analyzed in the 2600 to 4000 cm{sup {minus}1} region. The species studied include: the hydrated hydronium ions, H{sub 3}O{sup +} (H{sub 2}O){sub 3 {minus}10}, ammoniated ammonium ions, NH{sub 4}{sup +}(NH{sub 3}){sub 1 {minus}10} and cluster ions involving both water and ammonia around an ammonium ion core, (mixed clusters) NH{sub 4}{sup +}(NH{sub 3}){sub n}(H{sub 2}O){sub m} (n+m=4). In each case, the spectra reveal well resolved structures that can be assigned to transitions arising from the vibrational motions of both the ion core of the clusters and the surrounding neutral solvent molecules. 154 refs., 19 figs., 8 tabs.

  6. Bidirectional ionic wind in nonpremixed counterflow flames with DC electric fields

    KAUST Repository

    Park, Daegeun

    2016-05-05

    Under an electric field, ions in the reaction zone of a flame generate a bulk flow motion called ionic wind. Because the majority of ions are positive, ionic wind is commonly considered to be unidirectional toward the cathode. A more thorough understanding of the effects of electric fields on flames could be obtained by clarifying the role of minor negative ions in the ionic wind. Here, we report on the effects of direct current on nonpremixed counterflow flames by visualizing the ionic wind. We found that the original flow field separates near the flame when it locates at a flow stagnation plane, resulting in a double-stagnant flow configuration. This evidences a bidirectional ionic wind blowing from the flame to both the cathode and the anode due to the positive and the negative ions, respectively. Meanwhile, an electric body force pulls the flame toward the cathode. Thus, the electric field affects the strain rate and the axial location of the stoichiometry, which are important for characterizing nonpremixed counterflow flames. In addition, measurement of the electric current density roughly showed a nearly saturated current when these flames restabilized under relatively high voltage. Detailed explanations of flame behavior, electric currents, and flow characteristics of various fuels are discussed in this study.

  7. Computational solvation analysis of biomolecules in aqueous ionic liquid mixtures : From large flexible proteins to small rigid drugs.

    Science.gov (United States)

    Zeindlhofer, Veronika; Schröder, Christian

    2018-06-01

    Based on their tunable properties, ionic liquids attracted significant interest to replace conventional, organic solvents in biomolecular applications. Following a Gartner cycle, the expectations on this new class of solvents dropped after the initial hype due to the high viscosity, hydrolysis, and toxicity problems as well as their high cost. Since not all possible combinations of cations and anions can be tested experimentally, fundamental knowledge on the interaction of the ionic liquid ions with water and with biomolecules is mandatory to optimize the solvation behavior, the biodegradability, and the costs of the ionic liquid. Here, we report on current computational approaches to characterize the impact of the ionic liquid ions on the structure and dynamics of the biomolecule and its solvation layer to explore the full potential of ionic liquids.

  8. Recent development of ionic liquid membranes

    Directory of Open Access Journals (Sweden)

    Junfeng Wang

    2016-04-01

    Full Text Available The interest in ionic liquids (IL is motivated by its unique properties, such as negligible vapor pressure, thermal stability, wide electrochemical stability window, and tunability of properties. ILs have been highlighted as solvents for liquid–liquid extraction and liquid membrane separation. To further expand its application in separation field, the ionic liquid membranes (ILMs and its separation technology have been proposed and developed rapidly. This paper is to give a comprehensive overview on the recent applications of ILMs for the separation of various compounds, including organic compounds, mixed gases, and metal ions. Firstly, ILMs was classified into supported ionic liquid membranes (SILMs and quasi-solidified ionic liquid membranes (QSILMs according to the immobilization method of ILs. Then, preparation methods of ILMs, membrane stability as well as applications of ILMs in the separation of various mixtures were reviewed. Followed this, transport mechanisms of gaseous mixtures and organic compounds were elucidated in order to better understand the separation process of ILMs. This tutorial review intends to not only offer an overview on the development of ILMs but also provide a guide for ILMs preparations and applications. Keywords: Ionic liquid membrane, Supported ionic liquid membrane, Qusai-solidified ionic liquid membrane, Stability, Application

  9. Non-haloaluminate room-temperature ionic liquids in electrochemistry--a review.

    Science.gov (United States)

    Buzzeo, Marisa C; Evans, Russell G; Compton, Richard G

    2004-08-20

    Some twenty-five years after they first came to prominence as alternative electrochemical solvents, room temperature ionic liquids (RTILs) are currently being employed across an increasingly wide range of chemical fields. This review examines the current state of ionic liquid-based electrochemistry, with particular focus on the work of the last decade. Being composed entirely of ions and possesing wide electrochemical windows (often in excess of 5 volts), it is not difficult to see why these compounds are seen by electrochemists as attractive potential solvents. Accordingly, an examination of the pertinent properties of ionic liquids is presented, followed by an assessment of their application to date across the various electrochemical disciplines, concluding with an outlook viewing current problems and directions.

  10. Key Developments in Ionic Liquid Crystals

    OpenAIRE

    Fernandez, A.A.; Kouwer, P.H.J.

    2016-01-01

    Ionic liquid crystals are materials that combine the classes of liquid crystals and ionic liquids. The first one is based on the multi-billion-dollar flat panel display industry, whilst the latter quickly developed in the past decades into a family of highly-tunable non-volatile solvents. The combination yields materials with a unique set of properties, but also with many challenges ahead. In this review, we provide an overview of the key concepts in ionic liquid crystals, particularly from a...

  11. Ionic conductivity and complexation in liquid dielectrics

    International Nuclear Information System (INIS)

    Zhakin, Anatolii I

    2003-01-01

    Electronic and ionic conductivity in nonpolar liquids is reviewed. Theoretical results on ionic complexation (formation of ion pairs and triplets, dipole-dipole chains, ion-dipole clusters) in liquid dielectrics in an intense external electric field are considered, and the relation between the complexation process and ionic conductivity is discussed. Experimental results supporting the possibility of complexation are presented and compared with theoretical calculations. Onsager's theory about the effect of an intense external electric field on ion-pair dissociation is corrected for the finite size of ions. (reviews of topical problems)

  12. Nanoarchitecture Control Enabled by Ionic Liquids

    Science.gov (United States)

    Murdoch, Heather A.; Limmer, Krista R.; Labukas, Joseph P.

    2017-04-01

    Ionic liquids have many advantages over traditional aqueous electrosynthesis for fabrication of functional nanoarchitectures, including enabling the integration of nanoparticles into traditional coatings, superhydrophobicity, nanofoams, and other hierarchical structures. Shape and size control through ionic liquid selection and processing conditions can synthesize nanoparticles and nanoarchitectures without the use of capping agents, surfactants, or templates that are often deleterious to the functionality of the resultant system. Here we give a brief overview of some recent and interesting applications of ionic liquids to the synthesis of nanoparticles and nanoarchitectures.

  13. Alkaline ionic liquids applied in supported ionic liquid catalyst for selective hydrogenation of citral to citronellal

    Directory of Open Access Journals (Sweden)

    Eero eSalminen

    2014-02-01

    Full Text Available The challenge in preparation of ionic liquids containing a strong alkaline anion is to identify a suitable cation which can tolerate the harsh conditions induced by the anion. In this study, a commercial quaternary ammonium compound (quat benzalkonium [ADBA] (alkyldimethylbenzylammonium was used as a cation in the synthesis of different alkaline ionic liquids. In fact, the precursor, benzalkonium chloride, is a mixture of alkyldimethylbenzylammonium chlorides of various alkyl chain lengths and is commonly used in the formulation of various antiseptic products. The prepared ionic liquids were utilized as Supported Ionic Liquid Catalysts (SILCAs. Typically, a SILCA contains metal nanoparticles, enzymes or metal complexes in an ionic liquid layer which is immobilized on a solid carrier material such as an active carbon cloth (ACC. The catalysts were applied in the selective hydrogenation of citral to citronellal which is an important perfumery chemical. Interestingly, 70 % molar yield towards citronellal was achieved over a catalyst containing the alkaline ionic liquid benzalkonium methoxide.

  14. Alkaline ionic liquids applied in supported ionic liquid catalyst for selective hydrogenation of citral to citronellal

    Science.gov (United States)

    Salminen, Eero; Virtanen, Pasi; Mikkola, Jyri-Pekka

    2014-01-01

    The challenge in preparation of ionic liquids containing a strong alkaline anion is to identify a suitable cation which can tolerate the harsh conditions induced by the anion. In this study, a commercial quaternary ammonium compound (quat) benzalkonium [ADBA] (alkyldimethylbenzylammonium) was used as a cation in the synthesis of different alkaline ionic liquids. In fact, the precursor, benzalkonium chloride, is a mixture of alkyldimethylbenzylammonium chlorides of various alkyl chain lengths and is commonly used in the formulation of various antiseptic products. The prepared ionic liquids were utilized as Supported Ionic Liquid Catalysts (SILCAs). Typically, a SILCA contains metal nanoparticles, enzymes, or metal complexes in an ionic liquid layer which is immobilized on a solid carrier material such as an active carbon cloth (ACC). The catalysts were applied in the selective hydrogenation of citral to citronellal which is an important perfumery chemical. Interestingly, 70% molar yield toward citronellal was achieved over a catalyst containing the alkaline ionic liquid benzalkonium methoxide. PMID:24790972

  15. Ionic conductivity of polymer gels deriving from alkali metal ionic liquids and negatively charged polyelectrolytes

    International Nuclear Information System (INIS)

    Ogihara, Wataru; Sun Jiazeng; Forsyth, Maria; MacFarlane, Douglas R.; Yoshizawa, Masahiro; Ohno, Hiroyuki

    2004-01-01

    We have prepared polymer gel electrolytes with alkali metal ionic liquids (AMILs) that inherently contain alkali metal ions. The AMIL consisted of sulfate anion, imidazolium cation, and alkali metal cation. AMILs were mixed directly with poly(3-sulfopropyl acrylate) lithium salt or poly(2-acrylamido-2-methylpropanesulfonic acid) lithium salt to form polymer gels. The ionic conductivity of these gels decreased with increasing polymer fraction, as in general ionic liquid/polymer mixed systems. At low polymer concentrations, these gels displayed excellent ionic conductivity of 10 -4 to 10 -3 S cm -1 at room temperature. Gelation was found to cause little change in the 7 Li diffusion coefficient of the ionic liquid, as measured by pulse-field-gradient NMR. These data strongly suggest that the lithium cation migrates in successive pathways provided by the ionic liquids

  16. Polyelectrolyte brushes in mixed ionic medium studied via intermolecular forces

    Science.gov (United States)

    Farina, Robert; Laugel, Nicolas; Pincus, Philip; Tirrell, Matthew

    2011-03-01

    The vast uses and applications of polyelectrolyte brushes make them an attractive field of research especially with the growing interest in responsive materials. Polymers which respond via changes in temperature, pH, and ionic strength are increasingly being used for applications in drug delivery, chemical gating, etc. When polyelectrolyte brushes are found in either nature (e.g., surfaces of cartilage and mammalian lung interiors) or commercially (e.g., skin care products, shampoo, and surfaces of medical devices) they are always surrounded by mixed ionic medium. This makes the study of these brushes in varying ionic environments extremely relevant for both current and future potential applications. The polyelectrolyte brushes in this work are diblock co-polymers of poly-styrene sulfonate (N=420) and poly-t-butyl styrene (N=20) which tethers to a hydrophobic surface allowing for a purely thermodynamic study of the polyelectrolyte chains. Intermolecular forces between two brushes are measured using the SFA. As multi-valent concentrations are increased, the brushes collapse internally and form strong adhesion between one another after contact (properties not seen in a purely mono-valent environment).

  17. Ionic charging by local imbalance at interfaces in hybrid lead halide perovskites

    Energy Technology Data Exchange (ETDEWEB)

    Almora, Osbel; Guerrero, Antonio; Garcia-Belmonte, Germà, E-mail: garciag@uji.es [Institute of Advanced Materials (INAM), Universitat Jaume I, 12071 Castelló (Spain)

    2016-01-25

    Identification of specific operating mechanisms becomes particularly challenging when mixed ionic-electronic conductors are used in optoelectronic devices. Ionic effects in perovskite solar cells are believed to distort operation curves and possess serious doubts about their long term stability. Current hysteresis and switchable photovoltaic characteristics have been connected to the kinetics of ion migration. However, the nature of the specific ionic mechanism (or mechanisms) able to explain the operation distortions is still poorly understood. It is observed here that the local rearrangement of ions at the electrode interfaces gives rise to commonly observed capacitive effects. Charging transients in response to step voltage stimuli using thick CH{sub 3}NH{sub 3}PbI{sub 3} samples show two main polarization processes and reveal the structure of the ionic double-layer at the interface with the non-reacting contacts. It is observed that ionic charging, with a typical response time of 10 s, is a local effect confined in the vicinity of the electrode, which entails absence of net mobile ionic concentration (space-charge) in the material bulk.

  18. Synthesis of hetero ionic compounds using dialkylcarbonate quaternization

    Energy Technology Data Exchange (ETDEWEB)

    Friesen, Cody A.; Wolfe, Derek; Johnson, Paul Bryan

    2018-04-03

    Methods of preparing hetero ionic complexes, and ionic liquids from bisulfate salts of heteroatomic compounds using dialkylcarbonates as a primary quaternizing reactant are disclosed. Also disclosed are methods of making electrochemical cells comprising the ionic liquids, and an electrochemical cell comprising an alkaline electrolyte and a hetero ionic complex additive.

  19. Ionic liquids, tuneable solvents for intensifying reactions and separations

    NARCIS (Netherlands)

    Meindersma, G.W.; Kuipers, N.J.M.; Haan, de A.B.

    2007-01-01

    An Ionic Liquid (IL), or a Room Temperature Ionic Liquid (RTIL), is commonly defined as a liquid entirely composed of ions, which is a fluid below 100 °C. Due to the fact that an ionic liquid is a salt, it has a negligible vapour pressure. Therefore, ionic liquids are not volatile at ambient process

  20. Thioimidazolium Ionic Liquids as Tunable Alkylating Agents.

    Science.gov (United States)

    Guterman, Ryan; Miao, Han; Antonietti, Markus

    2018-01-19

    Alkylating ionic liquids based on the thioimidazolium structure combine the conventional properties of ionic liquids, including low melting point and nonvolatility, with the alkylating function. Alkyl transfer occurs exclusively from the S-alkyl position, thus allowing for easy derivatization of the structure without compromising specificity. We apply this feature to tune the electrophilicty of the cation to profoundly affect the reactivity of these alkylating ionic liquids, with a caffeine-derived compound possessing the highest reactivity. Anion choice was found to affect reaction rates, with iodide anions assisting in the alkylation reaction through a "shuttling" process. The ability to tune the properties of the alkylating agent using the toolbox of ionic liquid chemistry highlights the modular nature of these compounds as a platform for alkylating agent design and integration in to future systems.

  1. Thermodynamic Analysis of Ionic Compounds: Synthetic Applications.

    Science.gov (United States)

    Yoder, Claude H.

    1986-01-01

    Shows how thermodynamic cycles can be used to understand trends in heats of formation and aqueous solubilities and, most importantly, how they may be used to choose synthetic routes to new ionic compounds. (JN)

  2. Functionalized dicationic ionic liquids: Green and efficient ...

    Indian Academy of Sciences (India)

    have the advantages of liquid and solid phase together.11. Task-specific ionic liquids ... more attention as alternative reaction media in green chemistry than conventional ..... The reaction mixture was divided into two. Figure 3. Reusability of ...

  3. ELECTROCATALYSIS OF HEMOGLOBIN IN IONIC LIQUID ...

    African Journals Online (AJOL)

    Preferred Customer

    thermal stability, relatively high ionic conductivity, negligible vapor pressure and wide ... through the opposite end of the tube to establish an electrical contact and the ... support to assembly the Hb molecules and form a biocompatible porous ...

  4. Ionic Liquid Epoxy Composite Cryotanks, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The objective of this work is to determine the optimal process for manufacturing lightweight linerless cryogenic storage tanks using ionic liquid epoxy composite...

  5. Selective gas absorption by ionic liquids

    DEFF Research Database (Denmark)

    Shunmugavel, Saravanamurugan; Kegnæs, Søren; Due-Hansen, Johannes

    2010-01-01

    Reversible absorption performance for the flue gas components CO 2, NO and SO2 has been tested for several different ionic liquids (ILs) at different temperatures and flue gas compositions. Furthermore, different porous, high surface area carriers have been applied as supports for the ionic liquids...... to obtain Supported Ionic Liquid-Phase (SILP) absorber materials. The use of solid SILP absorbers with selected ILs were found to significantly improve the absorption capacity and sorption dynamics at low flue gas concentration, thus making the applicability of ILs viable in technical, continuous flow...... processes for flue gas cleaning. The results show that CO 2, NO and SO2 can be reversible and selective absorbed using different ILs and that Supported Ionic Liquid-Phase (SILP) absorbers are promising materials for industrial flue gas cleaning. Absorption/desorption dynamics can be tuned by temperatures...

  6. Polypyrrole for Artificial Muscles: Ionic Mechanisms

    DEFF Research Database (Denmark)

    Skaarup, Steen

    2006-01-01

    the matrix of a polymer electrode – thereby causing volume expansion which can be converted into work. Solvent molecules are able to penetrate the polymer too. A precise description of the nature of these ionic and solvent movements is therefore important for understanding and improving the performance....... This work examines the influence of solvent, ionic species and electrolyte concentration on the fundamental question about the ionic mechanism involved: Is the actuation process driven by anion motion, cation motion, or a mixture of the two? In addition: What is the extent of solvent motion? The discussion...... is centered on polypyrrole (PPy), which is the material most used and studied. The tetraethyl ammonium cation (TEA) is shown to be able to move in and out of PPy(DBS) polymer films, in contrast to expectations. There is a switching between ionic mechanisms during cycling in TEACl electrolyte....

  7. Modeling electrokinetics in ionic liquids: General

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chao [Physical and Computational Science Directorate, Pacific Northwest National Laboratory, Richland WA USA; Bao, Jie [Energy and Environment Directorate, Pacific Northwest National Laboratory, Richland WA USA; Pan, Wenxiao [Department of Mechanical Engineering, University of Wisconsin-Madison, Madison WI USA; Sun, Xin [Physical and Computational Science Directorate, Pacific Northwest National Laboratory, Richland WA USA

    2017-04-07

    Using direct numerical simulations we provide a thorough study on the electrokinetics of ionic liquids. In particular, the modfied Poisson-Nernst-Planck (MPNP) equations are solved to capture the crowding and overscreening effects that are the characteristics of an ionic liquid. For modeling electrokinetic flows in an ionic liquid, the MPNP equations are coupled with the Navier-Stokes equations to study the coupling of ion transport, hydrodynamics, and electrostatic forces. Specifically, we consider the ion transport between two parallel plates, charging dynamics in a 2D straight-walled pore, electro-osmotic ow in a nano-channel, electroconvective instability on a plane ion-selective surface, and electroconvective ow on a curved ion-selective surface. We discuss how the crowding and overscreening effects and their interplay affect the electrokinetic behaviors of ionic liquids in these application problems.

  8. IMPROVED SYNTHESIS OF ROOM TEMPERATURE IONIC LIQUIDS

    Science.gov (United States)

    Room temperature ionic liquids (RTILs), molten salts comprised of N-alkylimidazolium cations and various anions, have received significant attention due to their commercial potential in a variety of chemical applications especially as substitutes for conventional volatile organic...

  9. Ionic liquid-nanoparticle hybrid electrolytes

    KAUST Repository

    Lu, Yingying; Moganty, Surya S.; Schaefer, Jennifer L.; Archer, Lynden A.

    2012-01-01

    We investigate physical and electrochemical properties of a family of organic-inorganic hybrid electrolytes based on the ionic liquid 1-methyl-3-propylimidazolium bis(trifluoromethanesulfone) imide covalently tethered to silica nanoparticles (SiO 2

  10. Ionic liquid-nanoparticle hybrid electrolytes

    KAUST Repository

    Lu, Yingying

    2012-01-01

    We investigate physical and electrochemical properties of a family of organic-inorganic hybrid electrolytes based on the ionic liquid 1-methyl-3-propylimidazolium bis(trifluoromethanesulfone) imide covalently tethered to silica nanoparticles (SiO 2-IL-TFSI). The ionic conductivity exhibits a pronounced maximum versus LiTFSI composition, and in mixtures containing 13.4 wt% LiTFSI, the room-temperature ionic conductivity is enhanced by over 3 orders of magnitude relative to either of the mixture components, without compromising lithium transference number. The SiO 2-IL-TFSI/LiTFSI hybrid electrolytes are thermally stable up to 400°C and exhibit tunable mechanical properties and attractive (4.25V) electrochemical stability in the presence of metallic lithium. We explain these observations in terms of ionic coupling between counterion species in the mobile and immobile (particle-tethered) phases of the electrolytes. © 2012 The Royal Society of Chemistry.

  11. Low Temperature Reduction of Alumina Using Fluorine Containing Ionic Liquids

    Energy Technology Data Exchange (ETDEWEB)

    Dr. R. G. Reddy

    2007-09-01

    The major objective of the project is to establish the feasibility of using specific ionic liquids capable of sustaining aluminum electrolysis near room temperature at laboratory and batch recirculation scales. It will explore new technologies for aluminum and other valuable metal extraction and process methods. The new technology will overcome many of the limitations associated with high temperatures processes such as high energy consumption and corrosion attack. Furthermore, ionic liquids are non-toxic and could be recycled after purification, thus minimizing extraction reagent losses and environmental pollutant emissions. Ionic liquids are mixture of inorganic and organic salts which are liquid at room temperature and have wide operational temperature range. During the last several years, they were emerging as novel electrolytes for extracting and refining of aluminum metals and/or alloys, which are otherwise impossible using aqueous media. The superior high temperature characteristics and high solvating capabilities of ionic liquids provide a unique solution to high temperature organic solvent problems associated with device internal pressure build-up, corrosion, and thermal stability. However their applications have not yet been fully implemented due to the insufficient understanding of the electrochemical mechanisms involved in processing of aluminum with ionic liquids. Laboratory aluminum electrodeposition in ionic liquids has been investigated in chloride and bis (trifluoromethylsulfonyl) imide based ionic liquids. The electrowinning process yielded current density in the range of 200-500 A/m2, and current efficiency of about 90%. The results indicated that high purity aluminum (>99.99%) can be obtained as cathodic deposits. Cyclic voltammetry and chronoamperometry studies have shown that initial stages of aluminum electrodeposition in ionic liquid electrolyte at 30°C was found to be quasi-reversible, with the charge transfer coefficient (0.40). Nucleation

  12. Study of thioglycosylation in ionic liquids

    Directory of Open Access Journals (Sweden)

    Ragauskas Arthur

    2006-06-01

    Full Text Available Abstract A novel, green chemistry, glycosylation strategy was developed based upon the use of ionic liquids. Research studies demonstrated that thiomethyl glycosides could readily be activated with methyl trifluoromethane sulfonate, using 1-butyl-3-methylimidazolium tetrafluoroborate as a solvent. This green chemistry glycosylation strategy provided disaccharides with typical yields averaging 75%. The ionic liquid solvent could be readily reused for five sequential glycosylation reactions with no impact on product yield.

  13. Symmetric Imidazolium-Based Paramagnetic Ionic Liquids

    Science.gov (United States)

    2017-11-29

    Charts N/A Unclassified Unclassified Unclassified SAR 14 Kamran Ghiassi N/A 1 Symmetric Imidazolium-Based Paramagnetic Ionic Liquids Kevin T. Greeson...NUMBER (Include area code) 29 November 2017 Briefing Charts 01 November 2017 - 30 November 2017 Symmetric Imidazolium-Based Paramagnetic Ionic ... Liquids K. Greeson, K. Ghiassi, J. Alston, N. Redeker, J. Marcischak, L. Gilmore, A. Guenthner Air Force Research Laboratory (AFMC) AFRL/RQRP 9 Antares

  14. Ionic liquids in the synthesis of nanoobjects

    International Nuclear Information System (INIS)

    Tarasova, Natalia P; Smetannikov, Yurii V; Zanin, A A

    2010-01-01

    Data on the usage of the novel green solvents, ionic liquids, in the synthesis of nanoobjects and their stabilization are considered. The information is structured according to the resulting products of the synthetic processes: nanoparticles of noble metals, nanoparticles of non-metals, nanoparticles of metal oxides and chalcogenides, nanocomposites, and highly dispersed polymers. The conclusion is made that the ionic liquids might determine the structure and the properties of the nanoobjects, thus opening new fundamental and technological horizons in nanochemistry.

