Anomalous frequency-dependent ionic conductivity of lesion-laden human-brain tissue
Emin, David; Akhtari, Massoud; Fallah, Aria; Vinters, Harry V.; Mathern, Gary W.
2017-10-01
We study the effect of lesions on our four-electrode measurements of the ionic conductivity of (˜1 cm3) samples of human brain excised from patients undergoing pediatric epilepsy surgery. For most (˜94%) samples, the low-frequency ionic conductivity rises upon increasing the applied frequency. We attributed this behavior to the long-range (˜0.4 mm) diffusion of solvated sodium cations before encountering intrinsic impenetrable blockages such as cell membranes, blood vessels, and cell walls. By contrast, the low-frequency ionic conductivity of some (˜6%) brain-tissue samples falls with increasing applied frequency. We attribute this unusual frequency-dependence to the electric-field induced liberation of sodium cations from traps introduced by the unusually severe pathology observed in samples from these patients. Thus, the anomalous frequency-dependence of the ionic conductivity indicates trap-producing brain lesions.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
DEFF Research Database (Denmark)
Sillassen, M.; Eklund, P.; Pryds, Nini
2010-01-01
grain size, yielding a grain size of 6 nm and a microstrain of 2.5% at -200 V and -250 V with additional incorporation of argon. Temperature-dependent impedance spectroscopy of the SSZ films showed that the in-plane ionic conductivity had a maximum close to 10.7 mol% and decreased almost an order...... of magnitude as the scandia - content was increased to 15.9 mol%. The activation energy for oxygen ion migration was determined to be between 1.30 - 1.43 eV. In addition, no dependence on grain size was observed. The above observations suggest a bulk mechanism for ionic conduction....
Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram
DEFF Research Database (Denmark)
Nielsen, S.K.; Noat, Y.; Brandbyge, Mads
2003-01-01
The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...
DEFF Research Database (Denmark)
Sillassen, M.; Eklund, P.; Sridharan, M.
2009-01-01
Thermally stable, stoichiometric, cubic yttria-stabilized zirconia (YSZ) thin-film electrolytes have been synthesized by reactive pulsed dc magnetron sputtering from a Zr–Y (80/20 at. %) alloy target. Films deposited at floating potential had a texture. Single-line profile analysis of the 111 x.......5% at bias voltages of −175 and −200 V with additional incorporation of argon. The films were thermally stable; very limited grain coarsening was observed up to an annealing temperature of 800 °C. Temperature-dependent impedance spectroscopy analysis of the YSZ films with Ag electrodes showed that the in......-plane ionic conductivity was within one order of magnitude higher in films deposited with substrate bias corresponding to a decrease in grain size compared to films deposited at floating potential. This suggests that there is a significant contribution to the ionic conductivity from grain boundaries...
Li, Chen-Yu; Hemmig, Elisa A; Kong, Jinglin; Yoo, Jejoong; Hernández-Ainsa, Silvia; Keyser, Ulrich F; Aksimentiev, Aleksei
2015-02-24
The DNA origami technique can enable functionalization of inorganic structures for single-molecule electric current recordings. Experiments have shown that several layers of DNA molecules, a DNA origami plate, placed on top of a solid-state nanopore is permeable to ions. Here, we report a comprehensive characterization of the ionic conductivity of DNA origami plates by means of all-atom molecular dynamics (MD) simulations and nanocapillary electric current recordings. Using the MD method, we characterize the ionic conductivity of several origami constructs, revealing the local distribution of ions, the distribution of the electrostatic potential and contribution of different molecular species to the current. The simulations determine the dependence of the ionic conductivity on the applied voltage, the number of DNA layers, the nucleotide content and the lattice type of the plates. We demonstrate that increasing the concentration of Mg(2+) ions makes the origami plates more compact, reducing their conductivity. The conductance of a DNA origami plate on top of a solid-state nanopore is determined by the two competing effects: bending of the DNA origami plate that reduces the current and separation of the DNA origami layers that increases the current. The latter is produced by the electro-osmotic flow and is reversible at the time scale of a hundred nanoseconds. The conductance of a DNA origami object is found to depend on its orientation, reaching maximum when the electric field aligns with the direction of the DNA helices. Our work demonstrates feasibility of programming the electrical properties of a self-assembled nanoscale object using DNA.
Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors
Directory of Open Access Journals (Sweden)
Salmela Iikka
2012-08-01
Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.
Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing
2014-07-01
Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.
A high-voltage and non-corrosive ionic liquid electrolyte used in rechargeable aluminum battery.
Wang, Huali; Gu, Sichen; Bai, Ying; Chen, Shi; Wu, Feng; Wu, Chuan
2016-10-03
As a promising post-lithium battery, rechargeable aluminum battery has the potential to achieve a three-electron reaction with fully use of metal aluminum. Alternative electrolytes are strongly needed for further development of rechargeable aluminum batteries, since typical AlCl3-contained imidazole-based ionic liquids are moisture sensitive, corrosive, and with low oxidation voltage. In this letter, a kind of non-corrosive and water-stable ionic liquid obtained by mixing 1-butyl-3-methylimidazolium trifluoromethanesulfonate ([BMIM]OTF) with the corresponding aluminum salt (Al(OTF)3) is studied. This ionic liquid electrolyte has a high oxidation voltage (3.25V vs Al3+/Al) and high ionic conductivity, and a good electrochemical performance is also achieved. A new strategy, which first use corrosive AlCl3-based electrolyte to construct a suitable passageway on the Al anode for Al3+, and then use non-corrosive Al(OTF)3-based electrolyte to get stable Al/electrolyte interface, is put forward.
International Nuclear Information System (INIS)
Wenlong Yao
2006-01-01
This thesis consists of six sections. The first section gives the basic research background on the ionic conduction mechanism in glass, polarization in the glass, and the method of determining the mobile carrier density in glass. The proposed work is also included in this section. The second section is a paper that characterizes the structure of MI + M 2 S + (0.1 Ga 2 S 3 + 0.9 GeS 2 ) (M = Li, Na, K and Cs) glasses using Raman and IR spectroscopy. Since the ionic radius plays an important role in determining the ionic conductivity in glasses, the glass forming range for the addition of different alkalis into the basic glass forming system 0.1 Ga 2 S 3 + 0.9 GeS 2 was studied. The study found that the change of the alkali radius for the same nominal composition causes significant structure change to the glasses. The third section is a paper that investigates the ionic conductivity of MI + M 2 S + (0.1Ga 2 S 3 + 0.9 GeS 2 ) (M = Li, Na, K and Cs) glasses system. Corresponding to the compositional changes in these fast ionic conducting glasses, the ionic conductivity shows changes due to the induced structural changes. The ionic radius effect on the ionic conductivity in these glasses was investigated. The fourth section is a paper that examines the mobile carrier density based upon the measurements of space charge polarization. For the first time, the charge carrier number density in fast ionic conducting chalcogenide glasses was determined. The experimental impedance data were fitted using equivalent circuits and the obtained parameters were used to determine the mobile carrier density. The influence of mobile carrier density and mobility on the ionic conductivity was separated. The fifth section is a paper that studies the structures of low-alkali-content Na 2 S + B 2 S 3 (x (le) 0.2) glasses by neutron and synchrotron x-ray diffraction. Similar results were obtained both in neutron and synchrotron x-ray diffraction experiments. The results provide direct
Energy Technology Data Exchange (ETDEWEB)
Yao, Wenlong [Iowa State Univ., Ames, IA (United States)
2006-01-01
This thesis consists of six sections. The first section gives the basic research background on the ionic conduction mechanism in glass, polarization in the glass, and the method of determining the mobile carrier density in glass. The proposed work is also included in this section. The second section is a paper that characterizes the structure of MI + M2S + (0.1 Ga2S3 + 0.9 GeS2) (M = Li, Na, K and Cs) glasses using Raman and IR spectroscopy. Since the ionic radius plays an important role in determining the ionic conductivity in glasses, the glass forming range for the addition of different alkalis into the basic glass forming system 0.1 Ga2S3 + 0.9 GeS2 was studied. The study found that the change of the alkali radius for the same nominal composition causes significant structure change to the glasses. The third section is a paper that investigates the ionic conductivity of MI + M2S + (0.1Ga2S3 + 0.9 GeS2) (M = Li, Na, K and Cs) glasses system. Corresponding to the compositional changes in these fast ionic conducting glasses, the ionic conductivity shows changes due to the induced structural changes. The ionic radius effect on the ionic conductivity in these glasses was investigated. The fourth section is a paper that examines the mobile carrier density based upon the measurements of space charge polarization. For the first time, the charge carrier number density in fast ionic conducting chalcogenide glasses was determined. The experimental impedance data were fitted using equivalent circuits and the obtained parameters were used to determine the mobile carrier density. The influence of mobile carrier density and mobility on the ionic conductivity was separated. The fifth section is a paper that studies the structures of low-alkali-content Na2S + B2S3 (x ≤ 0.2) glasses by neutron and synchrotron x-ray diffraction
High pressure studies of ionic conductivity in solids
International Nuclear Information System (INIS)
Samara, G.A.
1979-01-01
The pressure dependence of the ionic conductivity provides information about the volume relaxation associated with the formation of lattice defects as well as with the diffusive motion of these defects, and thereby helps elucidate the conduction process. Pressure results on a variety of crystals will be discussed with emphasis on recent results on crystals with large lattice polarizabilities and soft phonon modes. Pressure is shown to be an important--sometimes essential, variable in the study of ionic transport processes
Ionic conductivity of N-alkyl pyridinium halides mesophases
International Nuclear Information System (INIS)
Meftah, Ahmed
1980-01-01
The quasi anhydrous N-alkyl pyridinium halides undergo at a temperature T c a phase transition from a crystalline isolating state to a conducting mesophase (σ = 3.10 -2 Ω -1 cm -1 ). The transition temperature depends on the nature on counter-ion and on the aliphatic chain length. The present study is devoted to the N-alkyl pyridinium chlorides, bromides and iodides varying the number of carbon atoms in the chain from ten to twenty two. The transition temperatures T c were found to increase from 30 deg. C up to 110 deg. C by a step of 10 deg. C for two added carbon atoms in the chain. The electrical measurements have shown that the conductivity of the mesophases which is ionic in origin is due to a large mobility of counter-ions in hydrophilic parts. At high frequencies (F > 10 3 Hz) ionic conductivity predominates in the bulk and does not depend on frequency. At low frequencies (F 3 Hz) the most important are interface phenomena depending on the square root of inverse frequency (ω -1/2 ) and being due to an electronic exchange limited by diffusion velocity of counter-ions. The electrical conductivity depends weekly on the chain length and the mesophases textures. The most conducting mesophase is the optically isotropic. The conductivity increases with increasing water content of the system and decreases with increasing atomic number of counter-ion. The diffusion measurements by radioactive tracers confirm the ionic character of charge carriers although the diffusion factors obtained by this method are largely higher than the calculated ones from the conductivity values. (author) [fr
Directory of Open Access Journals (Sweden)
Fengguo Liu
2018-03-01
Full Text Available Ionic liquids are considered environmentally friendly media for various industrial applications. Basic data on physicochemical properties are significant for a new material, in terms of developing its potential applications. In this work, 1-ethyl-3-methylimidazolium fluoride ([EMIm]F ionic liquid was synthesized via an anion metathesis process. Physical properties including the density, viscosity, electrical conductivity, and thermal stability of the product were measured. The results show that the density of [EMIm]F decreases linearly with temperature increases, while dynamic viscosity decreases rapidly below 320 K and the temperature dependence of electrical conductivity is in accordance with the VFT (Vogel–Fulcher–Tammann equation. The temperature dependence of the density, conductivity, and viscosity of [EMIm]F can be expressed via the following equations: ρ = 1.516 − 1.22 × 10−3 T, σm = 4417.1exp[−953.17/(T − 166.65] and η = 2.07 × 10−7exp(−5.39 × 104/T, respectively. [EMIm]F exhibited no clear melting point. However, its glass transition point and decomposition temperature are −71.3 °C and 135 °C, respectively.
Vaccaro, S. R.
2011-09-01
The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.
CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.
Directory of Open Access Journals (Sweden)
Samuel eGoodchild
2012-06-01
Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.
Ionic Conductivity of Polyelectrolyte Hydrogels.
Lee, Chen-Jung; Wu, Haiyan; Hu, Yang; Young, Megan; Wang, Huifeng; Lynch, Dylan; Xu, Fujian; Cong, Hongbo; Cheng, Gang
2018-02-14
Polyelectrolytes have many important functions in both living organisms and man-made applications. One key property of polyelectrolytes is the ionic conductivity due to their porous networks that allow the transport of water and small molecular solutes. Among polyelectrolytes, zwitterionic polymers have attracted huge attention for applications that involve ion transport in a polyelectrolyte matrix; however, it is still unclear how the functional groups of zwitterionic polymer side chains affect their ion transport and swelling properties. In this study, zwitterionic poly(carboxybetaine acrylamide), poly(2-methacryloyloxyethyl phosphorylcholine), and poly(sulfobetaine methacrylate) hydrogels were synthesized and their ionic conductivity was studied and compared to cationic, anionic, and nonionic hydrogels. The change of the ionic conductivity of zwitterionic and nonionic hydrogels in different saline solutions was investigated in detail. Zwitterionic hydrogels showed much higher ionic conductivity than that of the widely used nonionic poly(ethylene glycol) methyl ether methacrylate hydrogel in all tested solutions. For both cationic and anionic hydrogels, the presence of mobile counterions led to high ionic conductivity in low salt solutions; however, the ionic conductivity of zwitterionic hydrogels surpassed that of cationic and ionic hydrogels in high salt solutions. Cationic and anionic hydrogels showed much higher water content than that of zwitterionic hydrogels in deionized water; however, the cationic hydrogels shrank significantly with increasing saline concentration. This work provides insight into the effects of polyelectrolyte side chains on ion transport. This can guide us in choosing better polyelectrolytes for a broad spectrum of applications, including bioelectronics, neural implants, battery, and so on.
Ionic conducting poly-benzimidazoles
International Nuclear Information System (INIS)
Jouanneau, J.
2006-11-01
Over the last years, many research works have been focused on new clean energy systems. Hydrogen fuel cell seems to be the most promising one. However, the large scale development of this technology is still limited by some key elements. One of them is the polymer electrolyte membrane 'Nafion' currently used, for which the ratio performance/cost is too low. The investigations we carried out during this thesis work are related to a new class of ionic conducting polymer, the sulfonated poly-benzimidazoles (sPBI). Poly-benzimidazoles (PBI) are aromatic heterocyclic polymers well-known for their excellent thermal and chemical stability. Ionic conduction properties are obtained by having strong acid groups (sulfonic acid SO 3 H) on the macromolecular structure. For that purpose, we first synthesized sulfonated monomers. Their poly-condensation with an appropriate non-sulfonated co-monomer yields to sPBI with sulfonation range from 0 to 100 per cent. Three different sPBI structures were obtained, and verified by appropriate analytical techniques. We also showed that the protocol used for the synthesis resulted in high molecular weights polymers. We prepared ionic conducting membrane by casting sPBI solutions on glass plates. Their properties of stability, water swelling and ionic conductivity were investigated. Surprisingly, the behaviour of sPBI was quite different from the other sulfonated aromatic polymers with same amount of SO 3 H, their stability was much higher, but their water swelling and ionic conductivity were quite low. We attributed these differences to strong ionic interactions between the sulfonic acid groups and the basic benzimidazole groups of our polymers. However, we managed to solve this problem synthesizing very highly sulfonated PBI, obtaining membranes with a good balance between all the properties necessary. (author)
Ionic conductivity in irradiated KCL
International Nuclear Information System (INIS)
Vignolo Rubio, J.
1979-01-01
The ionic conductivity of X and gamma irradiated KCl single crystals has been studied between room temperature and 600 deg C. The radiation induced damage resulting in a decrease of the conductivity heals by thermal annealing in two steps which are at about 350 and 550 deg C respectively. It has been found that the radiation induced colour centres are not involved in the observed decrease of the ionic conductivity. Howewer, it has been observed that the effects of quenching and plastic deformation on the conductivity of the samples are very similar to the effect induced by irradiation. It is suggested that small radiation induced dislocation loops might cause the ionic conductivity decrease observed in irradiated samples. (auth)
Ionic conductivity in irradiated KCL
International Nuclear Information System (INIS)
Vignolo Rubio, J.
1979-01-01
The ionic conductivity of X and gamma irradiated KCL single crystals has been studied between room temperature and 600 degree centigree. the radiation induced damage resulting in a decrease of the conductivity heals by thermal annealing in two steps which are at about 350 and 550 degree centigree respectively. It has been found that the radiation induced colour centres are not involved in the observed decrease of the ionic conductivity. However. It has been observed that the effects of quenching and plastic deformation on the conductivity of the samples are very similar to the effect induced by irradiation. It is suggested that, samples radiation induced dislocation loops might cause the ionic conductivity decrease observed in irradiated samples. (Author)
Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267
Directory of Open Access Journals (Sweden)
Colin H Peters
Full Text Available E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Correlations between phase behaviors and ionic conductivities of (ionic liquid + alcohol) systems
International Nuclear Information System (INIS)
Park, Nam Ku; Bae, Young Chan
2010-01-01
To understand the basic properties of ionic liquids (ILs), we examined the phase behavior and ionic conductivity characteristics using various compositions of different ionic liquids (1-ethyl-3-methylimidazolium hexafluorophosphate [emim] [PF6] and 1-benzyl-3-methylimidazolium hexafluorophosphate [bzmim] [PF6]) in several different alcohols (ethanol, propanol, 1-butanol, 2-butanol, and hexanol). We conducted a systematic study of the impact of different factors on the phase behavior of imidazolium-based ionic liquids in alcohols. Using a new experimental method with a liquid electrolyte system, we observed that the ionic conductivity of the ionic liquid/alcohol was sensitive to the surrounding temperature. We employed Chang et al.'s thermodynamic model [Chang et al. (1997, 1998) ] based on the lattice model. The obtained co-ordinated unit parameter from this model was used to describe the phase behavior and ionic conductivities of the given system. Good agreement with experimental data of various alcohol and ILs systems was obtained in the range of interest.
Ionic conduction in polyether-based lithium arylfluorosulfonimide ionic melt electrolytes
International Nuclear Information System (INIS)
Herath, Mahesha B.; Creager, Stephen E.; Rajagopal, Rama V.; Geiculescu, Olt E.; DesMarteau, Darryl D.
2009-01-01
We report synthesis, characterization and ion transport in polyether-based ionic melt electrolytes consisting of Li salts of low-basicity anions covalently attached to polyether oligomers. Purity of the materials was investigated by HPLC analysis and electrospray ionization mass spectrometry. The highest ionic conductivity of 7.1 x 10 -6 S/cm at 30 deg. C was obtained for the sample consisting of a lithium salt of an arylfluorosulfonimide anion attached to a polyether oligomer with an ethyleneoxide (EO) to lithium ratio of 12. The conductivity order of various ionic melts having different polyether chain lengths suggests that at higher EO:Li ratios the conductivity of the electrolytes at room temperature is determined in part by the amount of crystallization of the polyether portion of the ionic melt.
International Nuclear Information System (INIS)
Ahn, Byung Tae.
1989-01-01
The first part of this work studies lithium-conducting sulfide glasses for battery applications, while the second part studies the thermodynamic properties of a superconducting oxide compound by using an oxide electrolyte. Lithium conducting glasses based on the SiS 2 -Li 2 S system are possible solid electrolytes for high-energy-density lithium batteries. The foremost requirement for solid electrolytes is that they should have high ionic conductivities. Unfortunately, most crystalline lithium conductors have low ionic conductivities at room temperature. However, glass ionic conductors show higher ionic conductivities than do crystalline forms of the same material. In addition to higher ionic conductivities, glasses appear to have several advantages over crystalline materials. These advantages include isotropic conductivity, absence of grain boundary effects, ease of glass forming, and the potential for a wide range of stability to oxidizing and reducing conditions. Using pyrolitic graphite-coated quartz ampoules, new ternary compounds and glasses in the SiS 2 -Li 2 S system were prepared. Several techniques were used to characterize the materials: powder x-ray diffraction, differential thermal analysis, differential scanning calorimetry, and AC impedance spectroscopy. The measured lithium conductivity of the sulfide glasses was one of the highest among the known solid lithium conductors. Measuring the equilibrium open circuit voltages assisted in determining the electrochemical stabilities of the ternary compounds and glasses with respect to pure Li. A solid-state ionic technique called oxygen coulometric titration was used to measure the thermodynamic stability, the oxygen stoichiometry, and the effects of the oxygen stoichiometry, and the effects of the oxygen stoichiometry and the cooling rate on superconductivity of the YBa 2 Cu 3 O 7-x compound were investigated
Ionic conductivity of ternary electrolyte containing sodium salt and ionic liquid
International Nuclear Information System (INIS)
Egashira, Minato; Asai, Takahito; Yoshimoto, Nobuko; Morita, Masayuki
2011-01-01
Highlights: ► Ternary electrolyte containing NaBF 4 , polyether and ionic liquid has been prepared. ► The conductivity of the electrolytes has been evaluated toward content of ionic liquid. ► The conductivity shows maximum 1.2 mS cm −1 and is varied in relation to solution structure. - Abstract: For the development of novel non-aqueous sodium ion conductor with safety of sodium secondary cell, non-flammable ionic liquid is attractive as electrolyte component. A preliminary study has been carried out for the purpose of constructing sodium ion conducting electrolyte based on ionic liquid. The solubility of sodium salt such as NaBF 4 in ionic liquid is poor, thus the ternary electrolyte has been prepared where NaBF 4 with poly(ethylene glycol) dimethyl ether (PEGDME) as coordination former is dissolved with ionic liquid diethyl methoxyethyl ammonium tetrafluoroborate (DEMEBF 4 ). The maximum conductivity among the prepared solutions, ca. 1.2 mS cm −1 at 25 °C, was obtained when the molar ratio (ethylene oxide unit in PEGDME):NaBF 4 :DEMEBF 4 was 8:1:2. The relationship between the conductivity of the ternary electrolyte and its solution structure has been discussed.
Li, Huili; Lv, Tian; Li, Ning; Yao, Yao; Liu, Kai; Chen, Tao
2017-11-30
Hydrogels with high ionic conductivity consisting of a cross-linked polymer network swollen in water are very promising to be used as an electrolyte for all-solid-state supercapacitors. However, there are rather few flexible supercapacitors using ionic conducting hydrogel electrolytes reported to date. In this work, highly flexible and ionic conducting polyacrylamide hydrogels were synthesized through a simple approach. On using the ionic hydrogels as the electrolyte, the resulting supercapacitors not only exhibited a high specific capacitance but also showed a long self-discharge time (over 10 hours to the half of original open-circuit voltage) and a low leakage current. These newly-developed all-solid-state supercapacitors can be bent, knot, and kneaded for 5000 cycles without performance decay, suggesting excellent flexibility and mechanical stability. These all-solid-state supercapacitors can also be easily tailored into strip-like supercapacitors without a short circuit, which provides an efficient approach to fabricate wearable energy storage devices.
Directory of Open Access Journals (Sweden)
Kota Kasahara
Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.
Energy Technology Data Exchange (ETDEWEB)
Johnson, Michael J. [Department of Aerospace and Mechanical Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States); Go, David B., E-mail: dgo@nd.edu [Department of Aerospace and Mechanical Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States); Department of Chemical and Biomolecular Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States)
2015-12-28
To generate a gas discharge (plasma) in atmospheric air requires an electric field that exceeds the breakdown threshold of ∼30 kV/cm. Because of safety, size, or cost constraints, the large applied voltages required to generate such fields are often prohibitive for portable applications. In this work, piezoelectric transformers are used to amplify a low input applied voltage (<30 V) to generate breakdown in air without the need for conventional high-voltage electrical equipment. Piezoelectric transformers (PTs) use their inherent electromechanical resonance to produce a voltage amplification, such that the surface of the piezoelectric exhibits a large surface voltage that can generate corona-like discharges on its corners or on adjacent electrodes. In the proper configuration, these discharges can be used to generate a bulk air flow called an ionic wind. In this work, PT-driven discharges are characterized by measuring the discharge current and the velocity of the induced ionic wind with ionic winds generated using input voltages as low as 7 V. The characteristics of the discharge change as the input voltage increases; this modifies the resonance of the system and subsequent required operating parameters.
Directory of Open Access Journals (Sweden)
E.F. Schwartz
2003-09-01
Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.
Density, viscosity and electrical conductivity of protic alkanolammonium ionic liquids.
Pinkert, André; Ang, Keng L; Marsh, Kenneth N; Pang, Shusheng
2011-03-21
Ionic liquids are molten salts with melting temperatures below the boiling point of water, and their qualification for applications in potential industrial processes does depend on their fundamental physical properties such as density, viscosity and electrical conductivity. This study aims to investigate the structure-property relationship of 15 ILs that are primarily composed of alkanolammonium cations and organic acid anions. The influence of both the nature and number of alkanol substituents on the cation and the nature of the anion on the densities, viscosities and electrical conductivities at ambient and elevated temperatures are discussed. Walden rule plots are used to estimate the ionic nature of these ionic liquids, and comparison with other studies reveals that most of the investigated ionic liquids show Walden rule values similar to many non-protic ionic liquids containing imidazolium, pyrrolidinium, tetraalkylammonium, or tetraalkylphosphonium cations. Comparison of literature data reveals major disagreements in the reported properties for the investigated ionic liquids. A detailed analysis of the reported experimental procedures suggests that inappropriate drying methods can account for some of the discrepancies. Furthermore, an example for the improved presentation of experimental data in scientific literature is presented.
International Nuclear Information System (INIS)
Leon, C.; Santamaria, J.; Paris, M.A.; Sanz, J.; Ibarra, J.; Torres, L.M.
1997-01-01
Nuclear magnetic resonance and electrical conductivity measurements are conducted to study the dynamics of the ionic diffusion process in the crystalline ionic conductor Li 0.5 La 0.5 TiO 3 . dc conductivity shows a non-Arrhenius temperature dependence, similar to the one recently reported for some ionic conducting glasses. Spin-lattice and conductivity relaxations are analyzed in the same frequency and temperature range in terms of the non-Arrhenius dependence of the correlation time. Both relaxations are then described using a single correlation function of the form f(t)=exp(-(t/τ) β ), with β=0.4 over the whole temperature range. copyright 1997 The American Physical Society
International Nuclear Information System (INIS)
Kishimoto, Akira; Ayano, Keiko; Hayashi, Hidetaka
2011-01-01
Ionic conductivity in yttria-stabilized zirconia ceramics under millimeter-wave irradiation heating was compared with that obtained using conventional heating. The former was found to result in higher conductivity than the latter. Enhancement of the ionic conductivity and the reduction in activation energy seemed to depend on self-heating resulting from the millimeter-wave irradiation. Millimeter-wave irradiation heating restricted the degradation in conductivity accompanying over-substitution, suggesting the optimum structure that provided the maximum conductivity could be different between the two heating methods.
Induced voltage due to time-dependent magnetisation textures
International Nuclear Information System (INIS)
Kudtarkar, Santosh Kumar; Dhadwal, Renu
2010-01-01
We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.
Dual patch voltage clamp study of low membrane resistance astrocytes in situ.
Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min
2014-03-17
Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Bikos, Dimitri A; Mason, Thomas G
2018-01-01
When determining the electric field E acting on charged objects in gel electrophoresis, the electrical conductivity of the buffer solution is often overlooked; E is typically calculated by dividing the applied voltage by a separation distance between electrodes. However, as a consequence of electrolytic reactions, which occur at the electrodes, gradients in the ionic content of the buffer solution and its conductivity can potentially develop over time, thereby impacting E and affecting propagation velocities of charged objects, v, directly. Here, we explore how the types and concentrations of ionic constituents of the buffer solution, which largely control its conductivity, when used in passivated gel electrophoresis (P-gelEP), can influence E, thereby altering v of charged nanospheres propagating through large-pore gels. We measure the conductivity of the buffer solution in the center of the gel region near propagating bands of nanospheres, and we show that predictions of E based on conductivity closely correlate with v. We also explore P-gelEP involving two different types of passivation agents: nonionic polyethylene glycol (PEG) and anionic sodium dodecyl sulfate (SDS). Our observations indicate that using a conductivity model to determine E from the local current density and the conductivity where spheres are propagating can lead to a better estimate than the standard approach of a voltage divided by a separation. Moreover, this conductivity model also provides a starting point for interpreting the complex behavior created by amphiphilic ionic passivation agents, such as SDS, on propagating nanospheres used in some P-gelEP experiments. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Das, S.; Ghosh, A.
2016-05-01
We have studied ionic conductivity and dielectric permittivity of PEO-LiClO4 solid polymer electrolyte plasticized with polyethylene glycol (PEG). The temperature dependence of the ionic conductivity has been well interpreted using Vogel-Tamman-Fulcher equation. The maximum dielectric constant is observed for 30 wt. % of PEG content. To get further insights into the ion dynamics, the complex dielectric permittivity has been studied with Havriliak-Negami function. The variation of relaxation time with inverse temperature obtained from HN formalism follows VTF nature.
Ionic conductivity studies of gel polyelectrolyte based on ionic liquid
Energy Technology Data Exchange (ETDEWEB)
Cha, E.H. [The Faculty of Liberal Arts (Chemistry), Hoseo University, Asan Choongnam 336-795 (Korea); Lim, S.A. [Functional Proteomics Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea); Park, J.H. [Department of Herbal Medicine, Hoseo University, Asan Choongnam 336-795 (Korea); Kim, D.W. [Department of Chemical Technology, Han Bat National University, Daejon 305-719 (Korea); Macfarlane, D.R. [School of Chemistry, Monash University, Clayton, Vic. 3800 (Australia)
2008-04-01
Novel lithium polyelectrolyte-ionic liquids have been prepared and characterized of their properties. Poly(lithium 2-acrylamido-2-methyl propanesulfonate) (PAMPSLi) and its copolymer with N-vinyl formamide (VF) also has been prepared as a copolymer. 1-Ethyl-3-methylimidazolium tricyanomethanide (emImTCM) and N,N-dimethyl-N-propyl-N-butyl ammonium tricyanomethanide (N{sub 1134}TCM) which are chosen because of the same with the anion of ionic liquid were prepared. The ionic conductivity of copolymer system (PAMPSLi/PVF/emImTCM: 5.43 x 10{sup -3} S cm{sup -1} at 25 C) exhibits about over four times higher than that of homopolymer system (PAMPSLi/emImTCM: 1.28 x 10{sup -3} S cm{sup -1} at 25 C). Introduction of vinyl formamide into the copolymer type can increase the dissociation of the lithium cations from the polymer backbone. The ionic conductivity of copolymer with emImTCM (PAMPSLi/PVF/emImTCM) exhibits the higher conductivity than that of PAMPSLi/PVF/N{sub 1134}TCM (2.48 x 10{sup -3} S cm{sup -1}). Because of using the polymerizable anion it is seen to maintain high flexibility of imidazolium cation effectively to exhibit the higher conductivity. And also the viscosity of emImTCM (19.56 cP) is lower than that of N{sub 1134}TCM (28.61 cP). Low viscosity leads to a fast rate of diffusion of redox species. (author)
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Susman, S.; Volin, K.J.
Described is an ionically conducting glass for use as a solid electrolyte in a power or secondary cell containing an alkali metal-containing anode and a cathode separated by an alkali metal ion conducting glass having an ionic transference number of unity and the general formula: A/sub 1 + x/D/sub 2-x/3/Si/sub x/P/sub 3 - x/O/sub 12 - 2x/3/, wherein A is a network modifier for the glass and is an alkali metal of the anode, D is an intermediate for the glass and is selected from the class consisting of Zr, Ti, Ge, Al, Sb, Be, and Zn and X is in the range of from 2.25 to 3.0. Of the alkali metals, Na and Li are preferred and of the intermediate, Zr, Ti and Ge are preferred.
Ionic conductivity and complexation in liquid dielectrics
International Nuclear Information System (INIS)
Zhakin, Anatolii I
2003-01-01
Electronic and ionic conductivity in nonpolar liquids is reviewed. Theoretical results on ionic complexation (formation of ion pairs and triplets, dipole-dipole chains, ion-dipole clusters) in liquid dielectrics in an intense external electric field are considered, and the relation between the complexation process and ionic conductivity is discussed. Experimental results supporting the possibility of complexation are presented and compared with theoretical calculations. Onsager's theory about the effect of an intense external electric field on ion-pair dissociation is corrected for the finite size of ions. (reviews of topical problems)
Energy Technology Data Exchange (ETDEWEB)
Itoh, Takahito; Hamaguchi, Yohei; Uno, Takahiro; Kubo, Masataka [Department of Chemistry for Materials, Faculty of Engineering, Mie University, 1577 Kurima Machiya-cho, Tsu, Mie 514-8507 (Japan); Aihara, Yuichi; Sonai, Atsuo [Samsung Yokohama Research Institute, 2-7 Sugasawa-cho, Tsurumi-ku, Yokohama 230-0027 (Japan)
2006-01-16
Hyperbranched polymer (poly-1a) with sulfonic acid groups at the end of chains was successfully synthesized. Interpenetration reaction of poly-1a with a hyperbranched polymer with acryloyl groups at the end of chains (poly-1b) as a cross-linker afforded a tough electrolyte membrane. The poly-1a and the resulting electrolyte membrane showed the ionic conductivities of 7x10{sup -4} and 8x10{sup -5} S/cm, respectively, at 150C under dry condition. The ionic conductivities of the poly-1a and the electrolyte membrane exhibited the VTF type temperature dependence. And also, both poly-1a and the resulting electrolyte membrane were thermally stable up to 200C. (author)
Influence of Ambient Humidity on the Voltage Response of Ionic Polymer-Metal Composite Sensor.
Zhu, Zicai; Horiuchi, Tetsuya; Kruusamäe, Karl; Chang, Longfei; Asaka, Kinji
2016-03-31
Electrical potential based on ion migration exists not only in natural systems but also in ionic polymer materials. In order to investigate the influence of ambient humidity on voltage response, classical Au-Nafion IPMC was chosen as the reference sample. Voltage response under a bending deformation was measured in two ways: first, continuous measurement of voltage response in the process of absorption and desorption of water to study the tendency of voltage variation at all water states; second, measurements at multiple fixed ambient humidity levels to characterize the process of voltage response quantitatively. Ambient humidity influences the voltage response mainly by varying water content in ionic polymer. Under a step bending, the amplitude of initial voltage peak first increases and then decreases as the ambient humidity and the inherent water content decrease. This tendency is explained semiquantitatively by mass storage capacity related to the stretchable state of the Nafion polymer network. Following the initial peak, the voltage shows a slow decay to a steady state, which is first characterized in this paper. The relative voltage decay during the steady state always decreases as the ambient humidity is lowered. It is ascribed to progressive increase of the ratio between the water molecules in the cation hydration shell to the free water. Under sinusoidal mechanical bending excitation in the range of 0.1-10 Hz, the voltage magnitude increases with frequency at high ambient humidity but decreases with frequency at low ambient humidity. The relationship is mainly controlled by the voltage decay effect and the response speed.
Ionic conductivity in aqueous solutions: deuterium isotope effect
International Nuclear Information System (INIS)
Samanta, Alok; Ghosh, Swapan K.
1997-01-01
A simple theoretical investigation of the calculation of ionic conductivity in aqueous solution is presented. The dipolar hard sphere model for the solvent which has been successful elsewhere has been employed here and it has been possible to reproduce the experimental results quite accurately for both water and heavy water using only two parameters. In a more detailed theoretical approach one should employ better models for water with proper account of its vibrations, liberations and also hydrogen bonding. It is also of interest to study the temperature effect and the concentration dependence of the conductivity. The time-dependent friction can also be calculated from the present formalism and be used for the study of isotope effect in proton transfer reactions or other aspects of chemical dynamics
Ionic conducting poly-benzimidazoles; Polybenzimidazoles conducteurs ioniques
Energy Technology Data Exchange (ETDEWEB)
Jouanneau, J
2006-11-15
Over the last years, many research works have been focused on new clean energy systems. Hydrogen fuel cell seems to be the most promising one. However, the large scale development of this technology is still limited by some key elements. One of them is the polymer electrolyte membrane 'Nafion' currently used, for which the ratio performance/cost is too low. The investigations we carried out during this thesis work are related to a new class of ionic conducting polymer, the sulfonated poly-benzimidazoles (sPBI). Poly-benzimidazoles (PBI) are aromatic heterocyclic polymers well-known for their excellent thermal and chemical stability. Ionic conduction properties are obtained by having strong acid groups (sulfonic acid SO{sub 3}H) on the macromolecular structure. For that purpose, we first synthesized sulfonated monomers. Their poly-condensation with an appropriate non-sulfonated co-monomer yields to sPBI with sulfonation range from 0 to 100 per cent. Three different sPBI structures were obtained, and verified by appropriate analytical techniques. We also showed that the protocol used for the synthesis resulted in high molecular weights polymers. We prepared ionic conducting membrane by casting sPBI solutions on glass plates. Their properties of stability, water swelling and ionic conductivity were investigated. Surprisingly, the behaviour of sPBI was quite different from the other sulfonated aromatic polymers with same amount of SO{sub 3}H, their stability was much higher, but their water swelling and ionic conductivity were quite low. We attributed these differences to strong ionic interactions between the sulfonic acid groups and the basic benzimidazole groups of our polymers. However, we managed to solve this problem synthesizing very highly sulfonated PBI, obtaining membranes with a good balance between all the properties necessary. (author)
Study of the ionic conduction mechanism based on carboxymethyl cellulose biopolymer electrolytes
Energy Technology Data Exchange (ETDEWEB)
Samsudin, A. S.; Isa, M. I. N. [Universiti Malaysia Terengganu, Terengganu (Mali)
2014-11-15
Biodegradable carboxymethyl cellulose (CMC) doped with various compositions of NH{sub 4}Br biopolymer electrolytes (BE) were successfully prepared via a solution-cast technique. The ionic conductivity for the CMC-NH{sub 4}Br BE system was measured by using impedance spectroscopy, and the highest ambient temperature conductivity was observed to be 1.12 x 10{sup -4} S cm{sup -1} for the sample containing 25-wt.% NH{sub 4}Br. The temperature dependence of the ionic conductivity revealed that the BE system followed an Arrhenius behavior. Jonscher's universal power law was applied to analyze the AC conductivity of the highest conducting sample in the BE system, and the results indicate that the conduction is due to small polaron hopping (SPH) caused by a non-adiabatic mechanism.
Vector spin modeling for magnetic tunnel junctions with voltage dependent effects
International Nuclear Information System (INIS)
Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.
2014-01-01
Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
Determination of proton conductivity of ionic liquids for fuel cell applications
Energy Technology Data Exchange (ETDEWEB)
Wallnofer, E.; Baumgartner, W.R.; Hacker, V. [Graz Univ. of Technology, Graz (Austria). Inst. for Chemistry and Technology of Inorganic Material
2006-07-01
Hydrogen fuel cells operating at temperatures of between 100 and 200 degrees C allow the catalyst to tolerate higher levels of carbon monoxide (CO) impurities. However, the number of possible materials for high temperature fuel cell electrolytes or membranes is limited. This study examined the relevant electrochemical properties of different ion liquids with specific reference to neutralized imidazole derivates with a dominant Grotthuss mechanism of proton conduction. The electrochemical stability of the ionic liquids was measured by cyclic voltammetry (CV) under nitrogen. Proton conductivity was measured under hydrogen by CV within the electrochemical limits. Hydrogen was dissolved at the anode, transported through the ionic liquid, and recombined at the cathode, so that the detected current could indicate the amount of transported hydrogen. Electrochemical impedance spectroscopy (EIS) was used to measure the frequency dependent behaviour of the ionic liquids. All measurements were conducted at 50, 100, and 150 degrees C. Results of the study showed that proton conductivity increased with higher temperatures. It was concluded that neutralized imidazole derivates with optimized side chains of the cation may prove to be a viable alternative to conventional fuel cell electrolytes. 4 refs., 2 figs.
Inhibition of large conductance calcium-dependent potassium ...
African Journals Online (AJOL)
conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.
High H⁻ ionic conductivity in barium hydride.
Verbraeken, Maarten C; Cheung, Chaksum; Suard, Emmanuelle; Irvine, John T S
2015-01-01
With hydrogen being seen as a key renewable energy vector, the search for materials exhibiting fast hydrogen transport becomes ever more important. Not only do hydrogen storage materials require high mobility of hydrogen in the solid state, but the efficiency of electrochemical devices is also largely determined by fast ionic transport. Although the heavy alkaline-earth hydrides are of limited interest for their hydrogen storage potential, owing to low gravimetric densities, their ionic nature may prove useful in new electrochemical applications, especially as an ionically conducting electrolyte material. Here we show that barium hydride shows fast pure ionic transport of hydride ions (H(-)) in the high-temperature, high-symmetry phase. Although some conductivity studies have been reported on related materials previously, the nature of the charge carriers has not been determined. BaH2 gives rise to hydride ion conductivity of 0.2 S cm(-1) at 630 °C. This is an order of magnitude larger than that of state-of-the-art proton-conducting perovskites or oxide ion conductors at this temperature. These results suggest that the alkaline-earth hydrides form an important new family of materials, with potential use in a number of applications, such as separation membranes, electrochemical reactors and so on.
Crystal Structure-Ionic Conductivity Relationships in Doped Ceria Systems
DEFF Research Database (Denmark)
Omar, Shobit; Wachsman, Eric D.; Jones, Jacob L.
2009-01-01
lattice strain of 10 mol% trivalent cation-doped ceria systems at the same temperatures. A consistent set of ionic conductivity data is developed, where the samples are synthesized under similar experimental conditions. On comparing the grain ionic conductivity, Nd0.10Ce0.90O2−δ exhibits the highest ionic...... conductivity among other doped ceria systems. The grain ionic conductivity is around 17% higher than that of Gd0.10Ce0.90O2−δ at 500°C, in air. X-ray diffraction profiles are collected on the sintered powder of all the compositions, from room temperature to 600°C, in air. From the lattice expansion data...... at high temperatures, the minimal elastic strain due to the presence of dopant is observed in Dy0.10Ce0.90O2−δ. Nd0.10Ce0.90O2−δ exhibits larger elastic lattice strain than Dy0.10Ce0.90O2−δ with better ionic conductivity at intermediate temperatures. Therefore, it is shown that the previously proposed...
Enhancement in ionic conductivity on solid polymer electrolytes containing large conducting species
Energy Technology Data Exchange (ETDEWEB)
Praveen, D. [Department of Physics, Amrita Viswha Vidyapeetham, Bangalore, India, E-mail: d-praveen@blr.amrita.edu (India); Damle, Ramakrishna [Department of Physics, Bangalore University, Bangalore, India. E-mail: ramkrishnadamle@bub.ernet.in (India)
2016-05-23
Solid Polymer Electrolytes (SPEs) lack better conducting properties at ambient temperatures. Various methods to enhance their ionic conductivity like irradiation with swift heavy ions, γ-rays, swift electrons and quenching at low temperature etc., have been explored in the literature. Among these, one of the oldest methods is incorporation of different conducting species into the polymer matrix and/or addition of nano-sized inert particles into SPEs. Various new salts like LiBr, Mg(ClO{sub 4}){sub 2}, NH{sub 4}I etc., have already been tried in the past with some success. Also various nanoparticles like Al{sub 2}O{sub 3}, TiO{sub 2} etc., have been tried in the past. In this article, we have investigated an SPE containing Rubidium as a conducting species. Rubidium has a larger ionic size compared to lithium and sodium ions which have been investigated in the recent past. In the present article, we have investigated the conductivity of large sized conducting species and shown the enhancement in the ionic conductivity by addition of nano-sized inert particles.
Enhancement in ionic conductivity on solid polymer electrolytes containing large conducting species
International Nuclear Information System (INIS)
Praveen, D.; Damle, Ramakrishna
2016-01-01
Solid Polymer Electrolytes (SPEs) lack better conducting properties at ambient temperatures. Various methods to enhance their ionic conductivity like irradiation with swift heavy ions, γ-rays, swift electrons and quenching at low temperature etc., have been explored in the literature. Among these, one of the oldest methods is incorporation of different conducting species into the polymer matrix and/or addition of nano-sized inert particles into SPEs. Various new salts like LiBr, Mg(ClO_4)_2, NH_4I etc., have already been tried in the past with some success. Also various nanoparticles like Al_2O_3, TiO_2 etc., have been tried in the past. In this article, we have investigated an SPE containing Rubidium as a conducting species. Rubidium has a larger ionic size compared to lithium and sodium ions which have been investigated in the recent past. In the present article, we have investigated the conductivity of large sized conducting species and shown the enhancement in the ionic conductivity by addition of nano-sized inert particles.
Measurement and Correlation of the Ionic Conductivity of Ionic Liquid-Molecular Solvent Solutions
Institute of Scientific and Technical Information of China (English)
LI,Wen-Jing; HAN,Bu-Xing; TAO,Ran-Ting; ZHANG,Zhao-Fu; ZHANG,Jian-Ling
2007-01-01
The ionic conductivity of the solutions formed from 1-n-butyl-3-methylimidazolium tetrafluoroborate ([Bmim][BF4]) or 1-n-butyl-3-methylimidazolium hexafluorophosphate ([Bmim][PF6]) and different molecular solvents (MSs) were measured at 298.15 K. The molar conductivity of the ionic liquids (ILs) increased dramatically with increasing concentration of the MSs. It was found that the molar conductivity of the IL in the solutions studied in this work could be well correlated by the molar conductivity of the neat ILs and the dielectric constant and molar volume of the MSs.
Ionic thermocurrents and ionic conductivity of solid solutions of SrF2 and YbF3
Meuldijk, J.; Hartog, den H.W.
1983-01-01
We report dielectric [ionic thermocurrent (!TC)] experiments and ionic conductivity of cubic solid solutions of the type Sr1-xYbxF2+x. These combined experiments provide us with new information concerning the ionic conductivity mechanisms which play an important role in solid solutions Sr1-xRxF2+x
Intermediate state trapping of a voltage sensor
DEFF Research Database (Denmark)
Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca
2012-01-01
Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...
International Nuclear Information System (INIS)
Ogihara, Wataru; Sun Jiazeng; Forsyth, Maria; MacFarlane, Douglas R.; Yoshizawa, Masahiro; Ohno, Hiroyuki
2004-01-01
We have prepared polymer gel electrolytes with alkali metal ionic liquids (AMILs) that inherently contain alkali metal ions. The AMIL consisted of sulfate anion, imidazolium cation, and alkali metal cation. AMILs were mixed directly with poly(3-sulfopropyl acrylate) lithium salt or poly(2-acrylamido-2-methylpropanesulfonic acid) lithium salt to form polymer gels. The ionic conductivity of these gels decreased with increasing polymer fraction, as in general ionic liquid/polymer mixed systems. At low polymer concentrations, these gels displayed excellent ionic conductivity of 10 -4 to 10 -3 S cm -1 at room temperature. Gelation was found to cause little change in the 7 Li diffusion coefficient of the ionic liquid, as measured by pulse-field-gradient NMR. These data strongly suggest that the lithium cation migrates in successive pathways provided by the ionic liquids
Theoretical studies of ionic conductivity of crosslinked chitosan membranes
Energy Technology Data Exchange (ETDEWEB)
Chavez, Ernesto Lopez [Programa de Ingenieria Molecular y Nuevos Materiales, Universidad Autonoma de la Ciudad de Mexico, Fray Servando Teresa de Mier 92, 1er. Piso, Col Centro, Mexico D.F. CP 06080 (Mexico); Oviedo-Roa, R.; Contreras-Perez, Gustavo; Martinez-Magadan, Jose Manuel [Instituto Mexicano del Petroleo, Eje Central Lazaro Cardenas Norte 152, Col. San Bartolo Atepehuacan, CP 07730 Mexico D.F. (Mexico); Castillo-Alvarado, F.L. [Escuela Superior de Fisica y Matematicas del Instituto Politecnico Nacional, Edificio 9 de la UPALM, Colonia Lindavista, Mexico D.F. CP 07738 (Mexico)
2010-11-15
Ionic conductivity of crosslinked chitosan membranes was studied using techniques of molecular modeling and simulation. The COMPASS force field was used. The simulation allows the description of the mechanism of ionic conductivity along the polymer matrix. The theoretical results obtained are compared with experimental results for chitosan membranes. The analysis suggests that the conduction mechanism is portrayed by the overlapping large Polaron tunneling model. In addition, when the chitosan membrane was crosslinked with an appropriate degree of crosslinking its ionic conductivity, at room temperature, was increased by about one order of magnitude. The chitosan membranes can be used as electrolytes in solid state batteries, electric double layer capacitors and fuel cells. (author)
The graph-theoretic minimum energy path problem for ionic conduction
Directory of Open Access Journals (Sweden)
Ippei Kishida
2015-10-01
Full Text Available A new computational method was developed to analyze the ionic conduction mechanism in crystals through graph theory. The graph was organized into nodes, which represent the crystal structures modeled by ionic site occupation, and edges, which represent structure transitions via ionic jumps. We proposed a minimum energy path problem, which is similar to the shortest path problem. An effective algorithm to solve the problem was established. Since our method does not use randomized algorithm and time parameters, the computational cost to analyze conduction paths and a migration energy is very low. The power of the method was verified by applying it to α-AgI and the ionic conduction mechanism in α-AgI was revealed. The analysis using single point calculations found the minimum energy path for long-distance ionic conduction, which consists of 12 steps of ionic jumps in a unit cell. From the results, the detailed theoretical migration energy was calculated as 0.11 eV by geometry optimization and nudged elastic band method. Our method can refine candidates for possible jumps in crystals and it can be adapted to other computational methods, such as the nudged elastic band method. We expect that our method will be a powerful tool for analyzing ionic conduction mechanisms, even for large complex crystals.