  15. Recent development of ionic liquid membranes

    OpenAIRE

    Wang, Junfeng; Luo, Jianquan; Feng, Shicao; Li, Haoran; Wan, Yinhua; Zhang, Xiangping

    2016-01-01

    The interest in ionic liquids (IL) is motivated by its unique properties, such as negligible vapor pressure, thermal stability, wide electrochemical stability window, and tunability of properties. ILs have been highlighted as solvents for liquidâliquid extraction and liquid membrane separation. To further expand its application in separation field, the ionic liquid membranes (ILMs) and its separation technology have been proposed and developed rapidly. This paper is to give a comprehensive ov...

  16. New electrolytes for aluminum production: Ionic liquids

    Science.gov (United States)

    Zhang, Mingming; Kamavarum, Venkat; Reddy, Ramana G.

    2003-11-01

    In this article, the reduction, refining/recycling, and electroplating of aluminum from room-temperature molten salts are reviewed. In addition, the characteristics of several non-conventional organic solvents, electrolytes, and molten salts are evaluated, and the applicability of these melts for production of aluminum is discussed with special attention to ionic liquids. Also reviewed are electrochemical processes and conditions for electrodeposition of aluminum using ionic liquids at near room temperatures.

  17. Ionic secondary emission SIMS principles and instrumentation

    International Nuclear Information System (INIS)

    Darque-Ceretti, E.; Migeon, H.N.; Aucouturier, M.

    1998-01-01

    The ionic analysis by secondary emission (SIMS) is one of material analysis based on the ions bombardment. That is micro-analysis method in taking into account that the dimensions of the analysed volume are under the micrometer. This paper details in a first part some ionic secondary emission principle to introduce a description of the instrumentation: microprobe, ions production, spectrometers. (A.L.B.)

  18. The Solubility Parameters of Ionic Liquids

    Science.gov (United States)

    Marciniak, Andrzej

    2010-01-01

    The Hildebrand’s solubility parameters have been calculated for 18 ionic liquids from the inverse gas chromatography measurements of the activity coefficients at infinite dilution. Retention data were used for the calculation. The solubility parameters are helpful for the prediction of the solubility in the binary solvent mixtures. From the solubility parameters, the standard enthalpies of vaporization of ionic liquids were estimated. PMID:20559495

  19. The Solubility Parameters of Ionic Liquids

    Directory of Open Access Journals (Sweden)

    Andrzej Marciniak

    2010-04-01

    Full Text Available The Hildebrand’s solubility parameters have been calculated for 18 ionic liquids from the inverse gas chromatography measurements of the activity coefficients at infinite dilution. Retention data were used for the calculation. The solubility parameters are helpful for the prediction of the solubility in the binary solvent mixtures. From the solubility parameters, the standard enthalpies of vaporization of ionic liquids were estimated.

  20. Probing Lipid Bilayers under Ionic Imbalance.

    Science.gov (United States)

    Lin, Jiaqi; Alexander-Katz, Alfredo

    2016-12-06

    Biological membranes are normally under a resting transmembrane potential (TMP), which originates from the ionic imbalance between extracellular fluids and cytosols, and serves as electric power storage for cells. In cell electroporation, the ionic imbalance builds up a high TMP, resulting in the poration of cell membranes. However, the relationship between ionic imbalance and TMP is not clearly understood, and little is known about the effect of ionic imbalance on the structure and dynamics of biological membranes. In this study, we used coarse-grained molecular dynamics to characterize a dipalmitoylphosphatidylcholine bilayer system under ionic imbalances ranging from 0 to ∼0.06 e charges per lipid (e/Lip). We found that the TMP displayed three distinct regimes: 1) a linear regime between 0 and 0.045 e/Lip, where the TMP increased linearly with ionic imbalance; 2) a yielding regime between ∼0.045 and 0.060 e/Lip, where the TMP displayed a plateau; and 3) a poration regime above ∼0.060 e/Lip, where we observed pore formation within the sampling time (80 ns). We found no structural changes in the linear regime, apart from a nonlinear increase in the area per lipid, whereas in the yielding regime the bilayer exhibited substantial thinning, leading to an excess of water and Na + within the bilayer, as well as significant misalignment of the lipid tails. In the poration regime, lipid molecules diffused slightly faster. We also found that the fluid-to-gel phase transition temperature of the bilayer dropped below the normal value with increased ionic imbalances. Our results show that a high ionic imbalance can substantially alter the essential properties of the bilayer, making the bilayer more fluid like, or conversely, depolarization of a cell could in principle lead to membrane stiffening. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  1. Polarization versus Temperature in Pyridinium Ionic Liquids

    DEFF Research Database (Denmark)

    Chaban, V. V.; Prezhdo, O. V.

    2014-01-01

    Electronic polarization and charge transfer effects play a crucial role in thermodynamic, structural, and transport properties of room-temperature ionic liquids (RTILs). These nonadditive interactions constitute a useful tool for tuning physical chemical behavior of RTILs. Polarization and charge...... interactions changes negligibly between 300 and 900 K, while the average dipole moment increases due to thermal fluctuations of geometries. Our results contribute to the fundamental understanding of electronic effects in the condensed phase of ionic systems and foster progress in physical chemistry...

  2. Ionic liquid gel materials: applications in green and sustainable chemistry

    OpenAIRE

    Marr, Patricia C.; Marr, Andrew C.

    2016-01-01

    Ionic liquid gel materials offer a way to further utilise ionic liquids in technological applications. Combining the controlled and directed assembly of gels, with the diverse applications of ionic liquids, enables the design of a heady combination of functional tailored materials, leading to the development of task specific / functional ionic liquid gels. This review introduces gels and gel classification, focusing on ionic liquid gels and their potential roles in a more sustainable future. ...

  3. Task-specific ionic liquids for solubilizing metal compounds

    OpenAIRE

    Thijs, Ben

    2007-01-01

    The main goal of this PhD thesis was to design new task-specific ionic liquids with the ability to dissolve metal compounds. Despite the large quantity of papers published on ionic liquids, not much is known about the mechanisms of dissolving metals in ionic liquids or about metal-containing ionic liquids. Additionally, many of the commercially available ionic liquids exhibit a very limited solubilizing power for metal compounds, although this is for many applications like electrodeposition a...

  4. Fast Ignition and Sustained Combustion of Ionic Liquids

    Science.gov (United States)

    Joshi, Prakash B. (Inventor); Piper, Lawrence G. (Inventor); Oakes, David B. (Inventor); Sabourin, Justin L. (Inventor); Hicks, Adam J. (Inventor); Green, B. David (Inventor); Tsinberg, Anait (Inventor); Dokhan, Allan (Inventor)

    2016-01-01

    A catalyst free method of igniting an ionic liquid is provided. The method can include mixing a liquid hypergol with a HAN (Hydroxylammonium nitrate)-based ionic liquid to ignite the HAN-based ionic liquid in the absence of a catalyst. The HAN-based ionic liquid and the liquid hypergol can be injected into a combustion chamber. The HAN-based ionic liquid and the liquid hypergol can impinge upon a stagnation plate positioned at top portion of the combustion chamber.

  5. The structure of ionic liquids

    CERN Document Server

    Gontrani, Lorenzo

    2014-01-01

    This volume describes the most recent findings on the structure of ILs interpreted through cutting-edge experimental and theoretical methods. Research in the field of ionic liquids (ILs) keeps a fast and steady pace. Since these new-generation molten salts first appeared in the chemistry and physics landscape, a large number of new compounds has been synthesized. Most of them display unexpected behaviour and possess stunning properties. The coverage in this book ranges from the mesoscopic structure of ILs to their interaction with proteins. The reader will learn how diffraction techniques (small and large angle X-Ray and neutron scattering, powder methods), X-Ray absorption spectroscopies (EXAFS/XANES), optical methods (IR, RAMAN), NMR and calorimetric methods can help the study of ILs, both as neat liquids and in mixtures with other compounds. It will enable the reader to choose the best method to suit their experimental needs. A detailed survey of theoretical methods, both quantum-chemical and classical, ...

  6. Ionic channels underlying the ventricular action potential in zebrafish embryo.

    Science.gov (United States)

    Alday, Aintzane; Alonso, Hiart; Gallego, Monica; Urrutia, Janire; Letamendia, Ainhoa; Callol, Carles; Casis, Oscar

    2014-06-01

    Over the last years zebrafish has become a popular model in the study of cardiac physiology, pathology and pharmacology. Recently, the application of the 3Rs regulation and the characteristics of the embryo have reduced the use of adult zebrafish use in many studies. However, the zebrafish embryo cardiac physiology is poorly characterized since most works have used indirect techniques and direct recordings of cardiac action potential and ionic currents are scarce. In order to optimize the zebrafish embryo model, we used electrophysiological, pharmacological and immunofluorescence tools to identify the characteristics and the ionic channels involved in the ventricular action potentials of zebrafish embryos. The application of Na(+) or T-type Ca(+2) channel blockers eliminated the cardiac electrical activity, indicating that the action potential upstroke depends on Na(+) and T-type Ca(+2) currents. The plateau phase depends on L-type Ca(+2) channels since it is abolished by specific blockade. The direct channel blockade indicates that the action potential repolarization and diastolic potential depends on ERG K(+) channels. The presence in the embryonic heart of the Nav1.5, Cav1.2, Cav3.2 and ERG channels was also confirmed by immunofluorescence, while the absence of effect of specific blockers and immunostaining indicate that two K(+) repolarizing currents present in human heart, Ito and IKs, are absent in the embryonic zebrafish heart. Our results describe the ionic channels present and its role in the zebrafish embryo heart and support the use of zebrafish embryos to study human diseases and their use for drug testing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  8. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  9. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  10. Fault current limiter using bulk oxides superconductors

    International Nuclear Information System (INIS)

    Belmont, O.; Ferracci, P.; Porcar, L.; Barbut, J.M.; Tixador, P.; Noudem, J.G.; Bourgault, D.; Tournier, R.

    1998-01-01

    We study the limitation possibilities of bulk Bi high T c materials. For this we test these materials with AC or DC currents above their critical currents. We study particularly the evolution of the voltage with time or with current. The material, the value of the current and the time duration play important parts. For sintered Bi samples the voltage depends only on the current even for values much larger than the critical current. With textured samples the V(I) curves shows an hysteretic behaviour due to a warming up. The textured materials are more interesting than sintered ones in terms of required volume for the current limitation. In both cases the superconductors are in a dissipative state but not in the normal state. This state is nevertheless reached if the dissipated energy inside the sample is sufficient. We have tried to apply a magnetic field on the samples in order to trigger a more effective limitation. The voltage increases but with a limited effect for currents much higher (3-4 times) than the critical zero field current. We think that the dissipative state is due mainly to the grain boundaries which become resistive above the critical current. (orig.)

  11. Tetraphenylborate Solubility in High Ionic Strength Salt Solutions

    International Nuclear Information System (INIS)

    Serkiz, S.M.; Ginn, J.D.; Jurgensen, A.R.

    1998-04-01

    Solubility of sodium and potassium salts of the tetraphenylborate ion (TPB) in simulated Savannah River Site High Level Waste was investigated. Data generated from this study allow more accurate predictions of TPB solubility at the In-Tank Precipitation (ITP) facility. Because previous research showed large deviations in the observed solubility of TPB salts when compared with model predictions, additional data were generated to better understand the solubility of TPB in more complex systems of high ionic strength and those containing both potassium and sodium. These data allow evaluation of the ability of current models to accurately predict equilibrium TPB concentrations over the range of experimental conditions investigated in this study

  12. Ionic liquid processing of cellulose.

    Science.gov (United States)

    Wang, Hui; Gurau, Gabriela; Rogers, Robin D

    2012-02-21

    Utilization of natural polymers has attracted increasing attention because of the consumption and over-exploitation of non-renewable resources, such as coal and oil. The development of green processing of cellulose, the most abundant biorenewable material on Earth, is urgent from the viewpoints of both sustainability and environmental protection. The discovery of the dissolution of cellulose in ionic liquids (ILs, salts which melt below 100 °C) provides new opportunities for the processing of this biopolymer, however, many fundamental and practical questions need to be answered in order to determine if this will ultimately be a green or sustainable strategy. In this critical review, the open fundamental questions regarding the interactions of cellulose with both the IL cations and anions in the dissolution process are discussed. Investigations have shown that the interactions between the anion and cellulose play an important role in the solvation of cellulose, however, opinions on the role of the cation are conflicting. Some researchers have concluded that the cations are hydrogen bonding to this biopolymer, while others suggest they are not. Our review of the available data has led us to urge the use of more chemical units of solubility, such as 'g cellulose per mole of IL' or 'mol IL per mol hydroxyl in cellulose' to provide more consistency in data reporting and more insight into the dissolution mechanism. This review will also assess the greenness and sustainability of IL processing of biomass, where it would seem that the choices of cation and anion are critical not only to the science of the dissolution, but to the ultimate 'greenness' of any process (142 references).

  13. Ionic liquids behave as dilute electrolyte solutions

    Science.gov (United States)

    Gebbie, Matthew A.; Valtiner, Markus; Banquy, Xavier; Fox, Eric T.; Henderson, Wesley A.; Israelachvili, Jacob N.

    2013-01-01

    We combine direct surface force measurements with thermodynamic arguments to demonstrate that pure ionic liquids are expected to behave as dilute weak electrolyte solutions, with typical effective dissociated ion concentrations of less than 0.1% at room temperature. We performed equilibrium force–distance measurements across the common ionic liquid 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([C4mim][NTf2]) using a surface forces apparatus with in situ electrochemical control and quantitatively modeled these measurements using the van der Waals and electrostatic double-layer forces of the Derjaguin–Landau–Verwey–Overbeek theory with an additive repulsive steric (entropic) ion–surface binding force. Our results indicate that ionic liquids screen charged surfaces through the formation of both bound (Stern) and diffuse electric double layers, where the diffuse double layer is comprised of effectively dissociated ionic liquid ions. Additionally, we used the energetics of thermally dissociating ions in a dielectric medium to quantitatively predict the equilibrium for the effective dissociation reaction of [C4mim][NTf2] ions, in excellent agreement with the measured Debye length. Our results clearly demonstrate that, outside of the bound double layer, most of the ions in [C4mim][NTf2] are not effectively dissociated and thus do not contribute to electrostatic screening. We also provide a general, molecular-scale framework for designing ionic liquids with significantly increased dissociated charge densities via judiciously balancing ion pair interactions with bulk dielectric properties. Our results clear up several inconsistencies that have hampered scientific progress in this important area and guide the rational design of unique, high–free-ion density ionic liquids and ionic liquid blends. PMID:23716690

  14. Green Imidazolium Ionics-From Truly Sustainable Reagents to Highly Functional Ionic Liquids.

    Science.gov (United States)

    Tröger-Müller, Steffen; Brandt, Jessica; Antonietti, Markus; Liedel, Clemens

    2017-09-04

    We report the synthesis of task-specific imidazolium ionic compounds and ionic liquids with key functionalities of organic molecules from electro-, polymer-, and coordination chemistry. Such products are highly functional and potentially suitable for technology applications even though they are formed without elaborate reactions and from cheap and potentially green reagents. We further demonstrate the versatility of the used synthetic approach by introducing different functional and green counterions to the formed ionic liquids directly during the synthesis or after metathesis reactions. The influence of different cation structures and different anions on the thermal and electrochemical properties of the resulting ionic liquids is discussed. Our goal is to make progress towards economically competitive and sustainable task-specific ionic liquids. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Ionic liquid stationary phases for gas chromatography.

    Science.gov (United States)

    Poole, Colin F; Poole, Salwa K

    2011-04-01

    This article provides a summary of the development of ionic liquids as stationary phases for gas chromatography beginning with early work on packed columns that established details of the retention mechanism and established working methods to characterize selectivity differences compared with molecular stationary phases through the modern development of multi-centered cation and cross-linked ionic liquids for high-temperature applications in capillary gas chromatography. Since there are many reviews on ionic liquids dealing with all aspects of their chemical and physical properties, the emphasis in this article is placed on the role of gas chromatography played in the design of ionic liquids of low melting point, high thermal stability, high viscosity, and variable selectivity for separations. Ionic liquids provide unprecedented opportunities for extending the selectivity range and temperature-operating range of columns for gas chromatography, an area of separation science that has otherwise been almost stagnant for over a decade. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Solid state ionics: a Japan perspective

    Science.gov (United States)

    Yamamoto, Osamu

    2017-12-01

    The 70-year history of scientific endeavor of solid state ionics research in Japan is reviewed to show the contribution of Japanese scientists to the basic science of solid state ionics and its applications. The term 'solid state ionics' was defined by Takehiko Takahashi of Nagoya University, Japan: it refers to ions in solids, especially solids that exhibit high ionic conductivity at a fairly low temperature below their melting points. During the last few decades of exploration, many ion conducting solids have been discovered in Japan such as the copper-ion conductor Rb4Cu16I7Cl13, proton conductor SrCe1-xYxO3, oxide-ion conductor La0.9Sr0.9Ga0.9Mg0.1O3, and lithium-ion conductor Li10GeP2S12. Rb4Cu16I7Cl13 has a conductivity of 0.33 S cm-1 at 25 °C, which is the highest of all room temperature ion conductive solid electrolytes reported to date, and Li10GeP2S12 has a conductivity of 0.012 S cm-1 at 25 °C, which is the highest among lithium-ion conductors reported to date. Research on high-temperature proton conducting ceramics began in Japan. The history, the discovery of novel ionic conductors and the story behind them are summarized along with basic science and technology.

  17. Counterion-induced swelling of ionic microgels

    Science.gov (United States)

    Denton, Alan R.; Tang, Qiyun

    2016-10-01

    Ionic microgel particles, when dispersed in a solvent, swell to equilibrium sizes that are governed by a balance between electrostatic and elastic forces. Tuning of particle size by varying external stimuli, such as pH, salt concentration, and temperature, has relevance for drug delivery, microfluidics, and filtration. To model swelling of ionic microgels, we derive a statistical mechanical theorem, which proves exact within the cell model, for the electrostatic contribution to the osmotic pressure inside a permeable colloidal macroion. Applying the theorem, we demonstrate how the distribution of counterions within an ionic microgel determines the internal osmotic pressure. By combining the electrostatic pressure, which we compute via both Poisson-Boltzmann theory and molecular dynamics simulation, with the elastic pressure, modeled via the Flory-Rehner theory of swollen polymer networks, we show how deswelling of ionic microgels with increasing concentration of particles can result from a redistribution of counterions that reduces electrostatic pressure. A linearized approximation for the electrostatic pressure, which proves remarkably accurate, provides physical insight and greatly eases numerical calculations for practical applications. Comparing with experiments, we explain why soft particles in deionized suspensions deswell upon increasing concentration and why this effect may be suppressed at higher ionic strength. The failure of the uniform ideal-gas approximation to adequately account for counterion-induced deswelling below close packing of microgels is attributed to neglect of spatial variation of the counterion density profile and the electrostatic pressure of incompletely neutralized macroions.

  18. Characteristics of large scale ionic source for JT-60

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Yukio; Honda, Atsushi; Inoue, Takashi [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment] [and others

    1997-02-01

    The Neutral Beam Injection (NBI) apparatus is expected for important role sharing apparatus to realize the plasma electric current drive and the plasma control in not only temperature upgrading of the plasma but also Tokamak nuclear fusion reactor for the next generation such as JT-60, ITER and so forth. Japan Atomic Energy Research Institute has developed the ionic source with high energy and large electric current for about 10 years. Some arrangement tests of the large negative ion source for JT-60 No. 1 were executed from June to October, 1995. As a series of arrangement tests, 400 KeV and 13.5 A of deuterium negative ion beam was successfully accelerated for 0.12 sec. under 0.22 Pa of low gas pressure. And, it was elucidated that electron electric current could be controlled efficiently even in deuterium negative ion beam. Here is described on the testing results in details. (G.K.)

  19. Water in Room Temperature Ionic Liquids

    Science.gov (United States)

    Fayer, Michael

    2014-03-01

    Room temperature ionic liquids (or RTILs, salts with a melting point below 25 °C) have become a subject of intense study over the last several decades. Currently, RTIL application research includes synthesis, batteries, solar cells, crystallization, drug delivery, and optics. RTILs are often composed of an inorganic anion paired with an asymmetric organic cation which contains one or more pendant alkyl chains. The asymmetry of the cation frustrates crystallization, causing the salt's melting point to drop significantly. In general, RTILs are very hygroscopic, and therefore, it is of interest to examine the influence of water on RTIL structure and dynamics. In addition, in contrast to normal aqueous salt solutions, which crystallize at low water concentration, in an RTIL it is possible to examine isolated water molecules interacting with ions but not with other water molecules. Here, optical heterodyne-detected optical Kerr effect (OHD-OKE) measurements of orientational relaxation on a series of 1-alkyl-3-methylimidazolium tetrafluoroborate RTILs as a function of chain length and water concentration are presented. The addition of water to the longer alkyl chain RTILs causes the emergence of a long time bi-exponential orientational anisotropy decay. Such decays have not been seen previously in OHD-OKE experiments on any type of liquid and are analyzed here using a wobbling-in-a-cone model. The orientational relaxation is not hydrodynamic, with the slowest relaxation component becoming slower as the viscosity decreases for the longest chain, highest water content samples. The dynamics of isolated D2O molecules in 1-butyl-3-methylimidazolium hexafluorophosphate (BmImPF6) were examined using two dimensional infrared (2D IR) vibrational echo spectroscopy. Spectral diffusion and incoherent and coherent transfer of excitation between the symmetric and antisymmetric modes are examined. The coherent transfer experiments are used to address the nature of inhomogeneous

  20. Effect of surface bilayer charges on the magnetic field around ionic channels

    Energy Technology Data Exchange (ETDEWEB)

    Gomes Soares, Marília Amável [Post-graduation in Computational Sciences, Rio de Janeiro State University (Brazil); Cortez, Celia Martins, E-mail: ccortezs@ime.uerj.br [Post-graduation in Computational Sciences, Rio de Janeiro State University (Brazil); Department of Applied Mathematics, Rio de Janeiro State University (Brazil); Oliveira Cruz, Frederico Alan de [Post-graduation in Computational Sciences, Rio de Janeiro State University (Brazil); Department of Physics, Rural Federal University of Rio de Janeiro (Brazil); Silva, Dilson [Post-graduation in Computational Sciences, Rio de Janeiro State University (Brazil); Department of Applied Mathematics, Rio de Janeiro State University (Brazil)

    2017-01-01

    In this work, we present a physic-mathematical model for representing the ion transport through membrane channels, in special Na{sup +} and K{sup +}-channels, and discuss the influence of surface bilayer charges on the magnetic field behavior around the ionic current. The model was composed of a set of equations, including: a nonlinear differential Poisson-Boltzmann equation which usually allows to estimate the surface potentials and electric potential profile across membrane; equations for the ionic flux through channel and the ionic current density based on Armstrong's model for Na{sup +} and K{sup +} permeability and other Physics concepts; and a magnetic field expression derived from the classical Ampère equation. Results from computational simulations using the finite element method suggest that the ionic permeability is strongly dependent of surface bilayer charges, the current density through a K{sup +}-channel is very less sensible to temperature changes than the current density through a Na{sup +}- channel, active Na{sup +}-channels do not directly interfere with the K{sup +}-channels around, and vice-versa, since the magnetic perturbation generated by an active channel is of short-range.

  1. Rendering high charge density of states in ionic liquid-gated MoS 2 transistors

    NARCIS (Netherlands)

    Lee, Y.; Lee, J.; Kim, S.; Park, H.S.

    2014-01-01

    We investigated high charge density of states (DOS) in the bandgap of MoS2 nanosheets with variable temperature measurements on ionic liquid-gated MoS2 transistors. The thermally activated charge transport indicates that the electrical current in the two-dimensional MoS 2 nanosheets under high

  2. Fabrication of Monolithic Dye-Sensitized Solar Cell Using Ionic Liquid Electrolyte

    Directory of Open Access Journals (Sweden)

    Seigo Ito

    2012-01-01

    Full Text Available To improve the durability of dye-sensitized solar cells (DSCs, monolithic DSCs with ionic liquid electrolyte were studied. Deposited by screen printing, a carbon layer was successfully fabricated that did not crack or peel when annealing was employed beforehand. Optimized electrodes exhibited photovoltaic characteristics of 0.608 V open-circuit voltage, 6.90 cm−2 mA short-circuit current, and 0.491 fill factor, yielding 2.06% power conversion efficiency. The monolithic DSC using ionic liquid electrolyte was thermally durable and operated stably for 1000 h at 80°C.

  3. Ionic diffusion in quartz studied by transport measurements, SIMS and atomistic simulations

    International Nuclear Information System (INIS)

    Sartbaeva, Asel; Wells, Stephen A; Redfern, Simon A T; Hinton, Richard W; Reed, Stephen J B

    2005-01-01

    Ionic diffusion in the quartz-β-eucryptite system is studied by DC transport measurements, SIMS and atomistic simulations. Transport data show a large transient increase in ionic current at the α-β phase transition of quartz (the Hedvall effect). The SIMS data indicate two diffusion processes, one involving rapid Li + motion and the other involving penetration of Al and Li atoms into quartz at the phase transition. Atomistic simulations explain why the fine microstructure of twin domain walls in quartz near the transition does not hinder Li + diffusion

  4. Recent developments in thermodynamics and thermophysics of non-aqueous mixtures containing ionic liquids. A review

    International Nuclear Information System (INIS)

    Heintz, Andreas

    2005-01-01

    Mixtures of ionic liquids with organic solvents exhibit a most interesting research area in thermodynamics. The increasing utilization of ionic liquids in chemical processes and separation processes requires reliable and systematic data of thermodynamic and thermophysical properties such as activity coefficients, VLE and LLE data, heats of mixing as well as gas solubility data, densities and transport properties like viscosity, electric conductivity and mutual diffusion coefficients. This review presents an survey of the most recent data material including current developments and aspects of research activities needed in the future

  5. Thermophysical properties of hydroxyl ammonium ionic liquids

    International Nuclear Information System (INIS)

    Kurnia, K.A.; Wilfred, C.D.; Murugesan, T.

    2009-01-01

    The thermophysical properties of hydroxyl ammonium ionic liquids: density ρ, T = (293.15 to 363.15) K; dynamic viscosity η, T = (298.2 to 348.2) K; and refractive indices n D , T = (293.15 to 333.15) K have been measured. The coefficients of thermal expansion α, values were calculated from the experimental density results using an empirical correlation for T = (293.15 to 363.15) K. The variation of volume expansion of ionic liquids studied was found to be independent of temperature within the range covered in the present work. The thermal decomposition temperature 'T d ' for all the six hydroxyl ammonium ionic liquids is also investigated using thermogravimetric analyzer (TGA)

  6. Key Developments in Ionic Liquid Crystals.

    Science.gov (United States)

    Alvarez Fernandez, Alexandra; Kouwer, Paul H J

    2016-05-16

    Ionic liquid crystals are materials that combine the classes of liquid crystals and ionic liquids. The first one is based on the multi-billion-dollar flat panel display industry, whilst the latter quickly developed in the past decades into a family of highly-tunable non-volatile solvents. The combination yields materials with a unique set of properties, but also with many challenges ahead. In this review, we provide an overview of the key concepts in ionic liquid crystals, particularly from a molecular perspective. What are the important molecular parameters that determine the phase behavior? How should they be introduced into the molecules? Finally, which other tools does one have to realize specific properties in the material?

  7. Key Developments in Ionic Liquid Crystals

    Directory of Open Access Journals (Sweden)

    Alexandra Alvarez Fernandez

    2016-05-01

    Full Text Available Ionic liquid crystals are materials that combine the classes of liquid crystals and ionic liquids. The first one is based on the multi-billion-dollar flat panel display industry, whilst the latter quickly developed in the past decades into a family of highly-tunable non-volatile solvents. The combination yields materials with a unique set of properties, but also with many challenges ahead. In this review, we provide an overview of the key concepts in ionic liquid crystals, particularly from a molecular perspective. What are the important molecular parameters that determine the phase behavior? How should they be introduced into the molecules? Finally, which other tools does one have to realize specific properties in the material?

  8. Desulfurization of oxidized diesel using ionic liquids

    Science.gov (United States)

    Wilfred, Cecilia D.; Salleh, M. Zulhaziman M.; Mutalib, M. I. Abdul

    2014-10-01

    The extraction of oxidized sulfur compounds from diesel were carried out using ten types of ionic liquids consisting of different cation and anion i.e. 1-ethyl-3-methylimidazolium tetrafluoroborate, 1-butyl-3-methylimidazoium thiocyanate, 1-butyl-3-methylimidazoium dicyanamide, 1-butyl-3-methylimidazolium trifluoromethanesulfonate, 1-butyl-3-methylimidazoliumhexafluorophosphate, 1-hexyl-3-methylimidazolium trifluoromethanesulfonate, trioctylmethylammonium chloride, 1-propionitrile-3-butylimidazolium thiocyanate, 1-propionitrile-3-butylimidazolium dicyanamide and 1-butyl-6-methylquinolinium dicyanamide. The oxidation of diesel was successfully done using phosphotungstic acid as the catalyst, hydrogen peroxide (H2O2) as the oxidant and trioctylmethylammonium chloride as the phase transfer agent. The oxidation of diesel changes the sulfur compounds into sulfone which increases its polarity and enhances the ionic liquid's extraction performance. Result showed that ionic liquid [C4mquin][N(CN)2] performed the highest sulfur removal (91% at 1:5 diesel:IL ratio) compared to the others.

  9. Synthesis and characterization of new ionic liquids

    International Nuclear Information System (INIS)

    Oliveira, L.M.C. de; Mattedi, S.; Boaventura, J.S.; Iglesias, M.; Universidad de Santiago de Compostela

    2010-01-01

    In recent years, ionic liquids have been highlighted for its potential in various industrial applications. Among them, the salts of Broensted has a promising profile for the low toxicity, low cost and simple synthesis. This paper presents the synthesis and characterization of new salts of Bronsted with branched (lactate) or large chain anions (oleate) for future use as additives promoters of proton conductivity in fuel cells of ethanol. Experimental data were measured for density, sound velocity and conductivity of pure ionic liquids and mixtures. The density decreases linearly with increasing temperature, and sound velocity shows a similar trend, but not linear. The conductivity increases according to the Arrhenius model with activation energy less than 10 J/mol. Tests NMR, FTIR and TGA confirm ionic structure and thermal stability up to 165 deg C. (author)

  10. BWR radiation buildup control with ionic zinc

    International Nuclear Information System (INIS)

    Marble, W.J.; Wood, C.J.; Leighty, C.E.; Green, T.A.

    1986-01-01

    In 1983 a hypothesis was disclosed which suggested that the presence of ionic zinc in the reactor water of the BWR could reduce radiation buildup. This hypothesis was developed from correlations of plant data, and subsequently, from laboratory experiments which demonstrated clearly that ionic zinc inhibits the corrosion of stainless steel. The benefits of zinc addition have been measured at the Vallecitos Nuclear Center under and EPRI/GE project. Experimentation and analyses have been performed to evaluate the impact of intentional zinc addition on the IGSCC characteristics of primary system materials and on the performance of the nuclear fuel. It has been concluded that no negative effects are expected. The author conclude that the intentional addition of ionic zinc to the BWR reactor water at a concentration of approximately 10 ppb will provide major benefits in controlling the Co-60 buildup on primary system stainless steel surfaces. The intentional addition of zinc is now a qualified technique for use in BWRs

  11. Selective Ionic Transport Pathways in Phosphorene.

    Science.gov (United States)

    Nie, Anmin; Cheng, Yingchun; Ning, Shoucong; Foroozan, Tara; Yasaei, Poya; Li, Wen; Song, Boao; Yuan, Yifei; Chen, Lin; Salehi-Khojin, Amin; Mashayek, Farzad; Shahbazian-Yassar, Reza

    2016-04-13

    Despite many theoretical predictions indicating exceptionally low energy barriers of ionic transport in phosphorene, the ionic transport pathways in this two-dimensional (2D) material has not been experimentally demonstrated. Here, using in situ aberration-corrected transmission electron microscopy (TEM) and density functional theory, we studied sodium ion transport in phosphorene. Our high-resolution TEM imaging complemented by electron energy loss spectroscopy demonstrates a precise description of anisotropic sodium ions migration along the [100] direction in phosphorene. This work also provides new insight into the effect of surface and the edge sites on the transport properties of phosphorene. According to our observation, the sodium ion transport is preferred in zigzag edge rather than the armchair edge. The use of this highly selective ionic transport property may endow phosphorene with new functionalities for novel chemical device applications.

  12. Correlations between phase behaviors and ionic conductivities of (ionic liquid + alcohol) systems

    International Nuclear Information System (INIS)

    Park, Nam Ku; Bae, Young Chan

    2010-01-01

    To understand the basic properties of ionic liquids (ILs), we examined the phase behavior and ionic conductivity characteristics using various compositions of different ionic liquids (1-ethyl-3-methylimidazolium hexafluorophosphate [emim] [PF6] and 1-benzyl-3-methylimidazolium hexafluorophosphate [bzmim] [PF6]) in several different alcohols (ethanol, propanol, 1-butanol, 2-butanol, and hexanol). We conducted a systematic study of the impact of different factors on the phase behavior of imidazolium-based ionic liquids in alcohols. Using a new experimental method with a liquid electrolyte system, we observed that the ionic conductivity of the ionic liquid/alcohol was sensitive to the surrounding temperature. We employed Chang et al.'s thermodynamic model [Chang et al. (1997, 1998) ] based on the lattice model. The obtained co-ordinated unit parameter from this model was used to describe the phase behavior and ionic conductivities of the given system. Good agreement with experimental data of various alcohol and ILs systems was obtained in the range of interest.

  13. Lattice mechanics of ionic crystals - unified study

    International Nuclear Information System (INIS)

    Sengupta, S.; Roy, D.; Basu, A.N.

    1979-01-01

    The up-to-date situation in the understanding of the mechanical properties of ionic solids is reviewed. These properties are determined by the Born-Oppenheimer (B-O) potential energy function. For ionic crystals this potential energy function can be written down with some precision. To keep the expression tractable, the dominant electron deformation, the dipolar deformation, is treated as an adiabatic variable and the energy then becomes a function of both the nuclear coordinates and the ionic dipole moments. All the well known models for ionic crystals are discussed in terms of the energy expression they imply. This makes the comparison straight forward and brings out the essential difference between the models clearly. Next various quantum mechanical treatments for ionic crystals are reviewed. An attempt is made to obtain the B-O potential energy expression using a Heitler-London approach. By comparing the various models one can arrive at some definitive conclusions about the degree of validity and the assumptions underlying these models. Finally a comprehensive review of the results of actual computation on various ionic crystals done by different authors is undertaken. The crucial quantitative results are examined and the success and shortcoming of each calculation are critically analysed. The guiding principle in this part is the unified approach. i.e. to see how far a model with a given set of parameters accounts for both the dynamic and static properties. The discussion is divided in three sections for crystals with sodium chloride, cesium chloride and zinc sulfide structures. Outstanding problems and difficulties in the present understanding are pointed out. (auth.)

  14. Functional ionic liquids; Funktionelle ionische Fluessigkeiten

    Energy Technology Data Exchange (ETDEWEB)

    Baecker, Tobias

    2012-07-01

    In the thesis at hand, new functional ionic liquids were investigated. Main focus was attended to their structure property relations and the structural features leading to a decrease of the melting point. New compounds of the type 1-butyl-3-methylimidazolium tris(N,Ndialkyldithiocarbamato) uranylate with variously substituated dithiocarbamato ligands were synthesized and characterized. Ligands with asymmetrical substitution pattern proved to be most suitable for ionic liquid formation. The single-crystal X-ray structures revealed the interactions in the solid state. Here, the first spectroscopic investigation of the U-S bond in sulfur donated uranyl complexes, up to now only observed in single-crystal X-ray structures, is presented, and the participation of the uranium f-orbitals is shown by theoretical calculations. Electrochemical investigations showed the accessibility of the respective U{sup V}O{sub 2}{sup +} compounds. As well, ionic liquids with [FeCl{sub 4}]{sup -} and [Cl{sub 3}FeOFeCl{sub 3}]{sup 2-} as anion were synthesized. Both of these anions contain high-spin Fe(III) centres in distorted tetrahedral environment, but exhibit different magnetic behaviour. The tetrachloroferrates show the usual paramagnetism, the m-oxobis(trichloroferrate) exhibits unexpectedly strong antiferromagnetic coupling, as was observed by NMR experiments and susceptibility measurements. To investigate structure-property relations in functionalized ionic liquids, a set of protic, primary alkylammonium and aprotic, quarternary trimethylalkylammonium based ionic liquids was synthesized, and characterized. The length of the alkyl chain was systematically varied, and all compounds were synthesized with and without hydroxyl group, as well as formate and bis(triflyl)amide salts, aiming at getting insight into the influence of the different structure parts on the respective ionic liquid's properties.

  15. Ionic Liquids as Additives of Coffee Bean Oil in Steel-Steel Contacts

    Directory of Open Access Journals (Sweden)

    James Grace

    2015-10-01

    Full Text Available Environmental awareness and ever-growing restrictive regulations over contamination have increased the need for more environmentally-friendly lubricants. Due to their superior biodegradability and lower toxicity, vegetable oils are a good alternative to replace currently-used mineral oils. However, vegetable oils show low oxidation and thermal stability and poor anti-wear properties. Most of these drawbacks can be attenuated through the use of additives. In the last decade, ionic liquids have emerged as high-performance fluids and lubricant additives due to their unique characteristics. In this study, the tribological behavior of two phosphonium-based ionic liquids is investigated as additives of coffee bean oil in steel-steel contact. Coffee bean oil-ionic liquid blends containing 1, 2.5, and 5 wt% of each ionic liquid are studied using a block-on-flat reciprocating tribometer and the test results are compared to commercially-available, fully-formulated lubricant. Results showed that the addition of the ionic liquids to the coffee bean oil reduces wear volume of the steel disks, and wear values achieved are comparable to that obtained when the commercially-available lubricant is used.

  16. Surface effects on ionic Coulomb blockade in nanometer-size pores

    Science.gov (United States)

    Tanaka, Hiroya; Iizuka, Hideo; Pershin, Yuriy V.; Di Ventra, Massimiliano

    2018-01-01

    Ionic Coulomb blockade in nanopores is a phenomenon that shares some similarities but also differences with its electronic counterpart. Here, we investigate this phenomenon extensively using all-atom molecular dynamics of ionic transport through nanopores of about one nanometer in diameter and up to several nanometers in length. Our goal is to better understand the role of atomic roughness and structure of the pore walls in the ionic Coulomb blockade. Our numerical results reveal the following general trends. First, the nanopore selectivity changes with its diameter, and the nanopore position in the membrane influences the current strength. Second, the ionic transport through the nanopore takes place in a hopping-like fashion over a set of discretized states caused by local electric fields due to membrane atoms. In some cases, this creates a slow-varying ‘crystal-like’ structure of ions inside the nanopore. Third, while at a given voltage, the resistance of the nanopore depends on its length, the slope of this dependence appears to be independent of the molarity of ions. An effective kinetic model that captures the ionic Coulomb blockade behavior observed in MD simulations is formulated.

  17. Surface effects on ionic Coulomb blockade in nanometer-size pores.

    Science.gov (United States)

    Tanaka, Hiroya; Iizuka, Hideo; Pershin, Yuriy V; Ventra, Massimiliano Di

    2018-01-12

    Ionic Coulomb blockade in nanopores is a phenomenon that shares some similarities but also differences with its electronic counterpart. Here, we investigate this phenomenon extensively using all-atom molecular dynamics of ionic transport through nanopores of about one nanometer in diameter and up to several nanometers in length. Our goal is to better understand the role of atomic roughness and structure of the pore walls in the ionic Coulomb blockade. Our numerical results reveal the following general trends. First, the nanopore selectivity changes with its diameter, and the nanopore position in the membrane influences the current strength. Second, the ionic transport through the nanopore takes place in a hopping-like fashion over a set of discretized states caused by local electric fields due to membrane atoms. In some cases, this creates a slow-varying 'crystal-like' structure of ions inside the nanopore. Third, while at a given voltage, the resistance of the nanopore depends on its length, the slope of this dependence appears to be independent of the molarity of ions. An effective kinetic model that captures the ionic Coulomb blockade behavior observed in MD simulations is formulated.

  18. Ionic Liquids as Unforeseen Assets to Fight Life-Threatening Mycotic Diseases.

    Science.gov (United States)

    Hartmann, Diego O; Petkovic, Marija; Silva Pereira, Cristina

    2016-01-01

    Ionic liquids discovery has celebrated 100 years. They consist solely of ions, one of which is typically organic and asymmetrical. Remarkable physical and chemical properties stirred their use as alternative solvents in many chemical processes. The recent demonstration of their occurrence in nature might boost their interest in biological sciences. In the search of mechanistic understandings of ionic liquids' ecotoxicological impacts in fungi, we have analyzed the proteome, transcriptome, and metabolome responses to this chemical stress. Data illuminated new hypotheses that altered our research path - exploit ionic liquids as tools for the discovery of pathways and metabolites that may impact fungal development and pathogenicity. As we get closer to solve the primary effects of each ionic liquid family and their specific gene targets, the vision of developing antifungal ionic liquids and/or materials, by taking advantage of elegant progresses in this field, might become a reality. Task-designed formulations may improve the performance of conventional antifungal drugs, build functional coatings for reducing allergens production, or aid in the recovery of antifungal plant polymers. The frontier research in this cross-disciplinary field may provide us unforeseen means to address the global concern of mycotic diseases. Pathogenic and opportunistic fungi are responsible for numerous infections, killing annually nearly 1.5 million immunocompromised individuals worldwide, a similar rate to malaria or tuberculosis. This perspective will review our major findings and current hypotheses, contextualizing how they might bring us closer to efficient strategies to prevent and fight mycotic diseases.

  19. Ionic liquids as unforeseen assets to fight life-threatening mycotic diseases

    Directory of Open Access Journals (Sweden)

    Diego O. Hartmann

    2016-02-01

    Full Text Available Ionic liquids discovery has celebrated 100 years. They consist solely of ions, one of which is typically organic and asymmetrical. Remarkable physical and chemical properties stirred their use as alternative solvents in many chemical processes. The recent demonstration of their occurrence in nature might boost their interest in biological sciences. In the search of mechanistic understandings of ionic liquids’ ecotoxicological impacts in fungi, we have analyzed the proteome, transcriptome and metabolome responses to this chemical stress. Data illuminated new hypotheses that altered our research path – exploit ionic liquids as tools for the discovery of pathways and metabolites that may impact fungal development and pathogenicity. As we get closer to solve the primary effects of each ionic liquid family and their specific gene targets, the vision of developing antifungal ionic liquids and/or materials, by taking advantage of elegant progresses in this field, might become a reality. Task-designed formulations may improve the performance of conventional antifungal drugs, build functional coatings for reducing allergens production, or aid in the recovery of antifungal plant polymers. The frontier research in this cross-disciplinary field may provide us unforeseen means to address the global concern of mycotic diseases. Pathogenic and opportunistic fungi are responsible for numerous infections, killing annually nearly 1.5 million immunocompromised individuals worldwide, a similar rate to malaria or tuberculosis. This perspective will review our major findings and current hypotheses, contextualizing how they might bring us closer to efficient strategies to prevent and fight mycotic diseases.

  20. Theoretical investigation of the Te{sub 4}Br{sub 2} molecule in ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Elfgen, Roman [Mulliken Center for Theoretical Chemistry, University of Bonn, Beringstr. 4+6, 53115, Bonn (Germany); Max Planck Institute for Chemical Energy Conversion, Stiftstr. 34-36, 45413, Muehlheim an der Ruhr (Germany); Holloczki, Oldamur; Ray, Promit; Kirchner, Barbara [Mulliken Center for Theoretical Chemistry, University of Bonn, Beringstr. 4+6, 53115, Bonn (Germany); Groh, Matthias F. [Department of Chemistry and Food Chemistry, Dresden University of Technology, 01062, Dresden (Germany); Ruck, Michael [Department of Chemistry and Food Chemistry, Dresden University of Technology, 01062, Dresden (Germany); Max Planck Institute for Chemical Physics of Solids, Noethnitzer Str. 40, 01187, Dresden (Germany)

    2017-01-15

    Material synthesis in ionic liquids, at or near room temperature, is currently a subject of immense academic interest. In order to illuminate molecular-level details and the underlying chemistry, we carried out molecular simulations of a single Te{sub 4}Br{sub 2} molecule dissolved in the ionic liquid 1-ethyl-3-methylimidazolium chloride, as well as in the ionic liquid mixed with aluminum chloride. Although the ethyl side chain is much too short to show detailed microheterogeneity, significant structuring with the small chloride anions is seen in case of the pure ionic liquid. In the case of the mixture, formation of larger anionic clusters is distinctly observed and analyzed. Due to the tendency of ionic liquids to dissociate, there is a pronounced shift to elongated Te-Br distances in both investigated solvents. However, only in the AlCl{sub 3}-containing liquid, we observe the reaction of the open chain-like Te{sub 4}Br{sub 2} molecule to a closed square-like Te{sub 4}Br{sup +} and AlCl{sub 3}Br{sup -} ion. The molecular arrangement of the [Te{sub 4}]{sup 2+} unit shows negligible deviation from that in the experimental crystal structure. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  1. Theoretical investigation of the Te4Br2 molecule in ionic liquids

    International Nuclear Information System (INIS)

    Elfgen, Roman; Holloczki, Oldamur; Ray, Promit; Kirchner, Barbara; Groh, Matthias F.; Ruck, Michael

    2017-01-01

    Material synthesis in ionic liquids, at or near room temperature, is currently a subject of immense academic interest. In order to illuminate molecular-level details and the underlying chemistry, we carried out molecular simulations of a single Te 4 Br 2 molecule dissolved in the ionic liquid 1-ethyl-3-methylimidazolium chloride, as well as in the ionic liquid mixed with aluminum chloride. Although the ethyl side chain is much too short to show detailed microheterogeneity, significant structuring with the small chloride anions is seen in case of the pure ionic liquid. In the case of the mixture, formation of larger anionic clusters is distinctly observed and analyzed. Due to the tendency of ionic liquids to dissociate, there is a pronounced shift to elongated Te-Br distances in both investigated solvents. However, only in the AlCl 3 -containing liquid, we observe the reaction of the open chain-like Te 4 Br 2 molecule to a closed square-like Te 4 Br + and AlCl 3 Br - ion. The molecular arrangement of the [Te 4 ] 2+ unit shows negligible deviation from that in the experimental crystal structure. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  2. Structure of ionic liquid-water mixtures at interfaces: x-ray and neutron reflectometry studies

    International Nuclear Information System (INIS)

    Lauw, Yansen; Rodopoulos, Theo; Horne, Mike; Follink, Bart; Hamilton, Bill; Knott, Robert; Nelson, Andy

    2009-01-01

    Full text: Fundamental studies on the effect of water in ionic liquids are necessary since the overall performance of ionic liquids in many industrial applications is often hampered by the presence of water.[1] Based on this understanding, the surface and interfacial structures of 1-butyl-1methylpyrrolidinium trifluoromethylsulfonylimide [C4mpyr][NTf2] ionic liquid-water mixtures were probed using x-ray and neutron reflectometry techniques. At the gas-liquid surface, a thick cation+water layer was detected next to the phase boundary, followed by an increasing presence of anion towards the bulk. The overall thickness of the surface exhibits non-monotonic trends with an increasing water content, which explains similar phenomenological trends in surface tension reported in the literature.[2] At an electrified interface, the interfacial structure of pure ionic liquids probed by neutron reflectometry shows similar trends to those predicted by a mean-field model.[3] However, the presence of water within the electrical double-layer is less obvious, although it is widely known that water reduces electrochemical window of ionic liquids. To shed light on this issue, further studies are currently in progress.

  3. Ionic Liquids as Unforeseen Assets to Fight Life-Threatening Mycotic Diseases

    Science.gov (United States)

    Hartmann, Diego O.; Petkovic, Marija; Silva Pereira, Cristina

    2016-01-01

    Ionic liquids discovery has celebrated 100 years. They consist solely of ions, one of which is typically organic and asymmetrical. Remarkable physical and chemical properties stirred their use as alternative solvents in many chemical processes. The recent demonstration of their occurrence in nature might boost their interest in biological sciences. In the search of mechanistic understandings of ionic liquids’ ecotoxicological impacts in fungi, we have analyzed the proteome, transcriptome, and metabolome responses to this chemical stress. Data illuminated new hypotheses that altered our research path – exploit ionic liquids as tools for the discovery of pathways and metabolites that may impact fungal development and pathogenicity. As we get closer to solve the primary effects of each ionic liquid family and their specific gene targets, the vision of developing antifungal ionic liquids and/or materials, by taking advantage of elegant progresses in this field, might become a reality. Task-designed formulations may improve the performance of conventional antifungal drugs, build functional coatings for reducing allergens production, or aid in the recovery of antifungal plant polymers. The frontier research in this cross-disciplinary field may provide us unforeseen means to address the global concern of mycotic diseases. Pathogenic and opportunistic fungi are responsible for numerous infections, killing annually nearly 1.5 million immunocompromised individuals worldwide, a similar rate to malaria or tuberculosis. This perspective will review our major findings and current hypotheses, contextualizing how they might bring us closer to efficient strategies to prevent and fight mycotic diseases. PMID:26903990

  4. Effect of ionic strength on the kinetics of ionic and micellar reactions in aqueous solution

    International Nuclear Information System (INIS)

    Dung, M.H.; Kozak, J.J.