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Ionic conductivity in oxide heterostructures: the role of interfaces
Directory of Open Access Journals (Sweden)
Emiliana Fabbri, Daniele Pergolesi and Enrico Traversa
2010-01-01
Full Text Available Rapidly growing attention is being directed to the investigation of ionic conductivity in oxide film heterostructures. The main reason for this interest arises from interfacial phenomena in these heterostructures and their applications. Recent results revealed that heterophase interfaces have faster ionic conduction pathways than the bulk or homophase interfaces. This finding can open attractive opportunities in the field of micro-ionic devices. The influence of the interfaces on the conduction properties of heterostructures is becoming increasingly important with the miniaturization of solid-state devices, which leads to an enhanced interface density at the expense of the bulk. This review aims to describe the main evidence of interfacial phenomena in ion-conducting film heterostructures, highlighting the fundamental and technological relevance and offering guidelines to understanding the interface conduction mechanisms in these structures.
Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J
2017-04-20
Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Fraser, James A; Huang, Christopher L-H; Pedersen, Thomas H
2011-07-01
Activation of skeletal muscle fibers requires rapid sarcolemmal action potential (AP) conduction to ensure uniform excitation along the fiber length, as well as successful tubular excitation to initiate excitation-contraction coupling. In our companion paper in this issue, Pedersen et al. (2011. J. Gen. Physiol. doi:10.1085/jgp.201010510) quantify, for subthreshold stimuli, the influence upon both surface conduction velocity and tubular (t)-system excitation of the large changes in resting membrane conductance (G(M)) that occur during repetitive AP firing. The present work extends the analysis by developing a multi-compartment modification of the charge-difference model of Fraser and Huang to provide a quantitative description of the conduction velocity of actively propagated APs; the influence of voltage-gated ion channels within the t-system; the influence of t-system APs on ionic homeostasis within the t-system; the influence of t-system ion concentration changes on membrane potentials; and the influence of Phase I and Phase II G(M) changes on these relationships. Passive conduction properties of the novel model agreed with established linear circuit analysis and previous experimental results, while key simulations of AP firing were tested against focused experimental microelectrode measurements of membrane potential. This study thereby first quantified the effects of the t-system luminal resistance and voltage-gated Na(+) channel density on surface AP propagation and the resultant electrical response of the t-system. Second, it demonstrated the influence of G(M) changes during repetitive AP firing upon surface and t-system excitability. Third, it showed that significant K(+) accumulation occurs within the t-system during repetitive AP firing and produces a baseline depolarization of the surface membrane potential. Finally, it indicated that G(M) changes during repetitive AP firing significantly influence both t-system K(+) accumulation and its influence on the
Directory of Open Access Journals (Sweden)
S. Das
2015-02-01
Full Text Available We have studied ionic conductivity and dielectric permittivity of PEO-LiClO4 solid polymer electrolyte plasticized with propylene carbonate. Differential scanning calorimetry and X-ray diffraction studies confirm minimum volume fraction of crystalline phase for the polymer electrolyte with 40 wt. % propylene carbonate. The ionic conductivity exhibits a maximum for the same composition. The temperature dependence of the ionic conductivity has been well interpreted using Vogel-Tamman-Fulcher equation. Ion-ion interactions in the polymer electrolytes have been studied using Raman spectra and the concentrations of free ions, ion-pairs and ion-aggregates have been determined. The ionic conductivity increases due to the increase of free ions with the increase of propylene carbonate content. But for higher content of propylene carbonate, the ionic conductivity decreases due to the increase of concentrations of ion-pairs and ion-aggregates. To get further insights into the ion dynamics, the experimental data for the complex dielectric permittivity have been studied using Havriliak–Negami function. The variation of relaxation time with temperature obtained from this formalism follows Vogel-Tamman-Fulcher equation similar to the ionic conductivity.
National Research Council Canada - National Science Library
Bendler, John
2001-01-01
A model, based on defect diffusion, is developed that describes temperature and pressure dependence of dielectric relaxation, ionic conductivity and viscosity of glass-forming liquids near the glass...
Robson, L; Hunter, M
1999-01-01
The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159
Ionic conductivity in irradiated KCL; Conductiviad ionica de KCL irradiado
Energy Technology Data Exchange (ETDEWEB)
Vignolo Rubio, J
1979-07-01
The ionic conductivity of X and gamma irradiated KCL single crystals has been studied between room temperature and 600 degree centigree. the radiation induced damage resulting in a decrease of the conductivity heals by thermal annealing in two steps which are at about 350 and 550 degree centigree respectively. It has been found that the radiation induced colour centres are not involved in the observed decrease of the ionic conductivity. However. It has been observed that the effects of quenching and plastic deformation on the conductivity of the samples are very similar to the effect induced by irradiation. It is suggested that, samples radiation induced dislocation loops might cause the ionic conductivity decrease observed in irradiated samples. (Author)
International Nuclear Information System (INIS)
Aram, E.; Ehsani, M.; Khonakdar, H.A.
2015-01-01
Graphical abstract: Reduced interfacial resistance of a quasi-solid-state dye sensitized solar cell with PEO/PMMA blend gel electrolytes. - Highlights: • A new polymer gel electrolyte containing PEO/PMMA was developed for DSSCs. • Optimization of polymer gel electrolyte was done for dye sensitized solar cell. • The best ionic conductivity was found in PEO/PMMA blend with 10/90 w/w composition. • The DSSC with the PEO/PMMA based electrolyte showed good photovoltaic performance. • Significant stability improvement for quasi-solid state DSSC was obtained. - Abstract: Polymer blend gel electrolytes based on polyethylene oxide (PEO) and poly(methyl methacrylate) (PMMA) as host polymers with various weight ratios, LiI/I 2 as redox couple in electrolyte and 4-tert-butyl pyridine as additive were prepared by solution method. The introduction of PMMA in the PEO gel electrolyte reduced the degree of crystallinity of PEO, which was confirmed by differential scanning calorimetry (DSC). Complexation and ionic conductivity as a function of temperature were investigated with Fourier transform infrared and ionic conductometry, respectively. A good correlation was found between the degree of crystallinity and ionic conductivity. The reduction in crystallinity, governed by blending ratio, led to improvement of ionic conductivity. The best ionic conductivity was attained in PEO/PMMA blend with 10/90 w/w composition. The performance of a quasi-solid-state dye sensitized solar cell using the optimized polymer gel electrolyte was investigated. The optimized system of high ionic conductivity of 7 mS cm −1 , with fill factor of 0.59, short-circuit density of 11.11 mA cm −2 , open-circuit voltage of 0.75 V and the conversion efficiency of 4.9% under air mass 1.5 irradiation (100 mW cm −2 ) was obtained. The long-term stability of the dye-sensitized solar cell (DSSC) during 600 h was improved by using PEO/PMMA gel electrolyte relative to a liquid type electrolyte
Energy Technology Data Exchange (ETDEWEB)
Aram, E. [Iran Polymer and Petrochemical Institute, 14965/115 Tehran (Iran, Islamic Republic of); Ehsani, M., E-mail: m.ehsani@ippi.ac.ir [Iran Polymer and Petrochemical Institute, 14965/115 Tehran (Iran, Islamic Republic of); Khonakdar, H.A. [Iran Polymer and Petrochemical Institute, 14965/115 Tehran (Iran, Islamic Republic of); Leibniz Institute of Polymer Research, D-01067 Dresden (Germany)
2015-09-10
Graphical abstract: Reduced interfacial resistance of a quasi-solid-state dye sensitized solar cell with PEO/PMMA blend gel electrolytes. - Highlights: • A new polymer gel electrolyte containing PEO/PMMA was developed for DSSCs. • Optimization of polymer gel electrolyte was done for dye sensitized solar cell. • The best ionic conductivity was found in PEO/PMMA blend with 10/90 w/w composition. • The DSSC with the PEO/PMMA based electrolyte showed good photovoltaic performance. • Significant stability improvement for quasi-solid state DSSC was obtained. - Abstract: Polymer blend gel electrolytes based on polyethylene oxide (PEO) and poly(methyl methacrylate) (PMMA) as host polymers with various weight ratios, LiI/I{sub 2} as redox couple in electrolyte and 4-tert-butyl pyridine as additive were prepared by solution method. The introduction of PMMA in the PEO gel electrolyte reduced the degree of crystallinity of PEO, which was confirmed by differential scanning calorimetry (DSC). Complexation and ionic conductivity as a function of temperature were investigated with Fourier transform infrared and ionic conductometry, respectively. A good correlation was found between the degree of crystallinity and ionic conductivity. The reduction in crystallinity, governed by blending ratio, led to improvement of ionic conductivity. The best ionic conductivity was attained in PEO/PMMA blend with 10/90 w/w composition. The performance of a quasi-solid-state dye sensitized solar cell using the optimized polymer gel electrolyte was investigated. The optimized system of high ionic conductivity of 7 mS cm{sup −1}, with fill factor of 0.59, short-circuit density of 11.11 mA cm{sup −2}, open-circuit voltage of 0.75 V and the conversion efficiency of 4.9% under air mass 1.5 irradiation (100 mW cm{sup −2}) was obtained. The long-term stability of the dye-sensitized solar cell (DSSC) during 600 h was improved by using PEO/PMMA gel electrolyte relative to a liquid type
Designing of an apparatus to measure ionic conductivity
International Nuclear Information System (INIS)
Vignolo Rubio, J.
1978-01-01
The main technical features of a rig to measure ionic conductivity in alkali halides are shown. The conductivity also can be measured while the temperature of the sample is rised at a constant rate between room temperature and 350 deg C. This is intended to search for correlations between variations in the ionic conductivity and the thermal annealing of radiation induce defects in these materials. The proportional temperature controller and programmer also allows to stabilize the sample temperature within +-0.1 degC during several hours. Some measurements in KCl (Harshaw) were made in order to check the reliability of the apparatus. (author)
International Nuclear Information System (INIS)
Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu
2015-01-01
Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)
Lithium conducting ionic liquids based on lithium borate salts
Energy Technology Data Exchange (ETDEWEB)
Zygadlo-Monikowska, E.; Florjanczyk, Z.; Sluzewska, K.; Ostrowska, J.; Langwald, N.; Tomaszewska, A. [Warsaw University of Technology, Faculty of Chemistry, ul. Noakowskiego 3, 00-664 Warsaw (Poland)
2010-09-15
The simple reaction of trialkoxyborates with butyllithium resulted in the obtaining of new lithium borate salts: Li{l_brace}[CH{sub 3}(OCH{sub 2}CH{sub 2}){sub n}O]{sub 3}BC{sub 4}H{sub 9}{r_brace}, containing oxyethylene substituents (EO) of n=1, 2, 3 and 7. Salts of n {>=} 2 show properties of room temperature ionic liquid (RTIL) of low glass transition temperature, T{sub g} of the order from -70 to -80 C. The ionic conductivity of the salts depends on the number of EO units, the highest conductivity is shown by the salt with n = 3; in bulk its ambient temperature conductivity is 2 x 10{sup -5} S cm{sup -1} and in solution in cyclic propylene sulfite or EC/PC mixture, conductivity increases by an order of magnitude. Solid polymer electrolytes with borate salts over a wide concentration range, from 10 to 90 mol.% were obtained and characterized. Three types of polymeric matrices: poly(ethylene oxide) (PEO), poly(trimethylene carbonate) (PTMC) and two copolymers of acrylonitrile and butyl acrylate p(AN-BuA) were used in them as polymer matrices. It has been found that for systems of low salt concentration (10 mol.%) the best conducting properties were shown by solid polymer electrolytes with PEO, whereas for systems of high salt concentration, of the polymer-in-salt type, good results were achieved for PTMC as polymer matrix. (author)
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Composite materials with ionic conductivity: from inorganic composites to hybrid membranes
Energy Technology Data Exchange (ETDEWEB)
Yaroslavtsev, Andrei B [N.S. Kurnakov Institute of General and Inorganic Chemistry, Russian Academy of Sciences, Moscow (Russian Federation)
2009-11-30
Information on composite materials with ionic conductivity including inorganic composites and hybrid polymeric ion exchange membranes containing inorganic or polymeric nanoparticles is generalized. The nature of the effect of increase in the ionic conductivity in this type of materials and the key approaches used for theoretical estimation of the conductivity are considered. Data on the ionic conductivity and some other important properties of composites and membrane materials are presented. Prospects for utilization of composite materials and hybrid membranes in hydrogen power engineering are briefly outlined.
Energy Technology Data Exchange (ETDEWEB)
Das, S.; Ghosh, A., E-mail: sspag@iacs.res.in [Department of Solid State Physics, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700032 (India)
2015-02-15
We have studied ionic conductivity and dielectric permittivity of PEO-LiClO{sub 4} solid polymer electrolyte plasticized with propylene carbonate. Differential scanning calorimetry and X-ray diffraction studies confirm minimum volume fraction of crystalline phase for the polymer electrolyte with 40 wt. % propylene carbonate. The ionic conductivity exhibits a maximum for the same composition. The temperature dependence of the ionic conductivity has been well interpreted using Vogel-Tamman-Fulcher equation. Ion-ion interactions in the polymer electrolytes have been studied using Raman spectra and the concentrations of free ions, ion-pairs and ion-aggregates have been determined. The ionic conductivity increases due to the increase of free ions with the increase of propylene carbonate content. But for higher content of propylene carbonate, the ionic conductivity decreases due to the increase of concentrations of ion-pairs and ion-aggregates. To get further insights into the ion dynamics, the experimental data for the complex dielectric permittivity have been studied using Havriliak–Negami function. The variation of relaxation time with temperature obtained from this formalism follows Vogel-Tamman-Fulcher equation similar to the ionic conductivity.
Energy Technology Data Exchange (ETDEWEB)
Martinez, Mathieu; Cointeaux, Laure; Iojoiu, Cristina; Lepretre, Jean-Claude; Sanchez, Jean-Yves [LEPMI, UMR 5631, CNRS-INP-UJF, PHELMA-Campus, BP.75, 1130 rue de la Piscine, 38402 Saint-Martin-d' Heres Cedex (France); Molmeret, Yannick; El Kissi, Nadia [Laboratoire de Rheologie, UMR 5520 CNRS-INPG-UJF, ENSHMG, BP 53, 38041 Grenoble (France); Judeinstein, Patrick [Institut de Chimie Moleculaire et des Materiaux d' Orsay (UMR 8182), Batiment 410, Universite Paris-Sud 11, 91405 Orsay Cedex (France)
2010-09-15
The paper deals with the synthesis and characterisation of proton-conducting ionic liquids (PCILs) and their polymer electrolytes obtained by blending modified Nafion membranes with different concentrations of PCILs. The PCILs are obtained by the neutralization of triethylamine with different organic acids. The first part of the paper studies the influence of acidity and acid structure on PCIL thermal and electrochemical performance, while the second part examines membrane conductivity and reveals it to depend more on PCIL structure than on its intrinsic conductivity. At 130 C, conductivities exceeding 10 mS cm{sup -1} were obtained in fully anhydrous conditions. (author)
International Nuclear Information System (INIS)
Ramesh, S.; Liew, Chiam-Wen; Morris, Ezra; Durairaj, R.
2010-01-01
In this paper, temperature dependence of ionic conductivity, crystallographic structural, morphological and thermal characteristics of polymer blends of PMMA and PVC with lithium bis(trifluoromethanesulfonyl) imide (LiTFSI) as a dopant salt are investigated. The study on the temperature dependence of ionic conductivity shows that these polymer blends exhibit Arrhenius behavior. The highest ionic conductivity was achieved when 70 wt% of PMMA was blended with 30 wt% of PVC. X-ray diffraction (XRD) and scanning electron microscopy (SEM) reveal the amorphous nature and surface morphology of polymer electrolytes, respectively. In DSC analysis it was found that the glass transition temperature (T g ) and melting temperature (T m ) decreased, whereas the decomposition temperature (T d ) increased. In contrast, the shift towards higher decomposition temperature and decrease in weight loss of polymer electrolytes, in TGA studies, indicates that the thermal stability of polymer electrolytes improved.
Parameswaran, V; Nallamuthu, N; Devendran, P; Manikandan, A; Nagarajan, E R
2018-06-01
Biodegradable polymer blend electrolyte based on ammonium based salt in variation composition consisting of PVA:PVP were prepared by using solution casting technique. The obtained films have been analyzed by various technical methods like as XRD, FT-IR, TG-DSC, SEM analysis and impedance spectroscopy. The XRD and FT-IR analysis exposed the amorphous nature and structural properties of the complex formation between PVA/PVP/NH4Br. Impedance spectroscopy analysis revealed the ionic conductivity and the dielectric properties of PVA/PVP/NH4Br polymer blend electrolyte films. The maximum ionic conductivity was determined to be 6.14 × 10-5 Scm-1 for the composition of 50%PVA: 50%PVP: 10% NH4Br with low activation energy 0.3457 eV at room temperature. Solid state battery is fabricated using highest ionic conducting polymer blend as electrolyte with the configuration Zn/ZnSO4 · 7H2O (anode) ∥ 50%PVA: 50%PVP: 10% NH4Br ∥ Mn2O3 (cathode). The observed open circuit voltage is 1.2 V and its performance has been studied.
Understanding the ionic conductivity maximum in doped ceria: trapping and blocking.
Koettgen, Julius; Grieshammer, Steffen; Hein, Philipp; Grope, Benjamin O H; Nakayama, Masanobu; Martin, Manfred
2018-02-26
Materials with high oxygen ion conductivity and low electronic conductivity are required for electrolytes in solid oxide fuel cells (SOFC) and high-temperature electrolysis (SOEC). A potential candidate for the electrolytes, which separate oxidation and reduction processes, is rare-earth doped ceria. The prediction of the ionic conductivity of the electrolytes and a better understanding of the underlying atomistic mechanisms provide an important contribution to the future of sustainable and efficient energy conversion and storage. The central aim of this paper is the detailed investigation of the relationship between defect interactions at the microscopic level and the macroscopic oxygen ion conductivity in the bulk of doped ceria. By combining ab initio density functional theory (DFT) with Kinetic Monte Carlo (KMC) simulations, the oxygen ion conductivity is predicted as a function of the doping concentration. Migration barriers are analyzed for energy contributions, which are caused by the interactions of dopants and vacancies with the migrating oxygen vacancy. We clearly distinguish between energy contributions that are either uniform for forward and backward jumps or favor one migration direction over the reverse direction. If the presence of a dopant changes the migration energy identically for forward and backward jumps, the resulting energy contribution is referred to as blocking. If the change in migration energy due to doping is different for forward and backward jumps of a specific ionic configuration, the resulting energy contributions are referred to as trapping. The influence of both effects on the ionic conductivity is analyzed: blocking determines the dopant fraction where the ionic conductivity exhibits the maximum. Trapping limits the maximum ionic conductivity value. In this way, a deeper understanding of the underlying mechanisms determining the influence of dopants on the ionic conductivity is obtained and the ionic conductivity is predicted
Highly Confined Electronic and Ionic Conduction in Oxide Heterostructures
DEFF Research Database (Denmark)
Pryds, Nini
2015-01-01
The conductance confined at the interface of complex oxide heterostructures provides new opportunities to explore nanoelectronic as well as nanoionic devices. In this talk I will present our recent results both on ionic and electronic conductivity at different heterostructures systems. In the first...... unattainable for Bi2O3-based materials, is achieved[1]. These confined heterostructures provide a playground not only for new high ionic conductivity phenomena that are sufficiently stable but also uncover a large variety of possible technological perspectives. At the second part, I will discuss and show our...
Electrical actuation of electrically conducting and insulating droplets using ac and dc voltages
International Nuclear Information System (INIS)
Kumari, N; Bahadur, V; Garimella, S V
2008-01-01
Electrical actuation of liquid droplets at the microscale offers promising applications in the fields of microfluidics and lab-on-chip devices. Much prior research has targeted the electrical actuation of electrically conducting liquid droplets using dc voltages (classical electrowetting). Electrical actuation of conducting droplets using ac voltages and the actuation of insulating droplets (using dc or ac voltages) has remained relatively unexplored. This paper utilizes an energy-minimization-based analytical framework to study the electrical actuation of a liquid droplet (electrically conducting or insulating) under ac actuation. It is shown that the electromechanical regimes of classical electrowetting, electrowetting under ac actuation and insulating droplet actuation can be extracted from the generic electromechanical actuation framework, depending on the electrical properties of the droplet, the underlying dielectric layer and the frequency of the actuation voltage. This paper also presents experiments which quantify the influence of the ac frequency and the electrical properties of the droplet on its velocity under electrical actuation. The velocities of droplets moving between two parallel plates under ac actuation are experimentally measured; these velocities are then related to the actuation force on the droplet which is predicted by the electromechanical model developed in this work. It is seen that the droplet velocities are strongly dependent on the frequency of the ac actuation voltage; the cut-off ac frequency, above which the droplet fails to actuate, is experimentally determined and related to the electrical conductivity of the liquid. This paper then analyzes and directly compares the various electromechanical regimes for the actuation of droplets in microfluidic applications
Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.
Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio
2016-11-17
Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.
Energy Technology Data Exchange (ETDEWEB)
Ramesh, S., E-mail: rameshtsubra@gmail.com [Centre for Ionics University Malaya, Department of Physics, Faculty of Science, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia); Liew, Chiam-Wen; Morris, Ezra; Durairaj, R. [Faculty of Engineering and Science, Universiti Tunku Abdul Rahman, Setapak, 53300 Kuala Lumpur (Malaysia)
2010-11-20
In this paper, temperature dependence of ionic conductivity, crystallographic structural, morphological and thermal characteristics of polymer blends of PMMA and PVC with lithium bis(trifluoromethanesulfonyl) imide (LiTFSI) as a dopant salt are investigated. The study on the temperature dependence of ionic conductivity shows that these polymer blends exhibit Arrhenius behavior. The highest ionic conductivity was achieved when 70 wt% of PMMA was blended with 30 wt% of PVC. X-ray diffraction (XRD) and scanning electron microscopy (SEM) reveal the amorphous nature and surface morphology of polymer electrolytes, respectively. In DSC analysis it was found that the glass transition temperature (T{sub g}) and melting temperature (T{sub m}) decreased, whereas the decomposition temperature (T{sub d}) increased. In contrast, the shift towards higher decomposition temperature and decrease in weight loss of polymer electrolytes, in TGA studies, indicates that the thermal stability of polymer electrolytes improved.
Sun, Liyuan; Morales-Collazo, Oscar; Xia, Han; Brennecke, Joan F
2015-12-03
A series of room temperature ionic liquids (RTILs) based on 1-ethyl-3-methylimidazolium ([emim](+)) with different aprotic heterocyclic anions (AHAs) were synthesized and characterized as potential electrolyte candidates for lithium ion batteries. The density and transport properties of these ILs were measured over the temperature range between 283.15 and 343.15 K at ambient pressure. The temperature dependence of the transport properties (viscosity, ionic conductivity, self-diffusion coefficient, and molar conductivity) is fit well by the Vogel-Fulcher-Tamman (VFT) equation. The best-fit VFT parameters, as well as linear fits to the density, are reported. The ionicity of these ILs was quantified by the ratio of the molar conductivity obtained from the ionic conductivity and molar concentration to that calculated from the self-diffusion coefficients using the Nernst-Einstein equation. The results of this study, which is based on ILs composed of both a planar cation and planar anions, show that many of the [emim][AHA] ILs exhibit very good conductivity for their viscosities and provide insight into the design of ILs with enhanced dynamics that may be suitable for electrolyte applications.
Improved ionic conductivity of lithium-zinc-tellurite glass-ceramic electrolytes
Directory of Open Access Journals (Sweden)
W. Widanarto
Full Text Available An enhancement in the secondary battery safety demands the optimum synthesis of glass-ceramics electrolytes with modified ionic conductivity. To achieve improved ionic conductivity and safer operation of the battery, we synthesized Li2O included zinc-tellurite glass-ceramics based electrolytes of chemical composition (85-xTeO2·xLi2O·15ZnO, where x = 0, 5, 10, 15 mol%. Samples were prepared using the melt quenching method at 800 °C followed by thermal annealing at 320 °C for 3 h and characterized. The effects of varying temperature, alternating current (AC frequency and Li2O concentration on the structure and ionic conductivity of such glass-ceramics were determined. The SEM images of the annealed glass-ceramic electrolytes displayed rough surface with a uniform distribution of nucleated crystal flakes with sizes less than 1 μm. X-ray diffraction analysis confirmed the well crystalline nature of achieved electrolytes. Incorporation of Li2O in the electrolytes was found to generate some new crystalline phases including hexagonal Li6(TeO6, monoclinic Zn2Te3O8 and monoclinic Li2Te2O5. The estimated crystallite size of the electrolyte was ranged from ≈40 to 80 nm. AC impedance measurement revealed that the variation in the temperatures, Li2O contents, and high AC frequencies have a significant influence on the ionic conductivity of the electrolytes. Furthermore, electrolyte doped with 15 mol% of Li2O exhibited the optimum performance with an ionic conductivity ≈2.4 × 10−7 S cm−1 at the frequency of 54 Hz and in the temperature range of 323–473 K. This enhancement in the conductivity was attributed to the sizable alteration in the ions vibration and ruptures of covalent bonds in the electrolytes network structures. Keywords: Zinc-tellurite, Glass-ceramics, X-ray diffraction, Ionic conductivity, Lithium oxide
Conductivity-Relaxation Relations in Nanocomposite Polymer Electrolytes Containing Ionic Liquid.
Shojaatalhosseini, Mansoureh; Elamin, Khalid; Swenson, Jan
2017-10-19
In this study, we have used nanocomposite polymer electrolytes, consisting of poly(ethylene oxide) (PEO), δ-Al 2 O 3 nanoparticles, and lithium bis(trifluoromethanesolfonyl)imide (LiTFSI) salt (with 4 wt % δ-Al 2 O 3 and PEO:Li ratios of 16:1 and 8:1), and added different amounts of the ionic liquid 1-butyl-3-methylimidazolium bis(trifluoromethanesolfonyl)imide (BMITFSI). The aim was to elucidate whether the ionic liquid is able to dissociate the Li-ions from the ether oxygens and thereby decouple the ionic conductivity from the segmental polymer dynamics. The results from DSC and dielectric spectroscopy show that the ionic liquid speeds up both the segmental polymer dynamics and the motion of the Li + ions. However, a close comparison between the structural (α) relaxation process, given by the segmental polymer dynamics, and the ionic conductivity shows that the motion of the Li + ions decouples from the segmental polymer dynamics at higher concentrations of the ionic liquid (≥20 wt %) and instead becomes more related to the viscosity of the ionic liquid. This decoupling increases with decreasing temperature. In addition to the structural α-relaxation, two more local relaxation processes, denoted β and γ, are observed. The β-relaxation becomes slightly faster at the highest concentration of the ionic liquid (at least for the lower salt concentration), whereas the γ-relaxation is unaffected by the ionic liquid, over the whole concentration range 0-40 wt %.
Conductivity-Dependent Flow Field-Flow Fractionation of Fulvic and Humic Acid Aggregates
Directory of Open Access Journals (Sweden)
Martha J. M. Wells
2015-09-01
Full Text Available Fulvic (FAs and humic acids (HAs are chemically fascinating. In water, they have a strong propensity to aggregate, but this research reveals that tendency is regulated by ionic strength. In the environment, conductivity extremes occur naturally—freshwater to seawater—warranting consideration at low and high values. The flow field flow fractionation (flow FFF of FAs and HAs is observed to be concentration dependent in low ionic strength solutions whereas the corresponding flow FFF fractograms in high ionic strength solutions are concentration independent. Dynamic light scattering (DLS also reveals insight into the conductivity-dependent behavior of humic substances (HSs. Four particle size ranges for FAs and humic acid aggregates are examined: (1 <10 nm; (2 10 nm–6 µm; (3 6–100 µm; and (4 >100 µm. Representative components of the different size ranges are observed to dynamically coexist in solution. The character of the various aggregates observed—such as random-extended-coiled macromolecules, hydrogels, supramolecular, and micellar—as influenced by electrolytic conductivity, is discussed. The disaggregation/aggregation of HSs is proposed to be a dynamic equilibrium process for which the rate of aggregate formation is controlled by the electrolytic conductivity of the solution.
Directory of Open Access Journals (Sweden)
Rajeev Gupta
2017-06-01
Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
International Nuclear Information System (INIS)
Liu, Qing-Shan; Li, Pei-Pei; Welz-Biermann, Urs; Chen, Jian; Liu, Xiao-Xia
2013-01-01
Highlights: • Targets of this research are hydrophobic series ionic liquids. • Density, dynamic viscosity and electrical conductivity were determined. • Influences of methylene to properties were discussed. • Influences of methyl group on pyridinium ring position to properties were discussed. • Relationship of ρ, η and σ were described systematically. -- Abstract: Air and water stable hydrophobic ionic liquids (ILs) were synthesized: N-propyl-3-methylpyridinium bis(trifluoromethylsulfonyl)imide [C 3 3mpy][NTf 2 ], N-hexyl-3-methylpyridinium bis(trifluoromethylsulfonyl)imide [C 6 3mpy][NTf 2 ], and N-hexyl-4-methylpyridinium bis(trifluoromethylsulfonyl)imide [C 6 4mpy][NTf 2 ]. Density, dynamic viscosity, and electrical conductivity of ILs were determined at atmospheric pressure in the temperature range of (278 to 353) K. The effects of methylene and methyl groups to density, dynamic viscosity, and electrical conductivity, respectively, were discussed. The thermal expansion coefficient, molecular volume, standard molar entropy, and lattice energy of the samples were estimated in terms of empirical and semi-empirical equations based on the density values. The temperature dependence on dynamic viscosity and electrical conductivity values of the ILs were discussed by Vogel–Fulcher–Tamman (VFT) and Arrhenius equations. The molar conductivities were calculated by density and electrical conductivity values
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Ionic conduction in sodium azide under high pressure: Experimental and theoretical approaches
Wang, Qinglin; Ma, Yanzhang; Sang, Dandan; Wang, Xiaoli; Liu, Cailong; Hu, Haiquan; Wang, Wenjun; Zhang, Bingyuan; Fan, Quli; Han, Yonghao; Gao, Chunxiao
2018-04-01
Alkali metal azides can be used as starting materials for the synthesis of polymeric nitrogen, a potential material of high energy density. In this letter, we report the ionic transport behavior in sodium azide under high pressure by in situ impedance spectroscopy and density functional theory calculations. The ionic transportation consists of ion transfer and Warburg diffusion processes. The ionic migration channels and barrier energy were given for the high-pressure phases. The enhanced ionic conductivity of the γ phase with pressure is because of the formation of space charge regions in the grain boundaries. This ionic conduction and grain boundary effect in NaN3 under pressures could shed light on the better understanding of the conduction mechanism of alkali azides and open up an area of research for polymeric nitrogen in these compounds and other high-energy-density polynitrides.
Strain induced ionic conductivity enhancement in epitaxial Ce0.9Gd0.1O22d
DEFF Research Database (Denmark)
Kant, K. Mohan; Esposito, Vincenzo; Pryds, Nini
2012-01-01
-plane ionic conductivity in CGO epitaxial thin films. The ionic conductivity is found to increase with decrease in buffer layer thickness. The tailored ionic conductivity enhancement is explained in terms of close relationships among epitaxy, strain, and ionic conductivity....
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
Kortschot, R. J.; Philipse, A. P.; Erné, B. H.
2014-01-01
The electrical impedance spectrum of simple ionic solutions is measured in a parallel plate capacitor at small applied ac voltage. The influence of the ionic strength is investigated using several electrolytes at different concentrations in solvents of different dielectric constants. The electric
Improved ionic conductivity of lithium-zinc-tellurite glass-ceramic electrolytes
Widanarto, W.; Ramdhan, A. M.; Ghoshal, S. K.; Effendi, M.; Cahyanto, W. T.; Warsito
An enhancement in the secondary battery safety demands the optimum synthesis of glass-ceramics electrolytes with modified ionic conductivity. To achieve improved ionic conductivity and safer operation of the battery, we synthesized Li2O included zinc-tellurite glass-ceramics based electrolytes of chemical composition (85-x)TeO2·xLi2O·15ZnO, where x = 0, 5, 10, 15 mol%. Samples were prepared using the melt quenching method at 800 °C followed by thermal annealing at 320 °C for 3 h and characterized. The effects of varying temperature, alternating current (AC) frequency and Li2O concentration on the structure and ionic conductivity of such glass-ceramics were determined. The SEM images of the annealed glass-ceramic electrolytes displayed rough surface with a uniform distribution of nucleated crystal flakes with sizes less than 1 μm. X-ray diffraction analysis confirmed the well crystalline nature of achieved electrolytes. Incorporation of Li2O in the electrolytes was found to generate some new crystalline phases including hexagonal Li6(TeO6), monoclinic Zn2Te3O8 and monoclinic Li2Te2O5. The estimated crystallite size of the electrolyte was ranged from ≈40 to 80 nm. AC impedance measurement revealed that the variation in the temperatures, Li2O contents, and high AC frequencies have a significant influence on the ionic conductivity of the electrolytes. Furthermore, electrolyte doped with 15 mol% of Li2O exhibited the optimum performance with an ionic conductivity ≈2.4 × 10-7 S cm-1 at the frequency of 54 Hz and in the temperature range of 323-473 K. This enhancement in the conductivity was attributed to the sizable alteration in the ions vibration and ruptures of covalent bonds in the electrolytes network structures.
Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Diffusivities, viscosities, and conductivities of solvent-free ionically grafted nanoparticles
Hong, Bingbing; Panagiotopoulos, Athanassios Z.
2013-01-01
A new class of conductive composite materials, solvent-free ionically grafted nanoparticles, were modeled by coarse-grained molecular dynamics methods. The grafted oligomeric counterions were observed to migrate between different cores, contributing to the unique properties of the materials. We investigated the dynamics by analyzing the dependence on temperature and structural parameters of the transport properties (self-diffusion coefficients, viscosities and conductivities) and counterion migration kinetics. Temperature dependence of all properties follows the Arrhenius equation, but chain length and grafting density have distinct effects on different properties. In particular, structural effects on the diffusion coefficients are described by the Rouse model and the theory of nanoparticles diffusing in polymer solutions, viscosities are strongly influenced by clustering of cores, and conductivities are dominated by the motions of oligomeric counterions. We analyzed the migration kinetics of oligomeric counterions in a manner analogous to unimer exchange between micellar aggregates. The counterion migrations follow the "double-core" mechanism and are kinetically controlled by neighboring-core collisions. © 2013 The Royal Society of Chemistry.
Ionic conduction in the solid state
Indian Academy of Sciences (India)
Unknown
Li+, its lower weight, ease of handling and its poten- tial use in high energy density batteries. Li2SiO4 is one of the .... that influence the ionic conductivity of a crystal the activation energy is of utmost importance since the .... fraction techniques are commonly employed to elu- cidate the structure features of superionic solids.
International Nuclear Information System (INIS)
Drennan, J.; Swain, M.V.; Badwal, S.P.S.
1989-01-01
Ionic conductivity measurements on a yttria-stabilized tetragonal zirconia polycrystal/alumina composite subjected to superplastic deformation demonstrate anisotropic character. Parallel to the pressing direction, the grain-boundary resistance to oxygen ion mobility is 25% to 30% higher than that measured perpendicular to the pressing direction. The same directional dependency on the volume conductivity is observed but is less pronounced, showing approximately a 9% difference. Microstructural evidence reveals an agglomeration and elongation of alumina particles perpendicular to the pressing direction, and it is suggested that this phenomenon restricts the passage of ions parallel to the compression direction, giving rise to the anisotropic nature of the conductivity measurements
Conductance of Ion Channels - Theory vs. Experiment
Pohorille, Andrew; Wilson, Michael; Mijajlovic, Milan
2013-01-01
Transmembrane ion channels mediate a number of essential physiological processes in a cell ranging from regulating osmotic pressure to transmission of neural signals. Kinetics and selectivity of ion transport is of critical importance to a cell and, not surprisingly, it is a subject of numerous experimental and theoretical studies. In this presentation we will analyze in detail computer simulations of two simple channels from fungi - antiamoebin and trichotoxin. Each of these channels is made of an alpha-helical bundle of small, nongenomically synthesized peptides containing a number of rare amino acids and exhibits strong antimicrobial activity. We will focus on calculating ionic conductance defined as the ratio of ionic current through the channel to applied voltage. From molecular dynamics simulations, conductance can be calculated in at least two ways, each involving different approximations. Specifically, the current, given as the number of charges transferred through the channel per unit of time, can be obtained from the number of events in which ions cross the channel during the simulation. This method works well for large currents (high conductance values and/or applied voltages). If the number of crossing events is small, reliable estimates of current are difficult to achieve. Alternatively, conductance can be estimated assuming that ion transport can be well approximated as diffusion in the external potential given by the free energy profile. Then, the current can be calculated by solving the one-dimensional diffusion equation in this external potential and applied voltage (the generalized Nernst-Planck equation). To do so three ingredients are needed: the free energy profile, the position-dependent diffusion coefficient and the diffusive flux of ions into the channel. All these quantities can be obtained from molecular dynamics simulations. An important advantage of this method is that it can be used equally well to estimating large and small currents
Viscosity, Conductivity, and Electrochemical Property of Dicyanamide Ionic Liquids
Directory of Open Access Journals (Sweden)
Wen-Li Yuan
2018-03-01
Full Text Available The instructive structure-property relationships of ionic liquids (ILs can be put to task-specific design of new functionalized ILs. The dicyanamide (DCA ILs are typical CHN type ILs which are halogen free, chemical stable, low-viscous, and fuel-rich. The transport properties of DCA ionic liquids are significant for their applications as solvents, electrolytes, and hypergolic propellants. This work systematically investigates several important transport properties of four DCA ILs ([C4mim][N(CN2], [C4m2im][N(CN2], N4442[N(CN2], and N8444[N(CN2] including viscosity, conductivity, and electrochemical property at different temperatures. The melting points, temperature-dependent viscosities and conductivities reveal the structure-activity relationship of four DCA ILs. From the Walden plots, the imidazolium cations exhibit stronger cation–anion attraction than the ammonium cations. DCA ILs have relatively high values of electrochemical windows (EWs, which indicates that the DCA ILs are potential candidates for electrolytes in electrochemical applications. The cyclic voltammograms of Eu(III in these DCA ILs at GC working electrode at various temperatures 303–333 K consists of quasi-reversible waves. The electrochemical properties of the DCA ILs are also dominated by the cationic structures. The current intensity (ip, the diffusion coefficients (Do, the charge transfer rate constants (ks of Eu(III in DCA ILs all increased with the molar conductivities increased. The cationic structure-transport property relationships of DCA ILs were constructed for designing novel functionalized ILs to fulfill specific demands.
Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi
2017-11-01
A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.
Directory of Open Access Journals (Sweden)
Yongqi Dong
2017-05-01
Full Text Available The effect of gate voltage polarity on the behavior of NdNiO3 epitaxial thin films during ionic liquid gating is studied using in situ synchrotron X-ray techniques. We show that while negative biases have no discernible effect on the structure or composition of the films, large positive gate voltages result in the injection of a large concentration of oxygen vacancies (∼3% and pronounced lattice expansion (0.17% in addition to a 1000-fold increase in sheet resistance at room temperature. Despite the creation of large defect densities, the heterostructures exhibit a largely reversible switching behavior when sufficient time is provided for the vacancies to migrate in and out of the thin film surface. The results confirm that electrostatic gating takes place at negative gate voltages for p-type complex oxides while positive voltages favor the electrochemical reduction of Ni3+. Switching between positive and negative gate voltages therefore involves a combination of electronic and ionic doping processes that may be utilized in future electrochemical transistors.
Lian, Cheng; Zhao, Shuangliang; Liu, Honglai; Wu, Jianzhong
2016-11-28
Understanding the charging kinetics of electric double layers is of fundamental importance for the design and development of novel electrochemical devices such as supercapacitors and field-effect transistors. In this work, we study the dynamic behavior of room-temperature ionic liquids using a classical time-dependent density functional theory that accounts for the molecular excluded volume effects, the electrostatic correlations, and the dispersion forces. While the conventional models predict a monotonic increase of the surface charge with time upon application of an electrode voltage, our results show that dispersion between ions results in a non-monotonic increase of the surface charge with the duration of charging. Furthermore, we investigate the effects of van der Waals attraction between electrode/ionic-liquid interactions on the charging processes.
Is Geometric Frustration-Induced Disorder a Recipe for High Ionic Conductivity?
Düvel, Andre; Heitjans, Paul; Fedorov, Pavel; Scholz, Gudrun; Cibin, Giannantonio; Chadwick, Alan V; Pickup, David M; Ramos, Silvia; Sayle, Lewis W L; Sayle, Emma K L; Sayle, Thi X T; Sayle, Dean C
2017-04-26
Ionic conductivity is ubiquitous to many industrially important applications such as fuel cells, batteries, sensors, and catalysis. Tunable conductivity in these systems is therefore key to their commercial viability. Here, we show that geometric frustration can be exploited as a vehicle for conductivity tuning. In particular, we imposed geometric frustration upon a prototypical system, CaF 2 , by ball milling it with BaF 2 , to create nanostructured Ba 1-x Ca x F 2 solid solutions and increased its ionic conductivity by over 5 orders of magnitude. By mirroring each experiment with MD simulation, including "simulating synthesis", we reveal that geometric frustration confers, on a system at ambient temperature, structural and dynamical attributes that are typically associated with heating a material above its superionic transition temperature. These include structural disorder, excess volume, pseudovacancy arrays, and collective transport mechanisms; we show that the excess volume correlates with ionic conductivity for the Ba 1-x Ca x F 2 system. We also present evidence that geometric frustration-induced conductivity is a general phenomenon, which may help explain the high ionic conductivity in doped fluorite-structured oxides such as ceria and zirconia, with application for solid oxide fuel cells. A review on geometric frustration [ Nature 2015 , 521 , 303 ] remarks that classical crystallography is inadequate to describe systems with correlated disorder, but that correlated disorder has clear crystallographic signatures. Here, we identify two possible crystallographic signatures of geometric frustration: excess volume and correlated "snake-like" ionic transport; the latter infers correlated disorder. In particular, as one ion in the chain moves, all the other (correlated) ions in the chain move simultaneously. Critically, our simulations reveal snake-like chains, over 40 Å in length, which indicates long-range correlation in our disordered systems. Similarly
Analysis of ionic conductance of carbon nanotubes
Biesheuvel, P.M.; Bazant, M.Z.
2016-01-01
We use space-charge (SC) theory (also called the capillary pore model) to describe the ionic conductance, G, of charged carbon nanotubes (CNTs). Based on the reversible adsorption of hydroxyl ions to CNT pore walls, we use a Langmuir isotherm for surface ionization and make calculations as a
Gupta, Rajeev
2017-09-02
The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.
High ionic conductivity in confined bismuth oxide-based heterostructures
Directory of Open Access Journals (Sweden)
Simone Sanna
2016-12-01
Full Text Available Bismuth trioxide in the cubic fluorite phase (δ-Bi2O3 exhibits the highest oxygen ionic conductivity. In this study, we were able to stabilize the pure δ-Bi2O3 at low temperature with no addition of stabilizer but only by engineering the interface, using highly coherent heterostructures made of alternative layers of δ-Bi2O3 and Yttria Stabilized Zirconia (YSZ, deposited by pulsed laser deposition. The resulting [δ-Bi2O3/YSZ] heterostructures are found to be stable over a wide temperature range (500-750 °C and exhibits stable high ionic conductivity over a long time comparable to the value of the pure δ-Bi2O3, which is approximately two orders of magnitude higher than the conductivity of YSZ bulk.
High ionic conductivity in confined bismuth oxide-based heterostructures
DEFF Research Database (Denmark)
Sanna, Simone; Esposito, Vincenzo; Christensen, Mogens
2016-01-01
Bismuth trioxide in the cubic fluorite phase (δ-Bi2O3) exhibits the highest oxygen ionic conductivity. In this study, we were able to stabilize the pure -Bi2O3 at low temperature with no addition of stabilizer but only by engineering the interface, using highly coherent heterostructures made...... of alternative layers of δ-Bi2O3 and Yttria Stabilized Zirconia (YSZ), deposited by pulsed laser deposition. The resulting [δ-Bi2O3=YSZ] heterostructures are found to be stable over a wide temperature range (500-750 °C) and exhibits stable high ionic conductivity over a long time comparable to the value...... of the pure δ-Bi2O3, which is approximately two orders of magnitude higher than the conductivity of YSZ bulk....
Directory of Open Access Journals (Sweden)
Mohamad Khairul Anuar
2017-01-01
Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.
Current-voltage characteristics of individual conducting polymer nanotubes and nanowires
Institute of Scientific and Technical Information of China (English)
Long Yun-ze; Yin Zhi-Hua; Li Meng-Meng; Gu Chang-Zhi; Duvail Jean-Luc; Jin Ai-zi; Wan Mei-xiang
2009-01-01
We report the current-voltage (Ⅰ-Ⅴ) characteristics of individual polypyrrole nanotubes and poly(3,4-ethylenedioxythiophene) (PEDOT) nanowires in a temperature range from 300 K to 2 K. Considering the complex structures of such quasi-one-dimensional systems with an array of ordered conductive regions separated by disordered barriers, we use the extended fluctuation-induced tunneling (FIT) and thermal excitation model (Kaiser expression) to fit the temperature and electric-field dependent Ⅰ-Ⅴ curves. It is found that the Ⅰ-Ⅴ data measured at higher temperatures or higher voltages can be well fitted by the Kaiser expression. However, the low-temperature data around the zero bias clearly deviate from those obtained from this model. The deviation (or zero-bias conductance suppression)could be possibly ascribed to the occurrence of the Coulomb-gap in the density of states near the Femi level and/or the enhancement of electron-electron interaction resulting from nanosize effects, which have been revealed in the previous studies on low-temperature electronic transport in conducting polymer films, pellets and nanostructures. In addition,similar Ⅰ-Ⅴ characteristics and deviation are also observed in an isolated K0.27MnO2 nanowire.
Ionic conductivity of ZrF4-BaF2-MFsub(n) fluoride glasses (M : The group I--V metal elements)
International Nuclear Information System (INIS)
Kawamoto, Yoji; Nohara, Ichiro
1985-01-01
To glass transition temperature in argon atmosphere using the complex capacitance and complex impedance methods. The ionic conductivity of glasses, represented by log σ = log σ 0 - ΔE/2.303 kT, was nearly dependent only upon the activation energy. The polarizability of cation was found to be a dominant factor which governs activation energy. Thus, glasses with high meanpolarizability of glass-constituting cations exhibited high ionic conductivity, and the ZrF 4 -BaF 2 -CsF system was suggested to be a promising system that may provide a glass with higher fluoride-ion conduction. (author)
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.
Experton, Juliette; Martin, Charles R
2018-05-01
Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ionic conductivity of perovskite LaCoO3 measured by oxygen permeation technique
Chen, C.H.; Kruidhof, H.; Bouwmeester, Henricus J.M.; Burggraaf, Anthonie; Burggraaf, A.J.
1997-01-01
Oxygen permeation measurement is demonstrated, not only for a mixed oxide ionic and electronic conductor, but also as a new alternative to determine ambipolar conductivities, which can be usually reduced to be partial conductivities (either ionic or electronic). As a model system and an end member
Ionic dependence of sulphur mustard cytotoxicity
International Nuclear Information System (INIS)
Sawyer, Thomas W.; Nelson, Peggy; Bjarnason, Stephen; Vair, Cory; Shei Yimin; Tenn, Catherine; Lecavalier, Pierre; Burczyk, Andrew
2010-01-01
The effect of ionic environment on sulphur mustard (bis 2-chloroethyl sulphide; HD) toxicity was examined in CHO-K1 cells. Cultures were treated with HD in different ionic environments at constant osmolar conditions (320 mOsM, pH 7.4). The cultures were refed with fresh culture medium 1 h after HD exposure, and viability was assessed. Little toxicity was apparent when HD exposures were carried out in ion-free sucrose buffer compared to LC 50 values of ∼ 100-150 μM when the cultures were treated with HD in culture medium. Addition of NaCl to the buffer increased HD toxicity in a salt concentration-dependent manner to values similar to those obtained in culture medium. HD toxicity was dependent on both cationic and anionic species with anionic environment playing a much larger role in determining toxicity. Substitution of NaI for NaCl in the treatment buffers increased HD toxicity by over 1000%. The activity of the sodium hydrogen exchanger (NHE) in recovering from cytosolic acidification in salt-free and in different chloride salts did not correlate with the HD-induced toxicity in these buffers. However, the inhibition by HD of intracellular pH regulation correlated with its toxicity in NaCl, NaI and sucrose buffers. Analytical chemical studies and the toxicity of the iodine mustard derivative ruled out the role of chemical reactions yielding differentially toxic species as being responsible for the differences in HD toxicity observed. This work demonstrates that the early events that HD sets into motion to cause toxicity are dependent on ionic environment, possibly due to intracellular pH deregulation.
Mixed ionic-electronic conduction in Ni doped lanthanum gallate perovskites
Energy Technology Data Exchange (ETDEWEB)
Long, N.J.; Tuller, H.L.
1998-07-01
Lanthanum gallate is a promising material for monolithic fuel cells or oxygen pumps, i.e., one in which the electrolyte and electrodes are formed from a common phase. The authors have investigated La{sub 1{minus}x}Sr{sub x}Ga{sub 1{minus}y}Ni{sub y}O{sub 3} (LSGN{sub x{minus}y}) with x = 0.1 and y = 0.2 and 0.5 as a potential cathode material for such an electrochemical device. The {sigma}(PO{sub 2},T) for LSGN{sub 10--20} points to a p-type electronic conductivity at high PO{sub 2} and predominantly ionic conductivity at low PO{sub 2}. LSGN{sub 10-50} has an electronic conductivity suitable for SOFC applications of approximately 50 S/cm in air at high temperature. AC impedance spectroscopy on an electron blocking cell of the form M/LSG/LSGN/LSG/M was used to isolate the ionic conductivity in the LSGN{sub 10--20} material. The ionic conductivity was found to have a similar magnitude and activation energy to that of undoped LSG material with {sigma}{sub i} = 0.12 S/cm at 800 C and E{sub A} = 1.0 {+-} 0.1 eV. Thermal expansion measurements on the LSGN materials were characterized as a function of temperature and dopant level and were found to match that of the electrolyte under operating conditions.
Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel
International Nuclear Information System (INIS)
Barchi, R.L.; Tanaka, J.C.
1984-01-01
In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab
Proton-conductive materials formed by coumarin photocrosslinked ionic liquid crystal dendrimers
Concellon, A.; Liang, T.; Schenning, A.P.H.J.; Luis Serrano, J.; Romero, P.; Marcos, M.
2018-01-01
In this work, we have successfully examined for the first time the use of ionic dendrimers as building blocks for the preparation of 1D and 2D proton conductive materials. For this purpose, a new family of liquid crystalline dendrimers has been synthesized by ionic self-assembly of poly(amidoamine)
International Nuclear Information System (INIS)
Sen, A.K.; Bhattacharya, S.
2006-12-01
In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)
Energy Technology Data Exchange (ETDEWEB)
Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)
2014-03-31
This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.
In-situ ionic conductivity measurement of lithium ceramics under high energy heavy ion irradiation
International Nuclear Information System (INIS)
Nakazawa, Tetsuya; Noda, Kenji; Ishii, Yoshinobu; Ohno, Hideo; Watanabe, Hitoshi; Matsui, Hisayuki.
1992-01-01
To obtain fundamental information regarding the radiation damage in some lithium ceramics, e.g. Li 2 O, Li 4 SiO 4 etc., candidate of breeder materials exposed to severe irradiation environment, an in-situ experiment technique for the ionic conductivity measurement, which allows the specimen temperature control and the beam current monitoring, have been developed. This paper describes the features of an apparatus to measure in situ the ionic conductivity under the irradiation environment and presents some results of ionic conductivity measured for typical ceramic breeders using this apparatus. (J.P.N.)
Enhanced ionic conductivity of AgI nanowires/AAO composites fabricated by a simple approach
International Nuclear Information System (INIS)
Liu Lifeng; Alexe, Marin; Lee, Woo; Goesele, Ulrich; Lee, Seung-Woo; Li Jingbo; Rao Guanghui; Zhou Weiya; Lee, Jae-Jong
2008-01-01
AgI nanowires/anodic aluminum oxide (AgI NWs/AAO) composites have been fabricated by a simple approach, which involves the thermal melting of AgI powders on the surface of the AAO membrane, followed by the infiltration of the molten AgI inside the nanochannels. As-prepared AgI nanowires have corrugated outer surfaces and are polycrystalline according to scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations. X-ray diffraction (XRD) shows that a considerable amount of 7H polytype AgI exists in the composites, which is supposed to arise from the interfacial interactions between the embedded AgI and the alumina. AC conductivity measurements for the AgI nanowires/AAO composites exhibit a notable conductivity enhancement by three orders of magnitude at room temperature compared with that of pristine bulk AgI. Furthermore, a large conductivity hysteresis and abnormal conductivity transitions were observed in the temperature-dependent conductivity measurements, from which an ionic conductivity as high as 8.0 x 10 2 Ω -1 cm -1 was obtained at around 70 deg. C upon cooling. The differential scanning calorimetry (DSC) result demonstrates a similar phase transition behavior as that found in the AC conductivity measurements. The enhanced ionic conductivity, as well as the abnormal phase transitions, can be explained in terms of the existence of the highly conducting 7H polytype AgI and the formation of well-defined conduction paths in the composites.
Enhanced ionic conductivity of AgI nanowires/AAO composites fabricated by a simple approach.
Liu, Li-Feng; Lee, Seung-Woo; Li, Jing-Bo; Alexe, Marin; Rao, Guang-Hui; Zhou, Wei-Ya; Lee, Jae-Jong; Lee, Woo; Gösele, Ulrich
2008-12-10
AgI nanowires/anodic aluminum oxide (AgI NWs/AAO) composites have been fabricated by a simple approach, which involves the thermal melting of AgI powders on the surface of the AAO membrane, followed by the infiltration of the molten AgI inside the nanochannels. As-prepared AgI nanowires have corrugated outer surfaces and are polycrystalline according to scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations. X-ray diffraction (XRD) shows that a considerable amount of 7H polytype AgI exists in the composites, which is supposed to arise from the interfacial interactions between the embedded AgI and the alumina. AC conductivity measurements for the AgI nanowires/AAO composites exhibit a notable conductivity enhancement by three orders of magnitude at room temperature compared with that of pristine bulk AgI. Furthermore, a large conductivity hysteresis and abnormal conductivity transitions were observed in the temperature-dependent conductivity measurements, from which an ionic conductivity as high as 8.0 × 10(2) Ω(-1) cm(-1) was obtained at around 70 °C upon cooling. The differential scanning calorimetry (DSC) result demonstrates a similar phase transition behavior as that found in the AC conductivity measurements. The enhanced ionic conductivity, as well as the abnormal phase transitions, can be explained in terms of the existence of the highly conducting 7H polytype AgI and the formation of well-defined conduction paths in the composites.
Ionic conductivity in BC3 type boron carbon nanolayers
Directory of Open Access Journals (Sweden)
Irina V. Zaporotskova
2017-06-01
Full Text Available Studies of ionic conductivity and structuresf in which it can be achieved are of great importance for the development of modern batteries. The use of new materials will allow avoiding such typical disadvantages of batteries as short service life, low capacity and leaks. In this article we present the results of our study of the ionic conductivity in boron carbon nanolayers. We have simulated three types of boron carbon nanolayers containing different amounts of boron. The studies have been carried out using the MNDO method within the framework of the molecular cluster model and the DFT method with the B3LYP functional and the 6–31G basis. To study the ion conduction process we have simulated vacancy formation for each type of the nanolayers and studied the energy and electronic characteristics of these processes. We show that 25% boron substitution is the most energetically favorable for vacancy formation. We have also simulated vacancy migration and determined the thermal conductivity as a function of temperature.
Probing the bulk ionic conductivity by thin film hetero-epitaxial engineering
Pergolesi, Daniele; Roddatis, Vladimir; Fabbri, Emiliana; Schneider, Christof W; Lippert, Thomas; Traversa, Enrico; Kilner, John A
2015-01-01
Highly textured thin films with small grain boundary regions can be used as model systems to directly measure the bulk conductivity of oxygen ion conducting oxides. Ionic conducting thin films and epitaxial heterostructures are also widely used
Effect of plasticizer and fumed silica on ionic conductivity behaviour ...
Indian Academy of Sciences (India)
behaviour of proton conducting polymer electrolytes containing different concentrations of hexafluorophosphoric acid (HPF6) in polyethylene oxide ... Polymer electrolytes; ionic conductivity; polyethylene oxide; plasticizer; fumed silica. 1. Introduction ..... is a rapid weight loss which could be due to the degradation of polymer ...
Effect of pressure on ionic conductivity in rubidium silver iodide and silver iodide
International Nuclear Information System (INIS)
Allen, P.C.; Lazarus, D.
1978-01-01
The effect of pressure on the ionic conductivity of RbAg 4 I 5 and AgI has been measured, using single crystals and polycrystalline samples, up to pressures of 6 kbar. The activation volumes for motion in α-RbAg 4 I 5 and β-RbAg 4 I 5 , respectively, are -0.4 +- 0.2 and -0.2 +- 0.1 cm 3 /mole. In α-AgI, the motion volume increases from 0.56 +- 0.1 cm 3 /mole at 435 K to 0.8 +- 0.1 cm 3 /mole at 623 K. These values are unusually small in relation to the activation energies and are not consistent with the strain-energy model or a domain-diffusion mechanism. The logarithms of the ionic conductivities of α- and β-RbAg 4 I 5 increase linearly at first and then decrease quadratically with pressure. This is related to the large quadratic pressure dependence of the second-order transition temperature ΔT/sub c/(K) = 0.141P(kbar) + 0.111P 2 (kbar 2 ). The variation of the 122-K transition temperature with pressure is ΔT/sub c/(K) = 5.65P(kbar)-0.53P 2 (kbar 2 ), implying a molar volume change of V/sub β/γ = 0.37 +- 0.01 cm 3 /mole and a change in compressibility K/sub β/γ = (0.033 +- 0.001) x 10 -11 cm 2 /dyn across the transition. The ionic conductivity of γ-RbAg 4 I 5 initially decreases with an activation volume of 9 +- 1 cm 3 /mole, and then levels off with increasing pressure. The negative activation volume for conduction along the c axis in β-AgI has been confirmed. Both low-temperature phases have large formation volumes consistent with the theory of Rice et al. of transitions to the superionic phase
Abidi, Yassine; Bellassoued, Mourad; Mahjoub, Moncef; Zemzemi, Nejib
2018-03-01
In this paper, we consider the inverse problem of space dependent multiple ionic parameters identification in cardiac electrophysiology modelling from a set of observations. We use the monodomain system known as a state-of-the-art model in cardiac electrophysiology and we consider a general Hodgkin-Huxley formalism to describe the ionic exchanges at the microscopic level. This formalism covers many physiological transmembrane potential models including those in cardiac electrophysiology. Our main result is the proof of the uniqueness and a Lipschitz stability estimate of ion channels conductance parameters based on some observations on an arbitrary subdomain. The key idea is a Carleman estimate for a parabolic operator with multiple coefficients and an ordinary differential equation system.
Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage
Directory of Open Access Journals (Sweden)
RAMÓN LATORRE
2006-01-01
Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.
Structural simulation and ionic conductivity mechanisms in lithium thio-borate based glasses
International Nuclear Information System (INIS)
Estournes, C.
1992-04-01
We propose in this work a structural study of B 2 S 3 -Li 2 S glass system through the use of neutron scattering, X-ray photo-electron spectroscopy and computerized simulation. We have got information on the order at low and short distance range of these glasses. This information has been correlated to changes in physical features like ionic conductivity, density and temperature of the vitreous transition according to their chemical compositions. The knowledge of the local order in the most modified binary glasses has allowed us to propose a model for ionic conduction similar to the model used for ionic crystals. This model has been validated: it yields an activation energy that agrees well with experimental data
Energy Technology Data Exchange (ETDEWEB)
Ramirez, Rosa E.; Torres-Gonzalez, Luis; Sanchez, Eduardo M. [Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza NL (Mexico). Facultad de Ciencias Quimicas. Lab. de Investigacion del Vidrio], e-mail: info_labiv@yahoo.com
2006-07-01
Ionic liquids are molten salts formed by organic cations as imidazolium, ammonium, pyridinium, picolinium and phosphonium in combination with several inorganic and organic anions. A new systematic series of phosphonium iodides (PI's) with low melting points have been prepared and properly characterized. Ionic conductivity was determined by impedance spectroscopy on molten salts as well as electrolytic solutions prepared by a mixture of PI's with low vapor pressure solvents. The conductivity dependence vs solvent concentration was interpreted in terms of the Fuoss-Krauss ion association theory. The conductivity did increased dramatically when small quantities of iodine were added, this phenomenon is explained in terms of the Grotthus charge transfer mechanism. Finally, several nanocrystalline solar cells were assembled with electrolytic solutions performing an efficiency up to 5.9% under an illuminance of 27 000 lux. (author)
Tiruye, Girum Ayalneh; Muñoz-Torrero, David; Palma, Jesus; Anderson, Marc; Marcilla, Rebeca
2016-09-01
Four Ionic Liquid based Polymer Electrolytes (IL-b-PE) were prepared by blending a Polymeric Ionic Liquid, Poly(diallyldimethylammonium) bis(trifluoromethanesulfonyl)imide (PILTFSI), with four different ionic liquids: 1-butyl-1-methylpyrrolidinium bis(trifluoromethanesulfonyl)imide (PYR14TFSI) (IL-b-PE1), 1-butyl-1-methylpyrrolidinium bis(fluorosulfonyl)imide (PYR14FSI) (IL-b-PE2), 1-(2-hydroxy ethyl)-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (HEMimTFSI) (IL-b-PE3), and 1-Butyl-1-methylpyrrolidinium dicyanamide, (PYR14DCA) (IL-b-PE4). Physicochemical properties of IL-b-PE such as ionic conductivity, thermal and electrochemical stability were found to be dependent on the IL properties. For instance, ionic conductivity was significantly higher for IL-b-PE2 and IL-b-PE4 containing IL with small size anions (FSI and DCA) than IL-b-PE1 and IL-b-PE3 bearing IL with bigger anion (TFSI). On the other hand, wider electrochemical stability window (ESW) was found for IL-b-PE1 and IL-b-PE2 having ILs with electrochemically stable pyrrolidinium cation and FSI and TFSI anions. Solid state Supercapacitors (SCs) were assembled with activated carbon electrodes and their electrochemical performance was correlated with the polymer electrolyte properties. Best performance was obtained with SC having IL-b-PE2 that exhibited a good compromise between ionic conductivity and electrochemical window. Specific capacitance (Cam), real energy (Ereal) & real power densities (Preal) as high as 150 F g-1, 36 Wh kg-1 & 1170 W kg-1 were found at operating voltage of 3.5 V.
Lithium-conducting ionic melt electrolytes from polyether-functionalized fluorosulfonimide anions
International Nuclear Information System (INIS)
Hallac, B.B.; Geiculescu, O.E.; Rajagopal, R.V.; Creager, S.E.; DesMarteau, D.D.
2008-01-01
Solvent-free lithium-conducting ionic melt (IM) electrolytes were synthesized and characterized with respect to chemical structure, purity, and ion transport properties. The melts consist of lithium (perfluorovinylether)sulfonimide salts attached covalently to a lithium-solvating polyether chain. Ionic conductivities are relatively high which is a consequence of the favorable combination of the low lattice energy of the lithium fluorosulfonimide salt (low basicity of the fluorosulfonimide anion), the relatively low viscosity of the polyether matrix, and the relatively high salt content of the melts. Galvanostatic dc polarization experiments, using cells with non-blocking Li electrodes, indicate that salt concentration polarization does not occur in these electrolytes as dc current is passed through them
Ionic conductivity and diffusion coefficient of barium-chloride-based ...
Indian Academy of Sciences (India)
styrenesulphonic acid) with bariumchloride dihydrate (BaCl 2 ·2H 2 O) salt complex has been synthesized following the usual solution casting. The ionic conductivity of polymer electrolyte was analysed by impedance spectroscopy. The highest room ...
Correlation between ionic conductivity and fluidity of polymer gel ...
Indian Academy of Sciences (India)
Unknown
Ionic conductivity; ion aggregates; FTIR spectroscopy; gels; fluidity. 1. Introduction ... liquid and polymer gel electrolytes have been studied as functions of salt ..... Ratner M A 1987 in Polymer electrolyte reviews (eds) J R. MacCallum and C A ...
Directory of Open Access Journals (Sweden)
S. Demirezen
Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase
Li, Zhiyong; Yuan, Xiaoqing; Feng, Ying; Chen, Yongkui; Zhao, Yuling; Wang, Huiyong; Xu, Qingli; Wang, Jianji
2018-05-09
Photo-induced conductivity modulation of stimuli-responsive materials is of great importance from the viewpoint of fundamental research and technology. In this work, 5 new kinds of azobenzene-based photo-responsive ionic liquids were synthesized and characterized, and UV/vis light modulation of their conductivity was investigated in an aqueous solution. The factors affecting the conductivity modulation of the photo-responsive fluids, such as photo-isomerization efficiency, photo-regulation aggregation, concentration and chemical structure of the ionic liquids, were examined systematically. It was found that the conductivity of the ionic liquids in water exhibited a significant increase upon UV light irradiation and the ionic liquids with a shorter alkyl spacer in the cation showed a more remarkable photo-induced conductivity enhancement with a maximum increase of 150%. In addition, the solution conductivity was restored (or very close) to the initial value upon an alternative irradiation with visible light. Thus, the solution conductivity can be modulated using alternative irradiation with UV and visible light. Although the reversible photo-isomerization of the azobenzene group under UV/vis irradiation is the origin of the conductivity modulation, the photo-regulated aggregation of the ionic liquid in water is indispensable for the maximum degree of conductivity modulation because UV irradiation can weaken, even break the aggregated cis-isomers of the ionic liquids in an aqueous solution.
ALTERNATIVE EQUATIONS FOR DYNAMIC BEHAVIOR OF IONIC CHANNEL ACTIVATION AND INACTIVATION GATES
Directory of Open Access Journals (Sweden)
Mahmut ÖZER
2003-03-01
Full Text Available In this paper, alternative equations for dynamics of ionic channel activation and inactivation gates are proposed based on the path probability method. Dynamic behavior of a voltage-gated ionic channel is modeled by the conventional Hodgkin-Huxley (H-H mathematical formalism. In that model, conductance of the channel is defined in terms of activation and inactivation gates. Dynamics of the activation and inactivation gates is modeled by first-order differential equations dependent on the gate variable and the membrane potential. In the new approach proposed in this study, dynamic behavior of activation and inactivation gates is modeled by a firstorder differential equation dependent on internal energy and membrane potential by using the path probability method which is widely used in statistical physics. The new model doesn't require the time constant and steadystate values which are used explicitly in the H-H model. The numerical results show validity of the proposed method.
High-throughput screening of ionic conductivity in polymer membranes
International Nuclear Information System (INIS)
Zapata, Pedro; Basak, Pratyay; Carson Meredith, J.
2009-01-01
Combinatorial and high-throughput techniques have been successfully used for efficient and rapid property screening in multiple fields. The use of these techniques can be an advantageous new approach to assay ionic conductivity and accelerate the development of novel materials in research areas such as fuel cells. A high-throughput ionic conductivity (HTC) apparatus is described and applied to screening candidate polymer electrolyte membranes for fuel cell applications. The device uses a miniature four-point probe for rapid, automated point-to-point AC electrochemical impedance measurements in both liquid and humid air environments. The conductivity of Nafion 112 HTC validation standards was within 1.8% of the manufacturer's specification. HTC screening of 40 novel Kynar poly(vinylidene fluoride) (PVDF)/acrylic polyelectrolyte (PE) membranes focused on varying the Kynar type (5x) and PE composition (8x) using reduced sample sizes. Two factors were found to be significant in determining the proton conducting capacity: (1) Kynar PVDF series: membranes containing a particular Kynar PVDF type exhibited statistically identical mean conductivity as other membranes containing different Kynar PVDF types that belong to the same series or family. (2) Maximum effective amount of polyelectrolyte: increments in polyelectrolyte content from 55 wt% to 60 wt% showed no statistically significant effect in increasing conductivity. In fact, some membranes experienced a reduction in conductivity.
Shi, Qing Xuan; Xia, Qing; Xiang, Xiao; Ye, Yun Sheng; Peng, Hai Yan; Xue, Zhi Gang; Xie, Xiao Lin; Mai, Yiu-Wing
2017-09-04
Composite polymeric and ionic liquid (IL) electrolytes are some of the most promising electrolyte systems for safer battery technology. Although much effort has been directed towards enhancing the transport properties of polymer electrolytes (PEs) through nanoscopic modification by incorporating nano-fillers, it is still difficult to construct ideal ion conducting networks. Here, a novel class of three-dimensional self-assembled polymeric ionic liquid (PIL)-functionalized cellulose nano-crystals (CNC) confining ILs in surface-grafted PIL polymer chains, able to form colloidal crystal polymer electrolytes (CCPE), is reported. The high-strength CNC nano-fibers, decorated with PIL polymer chains, can spontaneously form three-dimensional interpenetrating nano-network scaffolds capable of supporting electrolytes with continuously connected ion conducting networks with IL being concentrated in conducting domains. These new CCPE have exceptional ionic conductivities, low activation energies (close to bulk IL electrolyte with dissolved Li salt), high Li + transport numbers, low interface resistances and improved interface compatibilities. Furthermore, the CCPE displays good electrochemical properties and a good battery performance. This approach offers a route to leak-free, non-flammable and high ionic conductivity solid-state PE in energy conversion devices. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ionic conductivity and diffusion coefficient of barium-chloride-based ...
Indian Academy of Sciences (India)
2017-07-26
Jul 26, 2017 ... the present research is to reveal the effect of BaCl2 on the ionic conductivity ... pared polymer electrolyte was recorded and energy band gap was evaluated from ... The XRD analysis is useful to determine the structural and.
Effect of plasticizer and fumed silica on ionic conductivity behaviour
Indian Academy of Sciences (India)
The effect of addition of propylene carbonate (PC) and nano-sized fumed silica on the ionic conductivity behaviour of proton conducting polymer electrolytes containing different concentrations of hexafluorophosphoric acid (HPF6) in polyethylene oxide (PEO) has been studied. The addition of PC results in an increase in ...
Improvement in ionic conductivities of poly-(2-vinylpyridine) by ...
Indian Academy of Sciences (India)
cal properties, easy fabrication into thin films of desired sizes and their ability to ... liquid state can be used for electroplating and water purifi- cation. The merits of ... that its ionic conductivity increases very appreciably and. P-2VP-HI proved to ...
Voltage-Induced Nonlinear Conduction Properties of Epoxy Resin/Micron-Silver Particles Composites
Qu, Zhaoming; Lu, Pin; Yuan, Yang; Wang, Qingguo
2018-01-01
The nonlinear conduction properties of epoxy resin (ER)/micron-silver particles (MP) composites were investigated. Under sufficient high intensity applied constant voltage, the obvious nonlinear conduction properties of the samples with volume fraction 25% were found. With increments in the voltage, the conductive switching effect was observed. The nonlinear conduction mechanism of the ER/MP composites under high applied voltages could be attributed to the electrical current conducted via discrete paths of conductive particles induced by the electric field. The test results show that the ER/MP composites with nonlinear conduction properties are of great potential application in electromagnetic protection of electron devices and systems.
International Nuclear Information System (INIS)
Lin Peiyin; Soriano, Allan N.; Leron, Rhoda B.; Li Menghui
2010-01-01
As part of our systematic study on physicochemical characterization of ionic liquids, in this work, we report new measurements of electrolytic conductivity and molar heat capacity for aqueous solutions of two 1-ethyl-3-methylimidazolium-based ionic liquids, namely: 1-ethyl-3-methylimidazolium dicyanamide and 1-ethyl-3-methylimidazolium 2-(2-methoxyethoxy) ethylsulfate, at normal atmospheric condition and for temperatures up to 353.2 K. The electrolytic conductivity and molar heat capacity were measured by a commercial conductivity meter and a differential scanning calorimeter (DSC), respectively. The estimated experimental uncertainties for the electrolytic conductivity and molar heat capacity measurements were ±1% and ±2%, respectively. The property data are reported as functions of temperature and composition. A modified empirical equation from another researcher was used to correlate the temperature and composition dependence of the our electrolytic conductivity results. An excess molar heat capacity expression derived using a Redlich-Kister type equation was used to represent the temperature and composition dependence of the measured molar heat capacity and calculated excess molar heat capacity of the solvent systems considered. The correlations applied represent the our measurements satisfactorily as shown by an acceptable overall average deviation of 6.4% and 0.1%, respectively, for electrolytic conductivity and molar heat capacity.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-01-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact
Chintapalli, Mahati; Le, Thao; Venkatesan, Naveen; Thelen, Jacob; Rojas, Adriana; Balsara, Nitash
Block copolymer electrolytes are promising materials for safe, long-lasting lithium batteries because of their favorable mechanical and ion transport properties. The morphology, phase behavior, and ionic conductivity of a block copolymer electrolyte, SEO mixed with LiTFSI was studied over a wide, previously unexplored salt concentration range using small angle X-ray scattering, differential scanning calorimetry and ac impedance spectroscopy, respectively. SEO exhibits a maximum in ionic conductivity at twice the salt concentration that PEO, the homopolymer analog of the ion-containing block, does. This finding is contrary to prior studies that examined a more limited range of salt concentrations. In SEO, the phase behavior of the PEO block and LiTFSI closely resembles the phase behavior of homopolymer PEO and LiTFSI. The grain size of the block copolymer morphology was found to decrease with increasing salt concentration, and the ionic conductivity of SEO correlates with decreasing grain size. Structural effects impact the ionic conductivity-salt concentration relationship in block copolymer electrolytes. SEO: polystyrene-block-poly(ethylene oxide); also PS-PEO LiTFSI: lithium bis(trifluoromethanesulfonyl imide
Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.
Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin
2013-08-06
Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.
Pressure effect on ionic conductivity in yttrium-oxide-doped single-crystal zirconium oxide
International Nuclear Information System (INIS)
Park, E.T.; Park, J.H.
1998-06-01
In this study, the authors investigated the effect of pressure on the ionic conductivity of a 9.5 mol% yttria-stabilized zirconia (YSZ) single crystal. The experiment was conducted in the elastic region, and the oxygen ion transport number was unity (t ion > 0.99999). A conventional four-probe DC method was used to measure the ionic conductivity of the rectangular-shaped sample under uniaxial pressures up to 600 atm at 750 C in air. Measured ionic conductivity decreased as applied pressure increased. Based on henry Eyring's absolute reaction rate theory, which states that the calculated activation volume has a positive value (ΔV 2 = 2.08 cm 3 /mol of O -2 ) for oxygen ion transport in the fluoride cubic lattice, they concluded that the results they obtained could be explained by an oxygen ion transport mechanism. This mechanism can explain the fact that the interionic distance increases during oxygen ion transport from one unit cell to neighboring unit cells
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Oxygen partial pressure dependence of electrical conductivity in γ'-Bi2MoO6
International Nuclear Information System (INIS)
Vera, C.M.C.; Aragon, R.
2008-01-01
The electrical conductivity of γ'-Bi 2 MoO 6 was surveyed between 450 and 750 deg. C as a function of oxygen partial pressure, in the range 0.01-1 atm. A -1/6 power law dependence, consistent with a Frenkel defect model of doubly ionized oxygen vacancies and interstitials, is evidence for an n-type semiconductive component, with an optical band gap of 2.9 eV. The absence of this dependence is used to map the onset of dominant ionic conduction. - Graphical abstract: Temporal dependence of electrical conductivity at 500 deg. C for γ'-Bi 2 MoO 6 at controlled partial pressures of oxygen
Sangeetha, M.; Mallikarjun, A.; Jaipal Reddy, M.; Siva Kumar, J.
2017-08-01
In the present paper; the FTIR and Temperature dependent DC Ionic conductivity studies of polymer (80 Wt% PVDF-HFP) with inorganic lithium tetra fluoroborate salt (20 Wt% LiBF4) as ionic charge carrier and plasticized with various weight ratios of Ethylene carbonate plasticizer (10 Wt% to 70 Wt% EC) as gel polymer electrolytes. Solution casting method is used for the preparation of plasticized polymer-salt electrolyte films. FTIR analysis shows the good complexation between PVDF-HFP: LiBF4 and the presence of functional groups in the plasticized polymer-salt electrolyte membrane. Also the analysis and results show that the highest DC ionic conductivity of 1.66 × 10-3 SCm -1 was found at 373 K for a particular concentration of 80 Wt% PVDF-HFP: 20 Wt% LiBF4: 40 Wt% EC porous gel type polymer-salt plasticized porous membrane. Increase of temperature results expansion and segmental motion of polymer chain that generates free volume in turn promotes hopping of the lithium ions satisfying Vogel-Tammann-Fulcher equation.
Energy Technology Data Exchange (ETDEWEB)
Watanabe, Masahiro; Uchida, Hiroyuki; Yoshida, Manabu [Yamanashi Univ., Kofu (Japan)
1996-12-31
Solid oxide fuel cells (SOFCs) have been intensively investigated because, in principle, their energy conversion efficiency is fairly high. Lowering the operating temperature of SOFCs from 1000{degrees}C to around 800{degrees}C is desirable for reducing serious problems such as physical and chemical degradation of the constructing materials. The object of a series of the studies is to find a clue for achieving higher electrode performances at a low operating temperature than those of the present level. Although the polarization loss at electrodes can be reduced by using mixed-conducting ceria electrolytes, or introducing the mixed-conducting (reduced zirconia or ceria) laver on the conventional zirconia electrolyte surface, no reports are available on the effect of such an ionic conductivity of electrolytes on electrode polarizations. High ionic conductivity of the electrolyte, of course, reduces the ohmic loss. However, we have found that the IR-free polarization of a platinum anode attached to zirconia electrolytes is greatly influenced by the ionic conductivity, {sigma}{sub ion}, of the electrolytes used. The higher the {sigma}{sub ion}, the higher the exchange current density, j{sub 0}, for the Pt anode in H{sub 2} at 800 {approximately} 1000{degrees}C. It was indicated that the H{sub 2} oxidation reaction rate was controlled by the supply rate of oxide ions through the Pt/zirconia interface which is proportional to the {sigma}{sub ion}. Recently, we have proposed a new concept of the catalyzed-reaction layers which realizes both high-performances of anodes and cathodes for medium-temperature operating SOFCs. We present the interesting dependence of the polarization properties of various electrodes (the SDC anodes with and without Ru microcatalysts, Pt cathode, La(Sr)MnO{sub 3} cathodes with and without Pt microcatalysts) on the {sigma}{sub ion} of various zirconia electrolytes at 800 {approximately} 1000{degrees}C.
Berson, Jonathan; Burshtain, Doron; Zeira, Assaf; Yoffe, Alexander; Maoz, Rivka; Sagiv, Jacob
2015-06-01
Ionic transport plays a central role in key technologies relevant to energy, and information processing and storage, as well as in the implementation of biological functions in living organisms. Here, we introduce a supramolecular strategy based on the non-destructive chemical patterning of a highly ordered self-assembled monolayer that allows the reproducible fabrication of ion-conducting surface patterns (ion-conducting channels) with top -COOH functional groups precisely definable over the full range of length scales from nanometre to centimetre. The transport of a single layer of selected metal ions and the electrochemical processes related to their motion may thus be confined to predefined surface paths. As a generic solid ionic conductor that can accommodate different mobile ions in the absence of any added electrolyte, these ion-conducting channels exhibit bias-induced competitive transport of different ionic species. This approach offers unprecedented opportunities for the realization of designed ion-conducting systems with nanoscale control, beyond the inherent limitations posed by available ionic materials.
Ionic conductivity of co-doped Sc2O3-ZrO2 ceramics
DEFF Research Database (Denmark)
Omar, Shobit; bin Najib, Waqas; Chen, Weiwu
2012-01-01
The oxide ionic conductivity of Sc0.18Zr0.82O1.91 doped with 0.5 mol.% of both Yb2O3 and In2O3 is evaluated at various temperatures in air. Among various co-doped compositions, In0.02Sc0.18Zr0.80O1.90 exhibits the highest grain ionic conductivity followed by Yb0.02Sc0.18Zr0.80O1.90 at 500°C....... However, it also possesses phase transformation from c- to β-phase at 475°C on cooling. In the present work, an attempt is made to completely stabilize the cphase in In0.02Sc0.18Zr0.80O1.90 by substituting 0.5 mol.% of In2O3 with Yb2O3, which can enhance the ionic conductivity in co-doped compositions....
Regulation of KV channel voltage-dependent activation by transmembrane β subunits
Directory of Open Access Journals (Sweden)
Xiaohui eSun
2012-04-01
Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.
Energy Technology Data Exchange (ETDEWEB)
Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)
2016-11-01
In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.
Ionic relaxation in PEO/PVDF-HFP-LiClO4 blend polymer electrolytes: dependence on salt concentration
Das, S.; Ghosh, A.
2016-06-01
In this paper, we have studied the effect of LiClO4 salt concentration on the ionic conduction and relaxation in poly ethylene oxide (PEO) and poly (vinylidene fluoride hexafluoropropylene) (PVDF-HFP) blend polymer electrolytes, in which the molar ratio of ethylene oxide segments to lithium ions (R = EO: Li) has been varied between 3 and 35. We have observed two phases in the samples containing low salt concentrations (R > 9) and single phase in the samples containing high salt concentrations (R ⩽ 9). The scanning electron microscopic images indicate that there exists no phase separation in the blend polymer electrolytes. The temperature dependence of the ionic conductivity shows two slopes corresponding to high and low temperatures and follows Arrhenius relation for the samples containing low salt concentrations (R > 9). The conductivity relaxation as well as the structural relaxation has been clearly observed at around 104 Hz and 106 Hz for these concentrations of the blended electrolytes. However, a single conductivity relaxation peak has been observed for the compositions with R ⩽ 9. The scaling of the conductivity spectra shows that the relaxation mechanism is independent of temperature, but depends on salt concentration.
Patel, Shrayesh N; Javier, Anna E; Balsara, Nitash P
2013-07-23
Block copolymers that can simultaneously conduct electronic and ionic charges on the nanometer length scale can serve as innovative conductive binder material for solid-state battery electrodes. The purpose of this work is to study the electronic charge transport of poly(3-hexylthiophene)-b-poly(ethylene oxide) (P3HT-PEO) copolymers electrochemically oxidized with lithium bis(trifluoromethanesulfonyl) imide (LiTFSI) salt in the context of a lithium battery charge/discharge cycle. We use a solid-state three-terminal electrochemical cell that enables simultaneous conductivity measurements and control over electrochemical doping of P3HT. At low oxidation levels (ratio of moles of electrons removed to moles of 3-hexylthiophene moieties in the electrode), the electronic conductivity (σe,ox) increases from 10(-7) S/cm to 10(-4) S/cm. At high oxidation levels, σe,ox approaches 10(-2) S/cm. When P3HT-PEO is used as a conductive binder in a positive electrode with LiFePO4 active material, P3HT is electrochemically active within the voltage window of a charge/discharge cycle. The electronic conductivity of the P3HT-PEO binder is in the 10(-4) to 10(-2) S/cm range over most of the potential window of the charge/discharge cycle. This allows for efficient electronic conduction, and observed charge/discharge capacities approach the theoretical limit of LiFePO4. However, at the end of the discharge cycle, the electronic conductivity decreases sharply to 10(-7) S/cm, which means the "conductive" binder is now electronically insulating. The ability of our conductive binder to switch between electronically conducting and insulating states in the positive electrode provides an unprecedented route for automatic overdischarge protection in rechargeable batteries.
Directory of Open Access Journals (Sweden)
David M Fox
2017-06-01
Full Text Available Neuronal membrane potential resonance (MPR is associated with subthreshold and network oscillations. A number of voltage-gated ionic currents can contribute to the generation or amplification of MPR, but how the interaction of these currents with linear currents contributes to MPR is not well understood. We explored this in the pacemaker PD neurons of the crab pyloric network. The PD neuron MPR is sensitive to blockers of H- (IH and calcium-currents (ICa. We used the impedance profile of the biological PD neuron, measured in voltage clamp, to constrain parameter values of a conductance-based model using a genetic algorithm and obtained many optimal parameter combinations. Unlike most cases of MPR, in these optimal models, the values of resonant- (fres and phasonant- (fϕ = 0 frequencies were almost identical. Taking advantage of this fact, we linked the peak phase of ionic currents to their amplitude, in order to provide a mechanistic explanation the dependence of MPR on the ICa gating variable time constants. Additionally, we found that distinct pairwise correlations between ICa parameters contributed to the maintenance of fres and resonance power (QZ. Measurements of the PD neuron MPR at more hyperpolarized voltages resulted in a reduction of fres but no change in QZ. Constraining the optimal models using these data unmasked a positive correlation between the maximal conductances of IH and ICa. Thus, although IH is not necessary for MPR in this neuron type, it contributes indirectly by constraining the parameters of ICa.
Percolative ionic conduction in the LiAlSiO4 glass-ceramic system
International Nuclear Information System (INIS)
Biefeld, R.M.; Pike, G.E.; Johnson, R.T. Jr.
1977-01-01
The effect f crystallinity on the lithium ion conductivity in LiAlSiO 4 glass and glass-ceramic solid electrolytes has been determined. The ionic conductivity is thermally activated with an activation energy and pre-exponential factor that change in a marked and nonsimple manner as the volume fraction of crystallinity changes. These results are explained by using a continuum percolation model (effective-medium approximation) which assumes that ionic conduction in the glass-ceramic is almost entirely within the glass phase until the crystalline volume fraction rises above approx. 55%. The LiAlSiO 4 system would seem to be nearly ideal for application of percolation theory since the crystalline phase, β eucryptite, has nearly the same composition as the glass phase. Hence, as the crystallite volume fraction increases in the glass ceramic, the residual glass composition and conductivity remain the same. This is the first application of percolation theory to ionic transport in glass-ceramics and excellent agreement is obtained between theory and experiment for the LiAlSiO 4 system
Energy Technology Data Exchange (ETDEWEB)
Emin, David, E-mail: emin@unm.edu [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States); Akhtari, Massoud [Semple Institutes for Neuroscience and Human Behavior, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095 (United States); Ellingson, B. M. [Department of Radiology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095 (United States); Mathern, G. W. [Department of Neurosurgery, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095 (United States)
2015-08-15
We analyze the transient-dc and frequency-dependent electrical conductivities between blocking electrodes. We extend this analysis to measurements of ions’ transport in freshly excised bulk samples of human brain tissue whose complex cellular structure produces blockages. The associated ionic charge-carrier density and diffusivity are consistent with local values for sodium cations determined non-invasively in brain tissue by MRI (NMR) and diffusion-MRI (spin-echo NMR). The characteristic separation between blockages, about 450 microns, is very much shorter than that found for sodium-doped gel proxies for brain tissue, >1 cm.
Effect of the ionic conductivity on the performance of polyelectrolyte-based supercapacitors
Energy Technology Data Exchange (ETDEWEB)
Wee, Grace; Srinivasan, Madhavi; Mhaisalkar, Subodh [School of Materials Science and Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Energy Research Institute rate at NTU (ERI rate at N), Research Techno Plaza, 5th Storey, 50 Nanyang Drive, Singapore 637553 (Singapore); Larsson, Oscar; Berggren, Magnus; Crispin, Xavier [Department of Science and Technology, Organic Electronics, Linkoeping University, SE-601 74 Norrkoeping (Sweden)
2010-12-21
In the emerging technology field of printed electronics, circuits are envisioned to be powered with printed energy sources, such as printed batteries and printed supercapacitors (SCs). For manufacturing and reliability issues, solid electrolytes are preferred instead of liquid electrolytes. Here, a solid-state, polyanionic proton conducting electrolyte, poly(styrenesulfonic acid) (PSS:H), is demonstrated for the first time as an effective ion conducting electrolyte medium in SCs with electrodes based on carbon nanotube (CNT) networks. The effect of the ionic conductivity in the PSS:H film of those SCs is studied at different levels of relative humidity (RH) with impedance spectroscopy, cyclic voltammetry, and galvanostatic charge-discharge techniques. High capacitance values (85 F g{sup -1} at 80% RH) are obtained for these SCs due to the extremely high effective electrode area of the CNTs and the enhanced ionic conductivity of the PSS:H film at increasing RH level. The charging dynamics are primarily limited by the ionic conductivity of the electrolyte rather than a poor contact between the electrolyte and the CNT electrodes. The use of polyelectrolytes in SCs provides high mechanical strength and flexibility, while maintaining a high capacitance value, enabling a new generation of printable solid-state charge storage devices. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Effects of calcium impurity on phase relationship, ionic conductivity ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Effects of calcium impurity on phase relationship, ionic conductivity and microstructure of Na + - β / b e t a " -alumina solid electrolyte. SUNG-TAE LEE DAE-HAN LEE SANG-MIN LEE SANG-SOO HAN SANG-HYUNG LEE SUNG-KI LIM. Volume 39 Issue 3 ...
Ionic and electronic conductivity in lead-zirconate-titanate (PZT)
Boukamp, Bernard A.; Pham thi ngoc mai, P.T.N.M.; Blank, David H.A.; Bouwmeester, Henricus J.M.
2004-01-01
Accurate impedance measurements on differently sized samples of lead–zirconate–titanate (PbZr0.53Ti0.47O3, PZT) have been analyzed with a CNLS procedure, resulting in the separation of the ionic and electronic conductivities over a temperature range from f150 to 630 jC. At 603 jC the electronic
Fujimoto, Takuya; Miyoshi, Yasuhito; Matsushita, Michio M; Awaga, Kunio
2011-05-28
We studied a complementary organic inverter consisting of a p-type semiconductor, metal-free phthalocyanine (H(2)Pc), and an n-type semiconductor, tetrakis(thiadiazole)porphyrazine (H(2)TTDPz), operated through the ionic-liquid gate dielectrics of N,N-diethyl-N-methyl(2-methoxyethyl)ammonium bis(trifluoromethylsulfonyl)imide (DEME-TFSI). This organic inverter exhibits high performance with a very low operation voltage below 1.0 V and a dynamic response up to 20 Hz. © The Royal Society of Chemistry 2011
Intermediate temperature ionic conductivity of Sm1.92Ca0.08Ti2O7–δ pyrochlore
DEFF Research Database (Denmark)
Eurenius, Karinh E. J.; Bentzer, Henrik Karnøe; Bonanos, Nikolaos
2011-01-01
(500–300 °C). The impedance measurements revealed the conductivity to be mainly ionic under all conditions, with the highest total conductivity measured being 0.045 S/m under wet oxygen at 500 °C. Both bulk and grain boundary conductivity was predominantly ionic, but electronic conductivity appeared...... to play a slightly larger part in the grain boundaries. EMF data confirmed the conductivity to be mainly ionic, with oxide ions being the major conducting species at 500 °C and protons becoming increasingly important below this temperature....
Self-Sensing Ionic Polymer Actuators: A Review
Directory of Open Access Journals (Sweden)
Karl Kruusamäe
2015-03-01
Full Text Available Ionic electromechanically active polymers (IEAP are laminar composites that can be considered attractive candidates for soft actuators. Their outstanding properties such as low operating voltage, easy miniaturization, and noiseless operation are, however, marred by issues related to the repeatability in the production and operation of these materials. Implementing closed-loop control for IEAP actuators is a viable option for overcoming these issues. Since IEAP laminates also behave as mechanoelectrical sensors, it is advantageous to combine the actuating and sensing functionalities of a single device to create a so-called self-sensing actuator. This review article systematizes the state of the art in producing self-sensing ionic polymer actuators. The IEAPs discussed in this paper are conducting (or conjugated polymers actuators (CPA, ionic polymer-metal composite (IPMC, and carbonaceous polymer laminates.
International Nuclear Information System (INIS)
Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi
2009-01-01
Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms
Light sensitive memristor with bi-directional and wavelength-dependent conductance control
Energy Technology Data Exchange (ETDEWEB)
Maier, P.; Hartmann, F., E-mail: fabian.hartmann@physik.uni-wuerzburg.de; Emmerling, M.; Schneider, C.; Kamp, M.; Worschech, L. [Technische Physik and Wilhelm Conrad Röntgen Research Center for Complex Material Systems, Physikalisches Institut, Universität Würzburg, Am Hubland, D-97074 Würzburg (Germany); Rebello Sousa Dias, M. [Departamento de Fisica, Universidade Federal de São Carlos, 13565-905 São Carlos, São Paulo (Brazil); Institute for Research in Electronics and Applied Physics, University of Maryland, College Park, Maryland 20742 (United States); Castelano, L. K.; Marques, G. E.; Lopez-Richard, V. [Departamento de Fisica, Universidade Federal de São Carlos, 13565-905 São Carlos, São Paulo (Brazil); Höfling, S. [Technische Physik and Wilhelm Conrad Röntgen Research Center for Complex Material Systems, Physikalisches Institut, Universität Würzburg, Am Hubland, D-97074 Würzburg (Germany); SUPA, School of Physics and Astronomy, University of St. Andrews, St. Andrews KY16 9SS (United Kingdom)
2016-07-11
We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.
Light sensitive memristor with bi-directional and wavelength-dependent conductance control
International Nuclear Information System (INIS)
Maier, P.; Hartmann, F.; Emmerling, M.; Schneider, C.; Kamp, M.; Worschech, L.; Rebello Sousa Dias, M.; Castelano, L. K.; Marques, G. E.; Lopez-Richard, V.; Höfling, S.
2016-01-01
We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.
International Nuclear Information System (INIS)
Mustafa, M.F.; Ridwan, N.I.M.; Hatta, F.F.; Yahya, M.Z.A.
2012-01-01
Influences of dimethyl carbonate (DMC) plasticizer on ionic conductivity, dielectric permittivity and electrical modulus formalism of methyl cellulose (MC)-based polymer electrolytes have been studied. The room temperature electrical conductivity as measured by impedance spectroscopy shows that a methyl cellulose film has a conductivity of ∼10 -10 S cm -1 . In this study, other than KOH ionic dopant, DMC plasticizer is also added to the polymer with the aim of enhancing the electrical conductivity of the polymer. The highest room temperature conductivity of the plasticised sample is ∼10 -5 S cm -1 . The plot of log σ versus 10 3 / T for the highest conducting sample obeys Arrhenius rule indicating that the conductivity occurs by thermally activated mechanism. (author)
Enhancing ionic conductivity in composite polymer electrolytes with well-aligned ceramic nanowires
Liu, Wei; Lee, Seok Woo; Lin, Dingchang; Shi, Feifei; Wang, Shuang; Sendek, Austin D.; Cui, Yi
2017-04-01
In contrast to conventional organic liquid electrolytes that have leakage, flammability and chemical stability issues, solid electrolytes are widely considered as a promising candidate for the development of next-generation safe lithium-ion batteries. In solid polymer electrolytes that contain polymers and lithium salts, inorganic nanoparticles are often used as fillers to improve electrochemical performance, structure stability, and mechanical strength. However, such composite polymer electrolytes generally have low ionic conductivity. Here we report that a composite polymer electrolyte with well-aligned inorganic Li+-conductive nanowires exhibits an ionic conductivity of 6.05 × 10-5 S cm-1 at 30 ∘C, which is one order of magnitude higher than previous polymer electrolytes with randomly aligned nanowires. The large conductivity enhancement is ascribed to a fast ion-conducting pathway without crossing junctions on the surfaces of the aligned nanowires. Moreover, the long-term structural stability of the polymer electrolyte is also improved by the use of nanowires.
Ionic conductivity of Ca and Mg doped NdGdZr1.95Sc0.05O7
International Nuclear Information System (INIS)
Anithakumari, P.; Mandal, B.P.; Grover, V.; Tyagi, A.K.; Mishra, A.K.
2014-01-01
The ionic conductivity of pyrochlore based materials makes them promising candidates for fuel-cell applications where high ionic conductivity and low activation energy are desired. Earlier it has been reported that 5%Sc doped GdNdZr 2 O 7 shows highest ionic conductivity. In this present work, an attempt has been made to further increase the oxygen vacancy concentration by the incorporation of Ca 2+ and Mg 2+ ions at A site of NdGdZr 1.95 Sc 0.05 O 7 (NGZS)
Temperature-dependent ionic conductivity and transport properties ...
Indian Academy of Sciences (India)
Administrator
A conductivity cell containing two stainless-steel block- ing electrodes ... tions by matching the device impedance to the cable .... reveals that the presence of large negative value in the ... site exhibits VTF phenomenological relationship. 1/2 dc.
Ionic Conductivity and Air Stability of Al-Doped Li₇La₃Zr₂O₁₂ Sintered in Alumina and Pt Crucibles.
Xia, Wenhao; Xu, Biyi; Duan, Huanan; Guo, Yiping; Kang, Hongmei; Li, Hua; Liu, Hezhou
2016-03-02
Li7La3Zr2O12 (LLZO) is a promising electrolyte material for all-solid-state battery due to its high ionic conductivity and good stability with metallic lithium. In this article, we studied the effect of crucibles on the ionic conductivity and air stability by synthesizing 0.25Al doped LLZO pellets in Pt crucibles and alumina crucibles, respectively. The results show that the composition and microstructure of the pellets play important roles influencing the ionic conductivity, relative density, and air stability. Specifically, the 0.25Al-LLZO pellets sintered in Pt crucibles exhibit a high relative density (∼96%) and high ionic conductivity (4.48 × 10(-4) S cm(-1)). The ionic conductivity maintains 3.6 × 10(-4) S cm(-1) after 3-month air exposure. In contrast, the ionic conductivity of the pellets from alumina crucibles is about 1.81 × 10(-4) S cm(-1) and drops to 2.39 × 10(-5) S cm(-1) 3 months later. The large grains and the reduced grain boundaries in the pellets sintered in Pt crucibles are favorable to obtain high ionic conductivity and good air stability. X-ray photoelectron spectroscopy (XPS) and Raman spectroscopy results suggest that the formation of Li2CO3 on the pellet surface is probably another main reason, which is also closely related to the relative density and the amount of grain boundary within the pellets. This work stresses the importance of synthesis parameters, crucibles included, to obtain the LLZO electrolyte with high ionic conductivity and good air stability.