    1982-01-01

    The effect of electrostatic forces on the rate of reaction between ions in aqueous solutions of intermediate ionic strength is studied in this paper. We consider the kinetics of reactions involving simple ionic species (1--1 and 2--2 electrolyte systems) as well as kinetic processes mediated by the presence of micellar ions (or other charged organizates). In the regime of ionic strength considered, dielectric saturation of the solvent in the vicinity of the reacting ions must be taken into account and this is done by introducing several models to describe the recovery of the solvent from saturation to its continuum dielectric behavior. To explore the effects of ion size, charge number, and ionic strength on the overall rate constant for the process considered, we couple the traditional theory of ionic reactions in aqueous solution with calculations of the electrostatic potential obtained via solution of the nonlinear Poisson--Boltzmann equation. The great flexibility of the nonlinear Poisson--Boltzmann theory allows us to explore quantitatively the influence of each of these effects, and our simulations show that the short-range properties of the electrostatic potential affect primarily kinetically controlled processes (to varying degrees, depending on the ionic system considered) whereas the down-range properties of the potential play a (somewhat) greater role in influencing diffusion-controlled processes. A detailed examination is made of ionic strength effects over a broad range of ionic concentrations. In the regime of low ionic strength, the limiting slope and intercept of the curve describing the dependence of log k/sub D/ on I/sup 1/2//(1+I/sup 1/2/) may differ considerably from the usual Debye--Hueckel limiting relations, depending on the particular model chosen to describe local saturation effects

  5. Comparative Experimental Study on Ionic Polymer Mental Composite based on Nafion and Aquivion Membrane as Actuators

    Science.gov (United States)

    Luo, B.; Chen, Z.

    2017-11-01

    Most ionic polymer mental composites employ Nafion as the polymer matrix, Aquivion can also manufactured as ionic polymer mental composite while research was little. This paper researched on two kinds of ionic polymer mental composite based on Aquivion and Nafion matrix with palladium electrode called Aquivion-IPMC and Nafion-IPMC. The samples were fabricated by the same preparation process. The current and deformation responses of the samples were measured at voltage to characterize the mechano-electrical properties. The experimental observations revealed that shorter flexible side chains in Aquivion-IPMC provide a larger force than Nafion-IPMC, while the displacement properties were similar in two different samples. The results also showed that Aquivion membrane can also replace Nafion to reproduce IPMC application in soft robots, MEMS, and so on.

  6. Amphiphile Meets Amphiphile: Beyond the Polar-Apolar Dualism in Ionic Liquid/Alcohol Mixtures.

    Science.gov (United States)

    Russina, Olga; Sferrazza, Alessio; Caminiti, Ruggero; Triolo, Alessandro

    2014-05-15

    The mesoscopic morphology of binary mixtures of ethylammonium nitrate (EAN), the protic ionic liquid par excellence, and methanol is explored using neutron/X-ray diffraction and computational techniques. Both compounds are amphiphilic and characterized by an extended hydrogen bonding network: surprisingly, though macroscopically homogeneous, these mixtures turn out to be mesoscopically highly heterogeneous. Our study reveals that even in methanol-rich mixtures, a wide distribution of clusters exists where EAN preserves its bulk, sponge-like morphology. Accordingly methanol does not succeed in fully dissociating the ionic liquid that keeps on organizing in a bulk-like fashion. This behavior represents the premises to the more dramatic phenomenology observed with longer alcohols that eventually phase separate from EAN. These results challenge the commonly accepted polar and apolar moieties segregation in ionic liquids/molecular liquids mixtures and the current understanding of technologically relevant solvation processes.

  7. Computationally Efficient Prediction of Ionic Liquid Properties

    DEFF Research Database (Denmark)

    Chaban, V. V.; Prezhdo, O. V.

    2014-01-01

    Due to fundamental differences, room-temperature ionic liquids (RTIL) are significantly more viscous than conventional molecular liquids and require long simulation times. At the same time, RTILs remain in the liquid state over a much broader temperature range than the ordinary liquids. We exploit...... to ambient temperatures. We numerically prove the validity of the proposed concept for density and ionic diffusion of four different RTILs. This simple method enhances the computational efficiency of the existing simulation approaches as applied to RTILs by more than an order of magnitude....

  8. Steven's orbital reduction factor in ionic clusters

    Science.gov (United States)

    Gajek, Z.; Mulak, J.

    1985-11-01

    General expressions for reduction coefficients of matrix elements of angular momentum operator in ionic clusters or molecular systems have been derived. The reduction in this approach results from overlap and covalency effects and plays an important role in the reconciling of magnetic and spectroscopic experimental data. The formulated expressions make possible a phenomenological description of the effect with two independent parameters for typical equidistant clusters. Some detailed calculations also suggest the possibility of a one-parameter description. The results of these calculations for some ionic uranium compounds are presented as an example.

  9. Inhibition of GluR Current in Microvilli of Sensory Neurons via Na+-Microdomain Coupling Among GluR, HCN Channel, and Na+/K+ Pump

    Directory of Open Access Journals (Sweden)

    Yasuhiro Kawasaki

    2018-04-01

    Full Text Available Glutamatergic dendritic EPSPs evoked in cortical pyramidal neurons are depressed by activation of hyperpolarization-activated cyclic nucleotide-gated (HCN channels expressed in dendritic spines. This depression has been attributed to shunting effects of HCN current (Ih on input resistance or Ih deactivation. Primary sensory neurons in the rat mesencephalic trigeminal nucleus (MTN have the somata covered by spine-like microvilli that express HCN channels. In rat MTN neurons, we demonstrated that Ih enhancement apparently diminished the glutamate receptor (GluR current (IGluR evoked by puff application of glutamate/AMPA and enhanced a transient outward current following IGluR (OT-IGluR. This suggests that some outward current opposes inward IGluR. The IGluR inhibition displayed a U-shaped voltage-dependence with a minimal inhibition around the resting membrane potential, suggesting that simple shunting effects or deactivation of Ih cannot explain the U-shaped voltage-dependence. Confocal imaging of Na+ revealed that GluR activation caused an accumulation of Na+ in the microvilli, which can cause a negative shift of the reversal potential for Ih (Eh. Taken together, it was suggested that IGluR evoked in MTN neurons is opposed by a transient decrease or increase in standing inward or outward Ih, respectively, both of which can be caused by negative shifts of Eh, as consistent with the U-shaped voltage-dependence of the IGluR inhibition and the OT-IGluR generation. An electron-microscopic immunohistochemical study revealed the colocalization of HCN channels and glutamatergic synapses in microvilli of MTN neurons, which would provide a morphological basis for the functional interaction between HCN and GluR channels. Mathematical modeling eliminated the possibilities of the involvements of Ih deactivation and/or shunting effect and supported the negative shift of Eh which causes the U-shaped voltage-dependent inhibition of IGluR.

  10. Applications of ionic liquids in polymer science and technology

    CERN Document Server

    2015-01-01

    This book summarizes the latest knowledge in the science and technology of ionic liquids and polymers in different areas. Ionic liquids (IL) are actively being investigated in polymer science and technology for a number of different applications. In the first part of the book the authors present the particular properties of ionic liquids as speciality solvents. The state-of-the art in the use of ionic liquids in polymer synthesis and modification reactions including polymer recycling is outlined. The second part focuses on the use of ionic liquids as speciality additives such as plasticizers or antistatic agents.  The third part examines the use of ionic liquids in the design of functional polymers (usually called polymeric ionic liquids (PIL) or poly(ionic liquids)). Many important applications in diverse scientific and industrial areas rely on these polymers, like polymer electrolytes in electrochemical devices, building blocks in materials science, nanocomposites, gas membranes, innovative anion sensitive...

  11. Physical Chemistry of Reaction Dynamics in Ionic Liquid

    Energy Technology Data Exchange (ETDEWEB)

    Maroncelli, Mark [Pennsylvania State Univ., University Park, PA (United States)

    2016-10-02

    Work completed over the past year mainly involves finishing studies related to solvation dynamics in ionic liquids, amplifying and extending our initial PFG-NMR work on solute diffusion, and learning how to probe rotational dynamics in ionic liquids.

  12. Ionic systems in materials research : new materials and processes based on ionic polymerizations and/or ionic liquids

    NARCIS (Netherlands)

    Guerrero-Sanchez, C.A.

    2007-01-01

    Systems based on ionic interactions are usually related to reversible processes and/or transitory chemical states and, nowadays, they are believed to be key factors for the understanding and for the development of processes in several branches of chemistry and materials research. During the last

  13. Surface polymerization of (3,4-ethylenedioxythiophene) probed by in situ scanning tunneling microscopy on Au(111) in ionic liquids.

    Science.gov (United States)

    Ahmad, Shahzada; Carstens, Timo; Berger, Rüdiger; Butt, Hans-Jürgen; Endres, Frank

    2011-01-01

    The electropolymerization of 3,4-ethylenedioxythiophene (EDOT) to poly(3,4-ethylenedioxythiophene) (PEDOT) was investigated in the air and water-stable ionic liquids 1-hexyl-3-methylimidazolium tris(pentafluoroethyl) trifluorophosphate [HMIm]FAP and 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl) amide [EMIm]TFSA. In situ scanning tunnelling microscopy (STM) results show that the electropolymerization of EDOT in the ionic liquid can be probed on the nanoscale. In contrast to present understanding, it was observed that the EDOT can be oxidised in ionic liquids well below its oxidation potential and the under potential growth of polymer was visualized by in situ STM. These results serve as the first study to confirm the under potential growth of conducting polymers in ionic liquids. Furthermore, ex situ microscopy measurements were performed. Quite a high current of 670 nA was observed on the nanoscale by conductive scanning force microscopy (CSFM).

  14. Multistep Current Signal in Protein Translocation through Graphene Nanopores

    KAUST Repository

    Bonome, Emma Letizia; Lepore, Rosalba; Raimondo, Domenico; Cecconi, Fabio; Tramontano, Anna; Chinappi, Mauro

    2015-01-01

    of graphene constitute a major advantage for molecule characterization. Here we analyze the translocation pathway of the thioredoxin protein across a graphene nanopore, and the related ionic currents, by integrating two nonequilibrium molecular dynamics

  15. Ionic liquids and derived materials for lithium and sodium batteries.

    Science.gov (United States)

    Yang, Qiwei; Zhang, Zhaoqiang; Sun, Xiao-Guang; Hu, Yong-Sheng; Xing, Huabin; Dai, Sheng

    2018-03-21

    The ever-growing demand for advanced energy storage devices in portable electronics, electric vehicles and large scale power grids has triggered intensive research efforts over the past decade on lithium and sodium batteries. The key to improve their electrochemical performance and enhance the service safety lies in the development of advanced electrode, electrolyte, and auxiliary materials. Ionic liquids (ILs) are liquids consisting entirely of ions near room temperature, and are characterized by many unique properties such as ultralow volatility, high ionic conductivity, good thermal stability, low flammability, a wide electrochemical window, and tunable polarity and basicity/acidity. These properties create the possibilities of designing batteries with excellent safety, high energy/power density and long-term stability, and also provide better ways to synthesize known materials. IL-derived materials, such as poly(ionic liquids), ionogels and IL-tethered nanoparticles, retain most of the characteristics of ILs while being endowed with other favourable features, and thus they have received a great deal of attention as well. This review provides a comprehensive review of the various applications of ILs and derived materials in lithium and sodium batteries including Li/Na-ion, dual-ion, Li/Na-S and Li/Na-air (O 2 ) batteries, with a particular emphasis on recent advances in the literature. Their unique characteristics enable them to serve as advanced resources, medium, or ingredient for almost all the components of batteries, including electrodes, liquid electrolytes, solid electrolytes, artificial solid-electrolyte interphases, and current collectors. Some thoughts on the emerging challenges and opportunities are also presented in this review for further development.

  16. Synthetic Organic Electrochemistry in Ionic Liquids: The Viscosity Question

    Directory of Open Access Journals (Sweden)

    Scott T. Handy

    2011-07-01

    Full Text Available Ionic liquids are obvious candidates for use in electrochemical applications due to their ionic character. Nevertheless, relatively little has been done to explore their application in electrosynthesis. We have studied the Shono oxidation of arylamines and carbamates using ionic liquids as recyclable solvents and have noted that the viscosity of the medium is a major problem, although with the addition of sufficient co-solvent, good results and excellent recovery and recycling of the ionic liquid can be achieved.

  17. Application of Ionic Liquids in Amperometric Gas Sensors.

    Science.gov (United States)

    Gębicki, Jacek; Kloskowski, Adam; Chrzanowski, Wojciech; Stepnowski, Piotr; Namiesnik, Jacek

    2016-01-01

    This article presents an analysis of available literature data on metrological parameters of the amperometric gas sensors containing ionic liquids as an electrolyte. Four mechanism types of signal generation in amperometric sensors with ionic liquid are described. Moreover, this article describes the influence of selected physico-chemical properties of the ionic liquids on the metrological parameters of these sensors. Some metrological parameters are also compared for amperometric sensors with GDE and SPE electrodes and with ionic liquids for selected analytes.

  18. Effect of Ionic Strength on Settling of Activated Sludge

    OpenAIRE

    M Ahmadi Moghadam, M Soheili, MM Esfahani

    2005-01-01

    Structural properties of activated sludge flocs were found to be sensitive to small changes in ionic strength. This study investigates the effect of ionic strength on settling of activated sludge. Samples were taken from activated sludge process of Ghazvin Sasan soft drink wastewater treatment plant, then treated with different ionic strengths of KCl and CaCl2 solution, after that the turbidity of supernatant was measured. The results indicated that low ionic strength resulted in a steeper sl...

  19. PEG-bis phosphonic acid based ionic supramolecular structures

    DEFF Research Database (Denmark)

    Gonzalez, Lidia; Skov, Anne Ladegaard; Hvilsted, Søren

    2014-01-01

    . The resulting ionic assemblies are very comprehensively characterized by ATR-FTIR, proton, and carbon-13 NMR spectroscopy that unequivocally demonstrate the ionic network formation through ammonium phophonates. The resulting salt and ionic networks are additionally analyzed by differential scanning calorimetry...... and thermogravimetric analysis. The conclusion is that mixing the virgin components at room temperature spontaneously form either a salt or ionic supramolecular networks. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim....

  20. The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)

    2016-07-11

    Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.

  1. Ionic liquid containing hydroxamate and N-alkyl sulfamate ions

    Science.gov (United States)

    Friesen, Cody A.; Wolfe, Derek; Johnson, Paul Bryan

    2016-03-15

    Embodiments of the invention are related to ionic liquids and more specifically to ionic liquids used in electrochemical metal-air cells in which the ionic liquid includes a cation and an anion selected from hydroxamate and/or N-alkyl sulfamate anions.

  2. Improving lithium therapeutics by crystal engineering of novel ionic cocrystals.

    Science.gov (United States)

    Smith, Adam J; Kim, Seol-Hee; Duggirala, Naga K; Jin, Jingji; Wojtas, Lukasz; Ehrhart, Jared; Giunta, Brian; Tan, Jun; Zaworotko, Michael J; Shytle, R Douglas

    2013-12-02

    Current United States Food and Drug Administration (FDA)-approved lithium salts are plagued with a narrow therapeutic window. Recent attempts to find alternative drugs have identified new chemical entities, but lithium's polypharmacological mechanisms for treating neuropsychiatric disorders are highly debated and are not yet matched. Thus, re-engineering current lithium solid forms in order to optimize performance represents a low cost and low risk approach to the desired therapeutic outcome. In this contribution, we employed a crystal engineering strategy to synthesize the first ionic cocrystals (ICCs) of lithium salts with organic anions. We are unaware of any previous studies that have assessed the biological efficacy of any ICCs, and encouragingly we found that the new speciation did not negatively affect established bioactivities of lithium. We also observed that lithium ICCs exhibit modulated pharmacokinetics compared to lithium carbonate. Indeed, the studies detailed herein represent an important advancement in a crystal engineering approach to a new generation of lithium therapeutics.

  3. Ionic conduction in polyether-based lithium arylfluorosulfonimide ionic melt electrolytes

    International Nuclear Information System (INIS)

    Herath, Mahesha B.; Creager, Stephen E.; Rajagopal, Rama V.; Geiculescu, Olt E.; DesMarteau, Darryl D.

    2009-01-01

    We report synthesis, characterization and ion transport in polyether-based ionic melt electrolytes consisting of Li salts of low-basicity anions covalently attached to polyether oligomers. Purity of the materials was investigated by HPLC analysis and electrospray ionization mass spectrometry. The highest ionic conductivity of 7.1 x 10 -6 S/cm at 30 deg. C was obtained for the sample consisting of a lithium salt of an arylfluorosulfonimide anion attached to a polyether oligomer with an ethyleneoxide (EO) to lithium ratio of 12. The conductivity order of various ionic melts having different polyether chain lengths suggests that at higher EO:Li ratios the conductivity of the electrolytes at room temperature is determined in part by the amount of crystallization of the polyether portion of the ionic melt.

  4. Supported ionic liquid-phase (SILP) catalysis

    DEFF Research Database (Denmark)

    Riisager, Anders; Fehrmann, Rasmus; Wasserscheid, P.

    2005-01-01

    The concept of supported ionic liquid-phase (SILP) catalysis has been demonstrated for gas- and liquid-phase continuous fixed-bed reactions using rhodium phosphine catalyzed hydroformylation of propene and 1-octene as examples. The nature of the support had important influence on both the catalytic...

  5. Ionic conduction in the solid state

    Indian Academy of Sciences (India)

    Unknown

    Li+, its lower weight, ease of handling and its poten- tial use in high energy density batteries. Li2SiO4 is one of the .... that influence the ionic conductivity of a crystal the activation energy is of utmost importance since the .... fraction techniques are commonly employed to elu- cidate the structure features of superionic solids.

  6. High H⁻ ionic conductivity in barium hydride.

    Science.gov (United States)

    Verbraeken, Maarten C; Cheung, Chaksum; Suard, Emmanuelle; Irvine, John T S

    2015-01-01

    With hydrogen being seen as a key renewable energy vector, the search for materials exhibiting fast hydrogen transport becomes ever more important. Not only do hydrogen storage materials require high mobility of hydrogen in the solid state, but the efficiency of electrochemical devices is also largely determined by fast ionic transport. Although the heavy alkaline-earth hydrides are of limited interest for their hydrogen storage potential, owing to low gravimetric densities, their ionic nature may prove useful in new electrochemical applications, especially as an ionically conducting electrolyte material. Here we show that barium hydride shows fast pure ionic transport of hydride ions (H(-)) in the high-temperature, high-symmetry phase. Although some conductivity studies have been reported on related materials previously, the nature of the charge carriers has not been determined. BaH2 gives rise to hydride ion conductivity of 0.2 S cm(-1) at 630 °C. This is an order of magnitude larger than that of state-of-the-art proton-conducting perovskites or oxide ion conductors at this temperature. These results suggest that the alkaline-earth hydrides form an important new family of materials, with potential use in a number of applications, such as separation membranes, electrochemical reactors and so on.

  7. Ionic liquid based multifunctional double network gel

    Science.gov (United States)

    Ahmed, Kumkum; Higashihara, Tomoya; Arafune, Hiroyuki; Kamijo, Toshio; Morinaga, Takashi; Sato, Takaya; Furukawa, Hidemitsu

    2015-04-01

    Gels are a promising class of soft and wet materials with diverse application in tissue engineering and bio-medical purpose. In order to accelerate the development of gels, it is required to synthesize multi-functional gels of high mechanical strength, ultra low surface friction and suitable elastic modulus with a variety of methods and new materials. Among many types of gel ionic gel made from ionic liquids (ILs) could be used for diverse applications in electrochemical devices and in the field of tribology. IL, a promising materials for lubrication, is a salt with a melting point lower than 100 °C. As a lubricant, ILs are characterized by an extremely low vapor pressure, high thermal stability and high ion conductivity. In this work a novel approach of making double network DN ionic gel using IL has been made utilizing photo polymerization process. A hydrophobic monomer Methyl methacrylate (MMA) has been used as a first network and a hydrophobic IL monomer, N,N-diethyl-N-(2-mthacryloylethyl)-N-methylammonium bistrifluoromethylsulfonyl)imide (DEMM-TFSI) has been used as a second network using photo initiator benzophenon and crosslinker triethylene glycol dimethacrylate (TEGDMA). The resulting DN ionic gel shows transparency, flexibility, high thermal stability, good mechanical toughness and low friction coefficient value which can be a potential candidate as a gel slider in different mechanical devices and can open a new area in the field of gel tribology.

  8. SANS analysis of aqueous ionic perfluoropolyether micelles

    CERN Document Server

    Gambi, C M C; Chittofrati, A; Pieri, R; Baglioni, P; Teixeira, J

    2002-01-01

    Preliminary SANS results of ionic chlorine terminated perfluoropolyether micelles in water are given. The experimental spectra have been analyzed by a two-shell ellipsoidal model for the micellar form factor and a screened Coulombic plus hard-sphere repulsion potential for the structure factor. (orig.)

  9. Tilts and Ionic Shifts in Rhombohedral Perovskites

    NARCIS (Netherlands)

    Noheda, Beatriz; Duan, Ning; Cereceda, Noé; Gonzalo, Julio A.

    1998-01-01

    We make a comparative analysis of rhombohedral perovskites (ABO3) with/without oxygen rotations and ionic shifts, within the framework of a generalised effective field approach. We analyse available data on LaAlO3 and LiTaO3 and new data on Zr-rich PZT, examples of three different ways of structural

  10. Mechanistic aspects of ionic reactions in flames

    DEFF Research Database (Denmark)

    Egsgaard, H.; Carlsen, L.

    1993-01-01

    Some fundamentals of the ion chemistry of flames are summarized. Mechanistic aspects of ionic reactions in flames have been studied using a VG PlasmaQuad, the ICP-system being substituted by a simple quartz burner. Simple hydrocarbon flames as well as sulfur-containing flames have been investigated...

  11. Desalination of aqueous media using ionic liquids

    NARCIS (Netherlands)

    2014-01-01

    The present invention relates to a method for extracting metal and/or metalloid ions from an aqueous medium, comprising the steps of: a) mixing the aqueous medium with an ionic liquid comprising an aliphatic carboxylate anion having at least one unsaturated carbon-carbon bond, or and/or with a

  12. Analysis of ionic conductance of carbon nanotubes

    NARCIS (Netherlands)

    Biesheuvel, P.M.; Bazant, M.Z.

    2016-01-01

    We use space-charge (SC) theory (also called the capillary pore model) to describe the ionic conductance, G, of charged carbon nanotubes (CNTs). Based on the reversible adsorption of hydroxyl ions to CNT pore walls, we use a Langmuir isotherm for surface ionization and make calculations as a

  13. Vaporisation of a dicationic ionic liquid.

    Science.gov (United States)

    Lovelock, Kevin R J; Deyko, Alexey; Corfield, Jo-Anne; Gooden, Peter N; Licence, Peter; Jones, Robert G

    2009-02-02

    Highest heat of vaporization yet: The dicationic ionic liquid [C(3)(C(1)Im)(2)][Tf(2)N](2) evaporates as a neutral ion triplet. These neutral ion triplets can then be ionised to form singly and doubly charged ions. The mass spectrum exhibits the dication attached to one remaining anion, and the naked dication itself (see picture).

  14. Conservation of Charge and Conservation of Current

    OpenAIRE

    Eisenberg, Bob

    2016-01-01

    Conservation of current and conservation of charge are nearly the same thing: when enough is known about charge movement, conservation of current can be derived from conservation of charge, in ideal dielectrics, for example. Conservation of current is enforced implicitly in ideal dielectrics by theories that conserve charge. But charge movement in real materials like semiconductors or ionic solutions is never ideal. We present an apparently universal derivation of conservation of current and ...