Unconventional strain-dependent conductance oscillations in pristine phosphorene.
Ray, S J; Kamalakar, M Venkata
2018-05-16
Phosphorene is a single elemental, two-dimensional semiconductor that has quickly emerged as a high mobility material for transistors and optoelectronic devices. In addition, being a 2D material it can sustain high levels of strain, enabling sensitive modification of its electronic properties. In this paper, we investigate the strain dependent electronic properties of phosphorene nanocrystals. By performing extensive calculations we determine the electrical conductance as a function of uniaxial, as well as biaxial strain stimuli and uncover a unique zone phase diagram. This enables us to uncover conductance oscillations in pristine phosphorene for the first time, by the simple application of strain. We show that such unconventional current-voltage behaviour is tuneable by the nature of strain, and that an additional gate voltage can modulate the amplitude (peak to valley ratio) of the observed phenomena and its switching efficiency. Furthermore, we show that the switching is highly robust against doping and defects. Our detailed results present new leads for innovation in strain based gauging and high-frequency nanoelectronic switches of phosphorene.
Energy Technology Data Exchange (ETDEWEB)
Kesharwani, Priyanka; Sahu, Dinesh K.; Mahipal, Y.K.; Agrawal, R.C., E-mail: rakesh_c_agrawal@yahoo.co.in
2017-06-01
Flexible films of dry Solid Polymer Electrolytes (SPEs): [PEO: KNO{sub 3}] in varying salt concentrations have been hot-press cast. Salt concentration dependent conductivity study revealed two SPE films: [95PEO: 5KNO{sub 3}] and [70PEO: 30KNO{sub 3}] exhibiting relatively higher room temperature conductivity (σ{sub rt}) ∼ 2.76 × 10{sup -7} S/cm and ∼4.31 × 10{sup -7} S/cm respectively. In order to increase σ{sub rt} further, two strategies have been adopted. Firstly, fractional amount of KI has been dispersed as IInd-phase active filler into above two SPE film compositions which acted as Ist-phase host and Composite Polymer Electrolyte (CPE) films were hot-press cast. Filler particle concentration dependent conductivity study identified CPE films: [(95PEO: 5KNO{sub 3}) + 7KI] and [(70PEO: 30KNO{sub 3}) + 10 KI] as optimum conducting films with σ{sub rt} ∼ 6.15 × 10{sup -6} S/cm and ∼3.98 × 10{sup -6} S/cm respectively. σ{sub rt}-enhancement of approximately an order of magnitude was achieved by this approach. In second approach, dry powder mixture of (KNO{sub 3} + KI), in ratio that of above two CPE films, were subjected to high energy ball-milling separately for different durations prior to casting the films again. The conductivity measurements as a function of milling time identified CPE films: [(95PEO: 5KNO{sub 3}) + 7KI] and [(70PEO: 30KNO{sub 3}) + 10 KI] in which two respective (KNO{sub 3} + KI) ratios milled for 4- and 6-h, exhibited almost similar value of σ{sub rt} ∼ 2.09 × 10{sup -5} S/cm. This approach increased σ{sub rt} further by ∼3–6 fold. The reason attributed for this has been Nano–ionic effect introduced at the interphase boundaries between KNO{sub 3} and KI, as a consequence of milling. These films have been referred to as milled CPE films. Subsequently, all the optimum conducting SPE and CPE (unmilled/milled) films were subjected to various characterization studies in order to evaluate their utility in potential All
Energy Technology Data Exchange (ETDEWEB)
Manjunatha, H., E-mail: h-manjunath@blr.amrita.edu; Kumaraswamy, G. N. [Department of Physics, Amrita Vishwa Vidyapeetham, Bengaluru-560 035 (India); Damle, R. [Department of Physics, Bangalore University, Bengaluru-560 056 (India)
2016-05-06
Solid polymer electrolytes (SPEs) have potential applications in solid state electronic and energy devices. The optimum conductivity of SPEs required for such applications is about 10{sup −1} – 10{sup −3} Scm{sup −1}, which is hard to achieve in these systems. It is observed that ionic conductivity of SPEs continuously increase with increasing concentration of inorganic salt in the host polymer. However, there is a critical concentration of the salt beyond which the conductivity of SPEs decreases due to the formation of ion pairs. In the present study, solid polymer thin films based on poly (ethylene oxide) (PEO) complexed with NaBr salt with different concentrations have been prepared and the concentration at which ion pair formation occurs in PEO{sub x}NaBr is identified. The microstructure of the SPE with highest ionic conductivity is modified by irradiating it with low energy O{sup +1} ion (100 keV) of different fluencies. It is observed that the ionic conductivity of irradiated SPEs increases by one order in magnitude. The increase in ionic conductivity may be attributed to the enhanced segmental motion of the polymer chains due to radiation induced micro structural modification.
Highly Elastic, Transparent, and Conductive 3D-Printed Ionic Composite Hydrogels
Odent, Jérémy
2017-07-17
Despite extensive progress to engineer hydrogels for a broad range of technologies, practical applications have remained elusive due to their (until recently) poor mechanical properties and lack of fabrication approaches, which constrain active structures to simple geometries. This study demonstrates a family of ionic composite hydrogels with excellent mechanical properties that can be rapidly 3D-printed at high resolution using commercial stereolithography technology. The new material design leverages the dynamic and reversible nature of ionic interactions present in the system with the reinforcement ability of nanoparticles. The composite hydrogels combine within a single platform tunable stiffness, toughness, extensibility, and resiliency behavior not reported previously in other engineered hydrogels. In addition to their excellent mechanical performance, the ionic composites exhibit fast gelling under near-UV exposure, remarkable conductivity, and fast osmotically driven actuation. The design of such ionic composites, which combine a range of tunable properties and can be readily 3D-printed into complex architectures, provides opportunities for a variety of practical applications such as artificial tissue, soft actuators, compliant conductors, and sensors for soft robotics.
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Ionic Conductivity and its Role in Oxidation Reactions
Tamimi, Mazin Abdulla
In the field of solid oxide fuel cells (SOFCs), a substantial portion of research is focused on the ability of some oxide materials to conduct oxygen anions through their structure. For electrolytes, the benefits of improving bulk transport of ions are obvious: decrease the resistive losses of the electrolyte, and device efficiency goes up and higher power densities are possible. Even for cathode materials, better bulk ion transport leads to an increase in the oxygen exchange rate at the cathode surface, and the oxygen reduction reaction at the cathode surface is the rate limiting step for SOFC operation at intermediate temperatures (500-700ºC). As operation in this regime is a key step towards lowering the manufacturing cost and increasing the lifetime of devices, much effort is spent searching for new, more conductive materials, and analyzing existing materials to discover the structure-activity relationships that influence ionic conductivity. In the first part of this work, an overview is given of the neutron powder diffraction (NPD) techniques that are used to probe the structure of the materials in later parts. In the second part, NPD was used to analyze the structures of perovskite-type cathode materials, and show that increases in bulk conductivity led to increases in the surface oxygen exchange rate of these materials. In the final part, the methods used for SOFC cathode design were applied towards the design of oxide catalysts used for certain hydrocarbon partial oxidation reactions. The reactions studied follow the Mars van Krevelen mechanism, where oxygen atoms in the catalyst are consumed as part of the reaction and are subsequently replenished by oxygen in the gas phase. Similar to SOFC cathode operation, these processes include an oxygen reduction step, so it was hypothesized that increasing the ionic conductivity of the catalysts would improve their performance, just as it does for SOFC cathode materials. While the results are preliminary, the
Bai, Yu; Zhang, Jing; Wang, Yinghui; Zhang, Min; Wang, Peng
2011-04-19
Lithium ions are known for their potent function in modulating the energy alignment at the oxide semiconductor/dye/electrolyte interface in dye-sensitized solar cells (DSCs), offering the opportunity to control the associated multichannel charge-transfer dynamics. Herein, by optimizing the lithium iodide content in 1-ethyl-3-methylimidazolium dicyanamide-based ionic liquid electrolytes, we present a solvent-free DSC displaying an impressive 8.4% efficiency at 100 mW cm(-2) AM1.5G conditions. We further scrutinize the origins of evident impacts of lithium ions upon current density-voltage characteristics as well as photocurrent action spectra of DSCs based thereon. It is found that, along with a gradual increase of the lithium content in ionic liquid electrolytes, a consecutive diminishment of the open-circuit photovoltage arises, primarily owing to a noticeable downward movement of the titania conduction band edge. The conduction band edge displacement away from vacuum also assists the formation of a more favorable energy offset at the titania/dye interface, and thereby leads to a faster electron injection rate and a higher exciton dissociation yield as implied by transient emission measurements. We also notice that the adverse influence of the titania conduction band edge downward shift arising from lithium addition upon photovoltage is partly compensated by a concomitant suppression of the triiodide involving interfacial charge recombination. © 2011 American Chemical Society
Connection between NMR and electrical conductivity in glassy chalcogenide fast ionic conductors
International Nuclear Information System (INIS)
Kim, K.H.
1995-01-01
The work documented in this thesis follows the traditional order. In this chapter a general discussion of ionic conduction and of glassy materials are followed by a brief outline of the experimental techniques for the investigation of fast ionic conduction in glassy materials, including NMR and impedance spectroscopy techniques. A summary of the previous and present studies is presented in the last section of this introductory chapter. The details of the background theory and models are found in the Chapter II, followed by the description of the experimental details in Chapter III. Chapter IV of the thesis describes the experimental results and the analysis of the experimental observations followed by the conclusions in chapter V
Surface effects on ionic Coulomb blockade in nanometer-size pores.
Tanaka, Hiroya; Iizuka, Hideo; Pershin, Yuriy V; Ventra, Massimiliano Di
2018-01-12
Ionic Coulomb blockade in nanopores is a phenomenon that shares some similarities but also differences with its electronic counterpart. Here, we investigate this phenomenon extensively using all-atom molecular dynamics of ionic transport through nanopores of about one nanometer in diameter and up to several nanometers in length. Our goal is to better understand the role of atomic roughness and structure of the pore walls in the ionic Coulomb blockade. Our numerical results reveal the following general trends. First, the nanopore selectivity changes with its diameter, and the nanopore position in the membrane influences the current strength. Second, the ionic transport through the nanopore takes place in a hopping-like fashion over a set of discretized states caused by local electric fields due to membrane atoms. In some cases, this creates a slow-varying 'crystal-like' structure of ions inside the nanopore. Third, while at a given voltage, the resistance of the nanopore depends on its length, the slope of this dependence appears to be independent of the molarity of ions. An effective kinetic model that captures the ionic Coulomb blockade behavior observed in MD simulations is formulated.
Surface effects on ionic Coulomb blockade in nanometer-size pores
Tanaka, Hiroya; Iizuka, Hideo; Pershin, Yuriy V.; Di Ventra, Massimiliano
2018-01-01
Ionic Coulomb blockade in nanopores is a phenomenon that shares some similarities but also differences with its electronic counterpart. Here, we investigate this phenomenon extensively using all-atom molecular dynamics of ionic transport through nanopores of about one nanometer in diameter and up to several nanometers in length. Our goal is to better understand the role of atomic roughness and structure of the pore walls in the ionic Coulomb blockade. Our numerical results reveal the following general trends. First, the nanopore selectivity changes with its diameter, and the nanopore position in the membrane influences the current strength. Second, the ionic transport through the nanopore takes place in a hopping-like fashion over a set of discretized states caused by local electric fields due to membrane atoms. In some cases, this creates a slow-varying ‘crystal-like’ structure of ions inside the nanopore. Third, while at a given voltage, the resistance of the nanopore depends on its length, the slope of this dependence appears to be independent of the molarity of ions. An effective kinetic model that captures the ionic Coulomb blockade behavior observed in MD simulations is formulated.
Wojnarowska, Z; Swiety-Pospiech, A; Grzybowska, K; Hawelek, L; Paluch, M; Ngai, K L
2012-04-28
The pharmaceuticals, procaine hydrochloride and procainamide hydrochloride, are glass-forming as well as ionically conducting materials. We have made dielectric measurements at ambient and elevated pressures to characterize the dynamics of the ion conductivity relaxation in these pharmaceuticals, and calorimetric measurements for the structural relaxation. Perhaps due to their special chemical and physical structures, novel features are found in the ionic conductivity relaxation of these pharmaceuticals. Data of conductivity relaxation in most ionic conductors when represented by the electric loss modulus usually show a single resolved peak in the electric modulus loss M(")(f) spectra. However, in procaine hydrochloride and procainamide hydrochloride we find in addition another resolved loss peak at higher frequencies over a temperature range spanning across T(g). The situation is analogous to many non-ionic glass-formers showing the presence of the structural α-relaxation together with the Johari-Goldstein (JG) β-relaxation. Naturally the analogy leads us to name the slower and faster processes resolved in procaine hydrochloride and procainamide hydrochloride as the primary α-conductivity relaxation and the secondary β-conductivity relaxation, respectively. The analogy of the β-conductivity relaxation in procaine HCl and procainamide HCl with JG β-relaxation in non-ionic glass-formers goes further by the finding that the β-conductivity is strongly related to the α-conductivity relaxation at temperatures above and below T(g). At elevated pressure but compensated by raising temperature to maintain α-conductivity relaxation time constant, the data show invariance of the ratio between the β- and the α-conductivity relaxation times to changes of thermodynamic condition. This property indicates that the β-conductivity relaxation has fundamental importance and is indispensable as the precursor of the α-conductivity relaxation, analogous to the relation found
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating
Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar
2012-01-01
The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342
Probing the bulk ionic conductivity by thin film hetero-epitaxial engineering
Pergolesi, Daniele
2015-02-01
Highly textured thin films with small grain boundary regions can be used as model systems to directly measure the bulk conductivity of oxygen ion conducting oxides. Ionic conducting thin films and epitaxial heterostructures are also widely used to probe the effect of strain on the oxygen ion migration in oxide materials. For the purpose of these investigations a good lattice matching between the film and the substrate is required to promote the ordered film growth. Moreover, the substrate should be a good electrical insulator at high temperature to allow a reliable electrical characterization of the deposited film. Here we report the fabrication of an epitaxial heterostructure made with a double buffer layer of BaZrO3 and SrTiO3 grown on MgO substrates that fulfills both requirements. Based on such template platform, highly ordered (001) epitaxially oriented thin films of 15% Sm-doped CeO2 and 8 mol% Y2O3 stabilized ZrO2 are grown. Bulk conductivities as well as activation energies are measured for both materials, confirming the success of the approach. The reported insulating template platform promises potential application also for the electrical characterization of other novel electrolyte materials that still need a thorough understanding of their ionic conductivity.
Origin of Colossal Ionic Conductivity in Oxide Multilayers: Interface Induced Sublattice Disorder
International Nuclear Information System (INIS)
Pennycook, Timothy J.; Pantelides, Sokrates T.; Beck, Matthew J.; Varga, Kalman; Varela, Maria; Pennycook, Stephen J.
2010-01-01
Oxide ionic conductors typically operate at high temperatures, which limits their usefulness. Colossal room-temperature ionic conductivity was recently discovered in multilayers of yttria-stabilized zirconia (YSZ) and SrTiO 3 . Here we report density-functional calculations that trace the origin of the effect to a combination of lattice-mismatch strain and O-sublattice incompatibility. Strain alone in bulk YSZ enhances O mobility at high temperatures by inducing extreme O disorder. In multilayer structures, O-sublattice incompatibility causes the same extreme disorder at room temperature.
Electroactive Ionic Soft Actuators with Monolithically Integrated Gold Nanocomposite Electrodes.
Yan, Yunsong; Santaniello, Tommaso; Bettini, Luca Giacomo; Minnai, Chloé; Bellacicca, Andrea; Porotti, Riccardo; Denti, Ilaria; Faraone, Gabriele; Merlini, Marco; Lenardi, Cristina; Milani, Paolo
2017-06-01
Electroactive ionic gel/metal nanocomposites are produced by implanting supersonically accelerated neutral gold nanoparticles into a novel chemically crosslinked ion conductive soft polymer. The ionic gel consists of chemically crosslinked poly(acrylic acid) and polyacrylonitrile networks, blended with halloysite nanoclays and imidazolium-based ionic liquid. The material exhibits mechanical properties similar to that of elastomers (Young's modulus ≈ 0.35 MPa) together with high ionic conductivity. The fabrication of thin (≈100 nm thick) nanostructured compliant electrodes by means of supersonic cluster beam implantation (SCBI) does not significantly alter the mechanical properties of the soft polymer and provides controlled electrical properties and large surface area for ions storage. SCBI is cost effective and suitable for the scaleup manufacturing of electroactive soft actuators. This study reports the high-strain electromechanical actuation performance of the novel ionic gel/metal nanocomposites in a low-voltage regime (from 0.1 to 5 V), with long-term stability up to 76 000 cycles with no electrode delamination or deterioration. The observed behavior is due to both the intrinsic features of the ionic gel (elasticity and ionic transport capability) and the electrical and morphological features of the electrodes, providing low specific resistance (<100 Ω cm -2 ), high electrochemical capacitance (≈mF g -1 ), and minimal mechanical stress at the polymer/metal composite interface upon deformation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Galinski, Maciej; Lewandowski, Andrzej; Stepniak, Izabela
2006-01-01
Salts having a low melting point are liquid at room temperature, or even below, and form a new class of liquids usually called room temperature ionic liquids (RTIL). Information about RTILs can be found in the literature with such key words as: room temperature molten salt, low-temperature molten salt, ambient-temperature molten salt, liquid organic salt or simply ionic liquid. Their physicochemical properties are the same as high temperature ionic liquids, but the practical aspects of their maintenance or handling are different enough to merit a distinction. The class of ionic liquids, based on tetraalkylammonium cation and chloroaluminate anion, has been extensively studied since late 1970s of the XX century, following the works of Osteryoung. Systematic research on the application of chloroaluminate ionic liquids as solvents was performed in 1980s. However, ionic liquids based on aluminium halides are moisture sensitive. During the last decade an increasing number of new ionic liquids have been prepared and used as solvents. The general aim of this paper was to review the physical and chemical properties of RTILs from the point of view of their possible application as electrolytes in electrochemical processes and devices. The following points are discussed: melting and freezing, conductivity, viscosity, temperature dependence of conductivity, transport and transference numbers, electrochemical stability, possible application in aluminium electroplating, lithium batteries and in electrochemical capacitors
Effect of nanoparticles generation method on ionic conductivity in Yttria stabilized zirconia
International Nuclear Information System (INIS)
Khare, J.; Joshi, M.P.; Kukreja, L.M.; Satapathy, S.
2013-01-01
Yttria stabilized zirconia nanoparticles were generated in pulsed and CW mode of laser operation using CO 2 laser based laser vaporization method. Impedance spectroscopic measurements were carried out in frequency range of 100 Hz - 1 MHz at various temperatures ranging from room temperature to 500 C. The deconvolution of grain and grain boundary contribution were obtained from impedance spectra by an equivalent circuit analysis. Grain and grain boundary ionic conductivity of pellet made from nanoparticles generated in pulsed mode was two orders of magnitude large in comparison to pellets made from nanoparticles generated in CW mode of laser operation. The difference in ionic conductivities of pellets made from nanoparticles generated in pulsed mode and CW mode were explained on the basis of defect associations in nanoparticles produced during nanoparticles generation. (author)
Electrochemical behavior of ionically crosslinked polyampholytic gel electrolytes
International Nuclear Information System (INIS)
Chen Wanyu; Tang Haitao; Ou Ziwei; Wang Hong; Yang Yajiang
2007-01-01
An ionic complex of anionic and cationic monomers was obtained by protonation of (N,N-diethylamino)ethylmethacrylate (DEA) with acrylic acid (AAc). Free radical copolymerization of the ionic complex and acrylamide (AAm), yielded the ionically crosslinked polyampholytic gel electrolytes [poly(AAc-DEA-AAm), designated as PADA] using two types of organic solvents containing a lithium salt. The PADA gel electrolyte exhibited good thermal stability shown by the DSC thermogram. The impedance analysis at temperatures ranging from -30 to 75 deg. C indicated that the ionic conductivities of the PADA gel electrolytes were rather close to those of liquid electrolytes. The temperature dependence of the ionic conductivities was found to be in accord with the Arrhenius equation. Moreover, the ionic conductivities of PADA gel electrolytes increased with an increase of the molar ratios of cationic/anionic monomers. The ionic conductivities of PADA gels prepared in solvent mixtures of propylene carbonate, ethyl methyl ether and dioxolane (3:1:1, v/v) were higher than those of PADA gels prepared in propylene carbonate only. Significantly, the ionic conductivities of two kinds of PADA gel electrolytes were in the range of 10 -3 and 10 -4 S cm -1 even at -30 deg. C. The electrochemical windows of PADA gel electrolytes measured by cyclic voltammetry were in the range from -1 V to 4.5 V
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process
Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.
1988-08-01
Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.
International Nuclear Information System (INIS)
Dai, Chi-An; Hsiao, Chih-Chun; Weng, Shih-Chun; Kao, An-Cheng; Liu, Chien-Pan; Tsai, Wei-Bor; Chen, Wen-Shiang; Liu, Wei-Ming; Shih, Wen-Pin; Ma, Chien-Ching
2009-01-01
There is a growing interest in the development of ionic polymer–metal composites (IPMC) as sensors and actuators for biomedical applications due to their large deformation under low driving voltage. In this study, we employed poly(vinyl alcohol)/poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PVA/PAMPS) blend membranes as semi-interpenetrating polymer networks for ion exchange in IPMC construction. To improve the mechanical and electrical properties of the IPMC, multi-walled carbon nanotubes (MWNT) were added into PVA/PAMPS membranes. The actuator performance of the membranes was measured as a function of their water uptake, ion exchange capacity, ionic conductivity and the amount of MWNT in the membrane. The dispersion quality of the modified MWNT in the PVA/PAMPS membrane was measured using transmission electron microscopy. The cantilever-type IPMC actuator bends under applied voltage and its bending angle and the generative tip force were measured. Under an applied voltage, IPMC with ∼1 wt% MWNT showed the largest deflection and generated the largest blocking tip force compared with those of IPMC with other various amounts of MWNT. These results show that a small addition of MWNT can optimize the actuation performance of IPMC. The result indicates that IPMC with MWNT shows potential for use as biomimetic artificial muscle
ON the Nature of Ionic Liquid Gating of La2−xSrxCuO4
Directory of Open Access Journals (Sweden)
Hasan Atesci
2018-02-01
Full Text Available Ionic liquids have recently been used as means of modulating the charge carrier properties of cuprates. The mechanism behind it, however, is still a matter of debate. In this paper we report experiments on ionic liquid gated ultrathin La2−xSrxCuO4 films. Our results show that the electrostatic part of gating has limited influence in the conductance of the cuprate in the gate voltage range of 0 to − 2 V. A non-electrostatic mechanism takes over for gate voltages below − 2 V. This mechanism most likely changes the oxygen concentration of the film. The results presented are in line with previous X-ray based studies on ionic liquid gating induced oxygenation of the cuprate materials YBa2Cu3O7−x and La2−xSrxCuO4.
Ionic strength dependence of stability constants, complexation of Molybdenum(V I) with EDTA
International Nuclear Information System (INIS)
Zare, K.; Majlesi, K.; Teimoori, F.
2002-01-01
The stability constant of Mo (Vi) complexes with EDTA in aqueous solution has been determined by various authors using different techniques, but according to literature, no work has been reported on ionic strength dependence of these complexes. The present work describes the complexation of Mo (Vi) with EDTA in an ionic strength range of 0.1 to 1.0 moldm - 3 s odium perchlorate at 25 d ig C . The complexation of molybdenum (Vi) with EDTA was investigated in aqueous solution ranging in ph from 5 to 7 using UV spectrophotometric techniques. The composition of the complex was determined by the continuous variations method. It was shown that molybdenum (Vi) forms a 2:1 complex with EDTA of the type (MoO 3 ) 2 L - 4 a t ph =5.5 The parameters that define the dependence on ionic strength were analyzed with the aim of obtaining further information regarding to their variation as a function of the charges involved in the complex reaction. Moreover, a Debye-Huckel type equation makes it possible to estimate a stability constant at a fixed ionic strength when its value is known at another ionic media in the range of 0.1 3 . Therefore the evaluation may make a significant contribution solving many analytical and speciation problems
Mechanism of voltage-gated channel formation in lipid membranes.
Guidelli, Rolando; Becucci, Lucia
2016-04-01
Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.
Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon
2014-01-01
Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597
Energy Technology Data Exchange (ETDEWEB)
Feng, Qihang; Yang, Jiping, E-mail: jyang08@163.com; Yu, Yalin; Tian, Fangyu; Zhang, Boming; Feng, Mengjie; Wang, Shubin
2017-05-15
Highlights: • Structural electrolytes based on PEG-epoxy resins were prepared. • Factors of influencing ionic conductivity and mechanical properties were studied. • Co-continuous morphology was benefit for improved structural electrolyte property. • Efficiently optimized multifunctional electrolyte performance was achieved. - Abstract: As one of significant parts of structural power composites, structural electrolytes have desirable mechanical properties like structural resins while integrating enough ionic conductivity to work as electrolytes. Here, a series of polyethylene glycol (PEG)-epoxy-based electrolytes filled with nano-silica were prepared. The ionic conductivity and mechanical performance were studied as functions of PEG content, lithium salt concentration, nano-silica content and different curing agents. It was found that, PEG-600 and PEG-2000 content in the epoxy electrolyte system had a significant effect on their ionic conductivity. Furthermore, increasing the nano-silica content in the system induced increased ionic conductivity, decreased glass transition temperature and mechanical properties, and more interconnected irregular network in the cured systems. The introduction of rigid m-xylylenediamine resulted in enhanced mechanical properties and reasonably decreased ionic conductivity. As a result, these two-phase epoxy structural electrolytes have great potential to be used in the multifunctional energy storage devices.
Analytical Solutions of Ionic Diffusion and Heat Conduction in Multilayered Porous Media
Directory of Open Access Journals (Sweden)
Yu Bai
2015-01-01
Full Text Available Ionic diffusion and heat conduction in a multiple layered porous medium have many important engineering applications. One of the examples is the chloride ions from deicers penetrating into concrete structures such as bridge decks. Different overlays can be placed on top of concrete surface to slowdown the chloride penetration. In this paper, the chloride ion diffusion equations were established for concrete structures with multiple layers of protective system. By using Laplace transformation, an analytical solution was developed first for chloride concentration profiles in two-layered system and then extended to multiple layered systems with nonconstant boundary conditions, including the constant boundary and linear boundary conditions. Because ionic diffusion in saturated media and heat conduction are governed by the same form of partial differential equations with different materials parameters, the analytical solution was further extended to handle heat conduction in a multiple layered system under nonconstant boundary conditions. The numerical results were compared with available test data. The basic trends of the analytical solution and the test data agreed quite well.
Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer
DEFF Research Database (Denmark)
Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev
1999-01-01
bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...
Thasneema K., K.; Thayyil, M. Shahin; Krishna Kumar N., S.; Govindaraj, G.; Saheer, V. C.
2018-04-01
Usually ionic liquids consists of a large organic cation with low symmetry such as imidazolium, pyridinium, quaternary ammonium or phosponium etc combined with enormously wide range of inorganic or organic symmetric anion with melting point below 100. Ionic liquids existing in an extremely large number of possible ion pair combinations. It offers a very wide range of thermo physical properties led to the concept of designer solvents for specific applications. Due to the features of high chemical and thermal stability, low vapor pressure non flammability high ionic conductivity, and they show a good solvent ability towards a great variety of organic or inorganic compounds, ionic liquids have a widespread use in many areas such as batteries, fuel cell, solar cells, super capacitors etc. The main focus of this work is the study of molecular dynamics and conductivity relaxation of amorphous Trihexyl tetradecyl phosphonium dicyanamide ([P14,6,6,6][N(CN)2]) ionic liquid which is proved as a better electrolyte in super capacitors, over a wide frequency 10-2 Hz to 107 Hz and the temperature range between 123k and 265 k by means of Broadband Dielectric Spectroscopy. We observe alpha conductivity relaxation and secondary relaxation above and below Glass Transition Temperature. The experimental results were analyzed using electric modulus representation. The analysis emphasis the inter molecular interaction and the nature of glass forming system, whether it is fragile or strong system. The ionic liquid shows a fragile behavior and the fragility index m=123.59. TGA result of the sample exhibit a good resistance to thermal decomposition, up to 300°C.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Devendrappa, H.; Yesappa, L.; Niranjana, M.; Ashokkumar, S. P.; Vijeth, H.; Ganesh, S.
2018-04-01
The effects of electron beam (EB) irradiation on morphology, optical properties and ionic conductivity of (PVdF-co-HFP: LiClO4=90:10, PHL10) electrolyte films. The FESEM image reveal increasing porous morphology with increasing EB dose confirms the polymer degradation as result more amorphousity. The optical absorbance was found to be increase with red shift in UV region and direct optical band gaps was found decreased upon EB dose from 3.70 eV to 2.65 eV. The ionic conductivity increases slowly in lower frequency, whereas rapidly increases at the high frequency and found about 8.28×10-4 S/cm at 120 kGy dose. The obtained results suggest that the physical properties of polymer electrolytes can be changed using EB irradiation as requirement.
Ionic Conductivity of the Perovskites, NaMgF3MgF3 and KZnF3 at High Temperatures
DEFF Research Database (Denmark)
Andersen, N. H.; Kjems, Jørgen; Hayes, W.
1985-01-01
We have carried out a study of the ionic conductivity of NaMgF3, KMgF3 and KZnF3 up to temperatures close to the melting point. Our results, in contrast to previous reports in the literature, show no abnormal ionic conductivity at high temperatures. Care in interpretation of results is required...... because of surface electronic conduction....
Directory of Open Access Journals (Sweden)
Erin K Purcell
Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.
International Nuclear Information System (INIS)
Miller, F. M.
1985-01-01
Apparatus for sensing the electrical conductivity of fluid which can be used to detonate an electro explosive device for operating a release mechanism for uncoupling a parachute canopy from its load upon landing in water. An operating network connected to an ignition capacitor and to a conductivity sensing circuit and connected in controlling relation to a semiconductor switch has a voltage independent portion which controls the time at which the semiconductor switch is closed to define a discharge path to detonate the electro explosive device independent of the rate of voltage rise on the ignition capacitor. The operating network also has a voltage dependent portion which when a voltage of predetermined magnitude is developed on the conductivity sensing circuit in response to fluid not having the predetermined condition of conductivity, the voltage dependent portion closes the semiconductor switch to define the discharge path when the energy level is insufficient to detonate the electro explosive device. A regulated current source is connected in relation to the conductivity sensing circuit and to the electrodes thereof in a manner placing the circuit voltage across the electrodes when the conductivity of the fluid is below a predetermined magnitude so that the sensing circuit does not respond thereto and placing the circuit voltage across the sensing circuit when the conductivity of the fluid is greater than a predetermined magnitude. The apparatus is operated from a battery, and the electrodes are of dissimilar metals so selected and connected relative to the polarity portions of the circuit to maximize utilization of the battery output voltage
Voltage-dependent conductance states of a single-molecule junction
DEFF Research Database (Denmark)
Wang, Y F; Néel, N; Kröger, J
2012-01-01
Ag–Sn-phthalocyanine–Ag junctions are shown to exhibit three conductance states. While the junctions are conductive at low bias, their impedance drastically increases above a critical bias. Two-level fluctuations occur at intermediate bias. These characteristics may be used to protect a nanoscale...
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
Continuum electrostatics for ionic solutions with non-uniform ionic sizes
International Nuclear Information System (INIS)
Li Bo
2009-01-01
This work concerns electrostatic properties of an ionic solution with multiple ionic species of possibly different ionic sizes. Such properties are described by the minimization of an electrostatic free-energy functional of ionic concentrations. Bounds are obtained for ionic concentrations with low electrostatic free energies. Such bounds are used to show that there exists a unique set of equilibrium ionic concentrations that minimizes the free-energy functional. The equilibrium ionic concentrations are found to depend sorely on the equilibrium electrostatic potential, resembling the classical Boltzmann distributions that relate the equilibrium ionic concentrations to the equilibrium electrostatic potential. Unless all the ionic and solvent molecular sizes are assumed to be the same, explicit formulae of such dependence are, however, not available in general. It is nevertheless proved that in equilibrium the ionic charge density is a decreasing function of the electrostatic potential. This determines a variational principle with a convex functional for the electrostatic potential
International Nuclear Information System (INIS)
Guilherme, L.A.; Borges, R.S.; Moraes, E. Mara S.; Silva, G. Goulart; Pimenta, M.A.; Marletta, A.; Silva, R.A.
2007-01-01
The ionic conductivity and phase arrangement of solid polymeric electrolytes based on the block copolymer polyethylene-b-poly(ethylene oxide) (PE-b-PEO) and LiClO 4 have been investigated. One set of electrolytes was prepared from copolymers with 75% of PEO units and another set was based on a blend of copolymer with 50% PEO units and homopolymers. The differential scanning calorimetry (DSC) results, for electrolytes based on the copolymer with 75% of PEO units, were dominated by the PEO phase. The PEO block crystallinity dropped and the glass transition increased with salt addition due to the coordination of the cation by PEO oxygen. The conductivity for copolymers 75% PEO-based electrolyte with 15 wt% of salt was higher than 10 -5 S/cm at room temperature and reached to 10 -3 S/cm at 100 deg. C on a heating measurement. The blend of PE-b-PEO (50% PEO)/PEO/PE showed a complex thermal behavior with decoupled melting of the blocks and the homopolymers. Upon salt addition the endotherms associated with PEO domains disappeared and the PE crystals remained untouched. The conductivity results were limited at 100 deg. C to values close to 10 -4 S/cm and at room temperature values close to 3 x 10 -6 S/cm were obtained for the 15 wt% salt electrolyte. Raman study showed that the ionic association of the highly concentrated blend electrolytes at room temperature is not significant. Therefore, the lower values of conductivity in the case of the blend with 50% PEO can be assigned to the higher content of PE domains leading to a morphology with lower connectivity for ionic conduction both in the crystalline and melted state of the PE domains
International Nuclear Information System (INIS)
Shang, Chun Yu; Kang, Hui; Jiang, Hong Bo; Bu, Shu Po; Shang, Xiao Hong; Wu, Yan
2013-01-01
In order to improve the electric conductivity of Y 2 O 3 :Eu 3+ phosphor with the least amount of conductive component so as to maximize the improvement in low voltage cathodoluminescence, In 2 O 3 and Cu nanowires (NWs) were simultaneously introduced to form Cu NWs/In 2 O 3 -attached Y 2 O 3 :Eu 3+ phosphor. In 2 O 3 and Cu NWs play different roles in the formation of electrically conductive network, i.e., Cu NWs are suitable as conductive channels for charge transmission due to their one-dimensional morphology with large slenderness ratios, while the island-like In 2 O 3 condensates form local conductive contacts joining the adjacent Cu NWs. Meanwhile, In 2 O 3 forms attachment between Cu NWs and the phosphor. Owing to the cooperating effects between Cu NWs/In 2 O 3 conductive components in the phosphor, the efficiency in low voltage cathodoluminescence was significantly improved. -- Highlights: ► In 2 O 3 /Cu NWs were introduced in Y 2 O 3 :Eu 3+ phosphor to improve the low voltage cathodoluminescence. ► In 2 O 3 /Cu NWs play different key roles in the formation of electrically conductive network. ► The cooperating effect was proved by comparing the experimental data and the calculated results. ► The low voltage cathodoluminescence was significantly improved
Directory of Open Access Journals (Sweden)
J. Ishioka
2017-03-01
Full Text Available ZnO photocatalysts in water react with environmental water molecules and corrode under illumination. ZnO nanorods in water can also grow because of water splitting induced by UV irradiation. To investigate their morphological behavior caused by crystal growth and corrosion, here we developed a new laser-equipped high-voltage electron microscope and observed crystal ZnO nanorods immersed in ionic liquid. Exposing the specimen holder to a laser with a wavelength of 325 nm, we observed the photocorrosion in situ at the atomic scale for the first time. This experiment revealed that Zn and O atoms near the interface between the ZnO nanorods and the ionic liquid tended to dissolve into the liquid. The polarity and facet of the nanorods were strongly related to photocorrosion and crystal growth.
La Milia, Vincenzo; Pontoriero, Giuseppe; Virga, Giovambattista; Locatelli, Francesco
2015-10-01
Peritoneal membrane function can be assessed using the peritoneal equilibration test (PET) and similar tests, but these are almost always complicated to use, require a considerable amount of working time and their results cannot always be easily interpreted. Ionic conductivity is a measure of the ability of an electrolyte solution to conduct electricity. We tested the hypothesis that the ionic conductivity of peritoneal dialysate can be used to evaluate peritoneal membrane function in peritoneal dialysis patients. We measured the ionic conductivity and classic biochemical parameters of peritoneal dialysate in 69 patients during a modified PET and compared their ability to evaluate peritoneal membrane function and to diagnose ultrafiltration failure (UFF). Ionic conductivity was correlated well with classical parameters of peritoneal transport as glucose reabsorption of glucose (D/D0: r(2) = 0.62, P conductivity area under the receiver-operating characteristic curve was 0.91 (95% confidence interval: 0.81-0.96) with sensitivity of 1.00 and specificity of 0.84 at a cut-off value of 12.75 mS/cm. These findings indicate that the ionic conductivity of peritoneal dialysate can be used as a new screening tool to evaluate peritoneal membrane function. © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.
Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung
2017-10-01
Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Petit, C.; Zander, D.
2007-10-01
It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).
International Nuclear Information System (INIS)
Wu, You-Lin; Liao, Chun-Wei; Ling, Jing-Jenn
2014-01-01
The electrical characterization of HfO 2 /ITO/Invar resistive switching memory structure was studied using conductive atomic force microscopy (AFM) with a semiconductor parameter analyzer, Agilent 4156C. The metal alloy Invar was used as the metal substrate to ensure good ohmic contact with the substrate holder of the AFM. A conductive Pt/Ir AFM tip was placed in direct contact with the HfO 2 surface, such that it acted as the top electrode. Nanoscale current-voltage (I-V) characteristics of the HfO 2 /ITO/Invar structure were measured by applying a ramp voltage through the conductive AFM tip at various current compliances and ramp voltage sweep rates. It was found that the resistance of the low resistance state (RLRS) decreased with increasing current compliance value, but resistance of high resistance state (RHRS) barely changed. However, both the RHRS and RLRS decreased as the voltage sweep rate increased. The reasons for this dependency on current compliance and voltage sweep rate are discussed.
Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi
2009-01-01
Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...
International Nuclear Information System (INIS)
Saikia, D.; Kumar, A.; Singh, F.; Avasthi, D.K.; Mishra, N.C.
2005-01-01
In an attempt to increase the Li + -ion diffusivity, poly(vinylidenefluoride-co-hexafluoropropylene)-(propylene carbonate+diethyl carbonate)-lithium perchlorate gel polymer electrolyte system has been irradiated with 70-MeV C 5+ -ion beam of nine different fluences. Swift heavy-ion irradiation shows enhancement in ionic conductivity at lower fluences and decrease in ionic conductivity at higher fluences with respect to unirradiated gel polymer electrolyte films. Maximum room-temperature (303 K) ionic conductivity is found to be 2x10 -2 S/cm after irradiation with a fluence of 10 11 ions/cm 2 . This interesting result could be attributed to the fact that for a particular ion beam with a given energy, a higher fluence provides critical activation energy for cross linking and crystallization to occur, which results in the decrease in ionic conductivity. X-ray-diffraction results show decrease in the degree of crystallinity upon ion irradiation at low fluences (≤10 11 ions/cm 2 ) and increase in crystallinity at higher fluences (>10 11 ions/cm 2 ). Analysis of Fourier-transform infrared spectroscopy results suggests the bond breaking at a fluence of 5x10 9 ions/cm 2 and cross linking at a fluence of 10 12 ions/cm 2 and corroborate conductivity and x-ray-diffraction results. Scanning electron micrographs exhibit increased porosity of the polymer electrolyte after ion irradiation
DEFF Research Database (Denmark)
Bennekou, P.; Barksmann, T. L.; Christophersen, P.
2006-01-01
The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...
Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.
Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J
2012-06-06
Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Electrochemical properties of novel ionic liquids for electric double layer capacitor applications
International Nuclear Information System (INIS)
Sato, Takaya; Masuda, Gen; Takagi, Kentaro
2004-01-01
An aliphatic quaternary ammonium salt which has a methoxyethyl group on the nitrogen atom formed an ionic liquid (room temperature molten salt) when combined with the tetrafluoroborate (BF 4 - ) and bis(trifluoromethylsulfonyl)imide [TFSI; (CF 3 SO 2 ) 2 N - ] anions. The limiting oxidation and reduction potentials, specific conductivity, and some other physicochemical properties of the novel ionic liquids, N,N-diethyl-N-methyl-N-(2-methoxyethyl)ammonium tetrafluoroborate (DEME-BF 4 ) and DEME-TFSI have been evaluated and compared with those of 1-ethyl-3-methylimidazolium tetrafluoroborate. DEME-BF 4 is a practically useful ionic liquid for electrochemical capacitors as it has a quite wide potential window (6.0 V) and high ionic conductivity (4.8 mS cm -1 at 25 deg. C). We prepared an electric double layer capacitor (EDLC) composed of a pair of activated carbon electrodes and DEME-BF 4 as the electrolyte. This EDLC (working voltage ∼2.5 V) has both, a higher capacity above room temperature and a better charge-discharge cycle durability at 100 deg. C when compared to a conventional EDLC using an organic liquid electrolyte such as a tetraethylammonium tetrafluoroborate in propylene carbonate
International Nuclear Information System (INIS)
Kwak, Gun-Ho; Tominaga, Yoichi; Asai, Shigeo; Sumita, Masao
2003-01-01
The influence of the supercritical carbon dioxide (scCO 2 ) on ionic conductivity for polyether electrolytes based on oligo(oxyethylene glycol) methacrylate with lithium triflate, LiCF 3 SO 3 , has been investigated. In particular, the present research is a first attempt to improve an ion transport behavior of the polyether electrolytes using scCO 2 treatment technique. Consequently, the ionic conductivity of scCO 2 treated samples at room temperature was more than ten times elevated by the scCO 2 treatment under the condition of 10 MPa and 40 deg. C. From the Raman spectroscopy, decrease of aggregate ions and increase of free ions for the scCO 2 treated samples have been observed
International Nuclear Information System (INIS)
Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M
2016-01-01
We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)
Monitoring operating temperature and supply voltage in achieving high system dependability
Khan, M.A.; Kerkhoff, Hans G.
2013-01-01
System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability
Electro-optical phenomena based on ionic liquids in an optofluidic waveguide.
He, Xiaodong; Shao, Qunfeng; Cao, Pengfei; Kong, Weijie; Sun, Jiqian; Zhang, Xiaoping; Deng, Youquan
2015-03-07
An optofluidic waveguide with a simple two-terminal electrode geometry, when filled with an ionic liquid (IL), forms a lateral electric double-layer capacitor under a direct current (DC) electric field, which allows the realization of an extremely high carrier density in the vicinity of the electrode surface and terminals to modulate optical transmission at room temperature under low voltage operation (0 to 4 V). The unique electro-optical phenomenon of ILs was investigated at three wavelengths (663, 1330 and 1530 nm) using two waveguide geometries. Strong electro-optical modulations with different efficiencies were observed at the two near-infrared (NIR) wavelengths, while no detectable modulation was observed at 663 nm. The first waveguide geometry was used to investigate the position-dependent modulation along the waveguide; the strongest modulation was observed in the vicinity of the electrode terminal. The modulation phase is associated with the applied voltage polarity, which increases in the vicinity of the negative electrode and decreases at the positive electrode. The second waveguide geometry was used to improve the modulation efficiency. Meanwhile, the electro-optical modulations of seven ILs were compared at an applied voltage ranging from ±2 V to ±3.5 V. The results reveal that the modulation amplitude and response speed increase with increasing applied voltage, as well as the electrical conductivity of ILs. Despite the fact that the response speed isn't fast due to the high ionic density of ILs, the modulation amplitude can reach up to 6.0 dB when a higher voltage (U = ±3.5 V) is applied for the IL [Emim][BF4]. Finally, the physical explanation of the phenomenon was discussed. The effect of the change in IL structure on the electro-optical phenomena was investigated in another new experiment. The results reveal that the electro-optical phenomenon is probably caused mainly by the change in carrier concentration (ion redistribution near charged
Directory of Open Access Journals (Sweden)
Wing-Chiu Tong
2011-04-01
Full Text Available Uterine contractions during labor are discretely regulated by rhythmic action potentials (AP of varying duration and form that serve to determine calcium-dependent force production. We have employed a computational biology approach to develop a fuller understanding of the complexity of excitation-contraction (E-C coupling of uterine smooth muscle cells (USMC. Our overall aim is to establish a mathematical platform of sufficient biophysical detail to quantitatively describe known uterine E-C coupling parameters and thereby inform future empirical investigations of physiological and pathophysiological mechanisms governing normal and dysfunctional labors. From published and unpublished data we construct mathematical models for fourteen ionic currents of USMCs: Ca2+ currents (L- and T-type, Na+ current, an hyperpolarization-activated current, three voltage-gated K+ currents, two Ca2+-activated K+ current, Ca2+-activated Cl current, non-specific cation current, Na+-Ca2+ exchanger, Na+-K+ pump and background current. The magnitudes and kinetics of each current system in a spindle shaped single cell with a specified surface area:volume ratio is described by differential equations, in terms of maximal conductances, electrochemical gradient, voltage-dependent activation/inactivation gating variables and temporal changes in intracellular Ca2+ computed from known Ca2+ fluxes. These quantifications are validated by the reconstruction of the individual experimental ionic currents obtained under voltage-clamp. Phasic contraction is modeled in relation to the time constant of changing [Ca2+]i. This integrated model is validated by its reconstruction of the different USMC AP configurations (spikes, plateau and bursts of spikes, the change from bursting to plateau type AP produced by estradiol and of simultaneous experimental recordings of spontaneous AP, [Ca2+]i and phasic force. In summary, our advanced mathematical model provides a powerful tool to
Importance of liquid fragility for energy applications of ionic liquids
Sippel, Pit; Lunkenheimer, Peter; Krohns, Stephan; Thoms, Erik; Loidl, Alois
Ionic liquids (ILs) are salts that are liquid at ambient temperatures. The strong electrostatic forces between their molecular ions result, e.g., in low volatility and high stability for many members of this huge material class. For this reason they bear a high potential for new advancements in applications, e.g., as electrolytes in energy-storage devices such as supercapacitors or batteries, where the ionic conductivity is an essential figure of merit. Most ILs show dynamic properties typical for glassy matter, which dominate many of their physical properties. An important method to study these dynamical glass-properties is dielectric spectroscopy that can access relaxation times of dynamic processes and the conductivity in a broad frequency and temperature range. In the present contribution, we present results on a large variety of ionic liquids showing that the conductivity of ILs depends in a systematic way not only on their glass temperature but also on the so-called fragility, characterizing the non-canonical super-Arrhenius temperature dependence of their ionic mobility. This work was supported by the Deutsche Forschungsgemeinschaft via Research Unit FOR1394 and by the BMBF via ENREKON 03EK3015.
Electrowetting on dielectric: experimental and model study of oil conductivity on rupture voltage
Zhao, Qing; Tang, Biao; Dong, Baoqin; Li, Hui; Zhou, Rui; Guo, Yuanyuan; Dou, Yingying; Deng, Yong; Groenewold, Jan; Henzen, Alexander Victor; Zhou, Guofu
2018-05-01
Electrowetting on dielectric devices uses a conducting (water) and insulating (oil) liquid phase in conjunction on a dielectric layer. In these devices, the wetting properties of the liquid phases can be manipulated by applying an electric field. The electric field can rupture the initially flat oil film and promotes further dewetting of the oil. Here, we investigate a problem in the operation of electrowetting on dielectric caused by a finite conductivity of the oil. In particular, we find that the voltage at which the oil film ruptures is sensitive to the application of relatively low DC voltages prior to switching. Here, we systematically investigate this dependence using controlled driving schemes. The mechanism behind these history effects point to charge transport processes in the dielectric and the oil, which can be modeled and characterized by a decay time. To quantify the effects the typical response timescales have been measured with a high-speed video camera. The results have been reproduced in simulations. In addition, a simplified yet accurate equivalent circuit model is developed to analyze larger data sets more conveniently. The experimental data support the hypothesis that each pixel can be characterized by a single decay time. We studied an ensemble of pixels and found that they showed a rather broad distribution of decay times with an average value of about 440 ms. This decay time can be interpreted as a discharge timescale of the oil, not to be confused with discharge of the entire system which is generally much faster (<1 ms). Through the equivalent circuit model, we also found that variations in the fluoropolymer (FP) conductivity cannot explain the distribution of decay times, while variations in oil conductivity can.
Thawarkar, Sachin; Khupse, Nageshwar D; Kumar, Anil
2016-04-04
Electrical conductivity (σ), viscosity (η), and self-diffusion coefficient (D) measurements of binary mixtures of aprotic and protic imidazolium-based ionic liquids with water, dimethyl sulfoxide, and ethylene glycol were measured from 293.15 to 323.15 K. The temperature dependence study reveals typical Arrhenius behavior. The ionicities of aprotic ionic liquids were observed to be higher than those of protic ionic liquids in these solvents. The aprotic ionic liquid, 1-butyl-3-methylimidazolium tetrafluoroborate, [bmIm][BF4 ], displays 100 % ionicity in both water and ethylene glycol. The protic ionic liquids in both water and ethylene glycol are classed as good ionic candidates, whereas in DMSO they are classed as having a poor ionic nature. The solvation dynamics of the ionic species of the ionic liquids are illustrated on the basis of the (1) H NMR chemical shifts of the ionic liquids. The self-diffusion coefficients D of the cation and anion of [HmIm][CH3 COO] in D2 O and in [D6 ]DMSO are determined by using (1) H nuclei with pulsed field gradient spin-echo NMR spectroscopy. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Pedersen, Niels Falsig; Sørensen, O. H.; Mygind, Jesper
1978-01-01
The microwave response at 9 GHz of Sn-O-Sn tunnel-junction current biased at zero dc voltage has been measured just below the critical temperature Tc of the Sn films. The temperature dependence of the cosφ conductance is determined from the resonant response at the junction plasma frequency fp...
Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.
2018-04-01
Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.
International Nuclear Information System (INIS)
Xu, Yingjie
2013-01-01
Highlights: • Densities and viscosities of N4AC + water and N4NO 3 + water mixtures were measured. • Volumetric and viscosity properties were calculated. • Redlich–Kister equation was used to correlate the excess molar volumes and viscosity deviations. • Electrical conductivity was fitted according to the empirical Casteel–Amis equation. • The interactions and structural effects of N4AC or N4NO 3 with water were analyzed. -- Abstract: Densities and viscosities of (n-butylammonium acetate (N4AC) protic ionic liquid + water) and (n-butylammonium nitrate (N4NO 3 ) protic ionic liquid + water) mixtures were measured at T = (293.15, 298.15, 303.15, 308.15, and 313.15) K under atmospheric pressure. Electrical conductivities of the above-mentioned systems were determined at 298.15 K. Excess molar volumes and viscosity deviations were obtained from the experimental results and fitted to the Redlich–Kister equation with satisfactory results. Other volumetric properties, such as apparent molar volumes, partial molar volumes, and excess partial molar volumes were also calculated. The concentration dependence of electrical conductivity was fitted according to the empirical Casteel–Amis equation. Based on the measured and derived properties, the molecular interactions and structural factors in the above-mentioned systems were discussed
Li-rich anti-perovskite Li3OCl films with enhanced ionic conductivity
Energy Technology Data Exchange (ETDEWEB)
Lu, XJ; Wu, G; Howard, JW; Chen, AP; Zhao, YS; Daemen, LL; Jia, QX
2014-08-13
Anti-perovskite solid electrolyte films were prepared by pulsed laser deposition, and their room-temperature ionic conductivity can be improved by more than an order of magnitude in comparison with its bulk counterpart. The cyclability of Li3OCl films in contact with lithium was evaluated using a Li/Li3OCl/Li symmetric cell, showing self-stabilization during cycling test.
Voltage-gated lipid ion channels
DEFF Research Database (Denmark)
Blicher, Andreas; Heimburg, Thomas Rainer
2013-01-01
Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...
Kim, Sojeong; Choi, Soo-Hyung; Lee, Won Bo
Anion exchange membranes(AEMs) have been widely studied due to their various applications, especially for Fuel cells. Previous proton exchange membranes(PEMs), such as Nafions® have better conductivity than AEMs so far. However, technical limitations such as slow electrode kinetics, carbon monoxide (CO) poisoning of metal catalysts, high methanol crossover and high cost of Pt-based catalyst detered further usages. AEMs have advantages to supplement its drawbacks. AEMs are environmentally friendly and cost-efficient. Based on the well-defined block copolymer, self-assembled morphology is expected to have some relationship with its ionic conductivity. Recently AEMs based on various cations, including ammonium, phosphonium, guanidinium, imidazolium, metal cation, and benzimidazolium cations have been developed and extensively studied with the aim to prepare high- performance AEMs. But more fundamental approach, such as relationships between nanostructure and conductivity is needed. We use well-defined block copolymer Poly(styrene-block-isoprene) as a backbone which is synthesized by anionic polymerization. Then we graft various cationic functional groups and analysis the relation between morphology and conductivity. Theoretical and computational soft matter lab.
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
Energy Technology Data Exchange (ETDEWEB)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.
The Effect of a Spiral Gradient Magnetic Field on the Ionic Conductivity of Water
Czech Academy of Sciences Publication Activity Database
Bartušek, Karel; Marcon, P.; Fiala, P.; Máca, J.; Dohnal, P.
2017-01-01
Roč. 9, č. 9 (2017), s. 1-8, č. článku 664. ISSN 2073-4441 R&D Projects: GA ČR(CZ) GA17-00607S Institutional support: RVO:68081731 Keywords : gradient field * demineralized water * conductivity * ionic conductivity * magnetic field Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 1.832, year: 2016
Development of a LSSVM-GC model for estimating the electrical conductivity of ionic liquids
DEFF Research Database (Denmark)
Gharagheizi, Farhad; Ilani-Kashkouli, Poorandokht; Sattari, Mehdi
2014-01-01
In this communication, an extensive set of 1077 experimental electrical conductivity data for 54 ionic liquids (ILs) was collected from 21 different literature sources. Using this dataset, a reliable least square support vector machine-group contribution (LSSVM-GC) model has been developed, which...
Voltage-dependent amplification of synaptic inputs in respiratory motoneurones
Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A
2012-01-01
The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582
International Nuclear Information System (INIS)
Malik, Rajender Singh; Verma, Pawan; Choudhary, Veena
2015-01-01
Highlights: • New composite membranes based on SPEEK/EG/IL were fabricated. • Composite membranes exhibit good thermal stability than neat SPEEK and XSPEEK membrane. • Proton conductivity of all composite membranes increased with temperature and amount of ionic liquid. • Proton conductivity was measured under anhydrous condition in the temperature ranging from 30–140 °C. - Abstract: The present study describe the preparation and characterisation of anhydrous proton conducting composite membranes based on sulfonated poly(ether ether ketone) [SPEEK–degree of sulfonation 70–72%]/ethylene glycol [EG]/ionic liquid by solution casting method using water: ethanol (50:50) as solvent. For this purpose several composite membranes were prepared by mixing solution of SPEEK/ethylene glycol (67:33 wt %) in water:ethanol with varying amounts of 1-butyl-3-methyl-imidazolium trifluromethanesulfonate [bmim][OTf] ionic liquid. The cross-linking of SPEEK was carried out by thermal treatment i.e. by heating in vacuum oven at 80 °C (2 h), 100 °C (2 h), 120 °C (2 h) and 135 °C for 16 h. Ethylene glycol was used as a cross-linker for SPEEK to reduce the leaching out of ionic liquid and enhance the mechanical strength of SPEEK membranes. The membranes were characterized for thermal [thermogravimetry analysis], structural [FTIR–ATR], proton conductivity, morphology (XRD, SEM) and leaching out of ionic liquid with water. FTIR studies clearly showed the interactions between SPEEK, EG and ionic liquid. The proton conductivity and dynamic mechanical properties of the composite membranes were investigated at elevated temperature and under anhydrous conditions. Proton conductivity of all the membranes measured in the temperature range of 30–140 °C under anhydrous conditions was in the range of 10 −3 Scm −1 which showed an increase with increase in temperature and amount of ionic liquid
Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.
Held, Katharina; Voets, Thomas; Vriens, Joris
2016-01-01
Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.
Wang, Yue; Chen, Junhong; Qiu, Jingyi; Yu, Zhongbao; Ming, Hai; Li, Meng; Zhang, Songtong; Yang, Yusheng
2018-02-01
Electrical and ionic conductivity are two major limiting factors for LiCoPO4 cathode material. To overcome these shortcomings, a Cr-substituted LiCoPO4 core with a conductive carbon layer cathode material is synthesized using the sol-gel method. The physical chemistry properties of these materials are systematically investigated by using various characterization methods. For instance, the XRD and Rietveld refinement results reveal that Cr successfully substitutes the Co within the LiCoPO4 core to form LiCo1-1.5xCrxPO4/C (x = 0, 0.02, 0.04, 0.06) without changing the olivine structure but exhibits a decrease in the unit cell volume with increasing Cr substitution. SEM and TEM images indicate that Cr substitution does not lead to changes in the basic morphology of LiCo1-1.5xCrxPO4/C (x = 0, 0.02, 0.04, 0.06) material, which is composed of agglomerated nanoparticles with an 8 nm carbon layer on the surface. The EDS and XPS results confirm that Cr is uniformly distributed on the surface and that the oxidation state of Cr is +3. FTIR spectra indicate that the antisite defect concentration decreases with increasing Cr substitution. Furthermore, Cr substitution significantly improves the electrochemical performances of LiCo1-1.5xCrxPO4/C (x = 0.02, 0.04, 0.06) cathode. Notably, the LiCo0.94Cr0.04PO4/C delivers an initial discharge capacity of 144 mA h g-1 at 0.1 C and shows a capacity retention of 71% after 100 cycles between 3.0 and 5.0 V. The CV and EIS results indicate that the polarization is reduced and that the electronic and ionic conductivities are improved by Cr substitution. The good electrochemical performances for Cr-substituted LiCoPO4/C electrodes are attributed to the lower antisite defect concentration, as the reduction of polarization, the improvement of electronic and ion conductivity and the uniform carbon layer. These features will accelerate the commercial application of LiCoPO4 towards the start-art of the high voltage lithium-ion batteries.
Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites
Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.
2000-01-01
We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...
Directory of Open Access Journals (Sweden)
M. Egginger
2012-12-01
Full Text Available Polyvinylalcohol (PVA is a water soluble polymer frequently applied in the field of organic electronics for insulating thin film layers. By-products of PVA synthesis are sodium acetate ions which contaminate the polymer material and can impinge on the electronic performance when applied as interlayer dielectrics in thin film transistors. Uncontrollable voltage instabilities and unwanted hysteresis effects are regularly reported with PVA devices. An understanding of these effects require knowledge about the electronic dynamics of the ionic impurities and their influence on the dielectric properties of PVA. Respective data, which are largely unknown, are being presented in this work. Experimental investigations were performed from room temperature to 125°C on drop-cast PVA films of three different quality grades. Data from thermal discharge current (TDC measurements, polarization experiments, and dielectric impedance spectroscopy concurrently show evidence of mobile ionic carriers. Results from TDC measurements indicate the existence of an intrinsic, build-in electric field of pristine PVA films. The field is caused by asymmetric ionic double layer formation at the two different film-interfaces (substrate/PVA and PVA/air. The mobile ions cause strong electrode polarization effects which dominate dielectric impedance spectra. From a quantitative electrode polarization analysis of isothermal impedance spectra temperature dependent values for the concentration, the mobility and conductivity together with characteristic relaxation times of the mobile carriers are given. Also shown are temperature dependent results for the dc-permittivity and the electronic resistivity. The obtained results demonstrate the feasibility to partly remove contaminants from a PVA solution by dialysis cleaning. Such a cleaning procedure reduces the values of ion concentration, conductivity and relaxation frequency.
Ionic conductivities of lithium phosphorus oxynitride glasses, polycrystals, and thin films
International Nuclear Information System (INIS)
Wang, B.; Bates, J.B.; Chakoumakos, B.C.; Sales, B.C.; Kwak, B.S.; Zuhr, R.A.; Robertson, J.D.
1994-11-01
Various lithium phosphorus oxynitrides have been prepared in the form of glasses, polycrystals, and thin films. The structures of these compounds were investigated by X-ray and neutron diffraction, X-ray photoelectron spectroscopy (XPS), and high-performance liquid chromatography (HPLC). The ac impedance measurements indicate a significant improvement of ionic conductivity as the result of incorporation of nitrogen into the structure. In the case of polycrystalline Li 2.88 PO 3.73 N 0.14 with the γ-Li 3 PO 4 structure, the conductivity increased by several orders of magnitude on small addition of nitrogen. The highest conductivities in the bulk glasses and thin films were found to be 3.0 x 10 -7 and 8.9 x 10 -7 S·cm -1 at 25 degrees C, respectively
International Nuclear Information System (INIS)
Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika
2006-01-01
An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)
Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R
2003-03-01
The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.
Vodopyanov, B P
2010-05-12
The influence of the spin-dependent phase shifts (SDPSs) associated with the electronic reflection and transmission amplitudes acquired by electrons upon scattering at the potential barrier on the Andreev reflection probability of electron and hole excitations for a ferromagnet/isolator/d-wave superconductor (FIS) contact and on the charge conductance of the FIS contact is studied. Various superconductor orientations are considered. It has been found that for strong ferromagnets and ultrathin interface potential for the {110} oriented d-wave superconductor the presence of the SDPS can lead to the appearance of finite-voltage peaks in the charge conductance of the F/I/d-wave superconductor contact. On the contrary, for the {100} orientation of the d-wave superconductor the presence of the SDPS can lead to restoration of the zero-voltage peak and suppression of finite-voltage peaks. The spin-dependent amplitudes of the Andreev reflection probability and energy levels of the spin-dependent Andreev bound states are found.
International Nuclear Information System (INIS)
Yamacli, Serhan; Avci, Mutlu
2009-01-01
In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.
Lin, YuPo J [Naperville, IL; Henry, Michael P [Batavia, IL; Snyder, Seth W [Lincolnwood, IL
2011-07-12
An electrically and ionically conductive porous material including a thermoplastic binder and one or more of anion exchange moieties or cation exchange moieties or mixtures thereof and/or one or more of a protein capture resin and an electrically conductive material. The thermoplastic binder immobilizes the moieties with respect to each other but does not substantially coat the moieties and forms the electrically conductive porous material. A wafer of the material and a method of making the material and wafer are disclosed.
Quantitative analysis of dual whole-cell voltage-clamp determination of gap junctional conductance
van Rijen, H. V.; Wilders, R.; van Ginneken, A. C.; Jongsma, H. J.
1998-01-01
The dual whole-cell voltage-clamp technique is used widely for determination of kinetics and conductance of gap junctions. The use of this technique may, however, occasion to considerable errors. We have analysed the errors in steady state junctional conductance measurements under different
Directory of Open Access Journals (Sweden)
Seok-Yong Lee
2009-03-01
Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
International Nuclear Information System (INIS)
York, A; Seelecke, S; Dunn, J
2010-01-01
Dielectric electro-active polymers (DEAPs) can achieve substantial deformation (>300% strain) while sustaining, compared to their ionic counterparts, large forces. This makes them attractive for various actuation and sensing applications such as in light weight and energy efficient valve and pumping systems. Many applications operate DEAP actuators at higher frequencies where rate-dependent effects influence their performance. This motivates the seeking of dynamic characterization of these actuators beyond the quasi-static regime. This paper provides a systematic experimental investigation of the quasi-static and dynamic electromechanical properties of a DEAP actuator. In order to completely characterize the fully coupled behavior, force versus displacement measurements at various constant voltages and force versus voltage measurements at various fixed displacements are conducted. The experiments are conducted with a particular focus on the hysteretic and rate-dependent material behavior. These experiments provide insight into the electrical dynamics and viscoelastic relaxation inherent in DEAP actuators. This study is intended to provide information, including high frequency performance analysis, useful to anyone designing dynamic actuator systems using DEAPs
Energy Technology Data Exchange (ETDEWEB)
Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)
2015-07-07
Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.
Ionic conductivities of lithium phosphorus oxynitride glasses, polycrystals, and thin films
Energy Technology Data Exchange (ETDEWEB)
Wang, B.; Bates, J.B.; Chakoumakos, B.C.; Sales, B.C.; Kwak, B.S.; Zuhr, R.A. [Oak Ridge National Lab., TN (United States); Robertson, J.D. [Univ. of Kentucky, Lexington, KY (United States). Dept. of Chemistry
1994-11-01
Various lithium phosphorus oxynitrides have been prepared in the form of glasses, polycrystals, and thin films. The structures of these compounds were investigated by X-ray and neutron diffraction, X-ray photoelectron spectroscopy (XPS), and high-performance liquid chromatography (HPLC). The ac impedance measurements indicate a significant improvement of ionic conductivity as the result of incorporation of nitrogen into the structure. In the case of polycrystalline Li{sub 2.88}PO{sub 3.73}N{sub 0.14} with the {gamma}-Li{sub 3}PO{sub 4} structure, the conductivity increased by several orders of magnitude on small addition of nitrogen. The highest conductivities in the bulk glasses and thin films were found to be 3.0 {times} 10{sup -7} and 8.9 {times} 10{sup -7} S{center_dot}cm{sup -1} at 25{degrees}C, respectively.
Lin, Dingchang; Liu, Wei; Liu, Yayuan; Lee, Hye Ryoung; Hsu, Po-Chun; Liu, Kai; Cui, Yi
2016-01-13
High ionic conductivity solid polymer electrolyte (SPE) has long been desired for the next generation high energy and safe rechargeable lithium batteries. Among all of the SPEs, composite polymer electrolyte (CPE) with ceramic fillers has garnered great interest due to the enhancement of ionic conductivity. However, the high degree of polymer crystallinity, agglomeration of ceramic fillers, and weak polymer-ceramic interaction limit the further improvement of ionic conductivity. Different from the existing methods of blending preformed ceramic particles with polymers, here we introduce an in situ synthesis of ceramic filler particles in polymer electrolyte. Much stronger chemical/mechanical interactions between monodispersed 12 nm diameter SiO2 nanospheres and poly(ethylene oxide) (PEO) chains were produced by in situ hydrolysis, which significantly suppresses the crystallization of PEO and thus facilitates polymer segmental motion for ionic conduction. In addition, an improved degree of LiClO4 dissociation can also be achieved. All of these lead to good ionic conductivity (1.2 × 10(-3) S cm(-1) at 60 °C, 4.4 × 10(-5) S cm(-1) at 30 °C). At the same time, largely extended electrochemical stability window up to 5.5 V can be observed. We further demonstrated all-solid-state lithium batteries showing excellent rate capability as well as good cycling performance.
International Nuclear Information System (INIS)
Yashima, Masatomo; Nomura, Katsuhiro
2005-01-01
Research of the distribution of oxide ions and the ionic conduction path of bismuth oxide (Bi 2 O 3 ), cerium oxide (CeO 2 ) and lanthanum gallate ((La 0.8 Sr 0.2 )(Ga 0.8 Mg 0.15 Co 0.05 )O 3-δ ) is stated. The high temperature neutron diffraction method, analytical method such as Rietveld method, crystal structure analysis of ionic conductor and MEM (Maximum- Entropy Method) are explained. The nuclear density distribution of oxide ions in bismuth oxide showed so larger distribution in the direction of and than Bi ions that the oxide ions conducted these direction in the crystal. The nuclear density distribution of oxide ions of cerium oxide indicated larger distribution in the direction of than Ce ions and its tendency was remarkable at high temperature. Accordingly, the oxide ions conducted in the direction of and . The oxide ions distribution in lanthanum gallate compound was larger and complicated than positive ions. The oxide ions conducted to by describing an arc between the two stable positions. The nuclear density on the conduction path increased with increasing temperature. This above result corresponded to increase of oxide ion conductivity in the area. (S.Y.)
Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.
Directory of Open Access Journals (Sweden)
Paula L Diaz-Sylvester
Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.
Electronic and ionic conductivities and point defects in ytterbium sesquioxide at high temperature
International Nuclear Information System (INIS)
Carpentier, J.-L.; Lebrun, A.; Perdu, F.; Tellier, P.
1982-01-01
From the study of complex impedance diagrams applied to a symmetric cell Pt-Yb 2 O 3 -Pt, the authors have shown the mixed character of electrical conduction within the ytterbium sesquioxide. The measurements were performed at thermodynamic equilibrium in the temperature range from 1423 to 1623 K and the partial pressure of oxygen range from 10 -12 to 1 atm. The variations of ionic and electronic conductivity as a function of Psub(O 2 ) were interpreted in terms of four different point defects in the general case of a Frenkel disorder. The relative contributions and the activation energies of conduction of these different defects were determined. (author)
Super-ionic conductivity in (1D) nanofibrous TlGaTe2
International Nuclear Information System (INIS)
Sardarly, R.M.; Samedov, O.A.; Abdullaev, A.P.; Salmanov, F.T.; Urbanovic, A.; Garet, F.; Coutaz, J.-L.
2010-01-01
Full text : Nanodimension topologic-disorder materials constitute an important feature in the development of modern electronics. Among such materials, TlGaTe 2 is a p-type semiconductor with a nanofibrous structure Ga 3 +Te 2 - 2 groups form chains extending along the c-axis of the material. These negatively charged chains are bonded together by Tl+ ions. The resulting tetragonal lattice is characterized by a 18 D4h group symmetry. Recently, much attention has been paid to systems that behave as if they had less than 3 spatial dimensions. Such materials are often called quasi-one-dimensional (1D) nanorods, nanofibrous or nanochains. It was already studied the temperature dependence of conductivity σ (T) and current-voltage (I-V) characteristics of TlGaTe 2 . In the ohmic region of the I -V curve, σ (T) exhibits a behavior typical of hopping conductivity, which can be modeled in the framework of the Mott approximation. Moreover, it was determined the values of the density of localized states, the activation energy, the hop lengths, and the difference between the energies of states and the concentration of deep traps. The abrupt variation of the I-V curve is ascribed to the Pool-Frenkel thermal-field effect, which allows to obtain the concentration of ionized centers, the free-path lengths, the Frenkel coefficients and the shape of the potential well of TlGaTe 2 . For T>300 K, TlGaTe 2 crystals present interesting nonlinear electrical behaviors, such as switching effects and a negative-differential-resistance (NDR) region in their S-type I-V characteristics. In the NDR region, self-excited oscillations of the voltage were also observed. Here, it was investigated the temperature dependence of TlGaTe 2 crystals conductivity σ (T) in two experimental geometries, i.e. parallel and perpendicularly to the tetragonal c-axis of the crystal. The observed sharp increase of TlGaTe 2 conductivity results from a strong change of the number of the high-mobility ions. The
Chen, I-Wen Peter; Yang, Ming-Chia; Yang, Chia-Hui; Zhong, Dai-Xuan; Hsu, Ming-Chun; Chen, YiWen
2017-02-15
This is a study on the development of carbon nanotube-based composite actuators using a new ionic liquid-doped electroactive ionic polymer. For scalable production purposes, a simple hot-pressing method was used. Carbon nanotube/ionic liquid-Nafion/carbon nanotube composite films were fabricated that exhibited a large output blocking force and a stable cycling life with low alternating voltage stimuli in air. Of particular interest and importance, a blocking force of 1.5 N was achieved at an applied voltage of 6 V. Operational durability was confirmed by testing in air for over 30 000 cycles (or 43 h). The superior actuation performance of the carbon nanotube/ionic liquid-Nafion/carbon nanotube composite, coupled with easy manufacturability, low driving voltage, and reliable operation, promises great potential for artificial muscle and biomimetic applications.
Protic Cationic Oligomeric Ionic Liquids of the Urethane Type
DEFF Research Database (Denmark)
Shevchenko, V. V.; Stryutsky, A. V.; Klymenko, N. S.
2014-01-01
Protic oligomeric cationic ionic liquids of the oligo(ether urethane) type are synthesized via the reaction of an isocyanate prepolymer based on oligo(oxy ethylene)glycol with M = 1000 with hexamethylene-diisocyanate followed by blocking of the terminal isocyanate groups with the use of amine...... derivatives of imidazole, pyridine, and 3-methylpyridine and neutralization of heterocycles with ethanesulfonic acid and p-toluenesulfonic acid. The structures and properties of the synthesized oligomeric ionic liquids substantially depend on the structures of the ionic groups. They are amorphous at room...... temperature, but ethanesulfonate imidazolium and pyridinium oligomeric ionic liquids form a low melting crystalline phase. The proton conductivities of the oligomeric ionic liquids are determined by the type of cation in the temperature range 80-120 degrees C under anhydrous conditions and vary within five...
Chowdari, B. V. R.; Liu, Qingguo; Chen, Liquan
The Table of Contents for the book is as follows: * Preface * Invited Papers * Recent Trends in Solid State Ionics * Theoretical Aspects of Fast Ion Conduction in Solids * Chemical Bonding and Intercalation Processes in Framework Structures * Extra-Large Near-Electrode Regions and Diffusion Length on the Solid Electrolyte-Electrode Interface as Studied by Photo-EMF Method * Frequency Response of Glasses * XPS Studies on Ion Conducting Glasses * Characterization of New Ambient Temperature Lithium Polymer-Electrolyte * Recent Development of Polymer Electrolytes: Solid State Voltammetry in Polymer Electrolytes * Secondary Solid State Batteries: From Material Properties to Commercial Development * Silver Vanadium Oxide Bronze and its Applications for Electrochemical Devices * Study on β''-Alumina Solid Electrolyte and β Battery in SIC * Materials for Solid Oxide Fuel Cells * Processing for Super Superionic Ceramics * Hydrogen Production Using Oxide Ionic or Protonic Conductor * Ionically Conductive Sulfide-Based Lithium Glasses * Relation of Conductivity to Structure and Structural Relaxation in Ion-Conducting Glasses * The Mechanism of Ionic Conductivity in Glass * The Role of Synthesis and Structure in Solid State Ionics - Electrodes to Superconductors * Electrochromism in Spin-Coated Thin Films from Peroxo-Poly tungstate Solutions * Electrochemical Studies on High Tc Superconductors * Multivalence Fast Ionic Conductors - Montmorillonites * Contributed Papers * Volt-Ampere Characteristics and Interface Charge Transport in Solid Electrolytes * Internal Friction of Silver Chalcogenides * Thermal Expansion of Ionic and Superionic Solids * Improvement of PEO-LiCF3SO3 Complex Electrolytes Using Additives * Ionic Conductivity of Modified Poly (Methoxy Polyethylene Glycol Methacrylate) s-Lithium Salt Complexes * Solid Polymer Electrolytes of Crosslinked Polyethylene Glycol and Lithium Salts * Single Ionic Conductors Prepared by in Situ Polymerization of Methacrylic Acid
Impact of doping on the ionic conductivity of ceria: A comprehensive model
Wang, Hao
2013-06-13
Doped ceria is considered as an electrolyte for solid oxide fuel cell applications. The introduction of dopants in the ceria lattice will affect its electronic structure and, in turn, its ionic conductivity. Simulation of these issues using density functional theory becomes complicated by the random distribution of the constituent atoms. Here we use the generalized gradient approximation with on-site Coulomb interaction in conjunction with the special quasirandom structures method to investigate 18.75% and 25% Y, Gd, Sm, Pr, and La doped ceria. The calculated lattice constants and O migration energies allow us to explain the behavior of the conductivity as obtained in experiments.
Tsubaki, Shuntaro; Oono, Kiriyo; Onda, Ayumu; Yanagisawa, Kazumichi; Mitani, Tomohiko; Azuma, Jun-Ichi
2016-02-10
This study investigated the effects of ionic conduction of electrolytes under microwave field to facilitate hydrothermal hydrolysis of corn starch and crystalline cellulose (Avicel), typical model biomass substrates. Addition of 0.1M NaCl was effective to improve reducing sugar yield by 1.61-fold at unit energy (kJ) level. Although Avicel cellulose was highly recalcitrant to hydrothermal hydrolysis, addition of 0.1M MgCl2 improved reducing sugar yield by 6.94-fold at unit energy (kJ). Dielectric measurement of the mixture of corn starch/water/electrolyte revealed that ionic conduction of electrolytes were strongly involved in facilitating hydrothermal hydrolysis of polysaccharides. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ionic conductivity ageing behaviour of 10 mol.% Sc2O3–1 mol.% CeO2–ZrO2 ceramics
DEFF Research Database (Denmark)
Omar, Shobit; Bonanos, Nikolaos
2010-01-01
The long-term ionic conductivity behaviour of samples of zirconia co-doped with 10 mol.% of Sc2O3 and 1 mol.% CeO2 is evaluated in oxidizing and reducing atmospheres at 600 °C. After 3,000 h, the sample kept in reducing atmospheres exhibits 20% loss in the ionic conductivity, while the sample kep...
The ionic conductivity and local environment of cations in Bi9ReO17
International Nuclear Information System (INIS)
Thompson, M.; Herranz, T.; Santos, B.; Marco, J.F.; Berry, F.J.; Greaves, C.
2010-01-01
The influence of temperature on the structure of Bi 9 ReO 17 has been investigated using differential thermal analysis, variable temperature X-ray diffraction and neutron powder diffraction. The material undergoes an order-disorder transition at ∼1000 K on heating, to form a fluorite-related phase. The local environments of the cations in fully ordered Bi 9 ReO 17 have been investigated by Bi L III - and Re L III -edge extended X-ray absorption fine structure (EXAFS) measurements to complement the neutron powder diffraction information. Whereas rhenium displays regular tetrahedral coordination, all bismuth sites show coordination geometries which reflect the importance of a stereochemically active lone pair of electrons. Because of the wide range of Bi-O distances, EXAFS data are similar to those observed for disordered structures, and are dominated by the shorter Bi-O bonds. Ionic conductivity measurements indicate that ordered Bi 9 ReO 17 exhibits reasonably high oxide ion conductivity, corresponding to 2.9x10 -5 Ω -1 cm -1 at 673 K, whereas the disordered form shows higher oxide ion conductivity (9.1x10 -4 Ω -1 cm -1 at 673 K). - Graphical abstract: The structure of Bi 9 ReO 17 is discussed and related to the ionic conductivity of the ordered and disordered forms.
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
New perspectives in vacuum high voltage insulation. II. Gas desorption
Diamond, W T
1998-01-01
An examination has been made of gas desorption from unbaked electrodes of copper, niobium, aluminum, and titanium subjected to high voltage in vacuum. It has been shown that the gas is composed of water vapor, carbon monoxide, and carbon dioxide, the usual components of vacuum outgassing, plus an increased yield of hydrogen and light hydrocarbons. The gas desorption was driven by anode conditioning as the voltage was increased between the electrodes. The gas is often desorbed as microdischarges-pulses of a few to hundreds of microseconds-and less frequently in a more continuous manner without the obvious pulsed structure characteristic of microdischarge activity. The quantity of gas released was equivalent to many monolayers and consisted mostly of neutral molecules with an ionic component of a few percent. A very significant observation was that the gas desorption was more dependent on the total voltage between the electrodes than on the electric field. It was not triggered by field-emitted electrons but oft...
Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages
Kim, Jeonglae; Davidson, Scott; Mani, Ali
2017-11-01
Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.
Timmermann, E.; Prehn, F.; Schmidt, M.; Höft, H.; Brandenburg, R.; Kettlitz, M.
2018-04-01
A non-thermal plasma source based on a surface dielectric barrier discharge (DBD) is developed for purification of recirculating air in operating theatres in hospitals. This is a challenging application due to high flow rates, short treatment times and the low threshold for ozone in the ventilated air. Therefore, the surface DBD was enhanced in order to generate an ionic wind, which can deflect and thus, filter out airborne microorganisms. Electrical and gas diagnostics as well as microbiological experiments were performed in a downscaled plasma source under variation of various electrical parameters, but application-oriented airflow velocity and humidity. The dependence of electrical power and ozone concentration as well as charged particles in the plasma treated air on frequency, voltage and relative humidity is presented and discussed. The presence of humidity causes a more conductive dielectric surface and thus a weaker plasma formation, especially at low frequency. The airborne test bacteria, Escherichia coli, showed significant effect to plasma treatment (up to 20% reduction) and to plasma with ionic wind (up to 90% removal); especially a configuration with 70% removal and an accompanying ozone concentration of only 360 ppb is promising for future application.
International Nuclear Information System (INIS)
Kang, Sung Soo
2013-01-01
Ionic polymer actuators have recently attracted a great deal of interest as electroactive materials with potentials as soft actuators, sensors, artificial muscles, robotics, and microelectromechanical systems because of their numerous advantages, including low voltage requirement, high compliance, lightness, and flexibility. The platinum-plated Nafion, a perfluorosulfonic acid membrane made by Dupont, is commonly used as a polyelectrolyte in actuator applications. The bending of the ionic polymer actuators in an electric field is dominated by the electro-osmosis of hydrated ions and slow diffusion of free water molecules. The changes in hydration cause a local volumetric strain resulting in bending deformation, such as expansion and contraction. In this study, a two-dimensional finite element (FE) formulation based on the Galerkin method is derived for the governing equations describing these electrochemical responses. In addition, a three-dimensional FE deformation analysis is conducted on the bending behaviors of the platinum-plated ionic polymer actuators. Several numerical studies for ionic polymer actuators, such as plates with various electrode arrangements and disk models in electric field, are performed to confirm the validity of the proposed formulation.
Directory of Open Access Journals (Sweden)
Bor-Kuan Chen
2014-10-01
Full Text Available Proton exchange membranes (PEMs are a key component of a proton exchange membrane fuel cell. Sulfonated polyimides (SPIs were doped by protic ionic liquid (PIL to prepare composite PEMs with substantially improved conductivity. SPIs were synthesized from diamine, 2,2-bis[4-(4-amino-phenoxyphenyl]propane (BAPP, sulfonated diamine, 4,4'-diamino diphenyl ether-2,2'-disulfonic acid (ODADS and aromatic anhydride. BAPP improved the mechanical and thermal properties of SPIs, while ODADS enhanced conductivity. A PIL, 1-vinylimidazolium trifluoromethane-sulfonate ([VIm][OTf], was utilized. [VIm][OTf] offered better conductivity, which can be attributed to its vinyl chemical structure attached to an imidazolium ring that contributed to ionomer-PIL interactions. We prepared sulfonated polyimide/ionic liquid (SPI/IL composite PEMs using 50 wt% [VIm][OTf] with a conductivity of 7.17 mS/cm at 100 °C, and in an anhydrous condition, 3,3',4,4'-diphenyl sulfone tetracarboxylic dianhydride (DSDA was used in the synthesis of SPIs, leading to several hundred-times improvement in conductivity compared to pristine SPIs.
International Nuclear Information System (INIS)
Northcutt, Robert; Sundaresan, Vishnu-Baba
2012-01-01
Conducting polymers are electroactive materials that undergo conformal relaxation of the polymer backbone in the presence of an electrical field through ion exchange with solid or aqueous electrolytes. This conformal relaxation and the associated morphological changes make conducting polymers highly suitable for actuation and sensing applications. Among smart materials, bioderived active materials also use ion transport for sensing and actuation functions via selective ion transport. The transporter proteins extracted from biological cell membranes and reconstituted into a bilayer lipid membrane in bioderived active materials regulate ion transport for engineering functions. The protein transporter reconstituted in the bilayer lipid membrane is referred to as the bioderived membrane and serves as the active component in bioderived active materials. Inspired by the similarities in the physics of transduction in conducting polymers and bioderived active materials, an integrated ionic device is formed from the bioderived membrane and the conducting polymer membrane. This ionic device is fabricated into a laminated thin-film membrane and a common ion that can be processed by the bioderived and the conducting polymer membranes couple the ionic function of these two membranes. An integrated ionic device, fabricated from polypyrrole (PPy) doped with sodium dodecylbenzenesulfonate (NaDBS) and an alamethicin-reconstituted DPhPC bilayer lipid membrane, is presented in this paper. A voltage-gated sodium current regulates the electrochemical response in the PPy(DBS) layer. The integrated device is fabricated on silicon-based substrates through microfabrication, electropolymerization, and vesicle fusion, and ionic activity is characterized through electrochemical measurements. (paper)
Quantitative Determination on Ionic-Liquid-Gating Control of Interfacial Magnetism.
Zhao, Shishun; Zhou, Ziyao; Peng, Bin; Zhu, Mingmin; Feng, Mengmeng; Yang, Qu; Yan, Yuan; Ren, Wei; Ye, Zuo-Guang; Liu, Yaohua; Liu, Ming
2017-05-01
Ionic-liquid gating on a functional thin film with a low voltage has drawn a lot of attention due to rich chemical, electronic, and magnetic phenomena at the interface. Here, a key challenge in quantitative determination of voltage-controlled magnetic anisotropy (VCMA) in Au/[DEME] + [TFSI] - /Co field-effect transistor heterostructures is addressed. The magnetic anisotropy change as response to the gating voltage is precisely detected by in situ electron spin resonance measurements. A reversible change of magnetic anisotropy up to 219 Oe is achieved with a low gating voltage of 1.5 V at room temperature, corresponding to a record high VCMA coefficient of ≈146 Oe V -1 . Two gating effects, the electrostatic doping and electrochemical reaction, are distinguished at various gating voltage regions, as confirmed by X-ray photoelectron spectroscopy and atomic force microscopy experiments. This work shows a unique ionic-liquid-gating system for strong interfacial magnetoelectric coupling with many practical advantages, paving the way toward ion-liquid-gating spintronic/electronic devices. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.
2002-01-01
Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes
Physical properties of the eutectic NaF-LiF-LaF3 melt ionic liquid system
Directory of Open Access Journals (Sweden)
Yu. O. Plevachuk
2012-06-01
Full Text Available Results of experimental studies on electrical conductivity, viscosity and thermo-electromotive force temperature dependencies of eutectic NaF-LiF-LaF3 melt ionic liquid mixture in the temperature range of (580 ÷ 800 °C are presented. It has been found, that at the temperature of (675 ± 5 °C the ionic mixture thermo-electromotive force changes its sing to reverse, with this change being correlated with viscosity temperature dependence type readjustment occurring at the same temperature. It has been shown that the maximum value of liquid ionic mixture electrical conductivity is achieved at the temperature of (750 ± 5 °C. Obtained results could help in the molten salt reactor blanket design.
Buehler, M. G.; Kuhlman, G. M.; Keymeulen, D.; Myung, N.; Kounaves, S. P.
2003-01-01
REDOX and conductivity sensors are metal electrodes that are used to detect ionic species in solution by measuring the electrochemical cell current as the voltage is scanned. This paper describes the construction of the sensors, the potentiostat electronics, the measurement methodology, and applications to water quality measurements.
Terminology of Polymers Containing Ionizable or Ionic Groups and of Polymers Containing Ions, VII.3
Directory of Open Access Journals (Sweden)
Jarm, V.
2009-10-01
Full Text Available The class of ionic polymers has widespread application in many areas of everyday life, in industrial production, and in the processes of living matter. The properties of ionic polymers depend on the polymer structure, and the nature, content, and location of the ionic groups. To clear differences among various ionic polymers, the IUPAC recommendations present 34 definitionsfor the ionomer, polyacid, polybase, polyampholytic polymer, ion-exchange polymer, polybetaine, polyelectrolyte, intrinsically conducting polymer, solid polymer electrolyte, etc
Enhanced ionic conductivity in composite materials due to interfacial space charge layers
International Nuclear Information System (INIS)
Dudney, N.J.
1985-01-01
The ionic conductivity of a number of salts (e.g., β-AgI, LiI, CuCl, HgI 2 , etc.) can be enhanced by one to three orders of magnitude with the addition of fine particles of an insoluble and nonconducting material such as Al 2 O 3 or SiO 2 . Typically the conductivity increases with addition of the inert particles and reaches a peak at 10-40 vol % of the particles. The mechanism responsible for the enhanced conductivity of the composite is not understood at this time. Some claim that this effect is due to an increased concentration of charge carriers in a diffuse space charge layer near the charged surface of the particle. The goal of the present study is to test this proposed mechanism by calculating the maximum space charge layer effect and then using this result to estimate the conductivity of a composite with a random distribution of Al 2 O 3 particles. Also, the conductivity of composite systems has been investigated assuming an ordered distribution of particles which are surrounded by a high conductivity layer
Induction and Conduction Electromagnetic Waves Caused by Lightning Strike on the Low Voltage Network
Directory of Open Access Journals (Sweden)
Reynaldo Zoro
2010-10-01
Full Text Available Direct and indirect lightning strikes can disturb and induce low voltage overheadlines and it can produced overvoltage due to traveling waves along the lines. This overvoltage can damage the equipments connected to it. It was recorded that there were already a lot of damages of electronic equipments and arrestesr located inside the building of Lightning Measurement Station at Mnt. Tangkuban Perahu. Most of the overvoltage which was developed on the low voltage lines were coming from indirect lightning strike nearby due to the fact that most of the lines were covered by trees. Research was carried out to study and evaluate the induction and conduction of the lightning strikes to the LV lines that can lead to the cause of equipment and arrester damages inside the building. Local lightning data for the analysis were derived from measurement system installed at the stations and historical lightning data from lightning detection network called Jadpen (National Lightning Detection Network. The data was used for calculating and evaluating the voltage elevation, induction voltage profiles and conduction in the form of traveling waves using Rusck Model. Two damaged arresters were evaluated and compared and it give the better understanding on how the protection system work.Keywords:
Hema, M.; Tamilselvi, P.; Pandaram, P.
2017-07-01
Nanocomposite polymer electrolyte has been irradiated with 15 Gy Gamma rays. Exposure of gamma radiation caused scissoring and crosslinking of polymer chains thereby increasing amorphous phase of the polymer matrix because of which the ionic conductivity has been enhanced. Ionic conductivity of irradiated nanocomposite polymer electrolyte is enhanced to 9.4 × 10-4 Scm-1 at 303 K compared to un-irradiated system (σ ∼ 1.7 × 10-4 Scm-1). Temperature dependence of ionic conductivity of both un-irradiated and irradiated systems obeys VTF relation. Frequency and temperature dependence of dielectric and modulus of both systems have been analyzed. The ionic transference number of polymer electrolyte has been calculated by Wagner's polarization technique and it confirms that conducting species are predominantly due to ions in both systems.
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
International Nuclear Information System (INIS)
Hahlbohm, H.D.; Luebbig, H.; Luther, H.
1975-01-01
Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)
International Nuclear Information System (INIS)
Tian, Yue; Tian, Bining; Chen, Baojiu; Cui, Cai’e; Huang, Ping; Wang, Lei; Hua, Ruinian
2014-01-01
Graphical abstract: Three dimensional (3D) architectures YBO 3 :Eu 3+ phosphors were prepared via ionic liquid assisted hydrothermal process. The pH values and ionic liquid play an important role on the morphology of products. Excitation wavelength-dependent luminescent behavior was found in the as-prepared tyre-like YBO 3 :Eu 3+ microspheres. Highlights: • YBO 3 :Eu 3+ phosphors were prepared via ionic liquid assisted hydrothermal process. • pH values and ionic liquid play an important role on the morphology of products. • Excitation wavelength-dependent luminescent behavior was found. -- Abstract: Three dimensional (3D) architectures YBO 3 :Eu 3+ phosphors were prepared via ionic liquid-assisted hydrothermal process and characterized by X-ray diffraction (XRD), field emission scanning electron microscope (FE-SEM) and photoluminescence (PL). The pH value and ionic liquid play an important role in the control of morphology of products. By comparing with the corresponding bulk, the tyre-like YBO 3 :5 mol%Eu 3+ microspheres demonstrate a red shift of the charge transfer band (CTB), appearance of a long excitation tail at the long wavelength side of the CTB and high improved chromaticity. Two Eu 3+ environments in the tyre-like sample, namely interior and outside Eu 3+ , were found by selective excitation under the different wavelength light. Finally, fluorescent decays and Judd–Ofelt (J–O) theory were utilized to analyze the local crystal environments around Eu 3+ ions in the tyre-like and bulk phosphors
Amarasekara, Ananda S
2016-05-25
Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition.
International Nuclear Information System (INIS)
Oe, Yoshiyuki; Tominaga, Yoichi
2011-01-01
Highlights: ► Supercritical CO 2 treatment on amorphous polyether/salt mixtures improves ionic conductivity in the dry state. ► Suitable CO 2 condition for high conductivity exists in near the critical temperature and pressure. ► Conductivity decreases only 20% after 30 days. ► Dissociation of free ClO 4 − and interactions between ether chains and Li + increase in treated electrolytes. - Abstract: Supercritical carbon dioxide (scCO 2 ) as a treatment medium has a possibility to realize excellent room temperature conductivity more than 10 −4 S/cm for polymer electrolytes in the dry state. In this study, a typical high ion-conductive polyether-based electrolyte which consists of poly-[ethylene oxide-co-2-(2-methoxyethoxy)ethyl glycidyl ether] (P(EO/EM)) and lithium perchlorate (LiClO 4 ) was used as a model sample for the scCO 2 treatment. We found the suitable scCO 2 treatment conditions (pressure, temperature and time) for high conductivity. The conductivity of sample treated at 7.5 MPa and 40 °C for 40 min was more than 100-times higher than that of original without the treatment, and the value decreased only 20% after 30 days. DSC measurement revealed that the decrease in glass transition temperature (T g ) is caused by the scCO 2 -treatment. The change of ionic association in the scCO 2 -treated samples was confirmed using FT-IR measurement. The scCO 2 treatment gave rise to increase in peak fraction of free ClO 4 − anions (620–625 cm −1 ) and peak shift of ν(C–O–C) mode to lower frequency region (1060–1070 cm −1 ) depending on ether–Li + interactions.
Multiscale response of ionic systems to a spatially varying electric field
Directory of Open Access Journals (Sweden)
Jesper Schmidt Hansen
2017-05-01
Full Text Available In this paper the response of ionic systems subjected to a spatially varying electric field is studied. Following the Nernst-Planck equation, two forces driving the mass flux are present, namely, the concentration gradient and the electric potential gradient. The mass flux due to the concentration gradient is modelled through Fick's law, and a new constitutive relation for the mass flux due to the potential gradient is proposed. In the regime of low screening the response function due to the potential gradient is closely related to the ionic conductivity. In the large screening regime, on the other hand, the response function is governed by the charge-charge structure. Molecular dynamics simulations are conducted and the two wave vector dependent response functions are evaluated for models of a molten salt and an ionic liquid. In the low screening regime the response functions show same wave vector dependency, indicating that it is the same underlying physical processes that govern the response. In the screening regime the wave vector dependency is very different and, thus, the overall response is determined by different processes. This is in agreement with the observed failure of the Nernst-Einstein relation.
Diffuse-charge dynamics of ionic liquids in electrochemical systems.
Zhao, Hui
2011-11-01
We employ a continuum theory of solvent-free ionic liquids accounting for both short-range electrostatic correlations and steric effects (finite ion size) [Bazant et al., Phys. Rev. Lett. 106, 046102 (2011)] to study the response of a model microelectrochemical cell to a step voltage. The model problem consists of a 1-1 symmetric ionic liquid between two parallel blocking electrodes, neglecting any transverse transport phenomena. Matched asymptotic expansions in the limit of thin double layers are applied to analyze the resulting one-dimensional equations and study the overall charge-time relation in the weakly nonlinear regime. One important conclusion is that our simple scaling analysis suggests that the length scale √(λ*(D)l*(c)) accurately characterizes the double-layer structure of ionic liquids with strong electrostatic correlations where l*(c) is the electrostatic correlation length (in contrast, the Debye screening length λ*(D) is the primary double-layer length for electrolytes) and the response time of λ(D)(*3/2)L*/(D*l(c)(1/2)) (not λ*(D)L*/D* that is the primary charging time of electrolytes) is the correct charging time scale of ionic liquids with strong electrostatic correlations where D* is the diffusivity and L* is the separation length of the cell. With these two new scales, data of both electric potential versus distance from the electrode and the total diffuse charge versus time collapse onto each individual master curve in the presence of strong electrostatic correlations. In addition, the dependance of the total diffuse charge on steric effects, short-range correlations, and driving voltages is thoroughly examined. The results from the asymptotic analysis are compared favorably with those from full numerical simulations. Finally, the absorption of excess salt by the double layer creates a depletion region outside the double layer. Such salt depletion may bring a correction to the leading order terms and break down the weakly nonlinear
Energy Technology Data Exchange (ETDEWEB)
Harun, Fatin; Chan, Chin Han; Winie, Tan [Faculty of Applied Sciences, UniversitiTeknologi MARA (UiTM), Shah Alam, 40450 Selangor Darul Ehsan (Malaysia); Sim, Lai Har; Zainal, Nurul Fatahah Asyqin [Center of Foundation Studies, PuncakAlam Campus, UniversitiTeknologi MARA, 40430 Selangor Darul Ehsan (Malaysia)
2015-08-28
Effect of epoxide content on the thermal and conductivity properties of epoxidized natural rubber (ENR) solid polymer nanocomposite electrolytes was investigated. Commercial available epoxidized natural rubber having 25 (ENR25) and 50 mole% (ENR50) epoxide, respectively were incorporated with lithium perchlorate (LiClO{sub 4}) salt and titanium dioxide (TiO{sub 2}) nanofiller via solution casting method. The solid polymer nanocomposite electrolytes were characterized by differential scanning calorimetry (DSC) and impedance spectroscopy (IS) for their thermal properties and conductivity, respectively. It was evident that introduction of LiClO{sub 4} causes a greater increase in glass transition temperature (T{sub g}) and ionic conductivity of ENR50 as compared to ENR25. Upon addition of TiO{sub 2} in ENR/LiClO{sub 4} system, a remarkable T{sub g} elevation was observed for both ENRs where ENR50 reveals a more pronounced changes. It is interesting to note that they exhibit different phenomenon in ionic conductivity with TiO{sub 2} loading where ENR25 shows enhancement of conductivity while ENR50 shows declination.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Local Structure and Ionic Conduction at Interfaces of Electrode and Solid Electrolytes
Yamada, Hirotsohi; Oga, Yusuke; Saruwatari, Isamu; Moriguchi, Isamu
2012-01-01
All solid state batteries are attracting interests as next generation energy storage devices. However, little is known on interfaces between active materials and solid electrolytes, which may affect performance of the devices. In this study, interfacial phenomena between electrodes and solid electrolytes of all solid state batteries were investigated by using nano-composites of Li 2SiO 3-TiO 2, Li 2SiO 3-LiTiO 2, and Li 2SiO 3-FePO 4. Studies on ionic conductivity of these composites revealed...