  15. VOC and HAP recovery using ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Michael R. Milota : Kaichang Li

    2007-05-29

    During the manufacture of wood composites, paper, and to a lesser extent, lumber, large amounts of volatile organic compounds (VOCs) such as terpenes, formaldehyde, and methanol are emitted to air. Some of these compounds are hazardous air pollutants (HAPs). The air pollutants produced in the forest products industry are difficult to manage because the concentrations are very low. Presently, regenerative thermal oxidizers (RTOs and RCOs) are commonly used for the destruction of VOCs and HAPs. RTOs consume large amounts of natural gas to heat air and moisture. The combustion of natural gas generates increased CO2 and NOx, which have negative implications for global warming and air quality. The aforementioned problems are addressed by an absorption system containing a room-temperature ionic liquid (RTIL) as an absorbent. RTILs are salts, but are in liquid states at room temperature. RTILs, an emerging technology, are receiving much attention as replacements for organic solvents in industrial processes with significant cost and environmental benefits. Some of these processes include organic synthesis, extraction, and metal deposition. RTILs would be excellent absorbents for exhausts from wood products facilities because of their unique properties: no measurable vapor pressure, high solubility of wide range of organic compounds, thermal stability to 200°C (almost 400°F), and immisciblity with water. Room temperature ionic liquids were tested as possible absorbents. Four were imidizolium-based and were eight phosphonium-based. The imidizolium-based ionic liquids proved to be unstable at the conditions tested and in the presence of water. The phosphonium-based ionic liquids were stable. Most were good absorbents; however, cleaning the contaminates from the ionic liquids was problematic. This was overcome with a higher temperature (120°C) than originally proposed and a very low pressure (1 kPa. Absorption trials were conducted with tetradecy

  16. Effect of current density on the anodization of zircaloy-2

    International Nuclear Information System (INIS)

    Bhaskar Reddy, P.; Panasa Reddy, A.

    2005-01-01

    The effect of current density on the kinetics of anodization of Zircaloy-2 in 0.1 M potassium tartarate have been studied at various constant current densities ranging from 2 to 10 mA.cm -2 and at room temperature to investigate the exponential dependence of ionic current density on the field across the oxide. The rate of anodic film formation (dV/dt), the current efficiency the differential field of formation (F) and the ionic current density (i i ) were calculated. It was found that all these parameters were increased with increase of current density. The induction period was decreased with the increase of current density. It was also found that the plot of log (ionic current density) vs differential field gave fairly a linear relationship. The kinetic parameters, half jump distance (a) and height of the energy barrier (W) were calculated. (author)

  17. Ionic conductivity of ternary electrolyte containing sodium salt and ionic liquid

    International Nuclear Information System (INIS)

    Egashira, Minato; Asai, Takahito; Yoshimoto, Nobuko; Morita, Masayuki

    2011-01-01

    Highlights: ► Ternary electrolyte containing NaBF 4 , polyether and ionic liquid has been prepared. ► The conductivity of the electrolytes has been evaluated toward content of ionic liquid. ► The conductivity shows maximum 1.2 mS cm −1 and is varied in relation to solution structure. - Abstract: For the development of novel non-aqueous sodium ion conductor with safety of sodium secondary cell, non-flammable ionic liquid is attractive as electrolyte component. A preliminary study has been carried out for the purpose of constructing sodium ion conducting electrolyte based on ionic liquid. The solubility of sodium salt such as NaBF 4 in ionic liquid is poor, thus the ternary electrolyte has been prepared where NaBF 4 with poly(ethylene glycol) dimethyl ether (PEGDME) as coordination former is dissolved with ionic liquid diethyl methoxyethyl ammonium tetrafluoroborate (DEMEBF 4 ). The maximum conductivity among the prepared solutions, ca. 1.2 mS cm −1 at 25 °C, was obtained when the molar ratio (ethylene oxide unit in PEGDME):NaBF 4 :DEMEBF 4 was 8:1:2. The relationship between the conductivity of the ternary electrolyte and its solution structure has been discussed.

  18. The shape-memory effect in ionic elastomers: fixation through ionic interactions.

    Science.gov (United States)

    González-Jiménez, Antonio; Malmierca, Marta A; Bernal-Ortega, Pilar; Posadas, Pilar; Pérez-Aparicio, Roberto; Marcos-Fernández, Ángel; Mather, Patrick T; Valentín, Juan L

    2017-04-19

    Shape-memory elastomers based on a commercial rubber cross-linked by both ionic and covalent bonds have been developed. The elastomeric matrix was a carboxylated nitrile rubber (XNBR) vulcanized with magnesium oxide (MgO) providing ionic interactions that form hierarchical structures. The so-named ionic transition is used as the unique thermal transition responsible for the shape-memory effect (SME) in these elastomers. These ionic interactions fix the temporary shape due to their behavior as dynamic cross-links with temperature changes. Covalent cross-links were incorporated with the addition of different proportions of dicumyl peroxide (DCP) to the ionic elastomer to establish and recover the permanent shape. In this article, the SME was modulated by modifying the degree of covalent cross-linking, while keeping the ionic contribution constant. In addition, different programming parameters, such as deformation temperature, heating/cooling rate, loading/unloading rate and percentage of tensile strain, were evaluated for their effects on shape-memory behavior.

  19. Comparative Investigation of the Ionicity of Aprotic and Protic Ionic Liquids in Molecular Solvents by using Conductometry and NMR Spectroscopy.

    Science.gov (United States)

    Thawarkar, Sachin; Khupse, Nageshwar D; Kumar, Anil

    2016-04-04

    Electrical conductivity (σ), viscosity (η), and self-diffusion coefficient (D) measurements of binary mixtures of aprotic and protic imidazolium-based ionic liquids with water, dimethyl sulfoxide, and ethylene glycol were measured from 293.15 to 323.15 K. The temperature dependence study reveals typical Arrhenius behavior. The ionicities of aprotic ionic liquids were observed to be higher than those of protic ionic liquids in these solvents. The aprotic ionic liquid, 1-butyl-3-methylimidazolium tetrafluoroborate, [bmIm][BF4 ], displays 100 % ionicity in both water and ethylene glycol. The protic ionic liquids in both water and ethylene glycol are classed as good ionic candidates, whereas in DMSO they are classed as having a poor ionic nature. The solvation dynamics of the ionic species of the ionic liquids are illustrated on the basis of the (1) H NMR chemical shifts of the ionic liquids. The self-diffusion coefficients D of the cation and anion of [HmIm][CH3 COO] in D2 O and in [D6 ]DMSO are determined by using (1) H nuclei with pulsed field gradient spin-echo NMR spectroscopy. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Ionic thermocurrents and ionic conductivity of solid solutions of SrF2 and YbF3

    NARCIS (Netherlands)

    Meuldijk, J.; Hartog, den H.W.

    1983-01-01

    We report dielectric [ionic thermocurrent (!TC)] experiments and ionic conductivity of cubic solid solutions of the type Sr1-xYbxF2+x. These combined experiments provide us with new information concerning the ionic conductivity mechanisms which play an important role in solid solutions Sr1-xRxF2+x

  1. Phase Behavior of Mixtures of Ionic Liquids and Organic Solvents

    DEFF Research Database (Denmark)

    Abildskov, Jens; Ellegaard, Martin Dela; O’Connell, J.P.

    2010-01-01

    A corresponding-states form of the generalized van der Waals equation, previously developed for mixtures of an ionic liquid and a supercritical solute, is here extended to mixtures including an ionic liquid and a solvent (water or organic). Group contributions to characteristic parameters...... are implemented, leading to an entirely predictive method for densities of mixed compressed ionic liquids. Quantitative agreement with experimental data is obtained over wide ranges of conditions. Previously, the method has been applied to solubilities of sparingly soluble gases in ionic liquids and in organic...... solvents. Here we show results for heavier and more-than-sparingly solutes such as carbon dioxide and propane in ionic liquids....

  2. Supported ionic liquids: versatile reaction and separation media

    DEFF Research Database (Denmark)

    Riisager, Anders; Fehrmann, Rasmus; Haumann, Marco

    2006-01-01

    The latest developments in supported ionic liquid phase (SILP) systems for catalysis and separation technology are surveyed. The SILP concept combines the advantages of homogeneous catalysis with heterogeneous process technology, and a variety of reactions have been studied where supported ionic ...... liquid catalysts proved to be more active and selective than common systems. In separation applications the use of supported ionic liquids can facilitate selective transport of substrates across membranes.......The latest developments in supported ionic liquid phase (SILP) systems for catalysis and separation technology are surveyed. The SILP concept combines the advantages of homogeneous catalysis with heterogeneous process technology, and a variety of reactions have been studied where supported ionic...

  3. Structure, ionic Conductivity and mobile Carrier Density in Fast Ionic Conducting Chalcogenide Glasses

    International Nuclear Information System (INIS)

    Wenlong Yao

    2006-01-01

    This thesis consists of six sections. The first section gives the basic research background on the ionic conduction mechanism in glass, polarization in the glass, and the method of determining the mobile carrier density in glass. The proposed work is also included in this section. The second section is a paper that characterizes the structure of MI + M 2 S + (0.1 Ga 2 S 3 + 0.9 GeS 2 ) (M = Li, Na, K and Cs) glasses using Raman and IR spectroscopy. Since the ionic radius plays an important role in determining the ionic conductivity in glasses, the glass forming range for the addition of different alkalis into the basic glass forming system 0.1 Ga 2 S 3 + 0.9 GeS 2 was studied. The study found that the change of the alkali radius for the same nominal composition causes significant structure change to the glasses. The third section is a paper that investigates the ionic conductivity of MI + M 2 S + (0.1Ga 2 S 3 + 0.9 GeS 2 ) (M = Li, Na, K and Cs) glasses system. Corresponding to the compositional changes in these fast ionic conducting glasses, the ionic conductivity shows changes due to the induced structural changes. The ionic radius effect on the ionic conductivity in these glasses was investigated. The fourth section is a paper that examines the mobile carrier density based upon the measurements of space charge polarization. For the first time, the charge carrier number density in fast ionic conducting chalcogenide glasses was determined. The experimental impedance data were fitted using equivalent circuits and the obtained parameters were used to determine the mobile carrier density. The influence of mobile carrier density and mobility on the ionic conductivity was separated. The fifth section is a paper that studies the structures of low-alkali-content Na 2 S + B 2 S 3 (x (le) 0.2) glasses by neutron and synchrotron x-ray diffraction. Similar results were obtained both in neutron and synchrotron x-ray diffraction experiments. The results provide direct

  4. Interactions in ion pairs of protic ionic liquids: Comparison with aprotic ionic liquids

    International Nuclear Information System (INIS)

    Tsuzuki, Seiji; Shinoda, Wataru; Miran, Md. Shah; Kinoshita, Hiroshi; Yasuda, Tomohiro; Watanabe, Masayoshi

    2013-01-01

    The stabilization energies for the formation (E form ) of 11 ion pairs of protic and aprotic ionic liquids were studied by MP2/6-311G ** level ab initio calculations to elucidate the difference between the interactions of ions in protic ionic liquids and those in aprotic ionic liquids. The interactions in the ion pairs of protic ionic liquids (diethylmethylammonium [dema] and dimethylpropylammonium [dmpa] based ionic liquids) are stronger than those of aprotic ionic liquids (ethyltrimethylammonium [etma] based ionic liquids). The E form for the [dema][CF 3 SO 3 ] and [dmpa][CF 3 SO 3 ] complexes (−95.6 and −96.4 kcal/mol, respectively) are significantly larger (more negative) than that for the [etma][CF 3 SO 3 ] complex (−81.0 kcal/mol). The same trend was observed for the calculations of ion pairs of the three cations with the Cl − , BF 4 − , TFSA − anions. The anion has contact with the N–H bond of the dema + or dmpa + cations in the most stable geometries of the dema + and dmpa + complexes. The optimized geometries, in which the anions locate on the counter side of the cations, are 11.0–18.0 kcal/mol less stable, which shows that the interactions in the ions pairs of protic ionic liquids have strong directionality. The E form for the less stable geometries for the dema + and dmpa + complexes are close to those for the most stable etma + complexes. The electrostatic interaction, which is the major source of the attraction in the ion pairs, is responsible for the directionality of the interactions and determining the magnitude of the interaction energy. Molecular dynamic simulations of the [dema][TFSA] and [dmpa][TFSA] ionic liquids show that the N–H bonds of the cations have contact with the negatively charged (oxygen and nitrogen) atoms of TFSA − anion, while the strong directionality of the interactions was not suggested from the simulation of the [etma][CF 3 SO 3 ] ionic liquid

  5. Structure, ionic conductivity and mobile carrier density in fast ionic conducting chalcogenide glasses

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Wenlong [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    This thesis consists of six sections. The first section gives the basic research background on the ionic conduction mechanism in glass, polarization in the glass, and the method of determining the mobile carrier density in glass. The proposed work is also included in this section. The second section is a paper that characterizes the structure of MI + M2S + (0.1 Ga2S3 + 0.9 GeS2) (M = Li, Na, K and Cs) glasses using Raman and IR spectroscopy. Since the ionic radius plays an important role in determining the ionic conductivity in glasses, the glass forming range for the addition of different alkalis into the basic glass forming system 0.1 Ga2S3 + 0.9 GeS2 was studied. The study found that the change of the alkali radius for the same nominal composition causes significant structure change to the glasses. The third section is a paper that investigates the ionic conductivity of MI + M2S + (0.1Ga2S3 + 0.9 GeS2) (M = Li, Na, K and Cs) glasses system. Corresponding to the compositional changes in these fast ionic conducting glasses, the ionic conductivity shows changes due to the induced structural changes. The ionic radius effect on the ionic conductivity in these glasses was investigated. The fourth section is a paper that examines the mobile carrier density based upon the measurements of space charge polarization. For the first time, the charge carrier number density in fast ionic conducting chalcogenide glasses was determined. The experimental impedance data were fitted using equivalent circuits and the obtained parameters were used to determine the mobile carrier density. The influence of mobile carrier density and mobility on the ionic conductivity was separated. The fifth section is a paper that studies the structures of low-alkali-content Na2S + B2S3 (x ≤ 0.2) glasses by neutron and synchrotron x-ray diffraction

  6. Active chemisorption sites in functionalized ionic liquids for carbon capture.

    Science.gov (United States)

    Cui, Guokai; Wang, Jianji; Zhang, Suojiang

    2016-07-25

    Development of novel technologies for the efficient and reversible capture of CO2 is highly desired. In the last decade, CO2 capture using ionic liquids has attracted intensive attention from both academia and industry, and has been recognized as a very promising technology. Recently, a new approach has been developed for highly efficient capture of CO2 by site-containing ionic liquids through chemical interaction. This perspective review focuses on the recent advances in the chemical absorption of CO2 using site-containing ionic liquids, such as amino-based ionic liquids, azolate ionic liquids, phenolate ionic liquids, dual-functionalized ionic liquids, pyridine-containing ionic liquids and so on. Other site-containing liquid absorbents such as amine-based solutions, switchable solvents, and functionalized ionic liquid-amine blends are also investigated. Strategies have been discussed for how to activate the existent reactive sites and develop novel reactive sites by physical and chemical methods to enhance CO2 absorption capacity and reduce absorption enthalpy. The carbon capture mechanisms of these site-containing liquid absorbents are also presented. Particular attention has been paid to the latest progress in CO2 capture in multiple-site interactions by amino-free anion-functionalized ionic liquids. In the last section, future directions and prospects for carbon capture by site-containing ionic liquids are outlined.

  7. Hydrogen production from glucose in ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Assenbaum, D.W.; Taccardi, N.; Berger, M.E.M.; Boesmann, A.; Enzenberger, F.; Woelfel, R.; Wasserscheid, P. [Erlangen-Nuernberg Univ. (Germany). Lehrstuhl fuer chemische Reaktionstechnik

    2010-07-01

    technologies suffer from the fact that the overall reaction rates are often restricted by mass and heat transport problems. Lastly, there are severe limitations concerning the feedstock selection as for some important substrates, such as e.g. glucose, the process can only be operated in very diluted systems to avoid rapid tar formation [22,23,24]. In this contribution we describe for the first time a catalytic reaction system producing hydrogen from glucose in astonishingly high selectivities using a single reaction step under very mild conditions. The catalytic reaction system is characterized by its homogeneous nature and comprises a Ru-complex catalyst dissolved and stabilized in an ionic liquid medium. Ionic liquids are salts of melting points below 100 C [25]. These liquid materials have attracted much interest in the last decade as solvents for catalytic reactions [26] and separation technologies (extraction, distillation) [27,28,29,30,31,32]. Besides, these liquids have found industrial applications as process fluids for mechanic [33] and electrochemical applications [34]. Finally, from the pioneering work of Rogers and co-workers, it is known that ionic liquids are able to dissolve significant amounts of water-insoluble biopolymers (such as e.g. cellulose and chitin)[35] and even complex biopolymer mixtures, such as e.g. wood, have been completely dissolved in some ionic liquids [36]. In our specific application, the role of the ionic liquid is threefold: a) the ionic liquid dissolves the carbohydrate starting material thus expanding the range of applicable carbohydrate to water insoluble polymers; b) the ionic liquid provides a medium to dissolve and stabilize the catalyst; c) the ionic liquid dissolves hydrogen at a very low level, so inhibiting any possible collateral hydrogen-consuming process (detailed investigation of the hydrogen solubility in ionic liquids have been reported by e.g. Brennecke and coworkers [37]). (orig.)

  8. [Advances of poly (ionic liquid) materials in separation science].

    Science.gov (United States)

    Liu, Cuicui; Guo, Ting; Su, Rina; Gu, Yuchen; Deng, Qiliang

    2015-11-01

    Ionic liquids, as novel ionization reagents, possess beneficial characteristics including good solubility, conductivity, thermal stability, biocompatibility, low volatility and non-flammability. Ionic liquids are attracting a mass of attention of analytical chemists. Poly (ionic liquid) materials have common performances of ionic liquids and polymers, and have been successfully applied in separation science area. In this paper, we discuss the interaction mechanisms between the poly(ionic liquid) materials and analytes including hydrophobic/hydrophilic interactions, hydrogen bond, ion exchange, π-π stacking and electrostatic interactions, and summarize the application advances of the poly(ionic liquid) materials in solid phase extraction, chromatographic separation and capillary electrophoresis. At last, we describe the future prospect of poly(ionic liquid) materials.

  9. Comparison of soft tissue effects of conventional ionic, low osmolar ionic and nonionic iodine containing contrast material in experimental animals

    International Nuclear Information System (INIS)

    McAlister, W.H.; Kissane, J.M.

    1990-01-01

    Conventional, low osmolar, and non-ionic iodine containing contrast media and saline controls were placed in the paws, muscles, and subcutaneous tissues of Sprague-Dawley rat thighs. The paw injections were observed and photographed, while the thighs were examined histologically. Results showed that although the low osmolar and non-ionic agents did produce inflammatory reactions and focal necrosis in the soft tissues, they were much better tolerated than were the conventional ionic agents. A non-ionic or low osmolar ionic contrast agent should be strongly considered when a possibility for extravasation exists. (orig.)

  10. Catalytic Ionic-Liquid Membranes: The Convergence of Ionic-Liquid Catalysis and Ionic-Liquid Membrane Separation Technologies.

    Czech Academy of Sciences Publication Activity Database

    Izák, Pavel; Bobbink, F.D.; Hulla, M.; Klepic, M.; Friess, K.; Hovorka, Š.; Dyson, P.J.

    2018-01-01

    Roč. 83, č. 1 (2018), s. 7-18 ISSN 2192-6506 R&D Projects: GA ČR(CZ) GA17-00089S; GA ČR GA17-05421S Institutional support: RVO:67985858 Keywords : heterogeneous catalysis * ionic liquids * membranes Subject RIV: CI - Industrial Chemistry, Chemical Engineering OBOR OECD: Chemical process engineering Impact factor: 2.797, year: 2016

  11. Evaluation of ionic liquids as absorbents for ammonia absorption refrigeration cycles using COSMO-based process simulations

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, E.; Ferro, V.R., E-mail: victor.ferro@uam.es; Riva, J. de; Moreno, D.; Palomar, J.

    2014-06-01

    Highlights: • NH{sub 3}–IL absorption cycles are modeled by COSMO-based Aspen simulations. • Proposed a priori computational approach is validated using experimental data. • Cycle performance was analyzed for conventional and task-specific ILs. • IL solvents with high NH{sub 3} absorption capacity improve the cycle performance. • Using IL mixtures is revealed as promising alternative in NH{sub 3} absorption applications. - Abstract: COSMO-based process simulations with Aspen Plus/Aspen HYSYS are used, for the first time, to a priori estimate the thermodynamic performance of ammonia absorption refrigeration cycles using ionic liquids as absorbents. This allows not only broadening the criteria set used to select/design ionic liquids with optimized properties to be used in that role, but also evaluating innovative strategies to improve the cycle’s performances. COSMO-RS method provides the information required for both creating the ionic liquid non-database components and specifying the COSMOSAC property model to perform Aspen Plus calculations. The computational procedure used here gives at the same time reasonable good property predictions of the vapor (refrigerant) and the condensed (ammonia + ionic liquid) phases as well as physically consistent estimations of the cycle’s performance under different conditions. Current results agree with those previously reported in the literature for several ionic liquid-based systems taken for comparison. In addition, task-specific ionic liquids, with improved properties for ammonia absorption, and also binary ionic liquid mixtures are considered in the analysis. It is obtained that ionic liquids showing higher ammonia absorption capacity among the considered absorbents simultaneously provide the best cycle’s performances. The cycle performances vary in relatively wide intervals depending on the ammonia concentration in the (refrigerant + absorbent) solutions. This behavior is strongly modulated by the ammonia

  12. Evaluation of ionic liquids as absorbents for ammonia absorption refrigeration cycles using COSMO-based process simulations

    International Nuclear Information System (INIS)

    Ruiz, E.; Ferro, V.R.; Riva, J. de; Moreno, D.; Palomar, J.

    2014-01-01

    Highlights: • NH 3 –IL absorption cycles are modeled by COSMO-based Aspen simulations. • Proposed a priori computational approach is validated using experimental data. • Cycle performance was analyzed for conventional and task-specific ILs. • IL solvents with high NH 3 absorption capacity improve the cycle performance. • Using IL mixtures is revealed as promising alternative in NH 3 absorption applications. - Abstract: COSMO-based process simulations with Aspen Plus/Aspen HYSYS are used, for the first time, to a priori estimate the thermodynamic performance of ammonia absorption refrigeration cycles using ionic liquids as absorbents. This allows not only broadening the criteria set used to select/design ionic liquids with optimized properties to be used in that role, but also evaluating innovative strategies to improve the cycle’s performances. COSMO-RS method provides the information required for both creating the ionic liquid non-database components and specifying the COSMOSAC property model to perform Aspen Plus calculations. The computational procedure used here gives at the same time reasonable good property predictions of the vapor (refrigerant) and the condensed (ammonia + ionic liquid) phases as well as physically consistent estimations of the cycle’s performance under different conditions. Current results agree with those previously reported in the literature for several ionic liquid-based systems taken for comparison. In addition, task-specific ionic liquids, with improved properties for ammonia absorption, and also binary ionic liquid mixtures are considered in the analysis. It is obtained that ionic liquids showing higher ammonia absorption capacity among the considered absorbents simultaneously provide the best cycle’s performances. The cycle performances vary in relatively wide intervals depending on the ammonia concentration in the (refrigerant + absorbent) solutions. This behavior is strongly modulated by the ammonia absorption

  13. Osmoregulated Chloride Currents in Hemocytes from Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Monica Bregante

    Full Text Available We investigated the biophysical properties of the transport mediated by ion channels in hemocytes from the hemolymph of the bivalve Mytilus galloprovincialis. Besides other transporters, mytilus hemocytes possess a specialized channel sensitive to the osmotic pressure with functional properties similar to those of other transport proteins present in vertebrates. As chloride fluxes may play an important role in the regulation of cell volume in case of modifications of the ionic composition of the external medium, we focused our attention on an inwardly-rectifying voltage-dependent, chloride-selective channel activated by negative membrane potentials and potentiated by the low osmolality of the external solution. The chloride channel was slightly inhibited by micromolar concentrations of zinc chloride in the bath solution, while the antifouling agent zinc pyrithione did not affect the channel conductance at all. This is the first direct electrophysiological characterization of a functional ion channel in ancestral immunocytes of mytilus, which may bring a contribution to the understanding of the response of bivalves to salt and contaminant stresses.