Masuda, Masaharu; Fujita, Masashi; Iida, Osamu; Okamoto, Shin; Ishihara, Takayuki; Nanto, Kiyonori; Kanda, Takashi; Sunaga, Akihiro; Tsujimura, Takuya; Matsuda, Yasuhiro; Mano, Toshiaki
2017-08-01
A bipolar voltage reflects a thick musculature where formation of a transmural lesion may be hard to achieve. The purpose of this study was to explore the association between local bipolar voltage and conduction gap in patients with persistent atrial fibrillation (AF) who underwent atrial roof or septal linear ablation. This prospective observational study included 42 and 36 consecutive patients with persistent AF who underwent roof or septal linear ablations, respectively. After pulmonary vein isolation, left atrial linear ablations were performed, and conduction gap sites were identified and ablated after first-touch radiofrequency application. Conduction gap(s) after the first-touch roof and septal linear ablation were observed in 13 (32%) and 19 patients (53%), respectively. Roof and septal area voltages were higher in patients with conduction gap(s) than in those without (roof, 1.23 ± 0.77 vs 0.73 ± 0.42 mV, p = 0.010; septal, 0.96 ± 0.43 vs 0.54 ± 0.18 mV, p = 0.001). Trisected regional analyses revealed that the voltage was higher at the region with a conduction gap than at the region without. Complete conduction block across the roof and septal lines was not achieved in 3 (7%) and 6 patients (17%), respectively. Patients in whom a linear conduction block could not be achieved demonstrated higher ablation area voltage than those with a successful conduction block (roof, 1.91 ± 0.74 vs 0.81 ± 0.51 mV, p = 0.001; septal, 1.15 ± 0.56 vs 0.69 ± 0.31 mV, p = 0.006). In conclusion, a high regional bipolar voltage predicts failure to achieve conduction block after left atrial roof or septal linear ablation. In addition, the conduction gap was located at the preserved voltage area. Copyright © 2017 Elsevier Inc. All rights reserved.
Current-voltage-temperature characteristics of DNA origami
Energy Technology Data Exchange (ETDEWEB)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)
2009-04-29
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Current-voltage-temperature characteristics of DNA origami
International Nuclear Information System (INIS)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander
2009-01-01
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Ionic strength dependence of the oxidation of SO2 by H2O2 in sodium chloride particles
Ali, H. M.; Iedema, M.; Yu, X.-Y.; Cowin, J. P.
2014-06-01
The reaction of sulfur dioxide and hydrogen peroxide in the presence of deliquesced (>75% RH) sodium chloride (brine) particles was studied by utilizing a cross flow mini-reactor. The reaction kinetics were followed by observing chloride depletion in particles by computer-controlled scanning electron microscope with energy dispersive X-ray analysis, namely CCSEM/EDX. The reactions take place in concentrated mixed salt brine aerosols, for which no complete kinetic equilibrium data previously existed. We measured the Henry's law solubility of H2O2 in brine solutions to close that gap. We also calculated the reaction rate as the particle transforms continuously from concentrated NaCl brine to, eventually, a mixed NaHSO4 plus H2SO4 brine solution. The reaction rate of the SO2 oxidation by H2O2 was found to be influenced by the change in ionic strength as the particle undergoes compositional transformation, following closely the dependence of the third order rate constant on ionic strength as predicted using established rate equations. This is the first study that has measured the ionic strength dependence of sulfate formation (in non-aqueous media) from oxidation of mixed salt brine aerosols in the presence of H2O2. It also gives the first report of the dependence of the Henry's law constant of H2O2 on ionic strength.
International Nuclear Information System (INIS)
Shafique, Muhammad; Kennedy, Brenden J.; Iqbal, Yaseen; Ubic, Rick
2016-01-01
Compounds in the pyrochlore system Ho 2 (Zr y Ti 1−y ) 2 O 7 exhibit an order-disorder transition from pyrochlore to a defect-fluorite type structure. Compositions in this system were prepared via mechanical milling, followed by a two-step sintering process. Structural characterization was carried out via Rietveld refinements using neutron powder diffraction data, supported by X-ray diffraction to determine the phase and location of the pyrochlore-fluorite transformation. Unit-cell parameters were determined for the whole series using Rietveld refinements as well as the Nelson–Riley function. The neutron refinement results confirmed that the cation disorder was independent of the anion Frenkel disorder. The relation between the x-parameter in the oxygen 48f position and anion Frenkel disorder was found to be linear for the pyrochlore structure. The ionic conductivity studies were undertaken via AC impedance analysis to determine the electronic behaviour and its relation to the structural change in the temperature range 300°C–700 °C. The trends in ionic conductivity and activation energy were explained structurally via neutron powder diffraction and X-ray diffraction data. The pyrochlore-fluorite boundary composition (at y = 0.5) exhibited the lowest activation energy and highest ionic conductivity. - Highlights: • Ho 2 (Zr y Ti 1-y ) 2 O 7 structure changed from ordered pyrochlore to defect-fluorite at y = 0.6. • Ho 2 (Zr 0.5 Ti 0.5 ) 2 O 7 exhibited high ionic conductivity and low activation energy. • Doping improved stability in ionic conductivity behaviour at lower temperature.
2006-11-01
Technical Report 11 December 2005 - 30 November 2006 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Nanoscale Ionic Liquids 5b. GRANT NUMBER FA9550-06-1-0012...Title: Nanoscale Ionic Liquids Principal Investigator: Emmanuel P. Giannelis Address: Materials Science and Engineering, Bard Hall, Cornell University...based fluids exhibit high ionic conductivity. The NFs are typically synthesized by grafting a charged, oligomeric corona onto the nanoparticle cores
Flow reversal at low voltage and low frequency in a microfabricated ac electrokinetic pump
DEFF Research Database (Denmark)
Gregersen, Misha Marie; Olesen, Laurits Højgaard; Brask, Anders
2007-01-01
measured in a regime, where both the applied voltage and the frequency are low, Vrms1.5 V and f20 kHz, compared to previously investigated parameter ranges. The impedance spectrum has been thoroughly measured and analyzed in terms of an equivalent circuit diagram to rule out trivial circuit explanations......Microfluidic chips have been fabricated in Pyrex glass to study electrokinetic pumping generated by a low-voltage ac bias applied to an in-channel asymmetric metallic electrode array. A measurement procedure has been established and followed carefully resulting in a high degree of reproducibility...... of the measurements over several days. A large coverage fraction of the electrode array in the microfluidic channels has led to an increased sensitivity allowing for pumping measurements at low bias voltages. Depending on the ionic concentration a hitherto unobserved reversal of the pumping direction has been...
Tungsten oxide proton conducting films for low-voltage transparent oxide-based thin-film transistors
International Nuclear Information System (INIS)
Zhang, Hongliang; Wan, Qing; Wan, Changjin; Wu, Guodong; Zhu, Liqiang
2013-01-01
Tungsten oxide (WO x ) electrolyte films deposited by reactive magnetron sputtering showed a high room temperature proton conductivity of 1.38 × 10 −4 S/cm with a relative humidity of 60%. Low-voltage transparent W-doped indium-zinc-oxide thin-film transistors gated by WO x -based electrolytes were self-assembled on glass substrates by one mask diffraction method. Enhancement mode operation with a large current on/off ratio of 4.7 × 10 6 , a low subthreshold swing of 108 mV/decade, and a high field-effect mobility 42.6 cm 2 /V s was realized. Our results demonstrated that WO x -based proton conducting films were promising gate dielectric candidates for portable low-voltage oxide-based devices.
Screening for High Conductivity/Low Viscosity Ionic Liquids Using Product Descriptors.
Martin, Shawn; Pratt, Harry D; Anderson, Travis M
2017-07-01
We seek to optimize Ionic liquids (ILs) for application to redox flow batteries. As part of this effort, we have developed a computational method for suggesting ILs with high conductivity and low viscosity. Since ILs consist of cation-anion pairs, we consider a method for treating ILs as pairs using product descriptors for QSPRs, a concept borrowed from the prediction of protein-protein interactions in bioinformatics. We demonstrate the method by predicting electrical conductivity, viscosity, and melting point on a dataset taken from the ILThermo database on June 18 th , 2014. The dataset consists of 4,329 measurements taken from 165 ILs made up of 72 cations and 34 anions. We benchmark our QSPRs on the known values in the dataset then extend our predictions to screen all 2,448 possible cation-anion pairs in the dataset. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Kim, Kwang Man; Shin, Dong Ok; Lee, Young-Gi
2015-01-01
Li 1+x Al x Ti 2-x (PO 4 ) 3 (LATP) solid electrolytes are prepared by hydrothermal reaction as an effective method to yield moderate ionic conductivity adoptable in actual lithium-ion batteries. Particularly examined in this study are the effects of the synthesis conditions, such as Al dopant concentration (x), hydrothermal reaction time, and calcination and sintering temperatures, on the ionic conductivity of the synthesized LATP. Through repeated synthesis and characterizations of the LATPs by variation of the values of condition variables, the optimum condition for the best LATP with adequate ionic conductivity applicable to actual lithium batteries are determined to be x = 0.3 or 0.4, a hydrothermal reaction time of 12 h, and calcination and sintering temperatures of 600 °C and 900 °C, respectively
International Nuclear Information System (INIS)
Hsiu, S-I; Huang, J.-F.; Sun, I-W.; Yuan, C.-H.; Shiea, Jantaie
2002-01-01
Negative ion fast atom bombardment mass spectra (FAB-MS) recorded for ZnCl 2 -1-ethyl-3-methylimidazolium chloride (ZnCl 2 -EMIC) ionic liquids with various compositions indicate that various Lewis acidic chlorozincate clusters (ZnCl 3 - , Zn 2 Cl 5 - and Zn 3 Cl 7 - ) are present in ZnCl 2 -EMIC ionic liquids depending on the percentage of ZnCl 2 used in preparing the ionic liquids; higher ZnCl 2 percentage favors the larger clusters. Cyclic voltammetry reveals that the potential limits for a basic 1:3 ZnCl 2 -EMIC melt correspond to the cathodic reduction of EMI + and anodic oxidation of Cl - , giving an electrochemical window of approximately 3.0 V which is the same as that observed for basic AlCl 3 -EMIC ionic liquids. For acidic ionic liquids that have a ZnCl 2 /EMIC molar ratio higher than 0.5:1, the negative potential limit is due to the deposition of metallic zinc, and the positive potential limit is due to the oxidation of the chlorozincate complexes. All the acidic ionic liquids exhibit an electrochemical window of approximately 2 V, although the potential limits shifted in the positive direction with increasing ZnCl 2 mole ratio. Underpotential deposition of zinc was observed on Pt and Ni electrodes in the acidic ionic liquids. At proper temperatures and potentials, crystalline zinc electrodeposits were obtained from the acidic ionic liquids
Mohammad, A.; Mahmood, A.; Chin, K. T.; Danquah, M. K.; van Stratan, S.
2017-06-01
Conductive polymer had opened a new era of engineering for microelectronics and semiconductor applications. However, it is still a challenge for high voltage applications due to lower electrical conductivity compare to metals. This results tremendous energy losses during transmission and restricts its usage. In order to address such problem a novel method was investigated using nano silver particle doped iodothiophene since silver is the highest electrical conductive material. The experiments were carried out to study the organometallic diffusion behaviour of nanosilver doped iodothiophene with different concentration of iodothiophene. Five different mixing ratio between nanosilver and the solution of iodothiophene dissolved in diethyl ether were used which are 1:1.25, 1:1.5, 1:2.5, 1:3 and l:5. It was revealed that there is an effective threshold concentration of which the nano silver evenly distributed and there was no coagulation observed. These parameters laid the foundation of better doping process between the nano silver and the polymer significantly which would contribute developing conductive polymer towards high voltage application for industries that are vulnerable to corrosive environment.
Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP
Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.
2010-01-01
In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128
KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current
DEFF Research Database (Denmark)
Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten
2002-01-01
The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....
Bias-dependent model of the electrical impedance of ionic polymer-metal composites.
Cha, Youngsu; Porfiri, Maurizio
2013-02-01
In this paper, we analyze the charge dynamics of ionic polymer-metal composites (IPMCs) in response to voltage inputs composed of a large dc bias and a small superimposed time-varying voltage. The IPMC chemoelectrical behavior is described through the modified Poisson-Nernst-Planck framework, in which steric effects are taken into consideration. The physics of charge build-up and mass transfer in the proximity of the high surface electrodes is modeled by schematizing the IPMC as the stacked sequence of five layers, in which the ionomeric membrane is separated from the metal electrodes by two composite layers. The method of matched asymptotic expansions is used to derive a semianalytical solution for the concentration of mobile counterions and the electric potential in the IPMC, which is, in turn, used to establish an equivalent circuit model for the IPMC electrical response. The circuit model consists of the series connection of a resistor and two complex elements, each constituted by the parallel connection of a capacitor and a Warburg impedance. The resistor is associated with ion transport in the ionomeric membrane and is independent of the dc bias. The capacitors and the Warburg impedance idealize charge build-up and mass transfer in the vicinity of the electrodes and their value is controlled by the dc bias. The proposed approach is validated against experimental results on in-house fabricated IPMCs and the accuracy of the equivalent circuit is assessed through comparison with finite element results.
Gold-ionic liquid nanofluids with preferably tribological properties and thermal conductivity
Directory of Open Access Journals (Sweden)
Wang Baogang
2011-01-01
Full Text Available Abstract Gold/1-butyl-3-methylimidazolium hexafluorophosphate (Au/[Bmim][PF6] nanofluids containing different stabilizing agents were fabricated by a facile one-step chemical reduction method, of which the nanofluids stabilized by cetyltrimethylammonium bromide (CTABr exhibited ultrahighly thermodynamic stability. The transmission electron microscopy, UV-visible absorption, Fourier transform infrared, and X-ray photoelectron characterizations were conducted to reveal the stable mechanism. Then, the tribological properties of these ionic liquid (IL-based gold nanofluids were first investigated in more detail. In comparison with pure [Bmim][PF6] and the nanofluids possessing poor stability, the nanofluids with high stability exhibited much better friction-reduction and anti-wear properties. For instance, the friction coefficient and wear volume lubricated by the nanofluid with rather low volumetric concentration (1.02 × 10-3% stabilized by CTABr under 800 N are 13.8 and 45.4% lower than that of pure [Bmim][PF6], confirming that soft Au nanoparticles (Au NPs also can be excellent additives for high performance lubricants especially under high loads. Moreover, the thermal conductivity (TC of the stable nanofluids with three volumetric fraction (2.55 × 10-4, 5.1 × 10-4, and 1.02 × 10-3% was also measured by a transient hot wire method as a function of temperature (33 to 81°C. The results indicate that the TC of the nanofluid (1.02 × 10-3% is 13.1% higher than that of [Bmim][PF6] at 81°C but no obvious variation at 33°C. The conspicuously temperature-dependent and greatly enhanced TC of Au/[Bmim][PF6] nanofluids stabilized by CTABr could be attributed to micro-convection caused by the Brownian motion of Au NPs. Our results should open new avenues to utilize Au NPs and ILs in tribology and the high-temperature heat transfer field.
Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.
Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy
2012-07-01
Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.
Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica
2012-01-01
Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134
Ionic conductivity and the formation of cubic CaH2 in the LiBH4-Ca(BH4)2 composite
DEFF Research Database (Denmark)
Sveinbjörnsson, Dadi Þorsteinn; Blanchard, Didier; Mýrdal, Jón Steinar Garðarsson
2014-01-01
LiBH4–Ca(BH4)2 composites were prepared by ball milling. Their crystal structures and phase composition were investigated using synchrotron X-ray diffraction and Rietveld refinement, and their ionic conductivity was measured using impedance spectroscopy. The materials were found to form a physical...... treatment. Concurrent formation of elemental boron may also occur. The ionic conductivity of the composites was measured using impedance spectroscopy, and was found to be lower than that of ball milled LiBH4. Electronic band structure calculations indicate that cubic CaH2 with hydrogen defects...... is electronically conducting. Its formation along with the possible precipitation of boron therefore has an effect on the measured conductivity of the LiBH4–Ca(BH4)2 composites and may increase the risk of an internal short-circuit in the cells....
Cloning and functional expression of a plant voltage-dependent chloride channel.
Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C
1996-01-01
Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442
Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement
International Nuclear Information System (INIS)
Boudjella, Aissa
2011-01-01
The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.
International Nuclear Information System (INIS)
Stolwijk, Nicolaas A.; Kösters, Johannes; Wiencierz, Manfred; Schönhoff, Monika
2013-01-01
The degree of ion association in polymer electrolytes is often characterized by the Nernst–Einstein deviation parameter Δ, which quantifies the relative difference between the true ionic conductivity directly measured by electrical methods and the hypothetical maximum conductivity calculated from the individual ionic self-diffusion coefficients. Despite its unambiguous definition, the parameter Δ is a global quantity with limited explanatory power. Similar is true for the cation transport number t cat * , which relies on the same ionic diffusion coefficients usually measured by nuclear magnetic resonance or radiotracer methods. Particularly in cases when neutral ion pairs dominate over higher-order aggregates, more specific information can be extracted from the same body of experimental data that is used for the calculation of Δ and t cat * . This information concerns the pair contributions to the diffusion coefficient of cations and anions. Also the true cation transference number based on charged species only can be deduced. We present the basic theoretical framework and some pertinent examples dealing with ion pairing in polymer electrolytes
Energy Technology Data Exchange (ETDEWEB)
Jayaraman, R. [Department of Physics, GTN Arts and Science College, Dindigul (India); Vickraman, P., E-mail: vrsvickraman@yahoo.com; Subramanian, N. M. V.; Justin, A. Simon [Department of Physics, Gandhigram Rural Institute- Deemed University, Gandhigram (India)
2016-05-23
Impedance, XRD, DSC and FTIR studies had been carried out for PVdF-co-HFP/LIBETI based system for three plasticizer (EC/DMC) – filler (PbTiO3) weight ratios. The enhanced conductivity 4.18 × 10{sup −5} Scm{sup −1} was noted for 57.5 wt% −7.5 wt% plasticizer – filler. while blending PEMA to PVdF-co-HFP respectively 7.5: 22.5 wt % (3/7), 15 wt%: 15 wt % (5/5) and 22.5wt %: 7.5 wt % (7/3), the improved conductivity was noted for 3/7 ratio 1.22 × 10{sup −5} S cm{sup −1} and its temperature dependence abide Arrhenius behavior. The intensity of peaks in XRD diffractogram registered dominance of lead titanate, from 2θ = 10° to 80° and absence of VdF crystallites (α+β phase) was noted. In DSC studies, the presence of the exotherm events, filler effect was distinctively seen exhibiting recrystallization of VdF crystallites. In blending PEMA, however, no trace of exotherms was found suggestive of PEMA better inhibiting recrystallization. FTIR study confirmed molecular interactions of various constituents in the vibrational band 500 – 1000 cm{sup −1} both in pristine PVdF-co-HFP and PEMA blended composites with reference to C-F stretching, C-H stretching and C=O carbonyl bands.
Weyman, Alexander; Bier, Markus; Holm, Christian; Smiatek, Jens
2018-05-01
We study generic properties of poly(ionic liquid)s (PILs) via coarse-grained molecular dynamics simulations in bulk solution and under confinement. The influence of different side chain lengths on the spatial properties of the PIL systems and on the ionic transport mechanism is investigated in detail. Our results reveal the formation of apolar and polar nanodomains with increasing side chain length in good agreement with previous results for molecular ionic liquids. The ion transport numbers are unaffected by the occurrence of these domains, and the corresponding values highlight the potential role of PILs as single-ion conductors in electrochemical devices. In contrast to bulk behavior, a pronounced formation of ion conductivity channels in confined systems is initiated in close vicinity to the boundaries. We observe higher ion conductivities in these channels for increasing PIL side chain lengths in comparison with bulk values and provide an explanation for this effect. The appearance of these domains points to an improved application of PILs in modern polymer electrolyte batteries.
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2001-01-01
The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...
Energy Technology Data Exchange (ETDEWEB)
Ahmad, Mohamad M., E-mail: mmohamad@kfu.edu.sa [Department of Physics, College of Science, King Faisal University, Al-Ahsaa 31982 (Saudi Arabia); Department of Science and Mathematics, Faculty of Education in The New Valley, Assiut University, El-Kharga 72511 (Egypt); Yamane, Yohei; Yamada, Koji [Department of Applied Molecular Chemistry, College of Industrial Technology, Nihon University, Narashino, Chiba 275-8575 (Japan)
2013-09-01
Highlights: • New Ba{sub 1−x}Sn{sub x}F{sub 2} compositions have been synthesized by the mechanochemical milling. • Considerably higher ionic conductivity is obtained when increasing SnF{sub 2} content. • The increased conductivity is due to the enhanced mobility of fluoride ions -- Abstract: Solid solutions of Ba{sub 1−x}Sn{sub x}F{sub 2} fluoride ion conductors, with x = 0.1–0.4, have been synthesized by the mechanochemical milling technique for the first time. All of the prepared materials crystallize in the cubic fluorite-type structure, which indicates that the solid solution can be synthesized in the studied composition range by the mechanochemical milling technique at ambient temperature and pressure. The ionic conduction of the investigated materials has been studied by impedance spectroscopy. The ionic conductivity increased considerably, by up to six orders of magnitude compared to pure un-milled BaF{sub 2}, with increasing SnF{sub 2} content. From the analysis of the conductivity spectra of the investigated materials it is found that the concentration of mobile fluoride ions is independent of temperature with almost the same values for the investigated materials. The present results suggest that the enhanced mobility of mobile ions is the origin of the higher ionic conductivity. The dielectric properties and the associated relaxation phenomena of the current materials are also described.
Energy Technology Data Exchange (ETDEWEB)
Tripathy, Satya N., E-mail: satyanarayantripathy@gmail.com; Wojnarowska, Zaneta; Knapik, Justyna; Paluch, Marian [Institute of Physics, University of Silesia, Uniwersytecka 4, 40-007 Katowice (Poland); Silesian Center for Education and Interdisciplinary Research, 75 Pulku Piechoty 1A, 41-500 Chorzow (Poland); Shirota, Hideaki [Department of Nanomaterial Science and Department of Chemistry, Chiba University, 1-33 Yayoi, Inage-ku, Chiba 263-8522 (Japan); Biswas, Ranjit [Department of Chemical, Biological and Macromolecular Sciences, S. N. Bose National Centre for Basic Sciences, JD Block, Sector III, Salt Lake, Kolkata 700098 (India)
2015-05-14
A detailed investigation on the molecular dynamics of ionic deep eutectic solvents (acetamide + lithium nitrate/sodium thiocyanate) is reported. The study was carried out employing dielectric relaxation spectroscopy covering seven decades in frequency (10{sup −1}-10{sup 6} Hz) and in a wide temperature range from 373 K down to 173 K, accessing the dynamic observables both in liquid and glassy state. The dielectric response of the ionic system has been presented in the dynamic window of modulus formalism to understand the conductivity relaxation and its possible connection to the origin of localized motion. Two secondary relaxation processes appear below glass transition temperature. Our findings provide suitable interpretation on the nature of secondary Johari-Goldstein process describing the ion translation and orientation of dipoles in a combined approach using Ngai’s coupling model. A nearly constant loss feature is witnessed at shorter times/lower temperatures. We also discuss the ac conductivity scaling behavior using Summerfield approach and random free energy barrier model which establish the time-temperature superposition principle. These experimental observations have fundamental importance on theoretical elucidation of the conductivity relaxation and glass transition phenomena in molten ionic conductors.
International Nuclear Information System (INIS)
Suktha, Phansiri; Chiochan, Poramane; Iamprasertkun, Pawin; Wutthiprom, Juthaporn; Phattharasupakun, Nutthaphon; Suksomboon, Montakan; Kaewsongpol, Tanon; Sirisinudomkit, Pichamon; Pettong, Tanut; Sawangphruk, Montree
2015-01-01
Highlights: • A supercapacitor of organic functionalized carbon fiber paper (f-CFP) exhibits high areal and volumetric capacitances. • The performance of the supercapacitor depends on the organic functional group on the surface of the f-CFP. • Hydroxyl and carboxylic groups modified on the surface of f-CFP have higher pseudocapacitive property than amide and amine functional groups. • The f-CFP exhibits high surface ionic and bulk electrical conductivities. - Abstract: Although carbon fiber paper (CFP) or nonwovens are widely used as a non-corrosive and conductive substrate or current collector in batteries and supercapacitors as well as a gas diffusion layer in proton exchange membrane fuel cells, the CFP cannot store charges due to its poor ionic conductivity and its hydrophobic surface. In this work, the chemically functionalized CFP (f-CFP) consisting of hydroxyl and carboxylic groups on its surface was produced by an oxidation reaction of CFP in a mixed concentrated acid solution of H 2 SO 4 :HNO 3 (3:1 v/v) at 60 °C for 1 h. Other amide and amine groups modified CFP were also synthesized for comparison using a dehydration reaction of carboxylic modified CFP with ethylenediamine and n-butylamine. Interestingly, it was found that hydroxyl and carboxylic groups modified CFP behave as a pseudocapacitor electrode, which can store charges via the surface redox reaction in addition to electrochemical double layer capacitance. The aqueous-based supercapacitor of f-CFP has high areal, volumetric, and specific energy (49.0 μW.h/cm 2 , 1960 mW.h/L, and 5.2 W.h/Kg) and power (3.0 mW/cm 2 , 120 W/L, and 326.2 W/Kg) based on the total geometrical surface area and volume as well as the total weight of positive and negative electrodes. High charge capacity of the f-CFP stems from high ionic charge and pseudocapacitive behavior due to hydroxyl and carboxylic groups on its surface and high bulk electronic conductivity (2.03 mS/cm) due to 1D carbon fiber paper. The
Energy Technology Data Exchange (ETDEWEB)
Meier, Sebastian B., E-mail: sebastian.meier@belectric.com, E-mail: wiebke.sarfert@siemens.com [Department of Materials Science VI: Materials for Electronics and Energy Technology, Friedrich-Alexander-University of Erlangen-Nuremberg, 91058 Erlangen (Germany); Siemens AG, Corporate Technology, CT RTC MAT IEC-DE, 91058 Erlangen (Germany); Hartmann, David; Sarfert, Wiebke, E-mail: sebastian.meier@belectric.com, E-mail: wiebke.sarfert@siemens.com [Siemens AG, Corporate Technology, CT RTC MAT IEC-DE, 91058 Erlangen (Germany); Winnacker, Albrecht [Department of Materials Science VI: Materials for Electronics and Energy Technology, Friedrich-Alexander-University of Erlangen-Nuremberg, 91058 Erlangen (Germany)
2014-09-14
Light-emitting electrochemical cells (LECs) have received increasing attention during recent years due to their simple architecture, based on solely air-stabile materials, and ease of manufacture in ambient atmosphere, using solution-based technologies. The LEC's active layer offers semiconducting, luminescent as well as ionic functionality resulting in device physical processes fundamentally different as compared with organic light-emitting diodes. During operation, electrical double layers (EDLs) form at the electrode interfaces as a consequence of ion accumulation and electrochemical doping sets in leading to the in situ development of a light-emitting p-i-n junction. In this paper, we comment on the use of impedance spectroscopy in combination with complex nonlinear squares fitting to derive key information about the latter events in thin-film ionic transition metal complex-based light-emitting electrochemical cells based on the model compound bis-2-phenylpyridine 6-phenyl-2,2´-bipyridine iridium(III) hexafluoridophosphate ([Ir(ppy)₂(pbpy)][PF₆]). At operating voltages below the bandgap potential of the ionic complex used, we obtain the dielectric constant of the active layer, the conductivity of mobile ions, the transference numbers of electrons and ions, and the thickness of the EDLs, whereas the transient thickness of the p-i-n junction is determined at voltages above the bandgap potential. Most importantly, we find that charge transport is dominated by the ions when carrier injection from the electrodes is prohibited, that ion movement is limited by the presence of transverse internal interfaces and that the width of the intrinsic region constitutes almost 60% of the total active layer thickness in steady state at a low operating voltage.
Saranya, Aruppukottai M.; Pla, Dolors; Morata, Alex; Cavallaro, Andrea; Canales-Vá zquez, Jesú s; Kilner, John A.; Burriel, Mó nica; Tarancó n, Albert
2015-01-01
to implement in nanostructures. Here, an artificial mixed ionic electronic conducting oxide is fabricated by grain boundary (GB) engineering thin films of La0.8Sr0.2MnO3+δ. This electronic conductor is converted into a good mixed ionic electronic conductor
International Nuclear Information System (INIS)
Polu, Anji Reddy; Kumar, Ranveer; Causin, Valerio; Neppalli, Ramesh
2011-01-01
Solid polymer electrolytes based on poly (ethylene glycol) (PEG) doped with Mg(CH 3 COO) 2 have been prepared by using the solution-casting method. The X-ray diffraction patterns of PEG with Mg(CH 3 COO) 2 salt indicated a decrease in the degree of crystallinity with increasing concentration of the salt. The complexation of Mg(CH 3 COO) 2 salt with the polymer was confirmed by using Fourier transform infrared spectroscopy (FTIR) studies. The ionic conductivity was measured for the [PEG: Mg(CH 3 COO) 2 ] system in the frequency range 50 Hz - 1 MHz. The addition of Mg salt was found to improve the ionic conductivity significantly. The 15-wt-% Mg(CH 3 COO) 2 -doped system had a maximum conductivity of 1.07 x 10 -6 S/cm at 303 K. The conductance spectrum shows two distinct regions: a dc plateau and a dispersive region. The temperature dependence of the ionic conductivity reveals the conduction mechanism to be an Arrhenius-type thermally activated process.
GaN light-emitting device based on ionic liquid electrolyte
Hirai, Tomoaki; Sakanoue, Tomo; Takenobu, Taishi
2018-06-01
Ionic liquids (ILs) are attractive materials for fabricating unique hybrid devices based on electronics and electrochemistry; thus, IL-gated transistors and organic light-emitting devices of light-emitting electrochemical cells (LECs) are investigated for future low-voltage and high-performance devices. In LECs, voltage application induces the formation of electrochemically doped p–n homojunctions owing to ion rearrangements in composites of semiconductors and electrolytes, and achieves electron–hole recombination for light emission at the homojunctions. In this work, we applied this concept of IL-induced electrochemical doping to the fabrication of GaN-based light-emitting devices. We found that voltage application to the layered IL/GaN structure accumulated electrons on the GaN surface owing to ion rearrangements and improved the conductivity of GaN. The ion rearrangement also enabled holes to be injected by the strong electric field of electric double layers on hole injection contacts. This simultaneous injection of holes and electrons into GaN mediated by ions achieves light emission at a low voltage of around 3.4 V. The light emission from the simple IL/GaN structure indicates the usefulness of an electrochemical technique in generating light emission with great ease of fabrication.
Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification
Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo
2013-01-01
In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...
Energy Technology Data Exchange (ETDEWEB)
Batana, A; Faour, J
1987-03-01
The formalism of the exchange-charge model (ECM) is extended for studying the pressure dependence of the static dielectric constant and the volume dependence of the effective ionic charge for b.c.c. lattices. Calculated values for CsCl, CsBr, CsI, and TlBr together with the simple shell model values and experimental values are listed and discussed.
New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.
Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy
2004-10-01
We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.
A voltage-gated H+ channel underlying pH homeostasis in calcifying coccolithophores.
Directory of Open Access Journals (Sweden)
Alison R Taylor
2011-06-01
Full Text Available Marine coccolithophorid phytoplankton are major producers of biogenic calcite, playing a significant role in the global carbon cycle. Predicting the impacts of ocean acidification on coccolithophore calcification has received much recent attention and requires improved knowledge of cellular calcification mechanisms. Uniquely amongst calcifying organisms, coccolithophores produce calcified scales (coccoliths in an intracellular compartment and secrete them to the cell surface, requiring large transcellular ionic fluxes to support calcification. In particular, intracellular calcite precipitation using HCO₃⁻ as the substrate generates equimolar quantities of H+ that must be rapidly removed to prevent cytoplasmic acidification. We have used electrophysiological approaches to identify a plasma membrane voltage-gated H+ conductance in Coccolithus pelagicus ssp braarudii with remarkably similar biophysical and functional properties to those found in metazoans. We show that both C. pelagicus and Emiliania huxleyi possess homologues of metazoan H(v1 H+ channels, which function as voltage-gated H+ channels when expressed in heterologous systems. Homologues of the coccolithophore H+ channels were also identified in a diversity of eukaryotes, suggesting a wide range of cellular roles for the H(v1 class of proteins. Using single cell imaging, we demonstrate that the coccolithophore H+ conductance mediates rapid H+ efflux and plays an important role in pH homeostasis in calcifying cells. The results demonstrate a novel cellular role for voltage gated H+ channels and provide mechanistic insight into biomineralisation by establishing a direct link between pH homeostasis and calcification. As the coccolithophore H+ conductance is dependent on the trans-membrane H+ electrochemical gradient, this mechanism will be directly impacted by, and may underlie adaptation to, ocean acidification. The presence of this H+ efflux pathway suggests that there is no obligate
Across plane ionic conductivity of highly oriented neodymium doped ceria thin films.
Baure, G; Kasse, R M; Rudawski, N G; Nino, J C
2015-05-14
A methodology to limit interfacial effects in thin films is proposed and explained. The strategy is to reduce the impact of the electrode interfaces and eliminate cross grain boundaries that impede ionic motion. To this end, highly oriented Nd0.1Ce0.9O2-δ (NDC) nanocrystalline thin films were grown using pulsed laser deposition (PLD) on platinized single crystal a-plane sapphire substrates. High resolution cross-sectional transmission electron microscopy (HR-XTEM), scanning electron microscopy (SEM) and X-ray diffraction (XRD) verified the films were textured with columnar grains. The average widths of the columns were approximately 40 nm and not significantly changed by film thickness between 100 and 300 nm. HR-XTEM and XRD determined the {111} planes of NDC were grown preferentially on top of the {111} planes of platinum despite the large lattice mismatch between the two planes. From the XRD patterns, the out of plane strains on the platinum and NDC layers were less than 1%. This can be explained by the coincident site lattice (CSL) theory. Rotating the {111} ceria planes 19.11° with respect to the {111} platinum planes forms a Σ7 boundary where 1 in 7 cerium lattice sites are coincident with the platinum lattice sites. This orientation lowers interfacial energy promoting the preferential alignment of those two planes. The across plane ionic conductivity was measured at low temperatures (<350 °C) for the various film thicknesses. It is here shown that columnar grain growth of ceria can be induced on platinized substrates allowing pathways that are clear of blocking grain boundaries that cause conductivities to diminish as film thickness decreases.
Energy Technology Data Exchange (ETDEWEB)
Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)
2014-11-14
Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.
Ionic Conductance, Thermal and Morphological Behavior of PEO-Graphene Oxide-Salts Composites
Directory of Open Access Journals (Sweden)
Mohammad Saleem Khan
2015-01-01
Full Text Available Thin films composites of poly(ethylene oxide-graphene oxide were fabricated with and without lithium salts by solvent cast method. The ionic conductivity of these composites was studied at various concentrations of salt polymer-GO complexes and at different temperatures. The effects of temperature and graphene oxide concentration were measured from Arrhenius conductance plots. It is shown that the addition of salts in pure PEO increases conductance many times. The graphene oxide addition has enhanced the conductance approximately 1000 times as compared to that of pure PEO. The activation energies were determined for all the systems which gave higher values for pure PEO and the value decreased with the addition of LiClO4 and LiCl salts and further decreases with the addition of graphene oxide. The composite has also lowered the activation energy values which mean that incorporation of GO in PEO has decreased crystallinity and the amorphous region has increased the local mobility of polymer chains resulting in lower activation energies. SEM analysis shows uniform distribution of GO in polymer matrix. The thermal stability studies reveal that incorporation of GO has somewhat enhanced the thermal stability of the films.
Chatterjee, Soumi; Saha, Shyamal Kumar; Chakravorty, Dipankar
2018-04-01
Nanodimensional sodium silicate glasses of composition 30Na2O.70SiO2 has been prepared within the pores of 5.5 nm of mesoporous silica as a template using the surfactant P123. The nanocomposite was characterized by X-ray diffraction, transmission electron microscope, and X-ray photoelectron spectroscopy. Electrical conductivity of the sample was studied by ac impedance spectroscopy. The activation energy for ionic conduction was found to be 0.13 eV with dc conductivity at room temperature of 10-6 S-cm-1. This is attributed to the creation of oxygen ion vacancies at the interface of mesoporous silica and nanoglass arising out of the presence of Si2+ species in the system. These nanocomposites are expected to be useful for applications in sodiumion battery for storage of renewable energy.
Dynamic curvature sensing employing ionic-polymer–metal composite sensors
International Nuclear Information System (INIS)
Bahramzadeh, Yousef; Shahinpoor, Mohsen
2011-01-01
A dynamic curvature sensor is presented based on ionic-polymer–metal composite (IPMC) for curvature monitoring of deployable/inflatable dynamic space structures. Monitoring the curvature variation is of high importance in various engineering structures including shape monitoring of deployable/inflatable space structures in which the structural boundaries undergo a dynamic deployment process. The high sensitivity of IPMCs to the applied deformations as well as its flexibility make IPMCs a promising candidate for sensing of dynamic curvature changes. Herein, we explore the dynamic response of an IPMC sensor strip with respect to controlled curvature deformations subjected to different forms of input functions. Using a specially designed experimental setup, the voltage recovery effect, phase delay, and rate dependency of the output voltage signal of an IPMC curvature sensor are analyzed. Experimental results show that the IPMC sensor maintains the linearity, sensitivity, and repeatability required for curvature sensing. Besides, in order to describe the dynamic phenomena such as the rate dependency of the IPMC sensor, a chemo-electro-mechanical model based on the Poisson–Nernst–Planck (PNP) equation for the kinetics of ion diffusion is presented. By solving the governing partial differential equations the frequency response of the IPMC sensor is derived. The physical model is able to describe the dynamic properties of the IPMC sensor and the dependency of the signal on rate of excitations
Enhancing oxygen transport through Mixed-Ionic-and-Electronic-Conducting ceramic membranes
Yu, Anthony S.
Ceramic membranes based on Mixed-Ionic-and-Electronic-Conducting (MIEC) oxides are capable of separating oxygen from air in the presence of an oxygen partial-pressure gradient. These MIEC membranes show great promise for oxygen consuming industrial processes, such as the production of syngas from steam reforming of natural gas (SRM), as well as for electricity generation in Solid Oxide Fuel Cells (SOFC). For both applications, the overall performance is dictated by the rate of oxygen transport across the membrane. Oxygen transport across MIEC membranes is composed of a bulk oxygen-ion diffusion process and surface processes, such as surface reactions and adsorption/desorption of gaseous reactants/products. The main goal of this thesis was to determine which process is rate-limiting in order to significantly enhance the overall rate of oxygen transport in MIEC membrane systems. The rate-limiting step was determined by evaluating the total resistance to oxygen transfer, Rtot. Rtot is the sum of a bulk diffusion resistance in the membrane itself, Rb, and interfacial loss components, Rs. Rb is a function of the membrane's ionic conductivity and thickness, while Rs arises primarily from slow surface-exchange kinetics that cause the P(O2) at the surfaces of the membrane to differ from the P(O 2) in the adjacent gas phases. Rtot can be calculated from the Nernst potential across the membrane and the measured oxygen flux. The rate-limiting process can be determined by evaluating the relative contributions of the various losses, Rs and Rb, to Rtot. Using this method, this thesis demonstrates that for most membrane systems, Rs is the dominating factor. In the development of membrane systems with high oxygen transport rates, thin membranes with high ionic conductivities are required to achieve fast bulk oxygen-ion diffusion. However, as membrane thickness is decreased, surface reaction kinetics become more important in determining the overall transport rate. The two
Fernandez, Fernando R.; Broicher, Tilman; Truong, Alan; White, John A.
2011-01-01
Modulating the gain of the input-output function of neurons is critical for processing of stimuli and network dynamics. Previous gain control mechanisms have suggested that voltage fluctuations play a key role in determining neuronal gain in vivo. Here we show that, under increased membrane conductance, voltage fluctuations restore Na+ current and reduce spike frequency adaptation in rat hippocampal CA1 pyramidal neurons in vitro. As a consequence, membrane voltage fluctuations produce a leftward shift in the f-I relationship without a change in gain, relative to an increase in conductance alone. Furthermore, we show that these changes have important implications for the integration of inhibitory inputs. Due to the ability to restore Na+ current, hyperpolarizing membrane voltage fluctuations mediated by GABAA-like inputs can increase firing rate in a high conductance state. Finally, our data show that the effects on gain and synaptic integration are mediated by voltage fluctuations within a physiologically relevant range of frequencies (10–40 Hz). PMID:21389243
Determination of ionic conductivity in the Bi-Si-O and Pb-Si-O glasses
Directory of Open Access Journals (Sweden)
Karczewski J.
2018-03-01
Full Text Available Impedance spectroscopy measurements in various gas atmospheres were carried out in order to explain the doubts about the type of carriers and the mechanism of electrical conductivity in Bi-Si-O and Pb-Si-O glasses. In bismuth silicate glass, a typical ionic conductivity with oxygen ions as charge carriers was observed. The level of electrical conductivity of the glass at 400 °C was 5 × 10-8 S·cm-1, with the activation energy of 1.3 eV and was independent of measuring atmosphere. In the case of lead silicate glasses, the conductivity changed with measuring atmosphere. Two types of charge carriers: oxygen ions and proton ions were postulated. Proton conductivity measured in wet argon at temperature 400 °C was estimated at the level of 4 × 10-8 S·cm-1 while the oxygen ions conductivity in such conditions was 78 × 10-8 S·cm-1. We suggest that both types of charge carriers are transported along the same conduction paths using oxygen defects in the glass structure.
Investigation of ionic conduction in PEO-PVDF based blend polymer electrolytes
Patla, Subir Kumar; Ray, Ruma; Asokan, K.; Karmakar, Sanat
2018-03-01
We investigate the effect of blend host polymer on solid polymer electrolyte (SPE) films doped with ammonium iodide (NH4I) salt using a variety of experimental techniques. Structural studies on the composite SPEs show that the blending of Poly(ethylene oxide) (PEO)-Poly(vinylidene fluoride) (PVDF) polymers in a suitable ratio enhances the amorphous fraction of the polymer matrix and facilitates fast ion conduction through it. We observe that the addition of a small amount of PVDF in the PEO host polymer enhances the ion - polymer interaction leading to more ion dissociation. As a result, the effective number of mobile charge carriers within the polymer matrix increases. Systematic investigation in these blend SPEs shows that the maximum conductivity (1.01 × 10-3 S/cm) is obtained for PEO - rich (80 wt. % PEO, 20 wt. % PVDF) composites at 35 wt. % NH4I concentration at room temperature. Interestingly, at higher salt concentrations (above 35 wt. %), the conductivity is found to decrease in this system. The reduction of conductivity at higher salt concentrations is the consequence of decrease in the carrier concentration due to the formation of an ion pair and ion aggregates. PVDF-rich compositions (20 wt. % PEO and 80 wt. % PVDF), on the other hand, show a very complex porous microstructure. We also observe a much lower ionic conductivity (maximum ˜ 10-6 S/cm at 15 wt. % salt) in these composite systems relative to PEO-rich composites.
Conductivity studies on microwave synthesized glasses
Indian Academy of Sciences (India)
It has been found that conductivity in these glasses changes from the predominantly 'ionic' to predominantly 'electronic' depending upon the chemical composition. ... Indian Institute of Science, Bangalore 560012, India; Department of Physics, Sree Siddaganga College of Arts, Science and Commerce, Tumkur University, ...
Capacitive Energy Storage from - 50o to 100o Using an Ionic Liquid Electrolyte
Energy Technology Data Exchange (ETDEWEB)
Lin, Rongying [Universite Paul Sabatier, Toulouse Cedex, France.; Taberna, Pierre-Louis [Universite Paul Sabatier, Toulouse Cedex, France.; Santini, Sebastien [SOLVIONIC Company, Toulouse, France; Presser, Volker [ORNL; Perez, Carlos R. [Drexel University; Malbosc, Francois [SOLVIONIC Company, Toulouse, France; Rupesinghe, Nalin L. [AIXTRON, Cambridge, UK; Teo, Kenneth B. K. [AIXTRON, Cambridge, UK; Gogotsi, Yury G. [Drexel University; Simon, Patrice [Universite Paul Sabatier, Toulouse Cedex, France.
2011-01-01
Relying on redox reactions, most batteries are limited in their ability to operate at very low or very high temperatures. While performance of electrochemical capacitors is less dependent on the temperature, present-day devices still cannot cover the entire range needed for automotive and electronics applications under a variety of environmental conditions. We show that the right combination of the exohedral nanostructured carbon (nanotubes and onions) electrode and a eutectic mixture of ionic liquids can dramatically extend the temperature range of electrical energy storage, thus defying the conventional wisdom that ionic liquids can only be used as electrolytes above room temperature. We demonstrate electrical double layer capacitors able to operate from 50 to 100 C over a wide voltage window (up to 3.7 V) and at very high charge/discharge rates of up to 20 V/s.
Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A
2018-02-21
Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.
Effect of ionic strength on the kinetics of ionic and micellar reactions in aqueous solution
International Nuclear Information System (INIS)
Dung, M.H.; Kozak, J.J.
1982-01-01
The effect of electrostatic forces on the rate of reaction between ions in aqueous solutions of intermediate ionic strength is studied in this paper. We consider the kinetics of reactions involving simple ionic species (1--1 and 2--2 electrolyte systems) as well as kinetic processes mediated by the presence of micellar ions (or other charged organizates). In the regime of ionic strength considered, dielectric saturation of the solvent in the vicinity of the reacting ions must be taken into account and this is done by introducing several models to describe the recovery of the solvent from saturation to its continuum dielectric behavior. To explore the effects of ion size, charge number, and ionic strength on the overall rate constant for the process considered, we couple the traditional theory of ionic reactions in aqueous solution with calculations of the electrostatic potential obtained via solution of the nonlinear Poisson--Boltzmann equation. The great flexibility of the nonlinear Poisson--Boltzmann theory allows us to explore quantitatively the influence of each of these effects, and our simulations show that the short-range properties of the electrostatic potential affect primarily kinetically controlled processes (to varying degrees, depending on the ionic system considered) whereas the down-range properties of the potential play a (somewhat) greater role in influencing diffusion-controlled processes. A detailed examination is made of ionic strength effects over a broad range of ionic concentrations. In the regime of low ionic strength, the limiting slope and intercept of the curve describing the dependence of log k/sub D/ on I/sup 1/2//(1+I/sup 1/2/) may differ considerably from the usual Debye--Hueckel limiting relations, depending on the particular model chosen to describe local saturation effects
Toward protic ionic liquid and organic ionic plastic crystal electrolytes for fuel cells
International Nuclear Information System (INIS)
Rana, Usman Ali; Forsyth, Maria; MacFarlane, Douglas R.; Pringle, Jennifer M.
2012-01-01
Highlights: ► Polymer electrolyte membrane fuel cells that can operate above 120 °C, without humidification, would be much more commercially viable. ► Protic ionic liquids and organic ionic plastic crystals are showing increasing promise as anhydrous proton conductors in fuel cells. ► Here we review the recent progress in these two areas. - Abstract: There is increasing demand for the development of anhydrous proton conducting electrolytes, most notably to allow the development of fuel cells that can operate at temperatures above 120 °C, without the need for constant and controlled humidification. The emerging field of protic ionic liquids (PILs) represents a promising new direction for this research and the development of these materials has made significant progress in recent years. In a related but as yet little-explored avenue, proton conducting organic ionic plastic crystals offer the potential advantage of providing a solid state matrix for anhydrous proton conductivity. Here we discuss the recent progress in these areas and identify the key challenges for future research.
Yokota, Yasuyuki; Miyamoto, Hiroo; Imanishi, Akihito; Takeya, Jun; Inagaki, Kouji; Morikawa, Yoshitada; Fukui, Ken-Ichi
2018-05-09
Electric double-layer transistors based on ionic liquid/organic semiconductor interfaces have been extensively studied during the past decade because of their high carrier densities at low operation voltages. Microscopic structures and the dynamics of ionic liquids likely determine the device performance; however, knowledge of these is limited by a lack of appropriate experimental tools. In this study, we investigated ionic liquid/organic semiconductor interfaces using molecular dynamics to reveal the microscopic properties of ionic liquids. The organic semiconductors include pentacene, rubrene, fullerene, and 7,7,8,8-tetracyanoquinodimethane (TCNQ). While ionic liquids close to the substrate always form the specific layered structures, the surface properties of organic semiconductors drastically alter the ionic dynamics. Ionic liquids at the fullerene interface behave as a two-dimensional ionic crystal because of the energy gain derived from the favorable electrostatic interaction on the corrugated periodic substrate.