  14. Nontoxic Ionic Liquid Fuels for Exploration Applications

    Science.gov (United States)

    Coil, Millicent

    2015-01-01

    The toxicity of propellants used in conventional propulsion systems increases not only safety risks to personnel but also costs, due to special handling required during the entire lifetime of the propellants. Orbital Technologies Corporation (ORBITEC) has developed and tested novel nontoxic ionic liquid fuels for propulsion applications. In Phase I of the project, the company demonstrated the feasibility of several ionic liquid formulations that equaled the performance of conventional rocket propellant monomethylhydrazine (MMH) and also provided low volatility and low toxicity. In Phase II, ORBITEC refined the formulations, conducted material property tests, and investigated combustion behavior in droplet and microreactor experiments. The company also explored the effect of injector design on performance and demonstrated the fuels in a small-scale thruster. The ultimate goal is to replace propellants such as MMH with fuels that are simultaneously high-performance and nontoxic. The fuels will have uses in NASA's propulsion applications and also in a range of military and commercial functions.

  15. 5-HT modulation of hyperpolarization-activated inward current and calcium- dependent outward current in a crustacean motor neuron

    DEFF Research Database (Denmark)

    Kiehn, O.; Harris-Warrick, R. M.

    1992-01-01

    1. Serotonergic modulation of a hyperpolarization-activated inward current, I(h), and a calcium-dependent outward current, I(o(Ca)), was examined in the dorsal gastric (DG) motor neuron, with the use of intracellular recording techniques in an isolated preparation of the crab stomatogastric....... The time course of activation of I(h) was well fitted by a single exponential function and strongly voltage dependent. 5-HT increased the rate of activation of I(h). 5- HT also slowed the rate of deactivation of the I(h) tail on repolarization to -50 mV. 6. The activation curve for the conductance (G...... reduced or eliminated the 5-HT response in the depolarizing range, suggesting that 5-HT specifically reduces I(o(Ca)). 11. These results demonstrate that 5-HT has dual effects on the DG motor neuron, in the crab stomatogastric ganglion. We suggest that changes in the two conductances are responsible...

  16. A Review of Ionic Liquid Lubricants

    OpenAIRE

    Anthony E. Somers; Patrick C. Howlett; Douglas R. MacFarlane; Maria Forsyth

    2013-01-01

    Due to ever increasing demands on lubricants, such as increased service intervals, reduced volumes and reduced emissions, there is a need to develop new lubricants and improved wear additives. Ionic liquids (ILs) are room temperature molten salts that have recently been shown to offer many advantages in this area. The application of ILs as lubricants in a diverse range of systems has found that these materials can show remarkable protection against wear and significantly reduce friction in th...

  17. Supported ionic liquids fundamentals and applications

    CERN Document Server

    Fehrmann, Rasmus; Haumann, Marco

    2013-01-01

    This unique book gives a timely overview about the fundamentals and applications of supported ionic liquids in modern organic synthesis. It introduces the concept and synthesis of SILP materials and presents important applications in the field of catalysis (e.g. hydroformylation, hydrogenation, coupling reactions, fine chemical synthesis) as well as energy technology and gas separation. Written by pioneers in the field, this book is an invaluable reference book for organic chemists in academia or industry.

  18. Phytoremediation of Ionic and Methyl Mercury Pollution

    Energy Technology Data Exchange (ETDEWEB)

    Meagher, Richard B.

    2004-12-01

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems.

  19. Poly (ether imide sulfone) membranes from solutions in ionic liquids

    KAUST Repository

    Kim, Dooli

    2017-11-20

    A membrane manufacture method based on non-volatile solvents and a high performance polymer, poly (ether imide sulfone) (EXTEM™), is proposed, as greener alternative to currently industrial process. We dissolved EXTEM™ in pure ionic liquids: 1-ethyl-3-methylimidalzolium thiocyanate ([EMIM]SCN), 1-butyl-3-methylimidalzolium thiocyanate ([BMIM]SCN), and 1-ethyl-3-methylimidalzolium acetate ([EMIM]OAc). The following polymer solution parameters were evaluated to optimize the manufacture: Gibbs free energy of mixing (G), intrinsic viscosity ([]) and hydrodynamic diameter. Membranes with sponge-like structure and narrow pore size distribution were obtained from solutions in [EMIM]SCN. They were tested for separation of proteins and deoxyribonucleic acids (DNA). Due to the polymer stability, we foresee that applications in more demanding chemical separations would be possible. [EMIM]SCN was 96 % purified and recovered after the membrane fabrication, contributing to the sustainability of the whole manufacturing process.

  20. Photo-switchable two-dimensional nanofluidic ionic diodes.

    Science.gov (United States)

    Wang, Lili; Feng, Yaping; Zhou, Yi; Jia, Meijuan; Wang, Guojie; Guo, Wei; Jiang, Lei

    2017-06-01

    The bottom-up assembly of ion-channel-mimetic nanofluidic devices and materials with two-dimensional (2D) nano-building blocks paves a straightforward way towards the real-world applications of the novel transport phenomena on a nano- or sub-nanoscale. One immediate challenge is to provide the 2D nanofluidic systems with adaptive responsibilities and asymmetric ion transport characteristics. Herein, we introduce a facile and general strategy to provide a graphene-oxide-based 2D nanofluidic system with photo-switchable ionic current rectification (ICR). The degree of ICR can be prominently enhanced upon UV irradiation and it can be perfectly retrieved under irradiation with visible light. A maximum ICR ratio of about 48 was achieved. The smart and functional nanofluidic devices have applications in energy conversion, chemical sensing, water treatment, etc .

  1. Cyanoborohydride-based ionic liquids as green aerospace bipropellant fuels.

    Science.gov (United States)

    Zhang, Qinghua; Yin, Ping; Zhang, Jiaheng; Shreeve, Jean'ne M

    2014-06-02

    In propellant systems, the most common bipropellants are composed of two chemicals, a fuel (or reducer) and an oxidizer. Currently, the choices for propellant fuels rely mainly on hydrazine and its methylated derivatives, even though they are extremely toxic, highly volatile, sensitive to adiabatic compression (risk of detonation), and, therefore, difficult to handle. With this background, the search for alternative green propellant fuels has been an urgent goal of space science. In this study, a new family of cyanoborohydride-based ionic liquids (ILs) with properties and performances comparable to hydrazine derivatives were designed and synthesized. These new ILs as bipropellant fuels, have some unique advantages including negligible vapor pressure, ultra-short ignition delay (ID) time, and reduced synthetic and storage costs, thereby showing great application potential as environmentally friendly fuels in bipropellant formulations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Canopy Dynamics in Nanoscale Ionic Materials

    KAUST Repository

    Jespersen, Michael L.

    2010-07-27

    Nanoscale ionic materials (NIMS) are organic - inorganic hybrids in which a core nanostructure is functionalized with a covalently attached corona and an ionically tethered organic canopy. NIMS are engineered to be liquids under ambient conditions in the absence of solvent and are of interest for a variety of applications. We have used nuclear magnetic resonance (NMR) relaxation and pulse-field gradient (PFG) diffusion experiments to measure the canopy dynamics of NIMS prepared from 18-nm silica cores modified by an alkylsilane monolayer possessing terminal sulfonic acid functionality, paired with an amine-terminated ethylene oxide/propylene oxide block copolymer canopy. Carbon NMR studies show that the block copolymer canopy is mobile both in the bulk and in the NIMS and that the fast (ns) dynamics are insensitive to the presence of the silica nanoparticles. Canopy diffusion in the NIMS is slowed relative to the neat canopy, but not to the degree predicted from the diffusion of hard-sphere particles. Canopy diffusion is not restricted to the surface of the nanoparticles and shows unexpected behavior upon addition of excess canopy. Taken together, these data indicate that the liquid-like behavior in NIMS is due to rapid exchange of the block copolymer canopy between the ionically modified nanoparticles. © 2010 American Chemical Society.

  3. Canopy Dynamics in Nanoscale Ionic Materials

    KAUST Repository

    Jespersen, Michael L.; Mirau, Peter A.; Meerwall, Ernst von; Vaia, Richard A.; Rodriguez, Robert; Giannelis, Emmanuel P.

    2010-01-01

    Nanoscale ionic materials (NIMS) are organic - inorganic hybrids in which a core nanostructure is functionalized with a covalently attached corona and an ionically tethered organic canopy. NIMS are engineered to be liquids under ambient conditions in the absence of solvent and are of interest for a variety of applications. We have used nuclear magnetic resonance (NMR) relaxation and pulse-field gradient (PFG) diffusion experiments to measure the canopy dynamics of NIMS prepared from 18-nm silica cores modified by an alkylsilane monolayer possessing terminal sulfonic acid functionality, paired with an amine-terminated ethylene oxide/propylene oxide block copolymer canopy. Carbon NMR studies show that the block copolymer canopy is mobile both in the bulk and in the NIMS and that the fast (ns) dynamics are insensitive to the presence of the silica nanoparticles. Canopy diffusion in the NIMS is slowed relative to the neat canopy, but not to the degree predicted from the diffusion of hard-sphere particles. Canopy diffusion is not restricted to the surface of the nanoparticles and shows unexpected behavior upon addition of excess canopy. Taken together, these data indicate that the liquid-like behavior in NIMS is due to rapid exchange of the block copolymer canopy between the ionically modified nanoparticles. © 2010 American Chemical Society.

  4. Understanding SO2 Capture by Ionic Liquids.

    Science.gov (United States)

    Mondal, Anirban; Balasubramanian, Sundaram

    2016-05-19

    Ionic liquids have generated interest for efficient SO2 absorption due to their low vapor pressure and versatility. In this work, a systematic investigation of the structure, thermodynamics, and dynamics of SO2 absorption by ionic liquids has been carried out through quantum chemical calculations and molecular dynamics (MD) simulations. MP2 level calculations of several ion pairs complexed with SO2 reveal its preferential interaction with the anion. Results of condensed phase MD simulations of SO2-IL mixtures manifested the essential role of both cations and anions in the solvation of SO2, where the solute is surrounded by the "cage" formed by the cations (primarily its alkyl tail) through dispersion interactions. These structural effects of gas absorption are substantiated by calculated Gibbs free energy of solvation; the dissolution is demonstrated to be enthalpy driven. The entropic loss of SO2 absorption in ionic liquids with a larger anion such as [NTf2](-) has been quantified and has been attributed to the conformational restriction of the anion imposed by its interaction with SO2. SO2 loading IL decreases its shear viscosity and enhances the electrical conductivity. This systematic study provides a molecular level understanding which can aid the design of task-specific ILs as electrolytes for efficient SO2 absorption.

  5. Clinical trial of non-ionic contrast media -comparison of efficacy and safety between non-ionic iopromide (Ultravist) and ionic contrast media-

    International Nuclear Information System (INIS)

    Lee, Ghi Jai; Kim, Seung Hyup; Park, Jae Hyung; Chang, Kee Hyun; Han, Man Chung; Kim, Chu Wan

    1988-01-01

    Non-ionic contrast media, iopromide (Ultravist) was compared with ioxitalamate (Telebrix) and/or ioxaglate (Hexabrix) for efficacy and safety in 203 patients undergoing cardiac angiography, neurovascular angiography, peripheral and visceral angiography and intravenous pyelography. In all patients, adverse symptoms and signs including heat sense, pain, nausea, vomiting, etc. were checked during and after the injection. In addition, EKG and LV pressure were monitored during the cardiac angiography. And also CBC, UA, BUN and creatinine were checked before and 24 hours after the cardiac angiography. Serious adverse effect did not occur in any case. Minor effects, such as nausea and abdominal pain, were less frequently caused by non-ionic contrast media than by ionic contrast media, especially in cardiac angiography and intravenous pyelography. There was no significant difference between ionic and non-ionic contrast media in regard to electrophysiologic parameters such as EKG and LV pressure. In case of intravenous pyelography, nonionic contrast media seemed to be superior to ionic contrast media in image quality. It is suggested that, in spite of higher cost, non-ionic contrast media be needed for the safety and image quality, particularly in those patients at high risk of adverse effects by ionic contrast media

  6. Scanning thermo-ionic microscopy for probing local electrochemistry at the nanoscale

    Energy Technology Data Exchange (ETDEWEB)

    Eshghinejad, Ahmadreza; Nasr Esfahani, Ehsan; Wang, Peiqi; Li, Jiangyu, E-mail: jjli@uw.edu [Department of Mechanical Engineering, University of Washington, Seattle, Washington 98195 (United States); Xie, Shuhong [Key Laboratory of Low Dimensional Materials and Application Technology of Ministry of Education, School of Materials Science and Engineering, Xiangtan University, Xiangtan 411105, Hunan (China); Shenzhen Key Laboratory of Nanobiomechanics, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, Guangdong (China); Geary, Timothy C.; Adler, Stuart B. [Department of Chemical Engineering, University of Washington, Seattle, Washington 98195 (United States)

    2016-05-28

    Conventional electrochemical characterization techniques based on voltage and current measurements only probe faradaic and capacitive rates in aggregate. In this work we develop a scanning thermo-ionic microscopy (STIM) to probe local electrochemistry at the nanoscale, based on imaging of Vegard strain induced by thermal oscillation. It is demonstrated from both theoretical analysis and experimental validation that the second harmonic response of thermally induced cantilever vibration, associated with thermal expansion, is present in all solids, whereas the fourth harmonic response, caused by local transport of mobile species, is only present in ionic materials. The origin of STIM response is further confirmed by its reduced amplitude with respect to increased contact force, due to the coupling of stress to concentration of ionic species and/or electronic defects. The technique has been applied to probe Sm-doped Ceria and LiFePO{sub 4}, both of which exhibit higher concentrations of mobile species near grain boundaries. The STIM gives us a powerful method to study local electrochemistry with high sensitivity and spatial resolution for a wide range of ionic systems, as well as ability to map local thermomechanical response.

  7. Measurement and Correlation of the Ionic Conductivity of Ionic Liquid-Molecular Solvent Solutions

    Institute of Scientific and Technical Information of China (English)

    LI,Wen-Jing; HAN,Bu-Xing; TAO,Ran-Ting; ZHANG,Zhao-Fu; ZHANG,Jian-Ling

    2007-01-01

    The ionic conductivity of the solutions formed from 1-n-butyl-3-methylimidazolium tetrafluoroborate ([Bmim][BF4]) or 1-n-butyl-3-methylimidazolium hexafluorophosphate ([Bmim][PF6]) and different molecular solvents (MSs) were measured at 298.15 K. The molar conductivity of the ionic liquids (ILs) increased dramatically with increasing concentration of the MSs. It was found that the molar conductivity of the IL in the solutions studied in this work could be well correlated by the molar conductivity of the neat ILs and the dielectric constant and molar volume of the MSs.

  8. Significant Improvement of Catalytic Efficiencies in Ionic Liquids

    International Nuclear Information System (INIS)

    Song, Choong Eui; Yoon, Mi Young; Choi, Doo Seong

    2005-01-01

    The use of ionic liquids as reaction media can confer many advantages upon catalytic reactions over reactions in organic solvents. In ionic liquids, catalysts having polar or ionic character can easily be immobilized without additional structural modification and thus the ionic solutions containing the catalyst can easily be separated from the reagents and reaction products, and then, be reused. More interestingly, switching from an organic solvent to an ionic liquid often results in a significant improvement in catalytic performance (e.g., rate acceleration, (enantio)selectivity improvement and an increase in catalyst stability). In this review, some recent interesting results which can nicely demonstrate these positive 'ionic liquid effect' on catalysis are discussed

  9. Ionic liquids in proton exchange membrane fuel cells: Efficient systems for energy generation

    Energy Technology Data Exchange (ETDEWEB)

    Padilha, Janine C.; Basso, Juliana; da Trindade, Leticia G.; Martini, Emilse M.A.; de Souza, Michele O.; de Souza, Roberto F. [Institute of Chemistry, UFRGS, Av. Bento Goncalves 9500, Porto Alegre 91501-970, P.O. Box 15003 (Brazil)

    2010-10-01

    Proton exchange membrane fuel cells (PEMFCs) are used in portable devices to generate electrical energy; however, the efficiency of the PEMFC is currently only 40%. This study demonstrates that the efficiency of a PEMFC can be increased to 61% when 1-butyl-3-methylimidazolium tetrafluoroborate (BMI.BF{sub 4}) ionic liquid (IL) is used together with the membrane electrode assembly (MEA). The results for ionic liquids (ILs) 1-butyl-3-methylimidazolium chloride (BMI.Cl) and 1-butyl-3-methylimidazolium tetrafluoroborate (BMI.BF{sub 4}) in aqueous solutions are better than those obtained with pure water. The current and the power densities with IL are at least 50 times higher than those obtained for the PEMFC wetted with pure water. This increase in PEMFC performance can greatly facilitate the use of renewable energy sources. (author)

  10. Charge transfer in ionic systems

    International Nuclear Information System (INIS)

    Bacchus-Montabonel, M.C.; Tergiman, Y.S.; Vaeck, N.; Baloitcha, E.; Desouter-Lecomte, M.

    2002-01-01

    Charge transfer involving multiply charged ions in collision with atomic or molecular targets are determinant processes in controlled thermonuclear fusion research and astrophysical plasma. In such processes, an electron is generally captured in a excited state of the ion, followed by line emission. The observation of line intensities provides important information on the electron temperature, density and spacial distributions in the emitting region of the plasma. From a theoretical point of view, different approaches may be used with regard to the collisional energy range of the process. A semi-classical method is currently used at keV energies, but the description of very low-velocity processes requires a complete quantum mechanical treatment of the dynamics of both electrons and nuclei. The first approach extensively used is the resolution of the stationary close-coupling equations, but we have analyzed recently the efficiency of a time-dependent wave packet method which provides a clear and physical insight into the dynamics of the processes and may be particularly interesting for polyatomic systems since it allows the possibility of developing a fully quantal mechanical treatment for some degrees of freedom, the other ones being treated classically. The keV energy range treatment is presented on two examples pointing out the case of complex ion-atom collision systems, as well as the differences between ion-atom and ion-molecule mechanisms. In connection with translation energy spectroscopy experiments of McLaughlin et al in the 4-28 keV impact energy range, we present a complete ab-initio theoretical approach of the N 4+ (2s) 2 S + He system taking into account both single and double electron capture channels. This is an extremely complex collisional system which involves numerous channels with short range interactions and a very intricate interaction region may be observed for interatomic distances around R = 3.5 a.u.. In agreement with experimental data, the

  11. Potentiostat for Characterizing Microstructures at Ionic Liquid/Electrode Interfaces

    Science.gov (United States)

    2015-10-10

    reviewed journals (N/A for none) C. Zibart, D. Parr, B. Egan, H. Morris, A. Tivanski, L. M. Haverhals, “Investigation of Structure at Gold- Ionic Liquid ...into our electrochemistry program. In short, the instrument has been of great service to characterize ionic liquid -based (IL-based) electrolyte...Aug-2014 14-Nov-2014 Approved for Public Release; Distribution Unlimited Final Report: Potentiostat for Characterizing Microstructures at Ionic Liquid

  12. Ionic Liquids in Polymer Design: From Energy to Health

    Science.gov (United States)

    2016-10-19

    of Papers published in non peer- reviewed journals: Final Report: Ionic Liquids in Polymer Design: From Energy to Health Report Title ACS Symposium...SECURITY CLASSIFICATION OF: ACS Symposium: Ionic Liquids in Polymer Design: From Energy to Health at Fall 2015 ACS Meeting in Boston, MA The...combination of ionic liquids and polymers has emerged as an active field of exploration in polymer science, where new materials have be realized for

  13. Ion Transport in Nanostructured Block Copolymer/Ionic Liquid Membranes

    OpenAIRE

    Hoarfrost, Megan Lane

    2012-01-01

    Incorporating an ionic liquid into one block copolymer microphase provides a platform for combining the outstanding electrochemical properties of ionic liquids with a number of favorable attributes provided by block copolymers. In particular, block copolymers thermodynamically self-assemble into well-ordered nanostructures, which can be engineered to provide a durable mechanical scaffold and template the ionic liquid into continuous ion-conducting nanochannels. Understanding how the additio...

  14. Aerobic, catalytic oxidation of alcohols in ionic liquids

    Directory of Open Access Journals (Sweden)

    Souza Roberto F. de

    2006-01-01

    Full Text Available An efficient and simple catalytic system based on RuCl3 dissolved in ionic liquids has been developed for the oxidation of alcohols into aldehydes and ketones under mild conditions. A new fluorinated ionic liquid, 1-n-butyl-3-methylimidazolium pentadecafluorooctanoate, was synthesized and demonstrated better performance that the other ionic liquids employed. Moreover this catalytic system utilizes molecular oxygen as an oxidizing agent, producing water as the only by-product.

  15. Energy Efficient Electrochromic Windows Incorporating Ionic Liquids

    Energy Technology Data Exchange (ETDEWEB)

    Cheri Boykin; James Finley; Donald Anthony; Julianna Knowles; Richard Markovic; Michael Buchanan; Mary Ann Fuhry; Lisa Perrine

    2008-11-30

    One approach to increasing the energy efficiency of windows is to control the amount of solar radiation transmitted through a window by using electrochromic technology. What is unique about this project is that the electrochromic is based on the reduction/oxidation reactions of cathodic and anodic organic semi-conducting polymers using room temperature ionic liquids as ion transport electrolytes. It is believed that these types of coatings would be a lower cost alternative to traditional all inorganic thin film based electrochromic technologies. Although there are patents1 based on the proposed technology, it has never been reduced to practice and thoroughly evaluated (i.e. durability and performance) in a window application. We demonstrate that by using organic semi-conductive polymers, specific bands of the solar spectrum (specifically visible and near infrared) can be targeted for electrochemical variable transmittance responsiveness. In addition, when the technology is incorporated into an insulating glass unit, the energy parameters such as the solar heat gain coefficient and the light to solar gain ratio are improved over that of a typical insulating glass unit comprised of glass with a low emissivity coating. A minimum of {approx}0.02 quads of energy savings per year with a reduction of carbon emissions for electricity of {approx}320 MKg/yr benefit is achieved over that of a typical insulating glass unit including a double silver low-E coating. Note that these values include a penalty in the heating season. If this penalty is removed (i.e. in southern climates or commercial structures where cooling is predominate year-round) a maximum energy savings of {approx}0.05 quad per year and {approx}801 MKg/yr can be achieved over that of a typical insulating glass unit including a double silver low-E coating. In its current state, the technology is not durable enough for an exterior window application. The primary downfall is that the redox chemistry fails to

  16. Phencyclidine block of calcium current in isolated guinea-pig hippocampal neurones.

    Science.gov (United States)

    Ffrench-Mullen, J M; Rogawski, M A

    1992-10-01

    1. Phencyclidine (PCP) block of Ca2+ channel current in enzymatically dissociated neurones from the CA1 region of the adult guinea-pig hippocampus was studied using whole-cell voltage clamp techniques. Ca2+ channel current was recorded with 3 mM-Ba2+ as the charge carrier. Na+ currents were blocked with tetrodotoxin and K+ currents were eliminated by using tetraethylammonium and N-methyl-D-glucamine as the predominant extracellular and intracellular cations, respectively. 2. Peak Ca2+ channel current evoked by depolarization from -80 to -10 mV was reduced in a use-dependent fashion by PCP. The apparent forward and reverse rate constants for block at the depolarized voltage were 10(6) s-1 M-1 and 11-14 s-1, respectively. These values were at least 60 times faster than the corresponding rates at the resting voltage. The steady-state block produced by PCP increased in a concentration-dependent fashion with an IC50 of 7 microM. Other dissociative anaesthetic drugs were substantially weaker inhibitors of the current (tiletamine > dizocilpine (MK-801) > ketamine). 3. The Ca2+ channel current recorded under identical conditions in rat dorsal root ganglion neurones was less sensitive to blockade by PCP (IC50, 90 microM). 4. PCP block of the hippocampal Ca2+ channel current occurred in a voltage-dependent fashion with the fractional block decreasing at positive membrane potentials. Analysis indicated that the PCP blocking site senses 56% of the transmembrane electric field. 5. Analysis of tail currents recorded at -80 mV demonstrated that PCP does not affect the voltage-dependent or time-dependent activation or deactivation of the Ca2+ channel current. 6. The rate and extent of inactivation of the Ca2+ channel current was maximal at -10 mV and diminished at more positive potentials. Experiments with Ba(2+)-free external solution demonstrated that inactivation of the Ca2+ channels is largely voltage-dependent and is not affected by Ba2+ influx. 7. PCP markedly increased the

  17. Use of ionic liquids as coordination ligands for organometallic catalysts

    Science.gov (United States)

    Li, Zaiwei [Moreno Valley, CA; Tang, Yongchun [Walnut, CA; Cheng,; Jihong, [Arcadia, CA

    2009-11-10

    Aspects of the present invention relate to compositions and methods for the use of ionic liquids with dissolved metal compounds as catalysts for a variety of chemical reactions. Ionic liquids are salts that generally are liquids at room temperature, and are capable of dissolving a many types of compounds that are relatively insoluble in aqueous or organic solvent systems. Specifically, ionic liquids may dissolve metal compounds to produce homogeneous and heterogeneous organometallic catalysts. One industrially-important chemical reaction that may be catalyzed by metal-containing ionic liquid catalysts is the conversion of methane to methanol.