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
DEFF Research Database (Denmark)
Timmermann, D B; Lund, Trine Meldgaard; Belhage, B
2001-01-01
The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...
Energy Technology Data Exchange (ETDEWEB)
Chao, Jin Yu [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China); Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Zhu, Li Qiang, E-mail: lqzhu@nimte.ac.cn; Xiao, Hui [Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Yuan, Zhi Guo, E-mail: ncityzg@163.com [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China)
2015-12-21
Modulation of charge carrier density in condensed materials based on ionic/electronic interaction has attracted much attention. Here, protonic/electronic hybrid indium-zinc-oxide (IZO) transistors gated by chitosan based electrolyte were obtained. The chitosan-based electrolyte illustrates a high proton conductivity and an extremely strong proton gating behavior. The transistor illustrates good electrical performances at a low operating voltage of ∼1.0 V such as on/off ratio of ∼3 × 10{sup 7}, subthreshold swing of ∼65 mV/dec, threshold voltage of ∼0.3 V, and mobility of ∼7 cm{sup 2}/V s. Good positive gate bias stress stabilities are obtained. Furthermore, a low voltage driven resistor-loaded inverter was built by using an IZO transistor in series with a load resistor, exhibiting a linear relationship between the voltage gain and the supplied voltage. The inverter is also used for decreasing noises of input signals. The protonic/electronic hybrid IZO transistors have potential applications in biochemical sensors and portable electronics.
Ionic conductivity ageing investigation of 1Ce10ScSZ in different partial pressures of oxygen
DEFF Research Database (Denmark)
Omar, Shobit; Belda, Adriana; Escardino, Agustín
2011-01-01
The conductivity and its ageing behaviour has been determined for zirconia co-doped with 10 mol% of Sc2O3 and 1 mol% CeO2 in different partial pressures of oxygen at 600 °C. After 3000 h, samples kept in air, in a humidified mixture of H2/N2 and in humidified H2 exhibited loss in the ionic...
International Nuclear Information System (INIS)
Prasad, P.S.S.; Radhakrishna, S.
1988-01-01
The molybdo-tungstate (MoO 3 -WO 3 ) combination of glass formers with silver oxide (Ag 2 O) as glass modifier and silver iodide (AgI) as ionic conductor were prepared to study the transport and dielectric properties of 60% AgI-40% (x Ag 2 O-y(WO 3 -MoO 3 )) for x/y=0.33 to 3.0 and establish the feasibility of using these glasses as electrolytes in the fabrication and characterisation of solid state batteries and potential memory devices. The details of the preparation of glasses and methods of measurement of their capacitance, dielectric loss factor and ac conductivity in the frequency range 100 Hz - 100 kHz from 30-120 C have been reported. The electronic contribution to the total conductivity, the ionic and electronic transport numbers were determined using Wagners dc polarisation technique. The observed high ionic and low electronic conductivities were attributed to the formation of ionic clusters in the glass and the effect of mixing two glass formers. The observed total ionic conductivity and its temperature dependence was explained using Arrhenius relation σ=σ 0 /T exp(-E/RT) and the measured dielectric constant and dielectric loss were explained on the basis of Jonschers theory. The frequency dependence of dielectric constant obeys the theory based on the polarisation of ions. 25 refs.; 8 figs
Li, Mengya; Westover, Andrew S; Carter, Rachel; Oakes, Landon; Muralidharan, Nitin; Boire, Timothy C; Sung, Hak-Joon; Pint, Cary L
2016-08-03
A key parameter in the operation of an electrochemical double-layer capacitor is the voltage window, which dictates the device energy density and power density. Here we demonstrate experimental evidence that π-π stacking at a carbon-ionic liquid interface can modify the operation voltage of a supercapacitor device by up to 30%, and this can be recovered by steric hindrance at the electrode-electrolyte interface introduced by poly(ethylene oxide) polymer electrolyte additives. This observation is supported by Raman spectroscopy, electrochemical impedance spectroscopy, and differential scanning calorimetry that each independently elucidates the signature of π-π stacking between imidazole groups in the ionic liquid and the carbon surface and the role this plays to lower the energy barrier for charge transfer at the electrode-electrolyte interface. This effect is further observed universally across two separate ionic liquid electrolyte systems and is validated by control experiments showing an invariant electrochemical window in the absence of a carbon-ionic liquid electrode-electrolyte interface. As interfacial or noncovalent interactions are usually neglected in the mechanistic picture of double-layer capacitors, this work highlights the importance of understanding chemical properties at supercapacitor interfaces to engineer voltage and energy capability.
Directory of Open Access Journals (Sweden)
Mesbahus Saleheen
2016-05-01
Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.
Al-Qawasmeh, Ahmad; Holzwarth, N. A. W.
Oak Ridge National Laboratory (G. Sahu et al.) reported that the substitution of Ge into Li3AsS4 leads to the composition Li3.334Ge0.334As0.666S4 with impressively high ionic conductivity . We use ab initio calculations to examine the structural relationships and the ionic conductivity mechanisms for pure Li3AsS4, Li3.334Ge0.334As0.666S4, and other compositions of these electrolytes. Supported by NSF Grant DMR-1105485 and 1507942 and WFU's DEAC cluster.
Conductive Hybrid Crystal Composed from Polyoxomolybdate and Deprotonatable Ionic-Liquid Surfactant
Directory of Open Access Journals (Sweden)
Jun Kobayashi
2016-06-01
Full Text Available A polyoxomolybdate inorganic-organic hybrid crystal was synthesized with deprotonatable ionic-liquid surfactant. 1-dodecylimidazolium cation was employed for its synthesis. The hybrid crystal contained δ-type octamolybdate (Mo8 isomer, and possessed alternate stacking of Mo8 monolayers and interdigitated surfactant bilayers. The crystal structure was compared with polyoxomolybdate hybrid crystals comprising 1-dodecyl-3-methylimidazolium surfactant, which preferred β-type Mo8 isomer. The less bulky hydrophilic moiety of the 1-dodecylimidazolium interacted with the δ-Mo8 anion by N–H···O hydrogen bonds, which presumably induced the formation of the δ-Mo8 anion. Anhydrous conductivity of the hybrid crystal was estimated to be 5.5 × 10−6 S·cm−1 at 443 K by alternating current (AC impedance spectroscopy.
Formation of p-n-p junction with ionic liquid gate in graphene
International Nuclear Information System (INIS)
He, Xin; Tang, Ning; Duan, Junxi; Zhang, Yuewei; Lu, Fangchao; Xu, Fujun; Yang, Xuelin; Gao, Li; Wang, Xinqiang; Shen, Bo; Ge, Weikun
2014-01-01
Ionic liquid gating is a technique which is much more efficient than solid gating to tune carrier density. To observe the electronic properties of such a highly doped graphene device, a top gate made of ionic liquid has been used. By sweeping both the top and back gate voltage, a p-n-p junction has been created. The mechanism of forming the p-n-p junction has been discussed. Tuning the carrier density by ionic liquid gate can be an efficient method to be used in flexible electronics
Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A
2017-05-01
Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.
Proton conducting sodium alginate electrolyte laterally coupled low-voltage oxide-based transistors
Energy Technology Data Exchange (ETDEWEB)
Liu, Yang Hui; Wan, Qing, E-mail: wanqing@nju.edu.cn [Ningbo Institute of Materials Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); School of Electronic Science and Engineering, Nanjing University, Nanjing 210093 (China); Qiang Zhu, Li, E-mail: lqzhu@nimte.ac.cn [Ningbo Institute of Materials Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Shi, Yi [School of Electronic Science and Engineering, Nanjing University, Nanjing 210093 (China)
2014-03-31
Solution-processed sodium alginate electrolyte film shows a high proton conductivity of ∼5.5 × 10{sup −3} S/cm and a high lateral electric-double-layer (EDL) capacitance of ∼2.0 μF/cm{sup 2} at room temperature with a relative humidity of 57%. Low-voltage in-plane-gate indium-zinc-oxide-based EDL transistors laterally gated by sodium alginate electrolytes are fabricated on glass substrates. The field-effect mobility, current ON/OFF ratio, and subthreshold swing of such EDL transistors are estimated to be 4.2 cm{sup 2} V{sup −1} s{sup −1}, 2.8 × 10{sup 6}, and 130 mV/decade, respectively. At last, a low-voltage driven resistor-load inverter is also demonstrated. Such in-plane-gate EDL transistors have potential applications in portable electronics and low-cost biosensors.
Directory of Open Access Journals (Sweden)
Guo-Dung John Su
2012-08-01
Full Text Available Conventional camera modules with image sensors manipulate the focus or zoom by moving lenses. Although motors, such as voice-coil motors, can move the lens sets precisely, large volume, high power consumption, and long moving time are critical issues for motor-type camera modules. A deformable mirror (DM provides a good opportunity to improve these issues. The DM is a reflective type optical component which can alter the optical power to focus the lights on the two dimensional optical image sensors. It can make the camera system operate rapidly. Ionic polymer metal composite (IPMC is a promising electro-actuated polymer material that can be used in micromachining devices because of its large deformation with low actuation voltage. We developed a convenient simulation model based on Young’s modulus and Poisson’s ratio. We divided an ion exchange polymer, also known as Nafion®, into two virtual layers in the simulation model: one was expansive and the other was contractive, caused by opposite constant surface forces on each surface of the elements. Therefore, the deformation for different IPMC shapes can be described more easily. A standard experiment of voltage vs. tip displacement was used to verify the proposed modeling. Finally, a gear shaped IPMC actuator was designed and tested. Optical power of the IPMC deformable mirror is experimentally demonstrated to be 17 diopters with two volts. The needed voltage was about two orders lower than conventional silicon deformable mirrors and about one order lower than the liquid lens.
Changes in Ionic Conductance Signature of Nociceptive Neurons Underlying Fabry Disease Phenotype
Namer, Barbara; Ørstavik, Kirstin; Schmidt, Roland; Mair, Norbert; Kleggetveit, Inge Petter; Zeidler, Maximillian; Martha, Theresa; Jorum, Ellen; Schmelz, Martin; Kalpachidou, Theodora; Kress, Michaela; Langeslag, Michiel
2017-01-01
The first symptom arising in many Fabry patients is neuropathic pain due to changes in small myelinated and unmyelinated fibers in the periphery, which is subsequently followed by a loss of sensory perception. Here we studied changes in the peripheral nervous system of Fabry patients and a Fabry mouse model induced by deletion of α-galactosidase A (Gla−/0). The skin innervation of Gla−/0 mice resembles that of the human Fabry patients. In Fabry diseased humans and Gla−/0 mice, we observed similar sensory abnormalities, which were also observed in nerve fiber recordings in both patients and mice. Electrophysiological recordings of cultured Gla−/0 nociceptors revealed that the conductance of voltage-gated Na+ and Ca2+ currents was decreased in Gla−/0 nociceptors, whereas the activation of voltage-gated K+ currents was at more depolarized potentials. Conclusively, we have observed that reduced sensory perception due to small-fiber degeneration coincides with altered electrophysiological properties of sensory neurons. PMID:28769867
Changes in Ionic Conductance Signature of Nociceptive Neurons Underlying Fabry Disease Phenotype
Directory of Open Access Journals (Sweden)
Barbara Namer
2017-07-01
Full Text Available The first symptom arising in many Fabry patients is neuropathic pain due to changes in small myelinated and unmyelinated fibers in the periphery, which is subsequently followed by a loss of sensory perception. Here we studied changes in the peripheral nervous system of Fabry patients and a Fabry mouse model induced by deletion of α-galactosidase A (Gla−/0. The skin innervation of Gla−/0 mice resembles that of the human Fabry patients. In Fabry diseased humans and Gla−/0 mice, we observed similar sensory abnormalities, which were also observed in nerve fiber recordings in both patients and mice. Electrophysiological recordings of cultured Gla−/0 nociceptors revealed that the conductance of voltage-gated Na+ and Ca2+ currents was decreased in Gla−/0 nociceptors, whereas the activation of voltage-gated K+ currents was at more depolarized potentials. Conclusively, we have observed that reduced sensory perception due to small-fiber degeneration coincides with altered electrophysiological properties of sensory neurons.
Improved Performance of Ionic Liquid Supercapacitors by using Tetracyanoborate Anions.
Martins, Vitor L; Rennie, Anthony J R; Sanchez-Ramirez, Nedher; Torresi, Roberto M; Hall, Peter J
2018-02-01
Supercapacitors are energy storage devices designed to operate at higher power densities than conventional batteries, but their energy density is still too low for many applications. Efforts are made to design new electrolytes with wider electrochemical windows than aqueous or conventional organic electrolytes in order to increase energy density. Ionic liquids (ILs) with wide electrochemical stability windows are excellent candidates to be employed as supercapacitor electrolytes. ILs containing tetracyanoborate anions [B(CN) 4 ] offer wider electrochemical stability than conventional electrolytes and maintain a high ionic conductivity (6.9 mS cm -1 ). Herein, we report the use of ILs containing the [B(CN) 4 ] anion for such an application. They presented a high maximum operating voltage of 3.7 V, and two-electrode devices demonstrate high specific capacitances even when operating at relatively high rates (ca. 20 F g -1 @ 15 A g -1 ). This supercapacitor stored more energy and operated at a higher power at all rates studied when compared with cells using a commonly studied ILs.
Hekmat, F.; Sohrabi, B.; Rahmanifar, M. S.; Jalali, A.
2015-06-01
Multi-wall carbon nanotubes (MW-CNTs) have been arranged in nanochannels of anodic aluminum oxide template (AAO) by electrophoretic deposition (EPD) to make a vertically-aligned carbon nanotube (VA-CNT) based electrode. Well ordered AAO templates were prepared by a two-step anodizing process by applying a constant voltage of 45 V in oxalic acid solution. The stabilized CNTs in a water-soluble room temperature ionic liquid (1-methyl-3-octadecylimidazolium bromide), were deposited in the pores of AAO templates which were conductive by deposition of Ni nanoparticles in the bottom of pores. In order to obtain ideal results, different EPD parameters, such as concentration of MWCNTs and ionic liquid on stability of MWCNT suspensions, deposition time and voltage which are applied in EPD process and also optimal conditions for anodizing of template were investigated. The capacitive performance of prepared electrodes was analyzed by measuring the specific capacitance from cyclic voltammograms and the charge-discharge curves. A maximum value of 50 Fg-1 at the scan rate of 20 mV s-1was achieved for the specific capacitance.
DC ionic conductivity of NaNO3: γ-Al2O3 composite solid electrolyte system
International Nuclear Information System (INIS)
Madhava Rao, M.V.; Narender Reddy, S.; Sadananda Chary, A.
2005-01-01
We present DC ionic conductivity measurements on composites formed between Na + ion conductor (NaNO 3 ) and dispersed insulating oxide (alumina). Enhancement of conductivity is noticed to increase with mole percent (m/o) of the dispersoid. The maximum enhancement observed is more than two orders of magnitude with respect to the host material. X-ray diffraction and differential scanning calorimetry studies ruled out the formation of solid solutions between the host material and the dispersoid. The experimental data indicating higher conductivity in dispersed system is interpreted in terms of the formation of space charge layer between the host material and the dispersoid in which defect concentration increases and that is thought to be the possible mechanism of conductivity enhancement. Activation energies obtained from the conductivity data in the extrinsic conduction region indicated least value for the systems at threshold mole percentage
Directory of Open Access Journals (Sweden)
Wei Xia
2015-01-01
Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.
Directory of Open Access Journals (Sweden)
Amjad Ali
2015-01-01
Full Text Available A new simple moving voltage average (SMVA technique with fixed step direct control incremental conductance method is introduced to reduce solar photovoltaic voltage (VPV oscillation under nonuniform solar irradiation conditions. To evaluate and validate the performance of the proposed SMVA method in comparison with the conventional fixed step direct control incremental conductance method under extreme conditions, different scenarios were simulated. Simulation results show that in most cases SMVA gives better results with more stability as compared to traditional fixed step direct control INC with faster tracking system along with reduction in sustained oscillations and possesses fast steady state response and robustness. The steady state oscillations are almost eliminated because of extremely small dP/dV around maximum power (MP, which verify that the proposed method is suitable for standalone PV system under extreme weather conditions not only in terms of bus voltage stability but also in overall system efficiency.
Macroeconomic Assessment of Voltage Sags
Directory of Open Access Journals (Sweden)
Sinan Küfeoğlu
2016-12-01
Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.
Conductivity and applications of Li-biphenyl-1,2-dimethoxyethane solution for lithium ion batteries
Institute of Scientific and Technical Information of China (English)
Geng Chu; Bo-Nan Liu; Fei Luo; Wen-Jun Li; Hao Lu; Li-Quan Chen; Hong Li
2017-01-01
The total conductivity of Li-biphenyl-l,2-dimethoxyethane solution (LixBp(DME)9.65,Bp =biphenyl,DME =1,2-dimethoxyethane,x =0.25,0.50,1.00,1.50,2.00) is measured by impedance spectroscopy at a temperature range from 0 ℃C to 40 ℃C.The Li1.50Bp(DME)9.65 has the highest total conductivity 10.7 mS/cm.The conductivity obeys Arrhenius law with the activation energy (Ea(x=0.50) =0.014 eV,Ea(x=1.00) =0.046 eV).The ionic conductivity and electronic conductivity of LixBp(DME)9.65 solutions are investigated at 20 ℃C using the isothermal transient ionic current (ITIC) technique with an ion-blocking stainless steal electrode.The ionic conductivity and electronic conductivity of Li1.00Bp(DME)9.65 are measured as 4.5 mS/cm and 6.6 mS/cm,respectively.The Li1.00Bp(DME)9.65 solution is tested as an anode material of half liquid lithium ion battery due to the coexistence of electronic conductivity and ionic conductivity.The lithium iron phosphate (LFP) and Li1.5Al0.5Ti1.5(PO4)3 (LATP) are chosen to be the counter electrode and electrolyte,respectively.The assembled cell is cycled in the voltage range of 2.2 V-3.75 V at a current density of 50 mA/g.The potential of Lit.00Bp(DME)9.65 solution is about 0.3 V vs.Li+/Li,which indicates the solution has a strong reducibility.The Li1.00Bp(DME)9.65 solution is also used to prelithiate the anode material with low first efficiency,such as hard carbon,soft carbon and silicon.
Solid state ionics: a Japan perspective
Yamamoto, Osamu
2017-12-01
The 70-year history of scientific endeavor of solid state ionics research in Japan is reviewed to show the contribution of Japanese scientists to the basic science of solid state ionics and its applications. The term 'solid state ionics' was defined by Takehiko Takahashi of Nagoya University, Japan: it refers to ions in solids, especially solids that exhibit high ionic conductivity at a fairly low temperature below their melting points. During the last few decades of exploration, many ion conducting solids have been discovered in Japan such as the copper-ion conductor Rb4Cu16I7Cl13, proton conductor SrCe1-xYxO3, oxide-ion conductor La0.9Sr0.9Ga0.9Mg0.1O3, and lithium-ion conductor Li10GeP2S12. Rb4Cu16I7Cl13 has a conductivity of 0.33 S cm-1 at 25 °C, which is the highest of all room temperature ion conductive solid electrolytes reported to date, and Li10GeP2S12 has a conductivity of 0.012 S cm-1 at 25 °C, which is the highest among lithium-ion conductors reported to date. Research on high-temperature proton conducting ceramics began in Japan. The history, the discovery of novel ionic conductors and the story behind them are summarized along with basic science and technology.
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Jabes, B. Shadrack; Bratko, Dusan; Luzar, Alenka
2018-06-01
Solubilization of nanoparticles facilitates nanomaterial processing and enables new applications. An effective method to improve dispersibility in water is provided by ionic functionalization. We explore how the necessary extent of functionalization depends on the particle geometry. Using molecular dynamics/umbrella sampling simulations, we determine the effect of the solute curvature on solvent-averaged interactions among ionizing graphitic nanoparticles in aqueous dispersion. We tune the hydrophilicity of molecular-brush coated fullerenes, carbon nanotubes, and graphane platelets by gradually replacing a fraction of the methyl end groups of the alkyl coating by the ionizing -COOK or -NH3Cl groups. To assess the change in nanoparticles' dispersibility in water, we determine the potential-of-mean-force profiles at varied degrees of ionization. When the coating comprises only propyl groups, the attraction between the hydrophobic particles intensifies from spherical to cylindrical to planar geometry. This is explained by the increasing fraction of surface groups that can be brought into contact and the reduced access to water molecules, both following the above sequence. When ionic groups are added, however, the dispersibility increases in the opposite order, with the biggest effect in the planar geometry and the smallest in the spherical geometry. These results highlight the important role of geometry in nanoparticle solubilization by ionic functionalities, with about twice higher threshold surface charge necessary to stabilize a dispersion of spherical than planar particles. At 25%-50% ionization, the potential of mean force reaches a plateau because of the counterion condensation and saturated brush hydration. Moreover, the increase in the fraction of ionic groups can weaken the repulsion through counterion correlations between adjacent nanoparticles. High degrees of ionization and concomitant ionic screening gradually reduce the differences among surface
Han, Jae Hee; Lee, Jang Yong; Suh, Dong Hack; Hong, Young Taik; Kim, Tae-Ho
2017-10-04
We present cross-linkable precursor-type gel polymer electrolytes (GPEs) that have large ionic liquid uptake capability, can easily penetrate electrodes, have high ion conductivity, and are mechanically strong as high-performance, flexible all-solid-state supercapacitors (SC). Our polymer precursors feature a hydrophilic-hydrophobic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) triblock main-chain structure and trifunctional silane end groups that can be multi-cross-linked with each other through a sol-gel process. The cross-linked solid-state electrolyte film with moderate IL content (200 wt %) shows a well-balanced combination of excellent ionic conductivity (5.0 × 10 -3 S cm -1 ) and good mechanical stability (maximum strain = 194%). Moreover, our polymer electrolytes have various advantages including high thermal stability (decomposition temperature > 330 °C) and the capability to impregnate electrodes to form an excellent electrode-electrolyte interface due to the very low viscosity of the precursors. By assembling our GPE-impregnated electrodes and solid-state GPE film, we demonstrate an all-solid-state SC that can operate at 3 V and provides an improved specific capacitance (112.3 F g -1 at 0.1 A g -1 ), better rate capability (64% capacity retention until 20 A g -1 ), and excellent cycle stability (95% capacitance decay over 10 000 charge/discharge cycles) compared with those of a reference SC using a conventional PEO electrolyte. Finally, flexible SCs with a high energy density (22.6 W h kg -1 at 1 A g -1 ) and an excellent flexibility (>93% capacitance retention after 5000 bending cycles) can successfully be obtained.
Three-dimensional ionic conduction in the strained electrolytes of solid oxide fuel cells
International Nuclear Information System (INIS)
Han, Yupei; Zou, Minda; Lv, Weiqiang; He, Weidong; Mao, Yiwu; Wang, Wei
2016-01-01
Flexible power sources including fuel cells and batteries are the key to realizing flexible electronic devices with pronounced foldability. To understand the bending effects in these devices, theoretical analysis on three-dimensional (3-D) lattice bending is necessary. In this report, we derive a 3-D analytical model to analyze the effects of electrolyte crystal bending on ionic conductivity in flexible solid-state batteries/fuel cells. By employing solid oxide fuel cells as a materials' platform, the intrinsic parameters of bent electrolyte materials, including lattice constant, Young's modulus, and Poisson ratio, are evaluated. Our work facilitates the rational design of highly efficient flexible electrolytes for high-performance flexible device applications.
Ionic transport in P(VdF–HFP)–PEO based novel microporous ...
Indian Academy of Sciences (India)
Administrator
hexafluoropropylene) [P(VdF–HFP)] and polyethylene oxide (PEO) was prepared by phase inversion tech- nique. ... new consumer electronic technologies such as cell phones, notebook PC and ... methanol, pentane, ethanol, hexane or their binary mix- ture and .... Figure 6. Temperature dependence of ionic conductivity of.
Directory of Open Access Journals (Sweden)
Li Zhai
2018-04-01
Full Text Available The high dv/dt and di/dt outputs from power devices in a high-low voltage DC-DC converter on electric vehicles (EVs can always introduce the unwanted conducted electromagnetic interference (EMI emissions. A conducted EMI prediction and mitigation strategy that is based on transfer function for the high-low voltage DC-DC converter in EVs are proposed. A complete test for the DC-DC converter is conducted to obtain the conducted EMI from DC power cables in the frequency band of 150 kHz-108 MHz. The equivalent circuit with high-frequency parasitic parameters of the DC-DC converter is built`1 based on the measurement results to acquire the characteristics of the conducted EMI of the DC power cables. The common mode (CM and differential mode (DM propagation coupling paths are determined, and the corresponding transfer functions of the DM interference and CM interference are established. The simulation results of the conducted EMI can be obtained by software Matlab and Computer Simulation Technology (CST. By analyzing the transfer functions and the simulation results, the dominated interference is the CM interference, which is the main factor of the conducted EMI. A mitigation strategy for the design of the CM interference filter based on the dominated CM interference is proposed. Finally, the mitigation strategy of the conducted EMI is verified by performing the conducted voltage experiment. From the experiment results, the conducted voltage of the DC power cables is decreased, respectively, by 58 dBμV, 55 dBμV, 65 dBμV, 53 dBμV, and 54 dBμV at frequency 200 kHz, 400 kHz, 600 kHz, 1.4 MHz, and 50 MHz. The conduced voltage in the frequency band of 150 kHz–108 MHz can be mitigated by adding the CM interference filters, and the values are lower than the limit level-3 of CISPR25 standard (GB/T 18655-2010.
Electric Conductivity and Dielectric-Breakdown Behavior for Polyurethane Magnetic Elastomers.
Sasaki, Shuhei; Tsujiei, Yuri; Kawai, Mika; Mitsumata, Tetsu
2017-02-23
The electric-voltage dependence of the electric conductivity for cross-linked and un-cross-linked magnetic elastomers was measured at various magnetic fields, and the effect of cross-linking on the electric conductivity and the dielectric-breakdown behavior was investigated. The electric conductivity for un-cross-linked elastomers at low voltages was independent of magnetic fields and the volume fraction of magnetic particles, indicating the electric conduction in the polyurethane matrix. At high voltages, the electric conductivity increased with the magnetic field, showing the electric conduction via chains of magnetic particles. On the other hand, the electric conductivity at low voltages for cross-linked elastomers with volume fractions below 0.06 was independent of the magnetic field, suggesting the electric conduction in the polyurethane matrix. At volume fractions above 0.14, the electric conductivity increased with the magnetic field, suggesting the electric conduction via chains of magnetic particles. At high voltages, the electric conductivity for cross-linked elastomers with a volume fraction of 0.02 was independent of the magnetic field, indicating the electric conduction through the polyurethane matrix. At volume fractions above 0.06, the electric conductivity suddenly increased at a critical voltage, exhibiting the dielectric breakdown at the bound layer of magnetic particles and/or the discontinuous part between chains.
Nilsson, Martin; Frenning, Göran; Gråsjö, Johan; Alderborn, Göran; Strømme, Maria
2006-10-19
The present study aims at contributing to a complete understanding of the water-induced ionic charge transport in cellulose. The behavior of this transport in loosely compacted microcrystalline cellulose (MCC) powder was investigated as a function of density utilizing a new type of measurement setup, allowing for dielectric spectroscopy measurement in situ during compaction. The ionic conductivity in MCC was found to increase with increasing density until a leveling-out was observed for densities above approximately 0.7 g/cm3. Further, it was shown that the ionic conductivity vs density followed a percolation type behavior signifying the percolation of conductive paths in a 3D conducting network. The density percolation threshold was found to be between approximately 0.2 and 0.4 g/cm3, depending strongly on the cellulose moisture content. The observed percolation behavior was attributed to the forming of interparticulate bonds in the MCC and the percolation threshold dependence on moisture was linked to the moisture dependence of particle rearrangement and plastic deformation in MCC during compaction. The obtained results add to the understanding of the density-dependent water-induced ionic transport in cellulose showing that, at given moisture content, the two major parameters determining the magnitude of the conductivity are the connectedness of the interparticluate bonds and the connectedness of pores with a diameter in the 5-20 nm size range. At densities between approximately 0.7 and 1.2 g/cm3 both the bond and the pore networks have percolated, facilitating charge transport through the MCC compact.
Ionic drift velocity measurement on hot-pressed Ag ion conducting ...
Indian Academy of Sciences (India)
Shri Shankaracharya Institute of Professional Management & Technology, Raipur 492 015, India. MS received 29 October 2014; accepted 14 August 2015. Abstract. Ionic drift ..... Chandra S 1981 Superionic solids—principle and applications.
Ionic liquid-nanoparticle hybrid electrolytes
Lu, Yingying
2012-01-01
We investigate physical and electrochemical properties of a family of organic-inorganic hybrid electrolytes based on the ionic liquid 1-methyl-3-propylimidazolium bis(trifluoromethanesulfone) imide covalently tethered to silica nanoparticles (SiO 2-IL-TFSI). The ionic conductivity exhibits a pronounced maximum versus LiTFSI composition, and in mixtures containing 13.4 wt% LiTFSI, the room-temperature ionic conductivity is enhanced by over 3 orders of magnitude relative to either of the mixture components, without compromising lithium transference number. The SiO 2-IL-TFSI/LiTFSI hybrid electrolytes are thermally stable up to 400°C and exhibit tunable mechanical properties and attractive (4.25V) electrochemical stability in the presence of metallic lithium. We explain these observations in terms of ionic coupling between counterion species in the mobile and immobile (particle-tethered) phases of the electrolytes. © 2012 The Royal Society of Chemistry.
Increase of ionic conductivity in the microporous lithosilicate RUB-29 by Na-ion exchange processes
International Nuclear Information System (INIS)
Park, S.-H.; Senyshyn, A.; Paulmann, C.
2007-01-01
The ionic conductivity in the zeolite-like lithosilicate RUB-29 (Cs 14 Li 24 [Li 18 Si 72 O 172 ].14H 2 O [S.-H. Park, J.B. Parise, H. Gies, H. Liu, C.P. Grey, B.H. Toby, J. Am. Chem. Soc. 122 (2000) 11023-11024]) increases via simple ion-exchange processes, in particular when Na cations replace a part of Cs + and Li + of the material. The resulting ionic conductivity value of 3.2x10 -3 S cm -1 at 885 K is about two orders higher than that for the original material [S.-H. Park, J.B. Parise, M.E. Franke, T. Seydel, C. Paulmann, Micropor. Mesopor. Mater., in print ( (doi:10.1016/j.micromeso.2007.03.040) available online since April 19, 2007)]. The structural basis of a Na + -exchanged RUB-29 sample (Na-RUB-29) at 673 K could be elucidated by means of neutron powder diffraction. Rietveld refinements confirmed the replacement of Na + for both parts of Cs and Li cations, agreeing with idealized cell content, Na 8 Cs 8 Li 40 Si 72 O 172 . As a result of the incorporation of Na + in large pores, the number of Li + vacancies in dense Li 2 O-layers of the structure could increase. This can be one of the main reasons for the improved conductivity in Na-RUB-29. In addition, mobile Na cations may also contribute to the conductivity in Na-RUB-29 as continuous scattering length densities were found around the sites for Na in difference Fourier map. - Graphical abstract: Li 2 O-layers formed by edge- and corner-sharing LiO 4 - and LiO 3 -moieties in the zeolite-like lithosilicate RUB-29 provide optimal pathways for conducting Li + . The number of empty Li sites in this layer-like configuration could increase via 'simple' Na + -exchange processes, promoting fast Li motions
Thermoelectric Generators Based on Ionic Liquids
Laux, Edith; Uhl, Stefanie; Jeandupeux, Laure; López, Pilar Pérez; Sanglard, Pauline; Vanoli, Ennio; Marti, Roger; Keppner, Herbert
2018-06-01
Looking at energy harvesting using body or waste heat for portable electronic or on-board devices, Ionic liquids are interesting candidates as thermoactive materials in thermoelectric generators (TEGs) because of their outstanding properties. Two different kinds of ionic liquid, with alkylammonium and choline as cations, were studied, whereby different anions and redox couples were combined. This study focussed on the intention to find non-hazardous and environmentally friendly ionic liquids for TEGs to be selected among the thousands that can potentially be used. Seebeck coefficients (SEs) as high as - 15 mV/K were measured, in a particular case for an electrode temperature difference of 20 K. The bottleneck of our TEG device is still the abundance of negative SE liquids matching the internal resistance with the existing positive SE-liquids at series connections. In this paper, we show further progress in finding increased negative SE liquids. For current extraction from the TEG, the ionic liquid must be blended with a redox couple, allowing carrier exchange in a cyclic process under a voltage which is incuced by the asymmetry of the generator in terms of hot and cold electrodes. In our study, two types of redox pairs were tested. It was observed that a high SE of an ionic liquid/redox blend is not a sufficient condition for high power output. It appears that more complex effects between the ionic liquid and the electrode determine the magnitude of the final current/power output. The physico-chemical understanding of such a TEG cell is not yet available.
Energy Technology Data Exchange (ETDEWEB)
Yoshioka, Hideki [Hyogo Prefectural Institute of Technology, 3-1-12 Yukihira-cho, Suma-ku, Kobe 654-0037 (Japan); Nojiri, Yoshihiro [Kyushu University, Department of Mechanical Engineering Science, Faculty of Engineering, Motooka 744, Nishi-ku, Fukuoka 819-0935 (Japan); Tanase, Shigeo [National Institute of Advanced Industrial Science and Technology, 1-8-31 Midorigaoka, Ikeda, Osaka 563-8577 (Japan)
2008-11-30
Enhancement of the ionic conductivity of lanthanum silicate-based apatites is examined with emphasis on optimizing the La composition and the Mg doping level at the same time. La{sub 10}Si{sub 5.8}Mg{sub 0.2}O{sub 26.8} and La{sub 9.8}Si{sub 5.7}Mg{sub 0.3}O{sub 26.4} show the highest level of the ionic conductivities among apatite silicates, 8.8 and 7.4 x 10{sup -} {sup 2} S cm{sup -} {sup 1} at 800 C, respectively, with a very low level of activation energy (0.42-0.43 eV). Their conductivities are higher than yttria stabilized zirconia (YSZ) below 900 C and even comparable to Sr and Mg doped lanthanum gallate (LSGM) below 550 C. A solid oxide fuel cell using La{sub 9.8}Si{sub 5.7}Mg{sub 0.3}O{sub 26.4} as an electrolyte with Ni-ceria cermet anode and Sr doped lanthanum cobaltite cathode exhibits a remarkable improvement in power generation compared to previous data using Pt electrodes. Structural investigation by the Rietveld analysis on the powder X-ray diffraction pattern shows significant enlargement of the bottleneck triangle sizes of the conduction channel with the Mg doping. (author)
Proton-conducting cerate ceramics
Energy Technology Data Exchange (ETDEWEB)
Pederson, L.R.; Coffey, G.W.; Bates, J.L.; Weber, W.J. [Pacific Northwest National Lab., Richland, WA (United States)
1996-08-01
Single-cell solid oxide fuel cells were constructed using strontium cerate as the electrolyte and their performance tested. Like certain zirconates, hafnates, and tantalates, the cerate perovskites are among a class of solid electrolytes that conduct protons at elevated temperatures. Depending on the temperature and chemical environment, these ceramics also support electronic and oxygen ion currents. A maximum power output of {approx}100 mW per cm{sup 2} electrolyte surface area was obtained at 900{degrees}C using 4% hydrogen as the fuel and air as the oxidant. A series of rare earth/ceria/zirconia were prepared and their electrical properties characterized. Rare earth dopants included ytterbia, yttria, terbia, and europia. Ionic conductivities were highest for rare earth/ceria and rare earth zirconia compositions; a minimum in ionic conductivity for all series were found for equimolar mixtures of ceria and zirconia. Cerium oxysulfide is of interest in fossil energy applications because of its high chemical stability and refractory nature. An alternative synthesis route to preparing cerium oxysulfide powders has been developed using combustion techniques.
Preparation and transport properties of novel lithium ionic liquids
International Nuclear Information System (INIS)
Shobukawa, Hitoshi; Tokuda, Hiroyuki; Tabata, Sei-Ichiro; Watanabe, Masayoshi
2004-01-01
Novel lithium salts of borates having two electron-withdrawing groups (either 1,1,1,3,3,3-hexafluoro-2-propoxy or pentafluorophenoxy group) and two methoxy-oligo(ethylene oxide) groups (number of repeating unit: n = 3, 4, 7.2) were prepared by successive substitution-reactions from LiBH 4 . The obtained lithium salts were clear and colorless liquids at room temperature. The density, thermal property, viscosity, and ionic conductivity were measured for the lithium ionic liquids. The pulsed-gradient spin-echo NMR (PGSE-NMR) method was used to independently determine self-diffusion coefficients of the lithium cation ( 7 Li NMR) and the anion ( 19 F NMR) in the bulk. The ionic conductivity of the new lithium salts was 10 -5 to 10 -4 S cm -1 at 30 deg. C, which was lower than that of typical ionic liquids by two orders of magnitude. However, the degree of self-dissociation of the lithium ionic liquids; the ratio of the molar conductivity determined by the complex impedance method to that calculated from the self-diffusion coefficients and the Nernst-Einstein equation, ranged from 0.1 to 0.4, which are comparable values to those of a highly dissociable salt in an aprotic polar solvent and of typical ionic liquids. The main reason for the meager conductivity was high viscosities of the lithium ionic liquids. It should be noted that the lithium ionic liquids have self-dissociation ability and conduct the ions in the absence of organic solvents
She, Zimin; Ghosh, Debasis; Pope, Michael A
2017-10-24
A major stumbling block in the development of high energy density graphene-based supercapacitors has been maintaining high ion-accessible surface area combined with high electrode density. Herein, we develop an ionic liquid (IL)-surfactant microemulsion system that is found to facilitate the spontaneous adsorption of IL-filled micelles onto graphene oxide (GO). This adsorption distributes the IL over all available surface area and provides an aqueous formulation that can be slurry cast onto current collectors, leaving behind a dense nanocomposite film of GO/IL/surfactant. By removing the surfactant and reducing the GO through a low-temperature (360 °C) heat treatment, the IL plays a dual role of spacer and electrolyte. We study the effect of IL content and operating temperature on the performance, demonstrating a record high gravimetric capacitance (302 F/g at 1 A/g) for 80 wt % IL composites. At 60 wt % IL, combined high capacitance and bulk density (0.76 g/cm 3 ), yields one of the highest volumetric capacitances (218 F/cm 3 , at 1 A/g) ever reported for a high-voltage IL-based supercapacitor. While achieving promising rate performance and cycle-life, the approach also eliminates the long and costly electrolyte imbibition step of cell assembly as the electrolyte is cast directly with the electrode material.
International Nuclear Information System (INIS)
Verevkin, Sergey P.; Zaitsau, Dzmitry H.; Emel’yanenko, Vladimir N.; Ralys, Ricardas V.; Yermalayeu, Andrei V.; Schick, Christoph
2012-01-01
Highlights: ► Enthalpies of vaporization of ionic liquids were measured with thermogravimetry. ► We studied 1-alkyl-3-methyl-imidazolium bis(trifluoromethanesulfonyl)imide. ► The linear alkyl chain length was 4, 6, 8, 10, 12, 14, 16, and 18 C-atoms. ► A linear dependence on the chain length of the alkyl-imidazolium cation was found. - Abstract: Vaporization enthalpies for a series of ten ionic liquids (ILs) 1-alkyl-3-methyl-imidazolium bis(trifluoromethanesulfonyl)imide [C n mim][NTf 2 ], with the alkyl chain length n = 4, 6, 8, 10, 12, 14, 16, and 18 were determined using the thermogravimetric method. An internally consistent set of experimental data and vaporization enthalpies at 540 K was obtained. Vaporization enthalpies at 540 K have shown a linear dependence on the chain length of the alkyl-imidazolium cation in agreement with the experimental results measured previously with a quartz crystal microbalance. Ambiguity of Δ l g C pm o -values required for the extrapolation of experimental vaporization enthalpies to the reference temperature 298 K has been discussed.
Effect of grain mobility on ionic conductivity of Ceria added YSZ electrolyte
International Nuclear Information System (INIS)
Gupta, Alka; Omar, Shobit; Balani, Kantesh
2012-01-01
In an effort to develop novel electrolyte materials, the present work explores the effect of grain boundary mobility on ionic conductivity of CeO 2 -YSZ electrolyte. For cubic zirconia in general, the higher the grain boundary mobility, the lower the activation energy for oxide ion migration and judicious doping can be an effective method for mobility control. The two main directions for fabricating 8 mol. % YSZs (8YSZ) with 0,5 and 10 wt % CeO 2 are being followed: (i) co doping by conventional sintering (CS, 1400 ℃, 4h holding, ∼98 % theoretical density), and (ii) nano composite approach by spark plasma sintering (SPS, 1200 ℃, 5 min holding, ∼96 % theoretical density). Phase analysis by XRD, indicates that CeO 2 forms the complete solid solution with YSZ when synthesized by CS and both solid solution and composite formation (seen as isolated ceria rich zones in YSZ matrix by EDS analysis via TEM) by SPS. The grain boundary mobility for CS samples of pure and 10%CeO 2 added YSZ are 6.69 x 10 -18 to 10.35 X 10 -18 m 3 /N/s respectively. While for SPS sintered samples of pure and 10% CeO 2 added YSZ the grain boundary mobility comes out to be ∼0.032 X 10 -18 to 0.039 X 10 18 m 3 /N/s respectively. Grain mobility does not show any marginal change with increasing ceria content, elicit that the defect concentration is nearly constant in 8YSZ and is insensitive to ceria content. Remarkable increase of grain mobility in the SPS samples is attributed to rapid grain coarsening in the nano-grains limited to shorter sintering times. As expected, grain mobility for longer-times average out the transient phase and lower the net grain mobility such as in CS samples. The enhanced mobility in CeO 2 -YSZ SPS sintered electrolytes must be due to lower cation migration energy (activation energy for oxide ion migration), promoting enhanced ionic conductivity. (author)
A thermoelectric voltage effect in polyethylene oxide
International Nuclear Information System (INIS)
Martin, Bjoern; Wagner, Achim; Kliem, Herbert
2003-01-01
The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential
Behavior of ionic conducting IPN actuators in simulated space conditions
Fannir, Adelyne; Plesse, Cédric; Nguyen, Giao T. M.; Laurent, Elisabeth; Cadiergues, Laurent; Vidal, Frédéric
2016-04-01
The presentation focuses on the performances of flexible all-polymer electroactive actuators under space-hazardous environmental factors in laboratory conditions. These bending actuators are based on high molecular weight nitrile butadiene rubber (NBR), poly(ethylene oxide) (PEO) derivative and poly(3,4-ethylenedioxithiophene) (PEDOT). The electroactive PEDOT is embedded within the PEO/NBR membrane which is subsequently swollen with an ionic liquid as electrolyte. Actuators have been submitted to thermal cycling test between -25 to 60°C under vacuum (2.4 10-8 mbar) and to ionizing Gamma radiations at a level of 210 rad/h during 100 h. Actuators have been characterized before and after space environmental condition ageing. In particular, the viscoelasticity properties and mechanical resistance of the materials have been determined by dynamic mechanical analysis and tensile tests. The evolution of the actuation properties as the strain and the output force have been characterized as well. The long-term vacuuming, the freezing temperature and the Gamma radiations do not affect significantly the thermomechanical properties of conducting IPNs actuators. Only a slight decrease on actuation performances has been observed.
Component analysis of a mixed beam generated by vacuum electrospray of an ionic liquid
International Nuclear Information System (INIS)
Fujiwara, Yukio; Saito, Naoaki; Nonaka, Hidehiko; Ichimura, Shingo
2012-01-01
Vacuum electrospray of a quaternary ammonium ionic liquid, N,N-diethyl-N-methyl-N-(2-methoxyethyl)ammonium bis(trifluoromethanesulfonyl) amide (DEME-TFSA), was investigated to develop a primary ion source for secondary ion mass spectrometry (SIMS). Since the ionic liquid contains many methyl and ethyl groups as well as protons, its beam is expected to efficiently produce protonated molecules for SIMS analysis of organic materials. Experimental results showed that the beam consisted of charged particles of m/z about 1000 and charged droplets of m/z > 10 5 . The current components of both the charged particles and droplets changed with the applied voltage and the flow rate of the ionic liquid. With decreasing flow rate, the current component of the charged droplets increased, whereas that of the charged particles decreased. The m/z values of the charged droplets diminished with decreasing flow rate and increasing capillary voltage. In addition to masses and charge numbers, the numbers of the charged droplets and the charged particles were estimated.
Fabrication of transparent conductive tri-composite film for electrochromic application
Choi, Dahyun; Lee, Minji; Kim, Hyungsub; Chu, Won-shik; Chun, Doo-man; Ahn, Sung-Hoon; Lee, Caroline Sunyong
2017-12-01
A transparent conductive electrode (TCE) based on poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) was developed using a dry deposition method for application as an electrochromic (EC) device. To improve its electrical conductivity and stable EC performance, AgNW and TiO2 nanoparticles were included in the TCE film. The resulting TiO2/AgNW/PEDOT:PSS hybrid film showed electrical sheet resistivity of 23 Ω/sq., similar to that of a commercial TCE film. When +2.0 V was applied to the hybrid film, the response current was stable, maintaining a value of 2.0 mA. We found that the hybrid film could be used as an EC device, without using commercial TCE film. Antimony-doped tin oxide on indium-doped tin oxide-glass as an ion-storage layer was combined with the hybrid film, with 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EMIM-TFSI) injected into the EC device as an ionic liquid electrolyte. The optical transmittance difference between the colored and bleached states was 23% at 630 nm; under applied voltages of -2.0 V and +2.0 V, the coloration efficiency was 127.83 cm2/C. Moreover, cyclic transmittance with switching voltage for 3 h showed stable optical transmittance of 31% at 630 nm. Cyclic voltammetry measurements indicated stable behavior over 50 cycles. Thus, the proposed TCE configuration (TiO2/AgNW/PEDOT:PSS) shows great potential as a substitute for commercial TCEs, the cost of which depends on the availability of rare-earth materials.
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Phonon-mediated Thermal Conductivity in Ionic Solids by Lattice Dynamics-based Methods
Energy Technology Data Exchange (ETDEWEB)
Chernatynskiy, Aleksandr [Univ. of Florida, Gainesville, FL (United States); Turney, Joseph E. [Carnegie Mellon Univ., Pittsburgh, PA (United States); McGaughey, Alan J. H. [Carnegie Mellon Univ., Pittsburgh, PA (United States); Amon, Christina H. [Univ. of Toronto, ON (Canada); Phillpot, Simon R. [Univ. of Florida, Gainesville, FL (United States)
2011-07-22
Phonon properties predicted from lattice dynamics calculations and the Boltzmann Transport Equation (BTE) are used to elucidate the thermal-transport properties of ionic materials. It is found that a rigorous treatment of the Coulombic interactions within the harmonic analysis is needed for the analysis of the phonon structure of the solid, while a short-range approximation is sufficient for the third-order force constants. The effects on the thermal conductivity of the relaxation time approximation, the classical approximation to the phonon statistics, the direct summation method for the electrostatic interactions, and the quasi-harmonic approximation to lattice dynamics are quantified. Quantitative agreement is found between predictions from molecular dynamics simulations (a method valid at temperatures above the Debye temperature) and the BTE result within quasi-harmonic approximation over a wide temperature range.
Ionic-Liquid-Tethered Nanoparticles: Hybrid Electrolytes
Moganty, Surya S.
2010-10-22
A new class of solventless electrolytes was created by tethering ionic liquids to hard inorganic ZrO2 nanostructures (see picture; NIM=nanoscale ionic material). These hybrid fluids exhibit exceptional redox stability windows, excellent thermal stability, good lithium transference numbers, long-term interfacial stability in the presence of a lithium anode and, when doped with lithium salt, reasonable ionic conductivities.
Jakutavičiūtė, Milda; Ruzgys, Paulius; Šatkauskas, Saulius
2014-01-01
The electrotransfer efficiency was evaluated for different external medium conductivities, osmotic pressures and electric pulse voltages. It was found that increase in conductivity or decrease in electric pulse strength decreases electrotransfer efficiency. Decrease in osmotic pressure tends to decrease electrotransfer efficiency.
Theoretical and experimental studies on ionic currents in nanopore-based biosensors.
Liu, Lei; Li, Chu; Ma, Jian; Wu, Yingdong; Ni, Zhonghua; Chen, Yunfei
2014-12-01
Novel generation of analytical technology based on nanopores has provided possibilities to fabricate nanofluidic devices for low-cost DNA sequencing or rapid biosensing. In this paper, a simplified model was suggested to describe DNA molecule's translocation through a nanopore, and the internal potential, ion concentration, ionic flowing speed and ionic current in nanopores with different sizes were theoretically calculated and discussed on the basis of Poisson-Boltzmann equation, Navier-Stokes equation and Nernst-Planck equation by considering several important parameters, such as the applied voltage, the thickness and the electric potential distributions in nanopores. In this way, the basic ionic currents, the modulated ionic currents and the current drops induced by translocation were obtained, and the size effects of the nanopores were carefully compared and discussed based on the calculated results and experimental data, which indicated that nanopores with a size of 10 nm or so are more advantageous to achieve high quality ionic current signals in DNA sensing.