  18. Lipid extraction from microalgae using a single ionic liquid

    Science.gov (United States)

    Salvo, Roberto Di; Reich, Alton; Dykes, Jr., H. Waite H.; Teixeira, Rodrigo

    2013-05-28

    A one-step process for the lysis of microalgae cell walls and separation of the cellular lipids for use in biofuel production by utilizing a hydrophilic ionic liquid, 1-butyl-3-methylimidazolium. The hydrophilic ionic liquid both lyses the microalgae cell walls and forms two immiscible layers, one of which consists of the lipid contents of the lysed cells. After mixture of the hydrophilic ionic liquid with a suspension of microalgae cells, gravity causes a hydrophobic lipid phase to move to a top phase where it is removed from the mixture and purified. The hydrophilic ionic liquid is recycled to lyse new microalgae suspensions.

  19. Ionic Liquids in HPLC and CE: A Hope for Future.

    Science.gov (United States)

    Ali, Imran; Suhail, Mohd; Sanagi, Mohd Marsin; Aboul-Enein, Hassan Y

    2017-07-04

    The ionic liquids (ILs) are salts with melting points below 100°C. These are called as ionic fluids, ionic melts, liquid electrolytes, fused salts, liquid salts, ionic glasses, designer solvents, green solvents and solvents of the future. These have a wide range of applications, including medical, pharmaceutical and chemical sciences. Nowadays, their use is increasing greatly in separation science, especially in chromatography and capillary electrophoresis due to their remarkable properties. The present article describes the importance of ILs in high-performance liquid chromatography and capillary electrophoresis. Efforts were also made to highlight the future expectations of ILs.

  20. Recent developments in biocatalysis in multiphasic ionic liquid reaction systems.

    Science.gov (United States)

    Meyer, Lars-Erik; von Langermann, Jan; Kragl, Udo

    2018-06-01

    Ionic liquids are well known and frequently used 'designer solvents' for biocatalytic reactions. This review highlights recent achievements in the field of multiphasic ionic liquid-based reaction concepts. It covers classical biphasic systems including supported ionic liquid phases, thermo-regulated multi-component solvent systems (TMS) and polymerized ionic liquids. These powerful concepts combine unique reaction conditions with a high potential for future applications on a laboratory and industrial scale. The presence of a multiphasic system simplifies downstream processing due to the distribution of the catalyst and reactants in different phases.

  1. Are Ionic Liquids Good Boundary Lubricants? A Molecular Perspective

    Directory of Open Access Journals (Sweden)

    Romain Lhermerout

    2018-01-01

    Full Text Available The application of ionic liquids as lubricants has attracted substantial interest over the past decade and this has produced a rich literature. The aim of this review is to summarize the main findings about frictional behavior of ionic liquids in the boundary lubrication regime. We first recall why the unusual properties of ionic liquids make them very promising lubricants, and the molecular mechanisms at the origin of their lubricating behavior. We then point out the main challenges to be overcome in order to optimise ionic liquid lubricant performance for common applications. We finally discuss their use in the context of electroactive lubrication.

  2. Ionic liquids used in extraction and separation of metal ions

    International Nuclear Information System (INIS)

    Shen Xinghai; Xu Chao; Liu Xinqi; Chu Taiwei

    2006-01-01

    Ionic liquids as green solvents now have become a research hotspot in the field of separation of metal ions by solvent extraction. Experimental results of extraction of various metal ions with ionic liquids as solvents, including that of alkali metals, alkaline earths, transition metals rare earths and actinides are introduced. The extraction of uranium, plutonium and fission products that are involved in spent nuclear fuel reprocessing is also reviewed. The possible extraction mechanisms are discussed. Finally, the prospect of replacement of volatile and/or toxic organic solvents with environmentally benign ionic liquids for solvent extraction and the potency of applications of ionic liquids in solvent extraction are also commented. (authors)

  3. Ionic liquid and nanoparticle hybrid systems: Emerging applications.

    Science.gov (United States)

    He, Zhiqi; Alexandridis, Paschalis

    2017-06-01

    Having novel electronic and optical properties that emanate from their nano-scale dimensions, nanoparticles are central to numerous applications. Ionic liquids can confer to nanoparticle chemical protection and physicochemical property enhancement through intermolecular interactions and can consequently improve the stability and reusability of nanoparticle for various operations. With an aim to combine the novel properties of nanoparticles and ionic liquids, different structures have been generated, based on a balance of several intermolecular interactions. Such ionic liquid and nanoparticle hybrids are showing great potential in diverse applications. In this review, we first introduce various types of ionic liquid and nanoparticle hybrids, including nanoparticle colloidal dispersions in ionic liquids, ionic liquid-grafted nanoparticles, and nanoparticle-stabilized ionic liquid-based emulsions. Such hybrid materials exhibit interesting synergisms. We then highlight representative applications of ionic liquid and nanoparticle hybrids in the catalysis, electrochemistry and separations fields. Such hybrids can attain better stability and higher efficiency under a broad range of conditions. Novel and enhanced performance can be achieved in these applications by combining desired properties of ionic liquids and of nanoparticles within an appropriate hybrid nanostructure. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Ionic liquid electrolytes for dye-sensitized solar cells.

    Science.gov (United States)

    Gorlov, Mikhail; Kloo, Lars

    2008-05-28

    The potential of room-temperature molten salts (ionic liquids) as solvents for electrolytes for dye-sensitized solar cells has been investigated during the last decade. The non-volatility, good solvent properties and high electrochemical stability of ionic liquids make them attractive solvents in contrast to volatile organic solvents. Despite this, the relatively high viscosity of ionic liquids leads to mass-transport limitations. Here we review recent developments in the application of different ionic liquids as solvents or components of liquid and quasi-solid electrolytes for dye-sensitized solar cells.

  5. Predictions of Physicochemical Properties of Ionic Liquids with DFT

    Directory of Open Access Journals (Sweden)

    Karl Karu

    2016-07-01

    Full Text Available Nowadays, density functional theory (DFT-based high-throughput computational approach is becoming more efficient and, thus, attractive for finding advanced materials for electrochemical applications. In this work, we illustrate how theoretical models, computational methods, and informatics techniques can be put together to form a simple DFT-based throughput computational workflow for predicting physicochemical properties of room-temperature ionic liquids. The developed workflow has been used for screening a set of 48 ionic pairs and for analyzing the gathered data. The predicted relative electrochemical stabilities, ionic charges and dynamic properties of the investigated ionic liquids are discussed in the light of their potential practical applications.

  6. Method for enhancing the thermal stability of ionic compounds

    DEFF Research Database (Denmark)

    2013-01-01

    This invention relates to a method for enhancing the thermal stability of ionic compounds including ionic liquids, by immobilization on porous solid support materials having a pore diameter of between about 20-200 AA, wherein the solid support does not have a pore size of 90 AA.......This invention relates to a method for enhancing the thermal stability of ionic compounds including ionic liquids, by immobilization on porous solid support materials having a pore diameter of between about 20-200 AA, wherein the solid support does not have a pore size of 90 AA....

  7. Improved Ionic Liquids as Space Lubricants, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Ionic liquids are candidate lubricant materials. However for application in low temperature space mechanisms their lubrication performance needs to be enhanced. UES...

  8. Multistep Current Signal in Protein Translocation through Graphene Nanopores

    KAUST Repository

    Bonome, Emma Letizia

    2015-05-07

    © 2015 American Chemical Society. In nanopore sensing experiments, the properties of molecules are probed by the variation of ionic currents flowing through the nanopore. In this context, the electronic properties and the single-layer thickness of graphene constitute a major advantage for molecule characterization. Here we analyze the translocation pathway of the thioredoxin protein across a graphene nanopore, and the related ionic currents, by integrating two nonequilibrium molecular dynamics methods with a bioinformatic structural analysis. To obtain a qualitative picture of the translocation process and to identify salient features we performed unsupervised structural clustering on translocation conformations. This allowed us to identify some specific and robust translocation intermediates, characterized by significantly different ionic current flows. We found that the ion current strictly anticorrelates with the amount of pore occupancy by thioredoxin residues, providing a putative explanation of the multilevel current scenario observed in recently published translocation experiments.

  9. Ionic dependence of sulphur mustard cytotoxicity

    International Nuclear Information System (INIS)

    Sawyer, Thomas W.; Nelson, Peggy; Bjarnason, Stephen; Vair, Cory; Shei Yimin; Tenn, Catherine; Lecavalier, Pierre; Burczyk, Andrew

    2010-01-01

    The effect of ionic environment on sulphur mustard (bis 2-chloroethyl sulphide; HD) toxicity was examined in CHO-K1 cells. Cultures were treated with HD in different ionic environments at constant osmolar conditions (320 mOsM, pH 7.4). The cultures were refed with fresh culture medium 1 h after HD exposure, and viability was assessed. Little toxicity was apparent when HD exposures were carried out in ion-free sucrose buffer compared to LC 50 values of ∼ 100-150 μM when the cultures were treated with HD in culture medium. Addition of NaCl to the buffer increased HD toxicity in a salt concentration-dependent manner to values similar to those obtained in culture medium. HD toxicity was dependent on both cationic and anionic species with anionic environment playing a much larger role in determining toxicity. Substitution of NaI for NaCl in the treatment buffers increased HD toxicity by over 1000%. The activity of the sodium hydrogen exchanger (NHE) in recovering from cytosolic acidification in salt-free and in different chloride salts did not correlate with the HD-induced toxicity in these buffers. However, the inhibition by HD of intracellular pH regulation correlated with its toxicity in NaCl, NaI and sucrose buffers. Analytical chemical studies and the toxicity of the iodine mustard derivative ruled out the role of chemical reactions yielding differentially toxic species as being responsible for the differences in HD toxicity observed. This work demonstrates that the early events that HD sets into motion to cause toxicity are dependent on ionic environment, possibly due to intracellular pH deregulation.

  10. Computer simulation on molten ionic salts

    International Nuclear Information System (INIS)

    Kawamura, K.; Okada, I.

    1978-01-01

    The extensive advances in computer technology have since made it possible to apply computer simulation to the evaluation of the macroscopic and microscopic properties of molten salts. The evaluation of the potential energy in molten salts systems is complicated by the presence of long-range energy, i.e. Coulomb energy, in contrast to simple liquids where the potential energy is easily evaluated. It has been shown, however, that no difficulties are encountered when the Ewald method is applied to the evaluation of Coulomb energy. After a number of attempts had been made to approximate the pair potential, the Huggins-Mayer potential based on ionic crystals became the most often employed. Since it is thought that the only appreciable contribution to many-body potential, not included in Huggins-Mayer potential, arises from the internal electrostatic polarization of ions in molten ionic salts, computer simulation with a provision for ion polarization has been tried recently. The computations, which are employed mainly for molten alkali halides, can provide: (1) thermodynamic data such as internal energy, internal pressure and isothermal compressibility; (2) microscopic configurational data such as radial distribution functions; (3) transport data such as the diffusion coefficient and electrical conductivity; and (4) spectroscopic data such as the intensity of inelastic scattering and the stretching frequency of simple molecules. The computed results seem to agree well with the measured results. Computer simulation can also be used to test the effectiveness of a proposed pair potential and the adequacy of postulated models of molten salts, and to obtain experimentally inaccessible data. A further application of MD computation employing the pair potential based on an ionic model to BeF 2 , ZnCl 2 and SiO 2 shows the possibility of quantitative interpretation of structures and glass transformation phenomena

  11. Role of Oxygen in Ionic Liquid Gating on Two-Dimensional Cr2Ge2Te6: A Non-oxide Material.

    Science.gov (United States)

    Chen, Yangyang; Xing, Wenyu; Wang, Xirui; Shen, Bowen; Yuan, Wei; Su, Tang; Ma, Yang; Yao, Yunyan; Zhong, Jiangnan; Yun, Yu; Xie, X C; Jia, Shuang; Han, Wei

    2018-01-10

    Ionic liquid gating can markedly modulate a material's carrier density so as to induce metallization, superconductivity, and quantum phase transitions. One of the main issues is whether the mechanism of ionic liquid gating is an electrostatic field effect or an electrochemical effect, especially for oxide materials. Recent observation of the suppression of the ionic liquid gate-induced metallization in the presence of oxygen for oxide materials suggests the electrochemical effect. However, in more general scenarios, the role of oxygen in the ionic liquid gating effect is still unclear. Here, we perform ionic liquid gating experiments on a non-oxide material: two-dimensional ferromagnetic Cr 2 Ge 2 Te 6 . Our results demonstrate that despite the large increase of the gate leakage current in the presence of oxygen, the oxygen does not affect the ionic liquid gating effect on  the channel resistance of Cr 2 Ge 2 Te 6 devices (ionic liquid gating is more effective on the modulation of the channel resistances compared to the back gating across the 300 nm thick SiO 2 .

  12. Nonlinear polarization of ionic liquids: theory, simulations, experiments

    Science.gov (United States)

    Kornyshev, Alexei

    2010-03-01

    Room temperature ionic liquids (RTILs) composed of large, often asymmetric, organic cations and simple or complex inorganic or organic anions do not freeze at ambient temperatures. Their rediscovery some 15 years ago is widely accepted as a ``green revolution'' in chemistry, offering an unlimited number of ``designer'' solvents for chemical and photochemical reactions, homogeneous catalysis, lubrication, and solvent-free electrolytes for energy generation and storage. As electrolytes they are non-volatile, some can sustain without decomposition up to 6 times higher voltages than aqueous electrolytes, and many are environmentally friendly. The studies of RTILs and their applications have reached a critical stage. So many of them can be synthesized - about a thousand are known already - their mixtures can further provide ``unlimited'' number of combinations! Thus, establishing some general laws that could direct the best choice of a RTIL for a given application became crucial; guidance is expected from theory and modelling. But for a physical theory, RTILs comprise a peculiar and complex class of media, the description of which lies at the frontier line of condensed matter theoretical physics: dense room temperature ionic plasmas with ``super-strong'' Coulomb correlations, which behave like glasses at short time-scale, but like viscous liquids at long-time scale. This talk will introduce RTILs to physicists and overview the current understanding of the nonlinear response of RTILs to electric field. It will focus on the theory, simulations, and experimental characterisation of the structure and nonlinear capacitance of the electrical double layer at a charged electrode. It will also discuss pros and contras of supercapacitor applications of RTILs.

  13. Hot exozodiacal dust resolved around Vega with IOTA/IONIC

    Science.gov (United States)

    Defrère, D.; Absil, O.; Augereau, J.-C.; di Folco, E.; Berger, J.-P.; Coudé du Foresto, V.; Kervella, P.; Le Bouquin, J.-B.; Lebreton, J.; Millan-Gabet, R.; Monnier, J. D.; Olofsson, J.; Traub, W.

    2011-10-01

    Context. Although debris discs have been detected around a significant number of main-sequence stars, only a few of them are known to harbour hot dust in their inner part where terrestrial planets may have formed. Thanks to infrared interferometric observations, it is possible to obtain a direct measurement of these regions, which are of prime importance for preparing future exo-Earth characterisation missions. Aims: We resolve the exozodiacal dust disc around Vega with the help of infrared stellar interferometry and estimate the integrated H-band flux originating from the first few AUs of the debris disc. Methods: Precise H-band interferometric measurements were obtained on Vega with the 3-telescope IOTA/IONIC interferometer (Mount Hopkins, Arizona). Thorough modelling of both interferometric data (squared visibility and closure phase) and spectral energy distribution was performed to constrain the nature of the near-infrared excess emission. Results: Resolved circumstellar emission within ~6 AU from Vega is identified at the 3-σ level. The most straightforward scenario consists in a compact dust disc producing a thermal emission that is largely dominated by small grains located between 0.1 and 0.3 AU from Vega and accounting for 1.23 ± 0.45% of the near-infrared stellar flux for our best-fit model. This flux ratio is shown to vary slightly with the geometry of the model used to fit our interferometric data (variations within ± 0.19%). Conclusions: The presence of hot exozodiacal dust in the vicinity of Vega, initially revealed by K-band CHARA/FLUOR observations, is confirmed by our H-band IOTA/IONIC measurements. Whereas the origin of the dust is still uncertain, its presence and the possible connection with the outer disc suggest that the Vega system is currently undergoing major dynamical perturbations.

  14. Viscosity, Conductivity, and Electrochemical Property of Dicyanamide Ionic Liquids

    Directory of Open Access Journals (Sweden)

    Wen-Li Yuan

    2018-03-01

    Full Text Available The instructive structure-property relationships of ionic liquids (ILs can be put to task-specific design of new functionalized ILs. The dicyanamide (DCA ILs are typical CHN type ILs which are halogen free, chemical stable, low-viscous, and fuel-rich. The transport properties of DCA ionic liquids are significant for their applications as solvents, electrolytes, and hypergolic propellants. This work systematically investigates several important transport properties of four DCA ILs ([C4mim][N(CN2], [C4m2im][N(CN2], N4442[N(CN2], and N8444[N(CN2] including viscosity, conductivity, and electrochemical property at different temperatures. The melting points, temperature-dependent viscosities and conductivities reveal the structure-activity relationship of four DCA ILs. From the Walden plots, the imidazolium cations exhibit stronger cation–anion attraction than the ammonium cations. DCA ILs have relatively high values of electrochemical windows (EWs, which indicates that the DCA ILs are potential candidates for electrolytes in electrochemical applications. The cyclic voltammograms of Eu(III in these DCA ILs at GC working electrode at various temperatures 303–333 K consists of quasi-reversible waves. The electrochemical properties of the DCA ILs are also dominated by the cationic structures. The current intensity (ip, the diffusion coefficients (Do, the charge transfer rate constants (ks of Eu(III in DCA ILs all increased with the molar conductivities increased. The cationic structure-transport property relationships of DCA ILs were constructed for designing novel functionalized ILs to fulfill specific demands.

  15. Ionic nitriding of high chromium martensitic stainless steels

    International Nuclear Information System (INIS)

    Bruhl, S.P; Charadia, R; Vaca, L.S; Cimetta, J

    2008-01-01

    Martensitic stainless steels are used in industrial applications where resistance to corrosion and mechanical resistance are needed simultaneously. These steels are normally used in tempering and annealing condition which gives them hardnesses of 500 and 600 HV (about 54 HRC). Ionic nitriding is an assisted diffusion technique that has recently been successfully applied to harden austenitic stainless steels without reducing their resistance to corrosion. The application with AISI 420 martensitic steels has not given good results yet, because in most cases, it affects their corrosion resistance. This work presents the results of the pulsed nitriding of martensitic steels with a higher chrome content, such as the M340 and M333 Boehler steels and they are compared with the same materials after tempering and annealing, without nitriding. The influence of the variations in the parameters of the process, such as the percentage of active time in the pulsed wave, partial nitrogen pressure, current density and effective tension in the microstructure, hardness and wear and corrosion resistance was studied. The microstructure was studied with an optic microscope; the wear resistance with abrasion tests following ASTM G-65 and corrosion with 100 hour long saline haze tests, in a device built according to ASTM B117. Hardness was found to rise to values of 1000 to 1350 HV in all the steels after ionic nitriding, the modified layers oscillated from 3 to 15 microns. As a result, wear resistance also increased, with differences depending on the microstructure and the thickness of the modified layer. However, corrosion resistance was not good, except in the case of the M333 steel test piece with less hardness and a less thick nitrided layer without a noticeable interphase (au)

  16. Improved ionic conductivity of lithium-zinc-tellurite glass-ceramic electrolytes

    Science.gov (United States)

    Widanarto, W.; Ramdhan, A. M.; Ghoshal, S. K.; Effendi, M.; Cahyanto, W. T.; Warsito

    An enhancement in the secondary battery safety demands the optimum synthesis of glass-ceramics electrolytes with modified ionic conductivity. To achieve improved ionic conductivity and safer operation of the battery, we synthesized Li2O included zinc-tellurite glass-ceramics based electrolytes of chemical composition (85-x)TeO2·xLi2O·15ZnO, where x = 0, 5, 10, 15 mol%. Samples were prepared using the melt quenching method at 800 °C followed by thermal annealing at 320 °C for 3 h and characterized. The effects of varying temperature, alternating current (AC) frequency and Li2O concentration on the structure and ionic conductivity of such glass-ceramics were determined. The SEM images of the annealed glass-ceramic electrolytes displayed rough surface with a uniform distribution of nucleated crystal flakes with sizes less than 1 μm. X-ray diffraction analysis confirmed the well crystalline nature of achieved electrolytes. Incorporation of Li2O in the electrolytes was found to generate some new crystalline phases including hexagonal Li6(TeO6), monoclinic Zn2Te3O8 and monoclinic Li2Te2O5. The estimated crystallite size of the electrolyte was ranged from ≈40 to 80 nm. AC impedance measurement revealed that the variation in the temperatures, Li2O contents, and high AC frequencies have a significant influence on the ionic conductivity of the electrolytes. Furthermore, electrolyte doped with 15 mol% of Li2O exhibited the optimum performance with an ionic conductivity ≈2.4 × 10-7 S cm-1 at the frequency of 54 Hz and in the temperature range of 323-473 K. This enhancement in the conductivity was attributed to the sizable alteration in the ions vibration and ruptures of covalent bonds in the electrolytes network structures.

  17. Notre Dame Geothermal Ionic Liquids Research: Ionic Liquids for Utilization of Geothermal Energy

    Energy Technology Data Exchange (ETDEWEB)

    Brennecke, Joan F. [Univ. of Notre Dame, IN (United States)

    2017-03-07

    The goal of this project was to develop ionic liquids for two geothermal energy related applications. The first goal was to design ionic liquids as high temperature heat transfer fluids. We identified appropriate compounds based on both experiments and molecular simulations. We synthesized the new ILs, and measured their thermal stability, measured storage density, viscosity, and thermal conductivity. We found that the most promising compounds for this application are aminopyridinium bis(trifluoromethylsulfonyl)imide based ILs. We also performed some measurements of thermal stability of IL mixtures and used molecular simulations to better understand the thermal conductivity of nanofluids (i.e., mixtures of ILs and nanoparticles). We found that the mixtures do not follow ideal mixture theories and that the addition of nanoparticles to ILs may well have a beneficial influence on the thermal and transport properties of IL-based heat transfer fluids. The second goal was to use ionic liquids in geothermally driven absorption refrigeration systems. We performed copious thermodynamic measurements and modeling of ionic liquid/water systems, including modeling of the absorption refrigeration systems and the resulting coefficients of performance. We explored some IL/organic solvent mixtures as candidates for this application, both with experimentation and molecular simulations. We found that the COPs of all of the IL/water systems were higher than the conventional system – LiBr/H2O. Thus, IL/water systems appear very attractive for absorption refrigeration applications.

  18. New Pyrazolium Salts as a Support for Ionic Liquid Crystals and Ionic Conductors.

    Science.gov (United States)

    Pastor, María Jesús; Sánchez, Ignacio; Campo, José A; Schmidt, Rainer; Cano, Mercedes

    2018-04-03

    Ionic liquid crystals (ILCs) are a class of materials that combine the properties of liquid crystals (LCs) and ionic liquids (ILs). This type of materials is directed towards properties such as conductivity in ordered systems at different temperatures. In this work, we synthesize five new families of ILCs containing symmetrical and unsymmetrical substituted pyrazolium cations, with different alkyl long-chains, and anions such as Cl - , BF₄ - , ReO₄ - , p -CH₃-₆H₄SO₃ - (PTS) and CF₃SO₃ - (OTf). We study their thermal behavior by polarized light optical microscopy (POM) and differential scanning calorimetry (DSC). All of them, except those with OTf as counteranion, show thermotropic mesomorphism. The observations by POM reveal textures of lamellar mesophases. Those agree with the arrangement observed in the X-ray crystal structure of [H₂pz R(4),R(4) ][ReO₄]. The nature of the mesophases is also confirmed by variable temperature powder X-ray diffraction. On the other hand, the study of the dielectric properties at variable temperature in mesomorphic (Cl - and BF₄ - ) and non-mesomorphic (OTf) salts indicates that the supramolecular arrangement of the mesophase favors a greater ionic mobility and therefore ionic conductivity.

  19. Toward protic ionic liquid and organic ionic plastic crystal electrolytes for fuel cells

    International Nuclear Information System (INIS)

    Rana, Usman Ali; Forsyth, Maria; MacFarlane, Douglas R.; Pringle, Jennifer M.

    2012-01-01

    Highlights: ► Polymer electrolyte membrane fuel cells that can operate above 120 °C, without humidification, would be much more commercially viable. ► Protic ionic liquids and organic ionic plastic crystals are showing increasing promise as anhydrous proton conductors in fuel cells. ► Here we review the recent progress in these two areas. - Abstract: There is increasing demand for the development of anhydrous proton conducting electrolytes, most notably to allow the development of fuel cells that can operate at temperatures above 120 °C, without the need for constant and controlled humidification. The emerging field of protic ionic liquids (PILs) represents a promising new direction for this research and the development of these materials has made significant progress in recent years. In a related but as yet little-explored avenue, proton conducting organic ionic plastic crystals offer the potential advantage of providing a solid state matrix for anhydrous proton conductivity. Here we discuss the recent progress in these areas and identify the key challenges for future research.

  20. Theoretical and Experimental Study of the Friction Behavior of Halogen-Free Ionic Liquids in Elastohydrodynamic Regime

    Directory of Open Access Journals (Sweden)

    Karthik Janardhanan

    2016-05-01

    Full Text Available Ionic Liquids have emerged as effective lubricants and additives to lubricants, in the last decade. Halogen-free ionic liquids have recently been considered as more environmentally stable than their halogenated counterparts, which tend to form highly toxic and corrosive acids when exposed to moisture. Most of the studies using ionic liquids as lubricants or additives of lubricants have been done experimentally. Due to the complex nature of the lubrication mechanism of these ordered fluids, the development of a theoretical model that predicts the ionic liquid lubrication ability is currently one of the biggest challenges in tribology. In this study, a suitable and existing friction model to describe lubricating ability of ionic liquids in the elastohydrodynamic lubrication regime is identified and compared to experimental results. Two phosphonium-based, halogen-free ionic liquids are studied as additives to a Polyalphaolefin base oil in steel–steel contacts using a ball-on-flat reciprocating tribometer. Experimental conditions (speed, load and roughness are selected to ensure that operations are carried out in the elastohydrodynamic regime. Wear volume was also calculated for tests at high speed. A good agreement was found between the model and the experimental results when [THTDP][Phos] was used as an additive to the base oil, but some divergence was noticed when [THTDP][DCN] was added, particularly at the highest speed studied. A significant decrease in the steel disks wear volume is observed when 2.5 wt. % of the two ionic liquids were added to the base lubricant.

  1. Simulations of phase transitions in ionic systems

    International Nuclear Information System (INIS)

    Panagiotopoulos, A Z

    2005-01-01

    A review of recent simulation work in the area of phase transitions in ionic systems is presented. The vapour-liquid transition for the restricted primitive model has been studied extensively in the past decade. The critical temperature is now known to excellent accuracy and the critical density to moderate accuracy. There is also strong simulation-based evidence that the model is in the Ising universality class. Discretized lattice versions of the model are reviewed. Other systems covered are size- and charge-asymmetric electrolytes, colloid-salt mixtures, realistic salt models and charged chains. Areas of future research needs are briefly discussed

  2. Isotope separation by ionic cyclotron resonance

    International Nuclear Information System (INIS)

    Compant La Fontaine, A.; Gil, C.; Louvet, P.

    1986-10-01

    The principle of the process of isotopic separation by ionic cyclotron resonance is explained succinctly. The theoretical calculation of the isotopic effect is given as functions of the electric and magnetic fields in the frame of single particle approximation and of plasma collective theory. Then, the main parts of the demonstration device which is in operation at the CEA, are described here: the supraconducting magnetic field, the used diagnostics, the principle of the source and the collecting apparatus. Some experimental results are given for chromium. The application of the process to ponderal separation of metal isotopes, as chromium, nickel and molybdenum is discussed in view of production of medical, structural and irradiation isotopes

  3. Pycnonuclear reaction rates for binary ionic mixtures

    Science.gov (United States)

    Ichimaru, S.; Ogata, S.; Van Horn, H. M.

    1992-01-01

    Through a combination of compositional scaling arguments and examinations of Monte Carlo simulation results for the interparticle separations in binary-ionic mixture (BIM) solids, we have derived parameterized expressions for the BIM pycnonuclear rates as generalizations of those in one-component solids obtained previously by Salpeter and Van Horn and by Ogata et al. We have thereby discovered a catalyzing effect of the heavier elements, which enhances the rates of reactions among the lighter elements when the charge ratio exceeds a critical value of approximately 2.3.

  4. Design of Separation Processes with Ionic Liquids

    DEFF Research Database (Denmark)

    Peng-noo, Worawit; Kulajanpeng, Kusuma; Gani, Rafiqul

    2015-01-01

    A systematic methodology for screening and designing of Ionic Liquid (IL)-based separation processes is proposed and demonstrated using several case studies of both aqueous and non-aqueous systems, for instance, ethanol + water, ethanol + hexane, benzene + hexane, and toluene + methylcyclohexane....... The best four ILs of each mixture are [mmim][dmp], [emim][bti], [emim][etso4] and [hmim][tcb], respectively. All of them were used as entrainers in the extractive distillation. A process simulation of each system was carried out and showed a lower both energy requirement and solvent usage as compared...

  5. Study of an ionic smoke sensor

    International Nuclear Information System (INIS)

    Mokhtari, Z; Holé, S; Lewiner, J

    2013-01-01

    Ionization smoke sensors are among the best smoke sensors; however, the little radioactive source they include is no longer desirable since it makes recycling more complicated. In this paper, we discuss an electrostatic system in which a corona discharge is used to generate the ions needed for smoke detection. We show how the velocity of ions is reduced in our system for a better interaction between smoke and drifting ions. The influence of smoke, temperature and moisture is studied. It is shown that the proposed sensor has good sensitivity compared with conventional ionic and optical smoke sensors. (paper)

  6. Study of an ionic smoke sensor

    Science.gov (United States)

    Mokhtari, Z.; Holé, S.; Lewiner, J.

    2013-05-01

    Ionization smoke sensors are among the best smoke sensors; however, the little radioactive source they include is no longer desirable since it makes recycling more complicated. In this paper, we discuss an electrostatic system in which a corona discharge is used to generate the ions needed for smoke detection. We show how the velocity of ions is reduced in our system for a better interaction between smoke and drifting ions. The influence of smoke, temperature and moisture is studied. It is shown that the proposed sensor has good sensitivity compared with conventional ionic and optical smoke sensors.

  7. Nonextensive statistical mechanics of ionic solutions

    International Nuclear Information System (INIS)

    Varela, L.M.; Carrete, J.; Munoz-Sola, R.; Rodriguez, J.R.; Gallego, J.

    2007-01-01

    Classical mean-field Poisson-Boltzmann theory of ionic solutions is revisited in the theoretical framework of nonextensive Tsallis statistics. The nonextensive equivalent of Poisson-Boltzmann equation is formulated revisiting the statistical mechanics of liquids and the Debye-Hueckel framework is shown to be valid for highly diluted solutions even under circumstances where nonextensive thermostatistics must be applied. The lowest order corrections associated to nonadditive effects are identified for both symmetric and asymmetric electrolytes and the behavior of the average electrostatic potential in a homogeneous system is analytically and numerically analyzed for various values of the complexity measurement nonextensive parameter q

  8. Dielectric properties of classical and quantized ionic fluids.

    Science.gov (United States)

    Høye, Johan S

    2010-06-01

    We study time-dependent correlation functions of classical and quantum gases using methods of equilibrium statistical mechanics for systems of uniform as well as nonuniform densities. The basis for our approach is the path integral formalism of quantum mechanical systems. With this approach the statistical mechanics of a quantum mechanical system becomes the equivalent of a classical polymer problem in four dimensions where imaginary time is the fourth dimension. Several nontrivial results for quantum systems have been obtained earlier by this analogy. Here, we will focus upon the presence of a time-dependent electromagnetic pair interaction where the electromagnetic vector potential that depends upon currents, will be present. Thus both density and current correlations are needed to evaluate the influence of this interaction. Then we utilize that densities and currents can be expressed by polarizations by which the ionic fluid can be regarded as a dielectric one for which a nonlocal susceptibility is found. This nonlocality has as a consequence that we find no contribution from a possible transverse electric zero-frequency mode for the Casimir force between metallic plates. Further, we establish expressions for a leading correction to ab initio calculations for the energies of the quantized electrons of molecules where now retardation effects also are taken into account.

  9. Comparative investigation on electrochemical behavior of hydroquinone at carbon ionic liquid electrode, ionic liquid modified carbon paste electrode and carbon paste electrode

    International Nuclear Information System (INIS)

    Zhang, Ya; Zheng, Jian Bin

    2007-01-01

    Ionic liquid, 1-heptyl-3-methylimidazolium hexafluorophosphate (HMIMPF 6 ), has been used to fabricate two new electrodes, carbon ionic liquid electrode (CILE) and ionic liquid modified carbon paste electrode (IL/CPE), using graphite powder mixed with HMIMPF 6 or the mixture of HMIMPF 6 /paraffin liquid as the binder, respectively. The electrochemical behaviors of hydroquinone at the CILE, the IL/CPE and the CPE were investigated in phosphate buffer solution. At all these electrodes, hydroquinone showed a pair of redox peaks. The order of the current response and the standard rate constant of hydroquinone at these electrodes were as follows: CILE > IL/CPE > CPE, while the peak-to-peak potential separation was in an opposite sequence: CILE < IL/CPE < CPE. The results show the superiority of CILE to IL/CPE and CPE, and IL/CPE to CPE in terms of promoting electron transfer, improving reversibility and enhancing sensitivity. The CILE was chosen as working electrode to determine hydroquinone by differential pulse voltammetry, which can be used for sensitive, simple and rapid determination of hydroquinone in medicated skin cosmetic cream

  10. Excimer Formation Dynamics of Dipyrenyldecane in Structurally Different Ionic Liquids.

    Science.gov (United States)

    Yadav, Anita; Pandey, Siddharth

    2017-12-07

    Ionic liquids, being composed of ions alone, may offer alternative pathways for molecular aggregation. These pathways could be controlled by the chemical structure of the cation and the anion of the ionic liquids. Intramolecular excimer formation dynamics of a bifluorophoric probe, 1,3-bis(1-pyrenyl)decane [1Py(10)1Py], where the fluorophoric pyrene moieties are separated by a long decyl chain, is investigated in seven different ionic liquids in 10-90 °C temperature range. The long alkyl separator allows for ample interaction with the solubilizing milieu prior to the formation of the excimer. The ionic liquids are composed of two sets, one having four ionic liquids of 1-butyl-3-methylimidazolium cation ([bmim + ]) with different anions and the other having four ionic liquids of bis(trifluoromethylsulfonyl)imide anion ([Tf 2 N - ]) with different cations. The excimer-to-monomer emission intensity ratio (I E /I M ) is found to increase with increasing temperature in sigmoidal fashion. Chemical structure of the ionic liquid controls the excimer formation efficiency, as I E /I M values within ionic liquids with the same viscosities are found to be significantly different. The excited-state intensity decay kinetics of 1Py(10)1Py in ionic liquids do not adhere to a simplistic Birk's scheme, where only one excimer conformer forms after excitation. The apparent rate constants of excimer formation (k a ) in highly viscous ionic liquids are an order of magnitude lower than those reported in organic solvents. In general, the higher the viscosity of the ionic liquid, the more sensitive is the k a to the temperature with higher activation energy, E a . The trend in E a is found to be similar to that for activation energy of the viscous flow (E a,η ). Stokes-Einstein relationship is not followed in [bmim + ] ionic liquids; however, with the exception of [choline][Tf 2 N], it is found to be followed in [Tf 2 N - ] ionic liquids suggesting the cyclization dynamics of 1Py(10)1Py

  11. Synthesis and characterization of ionic liquid (EMImBF{sub 4})/Li{sup +} - chitosan membranes for ion battery

    Energy Technology Data Exchange (ETDEWEB)

    Pasaribu, Marvin H., E-mail: marvin-shady88@yahoo.com; Arcana, I Made, E-mail: arcana@chem.itb.ac.id; Wahyuningrum, Deana, E-mail: deana@chem.itb.ac.id [Department of Chemistry, Faculty of Mathematics and Natural Sciences, InstitutTeknologi Bandung, Jl. Ganesha No. 10, Bandung 40132 (Indonesia)

    2015-09-30

    Lithium ion battery has been currently developed and produced because it has a longer life time, high energycapacity, and the efficient use of lithium ion battery that is suitable for storing electrical energy. However, this battery has some drawbacks such as use liquid electrolytes that are prone to leakage and flammability during the battery charging process in high temperature. In this study, an ionic liquid 1-ethyl-3-methylimidazolium tetrafluoroborate (EMImBF4) containing Li{sup +} ions was synthesized and combined with chitosan polymer host as a polymer electrolyte membrane for lithium-ion batteries to solve this problems. This ionic liquid was obtained from the anion metathesis reaction between EMImBr and LiBF4 salt, while EMImBr was synthesized from the reaction between 1-methylimidazole and ethyl bromide utilizing Microwave Assisted Organic Synthesis (MAOS) method. The ionic liquid obtained was characterized by microstructure analysis with using NMR and FTIR spectroscopy. The polymer electrolyte membrane was characterized by analysis functional groups (FTIR), ionic conductivity (EIS), and surface morphology (SEM). The analysis results of ion conductivity by the EIS method showed the increase the ionic conductivity value of membranes from 1.30 × 10{sup −2} S cm{sup −1} for chitosan to 1.30 × 10{sup −2} S cm{sup −1} for chitosan with EMImBF4/Li{sup +}, and this result was supported by analysis the surface morphology (SEM)

  12. Fluorinated ionic liquids for protein drug delivery systems: Investigating their impact on the structure and function of lysozyme.

    Science.gov (United States)

    Alves, Márcia; Vieira, Nicole S M; Rebelo, Luís Paulo N; Araújo, João M M; Pereiro, Ana B; Archer, Margarida

    2017-06-30

    Since the approval of recombinant human insulin by FDA in 1982, more than 200 proteins are currently available for pharmaceutical use to treat a wide range of diseases. However, innovation is still required to develop effective approaches for drug delivery. Our aim is to investigate the potential use of fluorinated ionic liquids (FILs) as drug delivery systems (DDS) for therapeutic proteins. Some initial parameters need to be assessed before further studies can proceed. This work evaluates the impact of FILs on the stability, function, structure and aggregation state of lysozyme. Different techniques were used for this purpose, which included differential scanning fluorimetry (DSF), spectrophotometric assays, circular dichroism (CD), dynamic light scattering (DLS), and scanning and transmission electron microscopy (SEM/TEM). Ionic liquids composed of cholinium-, imidazolium- or pyridinium- derivatives were combined with different anions and analysed at different concentrations in aqueous solutions (below and above the critical aggregation concentration, CAC). The results herein presented show that the addition of ionic liquids had no significant effect on the stability and hydrolytic activity of lysozyme. Moreover, a distinct behaviour was observed in DLS experiments for non-surfactant and surfactant ionic liquids, with the latter encapsulating the protein at concentrations above the CAC. These results encourage us to further study ionic liquids as promising tools for DDS of protein drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Fabrication and characterization of an integrated ionic device from suspended polypyrrole and alamethicin-reconstituted lipid bilayer membranes

    International Nuclear Information System (INIS)

    Northcutt, Robert; Sundaresan, Vishnu-Baba

    2012-01-01

    Conducting polymers are electroactive materials that undergo conformal relaxation of the polymer backbone in the presence of an electrical field through ion exchange with solid or aqueous electrolytes. This conformal relaxation and the associated morphological changes make conducting polymers highly suitable for actuation and sensing applications. Among smart materials, bioderived active materials also use ion transport for sensing and actuation functions via selective ion transport. The transporter proteins extracted from biological cell membranes and reconstituted into a bilayer lipid membrane in bioderived active materials regulate ion transport for engineering functions. The protein transporter reconstituted in the bilayer lipid membrane is referred to as the bioderived membrane and serves as the active component in bioderived active materials. Inspired by the similarities in the physics of transduction in conducting polymers and bioderived active materials, an integrated ionic device is formed from the bioderived membrane and the conducting polymer membrane. This ionic device is fabricated into a laminated thin-film membrane and a common ion that can be processed by the bioderived and the conducting polymer membranes couple the ionic function of these two membranes. An integrated ionic device, fabricated from polypyrrole (PPy) doped with sodium dodecylbenzenesulfonate (NaDBS) and an alamethicin-reconstituted DPhPC bilayer lipid membrane, is presented in this paper. A voltage-gated sodium current regulates the electrochemical response in the PPy(DBS) layer. The integrated device is fabricated on silicon-based substrates through microfabrication, electropolymerization, and vesicle fusion, and ionic activity is characterized through electrochemical measurements. (paper)

  14. Ionic diffusion in superionic-conductor melts

    International Nuclear Information System (INIS)

    Tankeshwar, K.; Tosi, M.P.

    1991-03-01

    The self-diffusion coefficients D + and D - of the two ionic species in molten AgI, CuCl, CuBr and CuI are evaluated and contrasted with those calculated for molten NaCl. The evaluation adopts a simple model for liquid state dynamics, earlier proposed by Zwanzig to justify the Stokes-Einstein formula for monatomic fluids, and by suitable approximations relates the self-diffusion coefficients to pair potentials and to the pair structure of the melt. The results offer an interpretation for molecular dynamics data showing that, whereas for a ''normal'' system such as NaCl the ratio D + /D - in the melt is of the order unity, a sizable difference between D + and D - persists in salts melting from a fast-cation conducting solid. This difference is explicitly related to liquid structure through differences in the structural backscattering of cations by cations and of halogens by halogens. The calculated magnitudes of D + /D - are quite satisfactory, while the absolute magnitudes of D + and D - are in good agreement with the data only for those salts (AgI, CuBr and NaCl) in which the masses of the two ionic species are not greatly different. (author). 21 refs, 2 tabs

  15. Aerogels from Chitosan Solutions in Ionic Liquids

    Directory of Open Access Journals (Sweden)

    Gonzalo Santos-López

    2017-12-01

    Full Text Available Chitosan aerogels conjugates the characteristics of nanostructured porous materials, i.e., extended specific surface area and nano scale porosity, with the remarkable functional properties of chitosan. Aerogels were obtained from solutions of chitosan in ionic liquids (ILs, 1-butyl-3-methylimidazolium acetate (BMIMAc, and 1-ethyl-3-methyl-imidazolium acetate (EMIMAc, in order to observe the effect of the solvent in the structural characteristics of this type of materials. The process of elaboration of aerogels comprised the formation of physical gels through anti-solvent vapor diffusion, liquid phase exchange, and supercritical CO2 drying. The aerogels maintained the chemical identity of chitosan according to Fourier transform infrared spectrophotometer (FT-IR spectroscopy, indicating the presence of their characteristic functional groups. The internal structure of the obtained aerogels appears as porous aggregated networks in microscopy images. The obtained materials have specific surface areas over 350 m2/g and can be considered mesoporous. According to swelling experiments, the chitosan aerogels could absorb between three and six times their weight of water. However, the swelling and diffusion coefficient decreased at higher temperatures. The structural characteristics of chitosan aerogels that are obtained from ionic liquids are distinctive and could be related to solvation dynamic at the initial state.

  16. Furfural production using ionic liquids: A review.

    Science.gov (United States)

    Peleteiro, Susana; Rivas, Sandra; Alonso, José Luis; Santos, Valentín; Parajó, Juan Carlos

    2016-02-01

    Furfural, a platform chemical with a bright future, is commercially obtained by acidic processing of xylan-containing biomass in aqueous media. Ionic liquids (ILs) can be employed in processed for furfural manufacture as additives, as catalysts and/or as reaction media. Depending on the IL utilized, externally added catalysts (usually, Lewis acids, Brönsted acids and/or solid acid catalysts) can be necessary to achieve high reaction yields. Oppositely, acidic ionic liquids (AILs) can perform as both solvents and catalysts, enabling the direct conversion of suitable substrates (pentoses, pentosans or xylan-containing biomass) into furfural. Operating in IL-containing media, the furfural yields can be improved when the product is continuously removed along the reaction (for example, by stripping or extraction), to avoid unwanted side-reactions leading to furfural consumption. These topics are reviewed, as well as the major challenges involved in the large scale utilization of ILs for furfural production. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Magnetic ionic liquids: synthesis and characterization

    International Nuclear Information System (INIS)

    Medeiros, Anderson M.M.S.; Parize, Alexandre L.; Oliveira, Vanda M.; Neto, Brenno A.D.; Rubim, Joel C.

    2010-01-01

    The synthesis of magnetic ionic liquids (MILs) based on the stable dispersions of magnetic nanoparticles (MNPs) of γ-Fe 2 O 3 , Fe 3 O 4 , and CoFe 2 O 4 in the ionic liquid 1-n-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide (BMI.NTf 2 ) is reported. The MNPs were obtained by the coprecipitation method. The surface of the α-Fe 2 O 3 , Fe 3 O 4 , and CoFe 2 O 4 MNPs with mean sizes (XRD) of 9.3, 12.3, and 11.0 nm, respectively were functionalized by 1-n-butyl-3-(3'-trimethoxypropylsilane)- imidazolium chloride. The non functionalized and functionalized MNPs were further characterized by Raman, FTIR-ATR, and FTNIR spectroscopy and by TGA. The stability of the MILs was assigned to the formation of at least one monolayer of the surface modifier agent that mimics the structure of the BMI.NTf 2 IL. (author)

  18. Cellulose multilayer Membranes manufacture with Ionic liquid

    KAUST Repository

    Livazovic, Sara

    2015-05-09

    Membrane processes are considered energy-efficient for water desalination and treatment. However most membranes are based on polymers prepared from fossil petrochemical sources. The development of multilayer membranes for nanofiltration and ultrafiltration, with thin selective layers of naturally available cellulose has been hampered by the availability of non-aggressive solvents. We propose the manufacture of cellulose membranes based on two approaches: (i) silylation, coating from solutions in tetrahydrofuran, followed by solvent evaporation and cellulose regeneration by acid treatment; (ii) casting from solution in 1-ethyl-3-methylimidazolum acetate ([C2mim]OAc), an ionic liquid, followed by phase inversion in water. By these methods porous supports could be easily coated with semi-crystalline cellulose. The membranes were hydrophilic with contact angles as low as 22.0°, molecular weight cut-off as low as 3000 g mol-1 with corresponding water permeance of 13.8 Lm−2 h−1 bar−1. Self-standing cellulose membranes were also manufactured without porous substrate, using only ionic liquid as green solvent. This membrane was insoluble in water, tetrahydrofuran, hexane, N,N-dimethylformamide, 1-methyl-2-pyrrolidinone and N,N-dimethylacetamide.

  19. Electrogenic glutamate uptake is a major current carrier in the membrane of axolotl retinal glial cells

    Science.gov (United States)

    Brew, Helen; Attwell, David

    1987-06-01

    Glutamate is taken up avidly by glial cells in the central nervous system1. Glutamate uptake may terminate the transmitter action of glutamate released from neurons1, and keep extracellular glutamate at concentrations below those which are neurotoxic. We report here that glutamate evokes a large inward current in retinal glial cells which have their membrane potential and intracellular ion concentrations controlled by the whole-cell patch-clamp technique2. This current seems to be due to an electrogenic glutamate uptake carrier, which transports at least two sodium ions with every glutamate anion carried into the cell. Glutamate uptake is strongly voltage-dependent, decreasing at depolarized potentials: when fully activated, it contributes almost half of the conductance in the part of the glial cell membrane facing the retinal neurons. The spatial localization, glutamate affinity and magnitude of the uptake are appropriate for terminating the synaptic action of glutamate released from photoreceptors and bipolar cells. These data challenge present explanations of how the b-wave of the electroretinogram is generated, and suggest a mechanism for non-vesicular voltage-dependent release of glutamate from neurons.

  20. Strain induced ionic conductivity enhancement in epitaxial Ce0.9Gd0.1O22d

    DEFF Research Database (Denmark)

    Kant, K. Mohan; Esposito, Vincenzo; Pryds, Nini

    2012-01-01

    -plane ionic conductivity in CGO epitaxial thin films. The ionic conductivity is found to increase with decrease in buffer layer thickness. The tailored ionic conductivity enhancement is explained in terms of close relationships among epitaxy, strain, and ionic conductivity....