Ionomer design for augmented charge transport in novel ionic polymer transducers
International Nuclear Information System (INIS)
Duncan, Andrew J; Akle, Barbar J; Long, Timothy E; Leo, Donald J
2009-01-01
Ionic polymer transducers are devices that display electromechanical transduction and are projected to have extensive applications as actuators and sensors. This study employs novel, highly branched sulfonated polysulfones (sBPS) as part of an investigation into the contribution of polymer topology to electromechanical transduction. Specifically, the ionomers are combined with an ionic liquid to determine the optimal ratio and method for maximizing ionic conductivity, where charge transport is essential to device performance. Two uptake methods are assessed for introduction of ionic liquid into the central ionomeric membrane. The effects of casting membranes in the presence of ionic liquid and swelling preformed membranes in ionic liquid on film stability and ionic conductivity are examined. Membranes cast from a solution of the ionomer and ionic liquid allow for direct targeting of the component ratio and a single-step process for membrane formation. Swelling conditions for preformed neat membranes combine time, temperature, and the presence of organic co-diluents to achieve the maximum stable uptake of ionic liquid. Comparison of optimal conditions for the various methods reveals that swelling with co-diluents achieves ionic conductivity of the imbibed membrane per uptake higher than the levels achieved with the casting process for highly sulfonated sBPS. However, for less sulfonated sBPS the casting process successfully produced membranes with ionic conductivities unreachable with the co-diluent process. Both methods will enable the production of high performance ionic polymer transducers constructed from novel sBPS ionomers and ionic liquids
Graphitic carbon nitride nanosheet electrode-based high-performance ionic actuator
Wu, Guan; Hu, Ying; Liu, Yang; Zhao, Jingjing; Chen, Xueli; Whoehling, Vincent; Plesse, Cédric; Nguyen, Giao T. M.; Vidal, Frédéric; Chen, Wei
2015-01-01
Ionic actuators have attracted attention due to their remarkably large strain under low-voltage stimulation. Because actuation performance is mainly dominated by the electrochemical and electromechanical processes of the electrode layer, the electrode material and structure are crucial. Here, we report a graphitic carbon nitride nanosheet electrode-based ionic actuator that displays high electrochemical activity and electromechanical conversion abilities, including large specific capacitance (259.4 F g−1) with ionic liquid as the electrolyte, fast actuation response (0.5±0.03% in 300 ms), large electromechanical strain (0.93±0.03%) and high actuation stability (100,000 cycles) under 3 V. The key to the high performance lies in the hierarchical pore structure with dominant size actuation performance. PMID:26028354
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Ekino, T; Gabovich, A M; Suan Li, Mai; Szymczak, H; Voitenko, A I
2017-12-20
Quasiparticle tunnel conductance-voltage characteristics (CVCs), [Formula: see text], were calculated for break junctions (BJs) made up of layered d-wave superconductors partially gapped by charge-density waves (CDWs). The current is assumed to flow in the ab-plane of electrodes. The influence of CDWs is analyzed by comparing the resulting CVCs with CVCs calculated for BJs made up of pure d-wave superconductors with relevant parameters. The main CDW-effects were found to be the appearance of new CVC peculiarities and the loss of CVC symmetry with respect to the V-sign. Tunnel directionality was shown to be one of the key factors in the formation of [Formula: see text] dependences. In particular, the orientation of electrodes with respect to the current channel becomes very important. As a result, [Formula: see text] can acquire a large variety of forms similar to those for tunnel junctions between superconductors with s-wave, d-wave, and mixed symmetry of their order parameters. The diversity of peculiarities is especially striking at finite temperatures. In the case of BJs made up of pure d-wave superconductors, the resulting CVC can include a two-peak gap-driven structure. The results were compared with the experimental BJ data for a number of high-T c oxides. It was shown that the large variety of the observed current-voltage characteristics can be interpreted in the framework of our approach. Thus, quasiparticle tunnel currents in the ab-plane can be used as an additional mean to detect CDWs competing with superconductivity in cuprates or other layered superconductors.
Experimental Characterization of Ionic Polymer Metal Composite as a Novel Fractional Order Element
Directory of Open Access Journals (Sweden)
Riccardo Caponetto
2013-01-01
Full Text Available Ionic polymer metal composites (IPMCs are electroactive materials made of ionic polymer thin membranes with platinum metallization on their surfaces. They are interesting materials due to not only their electromechanical applications as transducers but also to their electrochemical features and the relationship between the ionic/solvent current and the potential field. Their electrochemical properties thus suggest the possibility for exploiting them as compact fractional-order elements (FOEs with a view of defining fabrication processes and production strategies that assure the desired performances. In this paper, the experimental electrical characterization of a brand new IPMC setup in a fixed sandwich configuration is proposed. Two IPMC devices with different platinum absorption times (5 h and 20 h are characterized through experimental data: first, a preliminary linearity study is performed for a fixed input voltage amplitude in order to determine the frequency region where IPMC can be approximated as linear; then, a frequency analysis is carried out in order to identify a coherent fractional-order dynamics in the bode diagrams. Such analyses take the first steps towards a simplified model of IPMC as a compact electronic FOE for which the fractional exponent value depends on fabrication parameters as the absorption time.
Energy Technology Data Exchange (ETDEWEB)
Higazy, A.A.; Kassem, M.E. (Qatar Univ. (Qatar). Physics Dept.); Sayed, M.B. (Qatar Univ. (Qatar). Chemistry Dept.)
1992-01-01
Analysis of the a.c. conductivity of the zeolite HZSM-5, in the 0.1-100 kHz frequency region and the 300-700 K temperature range, reveals semiconducting features based predominantly on an ionic mechanism. This is reflected in a low-frequency Cole-Cole dependence of the Z''(Z') impedance and in a linear dependence of the {epsilon}''(''epsilon''') dielectric constant throughout the temperature range. The zeolite Broensted sites are the active centers responsible for the ionic conduction. As the conductivity drops to 373 K, sorbed water seems to participate in the conduction as a vehicle assisting the proton mobility. Above 373 K, the conductivity continues to rise as an indication of critical transition into a thermally enhanced ionic conduction. Both low-temperature sorbed water and high-temperature thermal motion are necessary to ensure a firm contact at the aggregate surfaces, where conduction takes place. Gamma-irradiation also participates in the conduction by creating new sites sensitive to the same parameters governing the conduction mechanism. (author).
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
Energy Technology Data Exchange (ETDEWEB)
Arora, N D
1987-05-01
A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.
Current-voltage characteristics of porous-silicon structures
International Nuclear Information System (INIS)
Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.
1996-01-01
I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described
A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.
Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas
2016-02-25
Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Application of Ionic Liquids in Hydrometallurgy
Park, Jesik; Jung, Yeojin; Kusumah, Priyandi; Lee, Jinyoung; Kwon, Kyungjung; Lee, Churl Kyoung
2014-01-01
Ionic liquids, low temperature molten salts, have various advantages manifesting themselves as durable and environmentally friendly solvents. Their application is expanding into various fields including hydrometallurgy due to their unique properties such as non-volatility, inflammability, low toxicity, good ionic conductivity, and wide electrochemical potential window. This paper reviews previous literatures and our recent results adopting ionic liquids in extraction, synthesis and processing of metals with an emphasis on the electrolysis of active/light, rare earth, and platinum group metals. Because the research and development of ionic liquids in this area are still emerging, various, more fundamental approaches are expected to popularize ionic liquids in the metal manufacturing industry. PMID:25177864
There's no place like Ohm: conduction in oxide thin films.
Scott, J F
2014-04-09
A pedagogical essay is given that alerts researchers to the errors inherent in assigning linear I(V) current-voltage dependences to Ohmic conduction. Such a linear I(V) is necessary but not sufficient, since other mechanisms, including Simmons' modification of the basic Schottky emission theory, also give linear I(V) at small applied voltages. Discrimination among Ohmic, Schottky, space-charge limited, and other models requires accurate thickness dependence I(d) data, where for Ohmic conduction I=a/d, whereas for interface-limited mechanisms such as Simmons/Schottky, I is nearly independent of d.
Film size-dependent voltage-modulated magnetism in multiferroic heterostructures
Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.
2014-01-01
The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375
International Nuclear Information System (INIS)
Strnad, M.
1975-01-01
An original method of temperature measurement based on conductivity changes near the phase transition point of ionic compounds and suitable for the range from 200 to 700 0 C according to the thermometric compound used, is given. By choosing between two approaches it is posible to evaluate either a discrete value of temperature or continuous measurement in a range to about 50 0 C below the phase transition point of thermometric compounds. The extreme nonlinearity of conductivity of the chosen group of ionic crystals used as well as the technical applications developed in the laboratories have not previously been published. The aim of the research is the application of this measuring method for temperature indication in nuclear reactors. Preliminary tests in radiation fields in an experimental reactor are yielding a real hope in this direction. (author)
Siong, Chew Tze; Daik, Rusli; Hamid, Muhammad Azmi Abdul
2014-09-01
Nanofluid is a colloidal suspension of nano-size particles in a fluid. Spherical shape dodecylbenzenesulfonic acid doped polyaniline (DBSA-PANI) nanoparticles were synthesized via reverse micellar polymerization in isooctane with average size of 50 nm- 60 nm. The aim of study is to explore the possibility of using deep eutectic ionic liquid (DES) as a new base fluid in heat transfer application. DES was prepared by heating up choline chloride and urea with stirring. DES based nanofluids containing DBSA-PANI nanoparticles were prepared using two-step method. Thermal conductivity of nanofluids was measured using KD2 Pro Thermal Properties Analyzer. When incorporated with DBSA-PANI nanoparticles, DES with water was found to exhibit a bigger increase in thermal conductivity compared to that of the pure DES. The thermal conductivity of DES with water was increased by 4.67% when incorporated with 0.2 wt% of DBSA-PANI nanoparticles at 50°C. The enhancement in thermal conductivity of DES based nanofluids is possibly related to Brownian motion of nanoparticles as well as micro-convection of base fluids and also interaction between dopants and DES ions.
The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.
Directory of Open Access Journals (Sweden)
Ting-Feng Lin
Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.
Park, Hyung Ju; Chi, Young Shik; Choi, Insung S.; Yun, Wan Soo
2010-07-01
We report a simple method of enhancing electric conductance in nanogap devices without any additional treatments, such as silver-enhancing process. The low electric conductance after selective immobilization of biofunctionalized gold nanoparticles in the gap region was greatly enhanced by repeated I-V scans at relatively high voltage ranges of -5 to 5 V, which was attributed to the formation of a new conduction pathway across the gap. The higher conduction state of the nanogap device showed a very stable I-V curve, which was used as an excellent measure of the existence of prostate-specific antigen.
New Pyrazolium Salts as a Support for Ionic Liquid Crystals and Ionic Conductors.
Pastor, María Jesús; Sánchez, Ignacio; Campo, José A; Schmidt, Rainer; Cano, Mercedes
2018-04-03
Ionic liquid crystals (ILCs) are a class of materials that combine the properties of liquid crystals (LCs) and ionic liquids (ILs). This type of materials is directed towards properties such as conductivity in ordered systems at different temperatures. In this work, we synthesize five new families of ILCs containing symmetrical and unsymmetrical substituted pyrazolium cations, with different alkyl long-chains, and anions such as Cl - , BF₄ - , ReO₄ - , p -CH₃-₆H₄SO₃ - (PTS) and CF₃SO₃ - (OTf). We study their thermal behavior by polarized light optical microscopy (POM) and differential scanning calorimetry (DSC). All of them, except those with OTf as counteranion, show thermotropic mesomorphism. The observations by POM reveal textures of lamellar mesophases. Those agree with the arrangement observed in the X-ray crystal structure of [H₂pz R(4),R(4) ][ReO₄]. The nature of the mesophases is also confirmed by variable temperature powder X-ray diffraction. On the other hand, the study of the dielectric properties at variable temperature in mesomorphic (Cl - and BF₄ - ) and non-mesomorphic (OTf) salts indicates that the supramolecular arrangement of the mesophase favors a greater ionic mobility and therefore ionic conductivity.
DEFF Research Database (Denmark)
Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia
2016-01-01
This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...
Directory of Open Access Journals (Sweden)
Christopher J Love
Full Text Available It has long been known that there is a sustained electrical potential (voltage difference between the xylem of many plants and their surrounding soil, but the mechanism behind this voltage has remained controversial. After eliminating any extraneous capacitive or inductive couplings and ground-mediated electric current flows, we have measured sustained differences of 50-200 mV between the xylem region of a Faraday-caged, intact, potted Ficus benjamina tree and its soil, as well as between its cut branches and soils and ionic solutions standardized to various pH values. Using identical platinum electrodes, no correlation between the voltage and time of day, illumination, sap flow, electrode elevation, or ionic composition of soil was found, suggesting no direct connection to simple dissimilar-metal redox reactions or transpirational activity. Instead, a clear relationship between the voltage polarity and magnitude and the pH difference between xylem and soil was observed. We attribute these sustained voltages to a biological concentration cell likely set up by the homeostatic mechanisms of the tree. Potential applications of this finding are briefly explored.
Ionic and viscoelastic mechanisms of a bucky-gel actuator
Kruusamäe, Karl; Sugino, Takushi; Asaka, Kinji
2015-07-01
Ionic electromechanically active polymers (IEAPs) are considered attractive candidates for soft, miniature, and lightweight actuators. The bucky-gel actuator is a carbonaceous subtype of IEAP that due to its structure (i.e. two highly porous electrodes sandwiching a thin ion-permeable electrolyte layer) and composition (i.e. being composed of soft porous polymer, carbon nanotubes, and ionic liquid) is very similar to an electric double-layer capacitor. In response to the voltage applied between the electrodes of a bucky-gel actuator, the laminar structure bends. The time domain behavior exhibits, however, a phenomenon called the back-relaxation, i.e., after some time the direction of bending is reversed even though voltage remains constant. In spite of the working mechanism of IEAP actuators being generally attributed to the transport of ions within the soft multilayer system, the specific details remain unclear. A so-called two-carrier model proposes that the bending and subsequent back-relaxation are caused by the relocation of two ionic species having different mobilities as they enter and exit the electrode layers. By adopting the two-carrier model for bucky-gel actuators, we see very good agreement between the mathematical representation and the experimental data of the electromechanical behavior. Furthermore, since the bucky-gel actuator is viscoelastic, we propose to use the time domain response of a blocking force as the key parameter related to the inner ionic mechanism. We also introduce a method to estimate the viscoelastic creep compliance function from the time domain responses for curvature and blocking force. This analysis includes four types of bucky-gel actuators of varying composition and structure.
Benhassine, Narimane; Berger, Thomas
2005-02-01
Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.
High performance batteries with carbon nanomaterials and ionic liquids
Lu, Wen [Littleton, CO
2012-08-07
The present invention is directed to lithium-ion batteries in general and more particularly to lithium-ion batteries based on aligned graphene ribbon anodes, V.sub.2O.sub.5 graphene ribbon composite cathodes, and ionic liquid electrolytes. The lithium-ion batteries have excellent performance metrics of cell voltages, energy densities, and power densities.
Pressure dependence of conductivity
International Nuclear Information System (INIS)
Bracewell, B.L.; Hochheimer, H.D.
1993-01-01
The overall objectives of this work were to attempt the following: (1) Measure the pressure dependence of the electrical conductivity of several quasi-one-dimensional, charge-density-wave solids, including measurements along various crystal directions. (2) Measure photocurrents in selected MX solids at ambient and elevated pressures. (3) Measure the resonance Raman spectra for selected MX solids as a function of pressure
Impurity effects on ionic-liquid-based supercapacitors
International Nuclear Information System (INIS)
Liu, Kun; Lian, Cheng; Henderson, Douglas; Wu, Jianzhong
2016-01-01
Small amounts of an impurity may affect the key properties of an ionic liquid and such effects can be dramatically amplified when the electrolyte is under confinement. Here the classical density functional theory is employed to investigate the impurity effects on the microscopic structure and the performance of ionic-liquid-based electrical double-layer capacitors, also known as supercapacitors. Using a primitive model for ionic species, we study the effects of an impurity on the double layer structure and the integral capacitance of a room temperature ionic liquid in model electrode pores and find that an impurity strongly binding to the surface of a porous electrode can significantly alter the electric double layer structure and dampen the oscillatory dependence of the capacitance with the pore size of the electrode. Meanwhile, a strong affinity of the impurity with the ionic species affects the dependence of the integral capacitance on the pore size. Up to 30% increase in the integral capacitance can be achieved even at a very low impurity bulk concentration. As a result, by comparing with an ionic liquid mixture containing modified ionic species, we find that the cooperative effect of the bounded impurities is mainly responsible for the significant enhancement of the supercapacitor performance.
Impurity effects on ionic-liquid-based supercapacitors
Liu, Kun; Lian, Cheng; Henderson, Douglas; Wu, Jianzhong
2017-02-01
Small amounts of an impurity may affect the key properties of an ionic liquid and such effects can be dramatically amplified when the electrolyte is under confinement. Here the classical density functional theory is employed to investigate the impurity effects on the microscopic structure and the performance of ionic-liquid-based electrical double-layer capacitors, also known as supercapacitors. Using a primitive model for ionic species, we study the effects of an impurity on the double layer structure and the integral capacitance of a room temperature ionic liquid in model electrode pores and find that an impurity strongly binding to the surface of a porous electrode can significantly alter the electric double layer structure and dampen the oscillatory dependence of the capacitance with the pore size of the electrode. Meanwhile, a strong affinity of the impurity with the ionic species affects the dependence of the integral capacitance on the pore size. Up to 30% increase in the integral capacitance can be achieved even at a very low impurity bulk concentration. By comparing with an ionic liquid mixture containing modified ionic species, we find that the cooperative effect of the bounded impurities is mainly responsible for the significant enhancement of the supercapacitor performance.
International Nuclear Information System (INIS)
Saikia, D.; Hussain, A.M.P.; Kumar, A.; Singh, F.; Avasthi, D.K.
2006-01-01
In an attempt to increase the Li ion diffusivity in gel polymer electrolytes, the effects of Li 3+ ion irradiation in P(VDF-HFP)-(PC + DEC)-LiCF 3 SO 3 electrolyte system, with five different fluences, is studied. Irradiation with swift heavy ions shows enhancement in conductivity at low fluences and decreased in conductivity at higher fluences with respect to pristine polymer electrolyte films. Maximum room temperature ionic conductivity after irradiation is found to be 2.6 x 10 -3 S/cm. This interesting result could be attributed to the fact that, higher fluence provides critical activation energy for cross-linking and crystallization to occur, which results in decrease in ionic conductivity. XRD results show decrease in the degree of crystallinity upon ion irradiation at low fluences (≤10 11 ions/cm 2 ) and increase in crystallinity at high fluences (>10 11 ions/cm 2 ). In FTIR spectra the absorption band intensities around 3025 cm -1 and 2985 cm -1 decrease upon irradiation with a fluence of 5 x 10 1 ions/cm 2 suggesting chain scission and increase upon irradiation with a fluence of 5 x 10 12 ions/cm 2 indicating cross-linking. FTIR analyses corroborate the conductivity and XRD results
Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne
2010-10-01
The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.
Robust mixed conducting membrane structure
DEFF Research Database (Denmark)
2010-01-01
circuited. The present invention further provides a method of producing the above membrane structure, comprising the steps of : providing a ionically conducting layer; applying at least one layer of electronically conducting material on each side of said ionically conducting layer; sintering the multilayer...
Energy Technology Data Exchange (ETDEWEB)
Sengwa, R. J., E-mail: rjsengwa@rediffmail.com; Dhatarwal, Priyanka, E-mail: dhatarwalpriyanka@gmail.com; Choudhary, Shobhna, E-mail: shobhnachoudhary@rediffmail.com [Dielectric Research Laboratory, Department of Physics, Jai Narain Vyas University, Jodhpur – 342 005 (India)
2016-05-06
Solid polymer electrolyte (SPE) film consisted of poly(ethylene oxide) (PEO) and poly(methyl methacrylate) (PMMA) blend matrix with lithium tetrafluroborate (LiBF{sub 4}) as dopant ionic salt and poly(ethylene glycol) (PEG) as plasticizer has been prepared by solution casting method followed by melt pressing. Dielectric properties and ionic conductivity of the SPE film at different temperatures have been determined by dielectric relaxation spectroscopy. It has been observed that the dc ionic conductivity of the SPE film increases with increase of temperature and also the decrease of relaxation time. The temperature dependent relaxation time and ionic conductivity values of the electrolyte are governed by the Arrhenius relation. Correlation observed between dc conductivity and relaxation time confirms that ion transportation occurs with polymer chain segmental dynamics through hopping mechanism. The room temperature ionic conductivity is found to be 4 × 10{sup −6} S cm{sup −1} which suggests the suitability of the SPE film for rechargeable lithium batteries.
Ionic charging by local imbalance at interfaces in hybrid lead halide perovskites
Energy Technology Data Exchange (ETDEWEB)
Almora, Osbel; Guerrero, Antonio; Garcia-Belmonte, Germà, E-mail: garciag@uji.es [Institute of Advanced Materials (INAM), Universitat Jaume I, 12071 Castelló (Spain)
2016-01-25
Identification of specific operating mechanisms becomes particularly challenging when mixed ionic-electronic conductors are used in optoelectronic devices. Ionic effects in perovskite solar cells are believed to distort operation curves and possess serious doubts about their long term stability. Current hysteresis and switchable photovoltaic characteristics have been connected to the kinetics of ion migration. However, the nature of the specific ionic mechanism (or mechanisms) able to explain the operation distortions is still poorly understood. It is observed here that the local rearrangement of ions at the electrode interfaces gives rise to commonly observed capacitive effects. Charging transients in response to step voltage stimuli using thick CH{sub 3}NH{sub 3}PbI{sub 3} samples show two main polarization processes and reveal the structure of the ionic double-layer at the interface with the non-reacting contacts. It is observed that ionic charging, with a typical response time of 10 s, is a local effect confined in the vicinity of the electrode, which entails absence of net mobile ionic concentration (space-charge) in the material bulk.
Application of Ionic Liquids in Hydrometallurgy
Directory of Open Access Journals (Sweden)
Jesik Park
2014-08-01
Full Text Available Ionic liquids, low temperature molten salts, have various advantages manifesting themselves as durable and environmentally friendly solvents. Their application is expanding into various fields including hydrometallurgy due to their unique properties such as non-volatility, inflammability, low toxicity, good ionic conductivity, and wide electrochemical potential window. This paper reviews previous literatures and our recent results adopting ionic liquids in extraction, synthesis and processing of metals with an emphasis on the electrolysis of active/light, rare earth, and platinum group metals. Because the research and development of ionic liquids in this area are still emerging, various, more fundamental approaches are expected to popularize ionic liquids in the metal manufacturing industry.
A practical multilayered conducting polymer actuator with scalable work output
International Nuclear Information System (INIS)
Ikushima, Kimiya; John, Stephen; Yokoyama, Kazuo; Nagamitsu, Sachio
2009-01-01
Household assistance robots are expected to become more prominent in the future and will require inherently safe design. Conducting polymer-based artificial muscle actuators are one potential option for achieving this safety, as they are flexible, lightweight and can be driven using low input voltages, unlike electromagnetic motors; however, practical implementation also requires a scalable structure and stability in air. In this paper we propose and practically implement a multilayer conducting polymer actuator which could achieve these targets using polypyrrole film and ionic liquid-soaked separators. The practical work density of a nine-layer multilayer actuator was 1.4 kJ m −3 at 0.5 Hz, when the volumes of the electrolyte and counter electrodes were included, which approaches the performance of mammalian muscle. To achieve air stability, we analyzed the effect of air-stable ionic liquid gels on actuator displacement using finite element simulation and it was found that the majority of strain could be retained when the elastic modulus of the gel was kept below 3 kPa. As a result of this work, we have shown that multilayered conducting polymer actuators are a feasible idea for household robotics, as they provide a substantial practical work density in a compact structure and can be easily scaled as required
Murthy, Arun; Manthiram, Arumugam
2011-06-28
Highly water-dispersible polymer acid-doped polyanilines have been synthesized and evaluated as an alternative for expensive Nafion ionomers in the anode of direct methanol fuel cells (DMFC). These polymers as ionomers lead to higher performance in single cell DMFC compared to Nafion ionomers due to mixed ionic-electronic conduction, water dispersibility, and co-catalytic activity. This journal is © The Royal Society of Chemistry 2011
Energy Technology Data Exchange (ETDEWEB)
Neumayer, Sabine M.; Rodriguez, Brian J., E-mail: brian.rodriguez@ucd.ie [School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Belfield, Dublin 4 (Ireland); Strelcov, Evgheni; Kravchenko, Ivan I.; Kalinin, Sergei V. [Center for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Manzo, Michele; Gallo, Katia [Department of Applied Physics, KTH - Royal Institute of Technology, Roslagstullbacken 21, 10691 Stockholm (Sweden); Kholkin, Andrei L. [Department of Physics and CICECO-Aveiro Institute of Materials, 3810-193 Aveiro, Portugal and Institute of Natural Sciences, Ural Federal University, 620000 Ekaterinburg (Russian Federation)
2015-12-28
Mg doped lithium niobate (Mg:LN) exhibits several advantages over undoped LN such as resistance to photorefraction, lower coercive fields, and p-type conductivity that is particularly pronounced at domain walls and opens up a range of applications, e.g., in domain wall electronics. Engineering of precise domain patterns necessitates well founded knowledge of switching kinetics, which can differ significantly from that of undoped LN. In this work, the role of humidity and sample composition in polarization reversal has been investigated under application of the same voltage waveform. Control over domain sizes has been achieved by varying the sample thickness and initial polarization as well as atmospheric conditions. In addition, local introduction of proton exchanged phases allows for inhibition of domain nucleation or destabilization, which can be utilized to modify domain patterns. Polarization dependent current flow, attributed to charged domain walls and band bending, demonstrates the rectifying ability of Mg:LN in combination with suitable metal electrodes that allow for further tailoring of conductivity.
International Nuclear Information System (INIS)
Neumayer, Sabine M.; Rodriguez, Brian J.; Strelcov, Evgheni; Kravchenko, Ivan I.; Kalinin, Sergei V.; Manzo, Michele; Gallo, Katia; Kholkin, Andrei L.
2015-01-01
Mg doped lithium niobate (Mg:LN) exhibits several advantages over undoped LN such as resistance to photorefraction, lower coercive fields, and p-type conductivity that is particularly pronounced at domain walls and opens up a range of applications, e.g., in domain wall electronics. Engineering of precise domain patterns necessitates well founded knowledge of switching kinetics, which can differ significantly from that of undoped LN. In this work, the role of humidity and sample composition in polarization reversal has been investigated under application of the same voltage waveform. Control over domain sizes has been achieved by varying the sample thickness and initial polarization as well as atmospheric conditions. In addition, local introduction of proton exchanged phases allows for inhibition of domain nucleation or destabilization, which can be utilized to modify domain patterns. Polarization dependent current flow, attributed to charged domain walls and band bending, demonstrates the rectifying ability of Mg:LN in combination with suitable metal electrodes that allow for further tailoring of conductivity
International Nuclear Information System (INIS)
Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.
2008-01-01
Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field
International Nuclear Information System (INIS)
Miah, M. Idrish
2008-01-01
The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed
The role of MgBr2 to enhance the ionic conductivity of PVA/PEDOT:PSS polymer composite
Directory of Open Access Journals (Sweden)
Eslam M. Sheha
2015-07-01
Full Text Available A solid polymer electrolyte system based on poly(vinyl alcohol (PVA and poly(3,4-Etylenedioxythiophene:poly(styrenesulfonate (PEDOT:PSS complexed with magnesium bromide (MgBr2 salt was prepared using solution cast technique. The ionic conductivity is observed to increase with increasing MgBr2 concentration. The maximum conductivity was found to be 9.89 × 10−6 S/cm for optimum polymer composite film (30 wt.% MgBr2 at room temperature. The increase in the conductivity is attributed to the increase in the number of ions as the salt concentration is increased. This has been proven by dielectric studies. The increase in conductivity is also attributable to the increase in the fraction of amorphous region in the electrolyte films as confirmed by their structural, thermal, electrical and optical properties.
Proton Conductivity Studies on Biopolymer Electrolytes
International Nuclear Information System (INIS)
Harun, N. I.; Sabri, N. S.; Rosli, N. H. A.; Taib, M. F. M.; Saaid, S. I. Y.; Kudin, T. I. T.; Ali, A. M. M.; Yahya, M. Z. A.
2010-01-01
Proton conducting solid biopolymer electrolyte membranes consisting of methyl cellulose (MC) and different wt.% of ammonium nitrate (NH 4 NO 3 ) were prepared by solution cast technique. Impedance spectroscopy was carried out to study electrical characteristics of bulk materials. The ionic conductivity of the prepared samples was calculated using the bulk resistance (R b ) obtained from impedance spectroscopy plot. The highest ionic conductivity obtained was 1.17x10 -4 Scm -1 for the sample with composition ratio of MC(50): NH 4 NO 3 (50). To enhance the ionic conductivity, propylene carbonate (PC) and ethylene carbonate (EC) plasticizers were introduced. It was found that the ionic conductivity of polymer electrolyte membranes increased with the increase in plasticizers concentration. The ionic conductivities of solid polymer electrolytes based on MC-NH 4 NO 3 -PC was enhanced up to 4.91x10 -3 Scm -1 while for the MC-NH 4 NO 3 -EC system, the highest conductivity was 1.74x10 -2 Scm -1 . The addition of more plasticizer however decreases in mechanical stability of the membranes.
[Ion-dependency of the GABA-potentiating effects of benzodiazepine tranquilizers and harmane].
Abramets, I I; Komissarov, I V
1984-06-01
Experiments on an isolated spinal cord of 8-15-day-old rats have shown that one of the possible mechanisms of the GABA-potentiating action of the benzodiazepine tranquilizer, chlorodiazepoxide, may be a decrease in the intraneuronal concentration of Ca2+. This is evidenced by the enhancement of the GABA-potentiating action of chlorodiazepoxide under Ca2+ deficiency in the medium and in the presence of the blockers of the voltage-dependent Ca2+ ionic channels--Mn2+ and Co2+, and by the reduction of the effect in question under Ca2+ excess in the medium and in the presence of the K+ channels blockers--tetraethylammonium and 4-aminopyridine. The GABA-potentiating action of harmane is likely to be related to the blockade of the voltage-dependent K+ channels and elevation of the intracellular concentration of Ca2+.
International Nuclear Information System (INIS)
Cardoso, P.; Silva, J.; Agostinho Moreira, J.; Klosterman, D.; Hattum, F.W.J. van; Simoes, R.; Lanceros-Mendez, S.
2012-01-01
The influence of the dispersion of vapor grown carbon nanofibers (VGCNF) on the electrical properties of VGCNF/epoxy composites has been studied. A homogeneous dispersion of the VGCNF does not imply better electrical properties. The presence of well distributed clusters appears to be a key factor for increasing composite conductivity. It is also shown that the main conduction mechanism has an ionic nature for concentrations below the percolation threshold, while above the percolation threshold it is dominated by hopping between the fillers. Finally, using the granular system theory it is possible to explain the origin of conduction at low temperatures. -- Highlights: ► The influence of dispersion of carbon nanofibers on epoxy is investigated. ► A homogeneous dispersion does not imply better electrical properties. ► The conduction mechanism has an ionic nature below the percolation threshold. ► Above the percolation threshold it is dominated by hopping between the fillers. ► The granular system theory allows explaining conduction at low temperatures.
Energy Technology Data Exchange (ETDEWEB)
Cardoso, P. [Center of Physics, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); Silva, J. [Center of Physics, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); Institute for Polymers and Composites IPC/I3N, University of Minho, Campus de Azurém, 4800-058 Guimares (Portugal); Agostinho Moreira, J. [IFIMUP and IN—Institute of Nanoscience and Nanotechnology, Department of Physics and Astronomy, Faculty of Science, University of Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Klosterman, D. [Chemical and Materials Engineering, University of Dayton, 300 College Park, Dayton, OH 45469-0246 (United States); Hattum, F.W.J. van [Institute for Polymers and Composites IPC/I3N, University of Minho, Campus de Azurém, 4800-058 Guimares (Portugal); Simoes, R. [Institute for Polymers and Composites IPC/I3N, University of Minho, Campus de Azurém, 4800-058 Guimares (Portugal); School of Technology, Polytechnic Institute of Cávado and Ave, Campus do IPCA, 4750-810 Barcelos (Portugal); Lanceros-Mendez, S., E-mail: lanceros@fisica.uminho.pt [Center of Physics, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); INL—International Iberian Nanotechnology Laboratory, 4715-330 Braga (Portugal)
2012-10-01
The influence of the dispersion of vapor grown carbon nanofibers (VGCNF) on the electrical properties of VGCNF/epoxy composites has been studied. A homogeneous dispersion of the VGCNF does not imply better electrical properties. The presence of well distributed clusters appears to be a key factor for increasing composite conductivity. It is also shown that the main conduction mechanism has an ionic nature for concentrations below the percolation threshold, while above the percolation threshold it is dominated by hopping between the fillers. Finally, using the granular system theory it is possible to explain the origin of conduction at low temperatures. -- Highlights: ► The influence of dispersion of carbon nanofibers on epoxy is investigated. ► A homogeneous dispersion does not imply better electrical properties. ► The conduction mechanism has an ionic nature below the percolation threshold. ► Above the percolation threshold it is dominated by hopping between the fillers. ► The granular system theory allows explaining conduction at low temperatures.
Temperature dependent electronic conduction in semiconductors
International Nuclear Information System (INIS)
Roberts, G.G.; Munn, R.W.
1980-01-01
This review describes the temperature dependence of bulk-controlled electronic currents in semiconductors. The scope of the article is wide in that it contrasts conduction mechanisms in inorganic and organic solids and also single crystal and disordered semiconductors. In many experimental situations it is the metal-semiconductor contact or the interface between two dissimilar semiconductors that governs the temperature dependence of the conductivity. However, in order to keep the length of the review within reasonable bounds, these topics have been largely avoided and emphasis is therefore placed on bulk-limited currents. A central feature of electronic conduction in semiconductors is the concentrations of mobile electrons and holes that contribute to the conductivity. Various statistical approaches may be used to calculate these densities which are normally strongly temperature dependent. Section 1 emphasizes the relationship between the position of the Fermi level, the distribution of quantum states, the total number of electrons available and the absolute temperature of the system. The inclusion of experimental data for several materials is designed to assist the experimentalist in his interpretation of activation energy curves. Sections 2 and 3 refer to electronic conduction in disordered solids and molecular crystals, respectively. In these cases alternative approaches to the conventional band theory approach must be considered. For example, the velocities of the charge carriers are usually substantially lower than those in conventional inorganic single crystal semiconductors, thus introducing the possibility of an activated mobility. Some general electronic properties of these materials are given in the introduction to each of these sections and these help to set the conduction mechanisms in context. (orig.)
Coupling between the voltage-sensing and phosphatase domains of Ci-VSP.
Villalba-Galea, Carlos A; Miceli, Francesco; Taglialatela, Maurizio; Bezanilla, Francisco
2009-07-01
The Ciona intestinalis voltage sensor-containing phosphatase (Ci-VSP) shares high homology with the phosphatidylinositol phosphatase enzyme known as PTEN (phosphatase and tensin homologue deleted on chromosome 10). We have taken advantage of the similarity between these proteins to inquire about the coupling between the voltage sensing and the phosphatase domains in Ci-VSP. Recently, it was shown that four basic residues (R11, K13, R14, and R15) in PTEN are critical for its binding onto the membrane, required for its catalytic activity. Ci-VSP has three of the basic residues of PTEN. Here, we show that when R253 and R254 (which are the homologues of R14 and R15 in PTEN) are mutated to alanines in Ci-VSP, phosphatase activity is disrupted, as revealed by a lack of effect on the ionic currents of KCNQ2/3, where current decrease is a measure of phosphatase activity. The enzymatic activity was not rescued by the introduction of lysines, indicating that the binding is an arginine-specific interaction between the phosphatase binding domain and the membrane, presumably through the phosphate groups of the phospholipids. We also found that the kinetics and steady-state voltage dependence of the S4 segment movement are affected when the arginines are not present, indicating that the interaction of R253 and R254 with the membrane, required for the catalytic action of the phosphatase, restricts the movement of the voltage sensor.
Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes
DEFF Research Database (Denmark)
Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R
2006-01-01
Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....
Dharia, Sameera; Rabbitt, Richard D.
2011-01-01
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...
Spatial resolution of the electrical conductance of ionic fluids using a Green-Kubo method
Jones, R. E.; Ward, D. K.; Templeton, J. A.
2014-11-01
We present a Green-Kubo method to spatially resolve transport coefficients in compositionally heterogeneous mixtures. We develop the underlying theory based on well-known results from mixture theory, Irving-Kirkwood field estimation, and linear response theory. Then, using standard molecular dynamics techniques, we apply the methodology to representative systems. With a homogeneous salt water system, where the expectation of the distribution of conductivity is clear, we demonstrate the sensitivities of the method to system size, and other physical and algorithmic parameters. Then we present a simple model of an electrochemical double layer where we explore the resolution limit of the method. In this system, we observe significant anisotropy in the wall-normal vs. transverse ionic conductances, as well as near wall effects. Finally, we discuss extensions and applications to more realistic systems such as batteries where detailed understanding of the transport properties in the vicinity of the electrodes is of technological importance.
Spatial resolution of the electrical conductance of ionic fluids using a Green-Kubo method.
Jones, R E; Ward, D K; Templeton, J A
2014-11-14
We present a Green-Kubo method to spatially resolve transport coefficients in compositionally heterogeneous mixtures. We develop the underlying theory based on well-known results from mixture theory, Irving-Kirkwood field estimation, and linear response theory. Then, using standard molecular dynamics techniques, we apply the methodology to representative systems. With a homogeneous salt water system, where the expectation of the distribution of conductivity is clear, we demonstrate the sensitivities of the method to system size, and other physical and algorithmic parameters. Then we present a simple model of an electrochemical double layer where we explore the resolution limit of the method. In this system, we observe significant anisotropy in the wall-normal vs. transverse ionic conductances, as well as near wall effects. Finally, we discuss extensions and applications to more realistic systems such as batteries where detailed understanding of the transport properties in the vicinity of the electrodes is of technological importance.
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Pena, Rodrigo F. O.; Ceballos, Cesar C.; Lima, Vinicius; Roque, Antonio C.
2018-04-01
In a neuron with hyperpolarization activated current (Ih), the correct input frequency leads to an enhancement of the output response. This behavior is known as resonance and is well described by the neuronal impedance. In a simple neuron model we derive equations for the neuron's resonance and we link its frequency and existence with the biophysical properties of Ih. For a small voltage change, the component of the ratio of current change to voltage change (d I /d V ) due to the voltage-dependent conductance change (d g /d V ) is known as derivative conductance (GhDer). We show that both GhDer and the current activation kinetics (characterized by the activation time constant τh) are mainly responsible for controlling the frequency and existence of resonance. The increment of both factors (GhDer and τh) greatly contributes to the appearance of resonance. We also demonstrate that resonance is voltage dependent due to the voltage dependence of GhDer. Our results have important implications and can be used to predict and explain resonance properties of neurons with the Ih current.
Relaxation behavior of ion conducting glasses
International Nuclear Information System (INIS)
Bunde, A.; Dieterich, W.; Maass, P.; Meyer, M.
1997-01-01
We investigate by Monte Carlo simulations the diffusion of ions in an energetically disordered lattice, where the Coulomb interaction between the mobile ions is explicitly taken into account. We show that the combined effect of Coulomb interaction and disorder can account for the ionic ac-conductivity in glasses and the recently discovered non-Arrhenius behavior of the dc-conductivity in glassy fast ionic conductors. Our results suggest that glassy ionic conductors can be optimized by lowering the strength of the energetic disorder but that the ionic interaction effects set an upper bound for the conductivity at high temperatures. (author)
Energy Technology Data Exchange (ETDEWEB)
Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)
2007-04-30
The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.
DEFF Research Database (Denmark)
Goff, J.P.; Hayes, W.; Hull, S.
1999-01-01
The defect structure of cubic fluorite structured yttria-stabilized zirconia (ZrO2)(1-x)(Y2O3)(x) has been investigated over the composition range 0.100(3)less than or equal to x less than or equal to 0.241 (10) and temperatures T(K) up to 2780(10) K, using single-crystal specimens. Analysis of n......, we propose that the anomalous decrease in the ionic conductivity with increasing x is a consequence of the decreasing mobility of the isolated defects, possibly due to blockage by the increasing number of static aggregates....
Functional diversity of voltage-sensing phosphatases in two urodele amphibians.
Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi
2014-07-16
Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Mathematical modeling of electrical activity of uterine muscle cells.
Rihana, Sandy; Terrien, Jeremy; Germain, Guy; Marque, Catherine
2009-06-01
The uterine electrical activity is an efficient parameter to study the uterine contractility. In order to understand the ionic mechanisms responsible for its generation, we aimed at building a mathematical model of the uterine cell electrical activity based upon the physiological mechanisms. First, based on the voltage clamp experiments found in the literature, we focus on the principal ionic channels and their cognate currents involved in the generation of this electrical activity. Second, we provide the methodology of formulations of uterine ionic currents derived from a wide range of electrophysiological data. The model is validated step by step by comparing simulated voltage-clamp results with the experimental ones. The model reproduces successfully the generation of single spikes or trains of action potentials that fit with the experimental data. It allows analyzing ionic channels implications. Likewise, the calcium-dependent conductance influences significantly the cellular oscillatory behavior.
Biswas, Swarup; Dutta, Bula; Bhattacharya, Subhratanu
2013-10-01
The present article demonstrates an intensive study upon the temperature dependent current density (J)-voltage (V) characteristics of moderately doped polypyrrole nanostructure and its silver nanoparticles incorporated nanocomposites. Analysis of the measured J-V characteristics of different synthesized nano-structured samples within a wide temperature range revealed that the electrical conduction behavior followed a trapped charge-limited conduction and a transition of charge transport mechanism from deep exponential trap limited conduction to shallow traps limited conduction had been occurred due to the incorporation of silver nanoparticles within the polypyrrole matrix. A direct evaluation of carrier mobility as a function of electric field and temperature from the measured J-V characteristics illustrates that the incorporation of silver nanoparticles within the polypyrrole matrix enhances the carrier mobility at a large extent by reducing the concentration of traps within the polypyrrole matrix. The calculated mobility is consistent with the Poole-Frenkel form for the electrical field up to a certain temperature range. The nonlinear low temperature dependency of mobility of all the nanostructured samples was explained by Mott variable range hopping conduction mechanisms. Quantitative information regarding the charge transport parameters obtained from the above study would help to extend optimization strategies for the fabrication of new organic semiconducting nano-structured devices.
Synthesis and characterization of new ionic liquids
International Nuclear Information System (INIS)
Oliveira, L.M.C. de; Mattedi, S.; Boaventura, J.S.; Iglesias, M.; Universidad de Santiago de Compostela
2010-01-01
In recent years, ionic liquids have been highlighted for its potential in various industrial applications. Among them, the salts of Broensted has a promising profile for the low toxicity, low cost and simple synthesis. This paper presents the synthesis and characterization of new salts of Bronsted with branched (lactate) or large chain anions (oleate) for future use as additives promoters of proton conductivity in fuel cells of ethanol. Experimental data were measured for density, sound velocity and conductivity of pure ionic liquids and mixtures. The density decreases linearly with increasing temperature, and sound velocity shows a similar trend, but not linear. The conductivity increases according to the Arrhenius model with activation energy less than 10 J/mol. Tests NMR, FTIR and TGA confirm ionic structure and thermal stability up to 165 deg C. (author)
Parameswaran, V.; Nallamuthu, N.; Devendran, P.; Nagarajan, E. R.; Manikandan, A.
2017-06-01
Solid polymer blend electrolytes are widely studied due to their extensive applications particularly in electrochemical devices. Blending polymer makes the thermal stability, higher mechanical strength and inorganic salt provide ionic charge carrier to enhance the conductivity. In these studies, 50% polyvinyl alcohol (PVA), 50% poly (N-vinyl pyrrolidone) (PVP) and 2.5% L-Asparagine mixed with different ratio of the Ammonium bromide (NH4Br), have been synthesized using solution casting technique. The prepared PVA/PVP/L-Asparagine/doped-NH4Br polymer blend electrolyte films have been characterized by various analytical methods such as FT-IR, XRD, impedance spectroscopy, TG-DSC and scanning electron microscopy. FT-IR, XRD and TG/DSC analysis revealed the structural and thermal behavior of the complex formation between PVA/PVP/L-Asparagine/doped-NH4Br. The ionic conductivity and the dielectric properties of PVA/PVP/L-Asparagine/doped-NH4Br polymer blend electrolyte films were examined using impedance analysis. The highest ionic conductivity was found to be 2.34×10-4 S cm-1 for the m.wt. composition of 50%PVA:50%PVP:2.5%L-Asparagine:doped 0.15 g NH4Br at ambient temperature. Solid state proton battery is fabricated and the observed open circuit voltage is 1.1 V and its performance has been studied.
Essa, Mohammed Hussain; Mu'azu, Nuhu Dalhat; Lukman, Salihu; Bukhari, Alaadin
2013-01-01
In this study, an integrated in situ remediation technique which couples electrokinetics with adsorption, using locally produced granular activated carbon from date palm pits in the treatment zones that are installed directly to bracket the contaminated soils at bench-scale, is investigated. Natural saline-sodic clay soil, spiked with contaminant mixture (kerosene, phenol, Cr, Cd, Cu, Zn, Pb, and Hg), was used in this study to investigate the effects of voltage gradient, initial contaminant concentration, and polarity reversal rate on the soil electrical conductivity. Box-Behnken Design (BBD) was used for the experimental design and response surface methodology (RSM) was employed to model, optimize, and interpret the results obtained using Design-Expert version 8 platform. The total number of experiments conducted was 15 with voltage gradient, polarity reversal rate, and initial contaminant concentration as variables. The main target response discussed in this paper is the soil electrical conductivity due to its importance in electrokinetic remediation process. Responses obtained were fitted to quadratic models whose R (2) ranges from 84.66% to 99.19% with insignificant lack of fit in each case. Among the investigated factors, voltage gradient and initial contaminant concentration were found to be the most significant influential factors.
Directory of Open Access Journals (Sweden)
Mohammed Hussain Essa
2013-01-01
Full Text Available In this study, an integrated in situ remediation technique which couples electrokinetics with adsorption, using locally produced granular activated carbon from date palm pits in the treatment zones that are installed directly to bracket the contaminated soils at bench-scale, is investigated. Natural saline-sodic clay soil, spiked with contaminant mixture (kerosene, phenol, Cr, Cd, Cu, Zn, Pb, and Hg, was used in this study to investigate the effects of voltage gradient, initial contaminant concentration, and polarity reversal rate on the soil electrical conductivity. Box-Behnken Design (BBD was used for the experimental design and response surface methodology (RSM was employed to model, optimize, and interpret the results obtained using Design-Expert version 8 platform. The total number of experiments conducted was 15 with voltage gradient, polarity reversal rate, and initial contaminant concentration as variables. The main target response discussed in this paper is the soil electrical conductivity due to its importance in electrokinetic remediation process. Responses obtained were fitted to quadratic models whose R2 ranges from 84.66% to 99.19% with insignificant lack of fit in each case. Among the investigated factors, voltage gradient and initial contaminant concentration were found to be the most significant influential factors.
International Nuclear Information System (INIS)
Morgan, B J; Madden, P A
2012-01-01
Extreme room temperature conductivity enhancements have been reported for nanocrystalline AgI of up to × 10 4 relative to bulk β-AgI (Guo et al 2005 Adv. Mater. 17 2815-9). These samples were identified as possessing 7H and 9R polytype structures, which can be considered as heterostructures composed of thin, commensurate layers in the β (wurtzite) and γ (zincblende) phases. It has been proposed that space-charge layer formation at β|γ-interfaces causes near complete disordering of the Ag + sublattice in these polytypes, resulting in a massive intrinsic enhancement of ionic conductivity. We have performed molecular dynamics simulations of β- and γ-AgI and mixed β|γ superlattices, to study the effect of heterostructuring on intrinsic defect populations and Ag + transport. The ionic conductivities and Ag + diffusion coefficients vary as β > 7H ≈ 9R ≈ 10L > γ. The β|γ-heterostructured polytypes show no enhancement in defect populations or Ag + mobilities relative to the β-AgI phase, and instead behave as simple composites of β- and γ-AgI. This contradicts the proposal that the extreme conductivity enhancement observed for 7H and 9R polytypes is explained by extensive space-charge formation. (paper)
Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field
Energy Technology Data Exchange (ETDEWEB)
Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au
2008-10-15
The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.
Design of a mixed ionic/electronic conducting oxygen transport membrane pilot module
Energy Technology Data Exchange (ETDEWEB)
Pfaff, E.M.; Kaletsch, A.; Broeckmann, C. [RWTH Aachen University, IWM, Aachen (Germany)
2012-03-15
In the last years, a lot of ceramic materials were developed that, at higher temperatures, have a high electrical conductivity and a high conductivity of oxygen ions. Such mixed ionic/electronic conductors can be used to produce high-purity oxygen. This work focuses on the realization of a pilot membrane module, with BSCF (Ba{sub 0.5}Sr{sub 0.5}Co{sub 0.8}Fe{sub 0.2}O{sub 3-{delta}}) perovskite selected as the membrane material. An amount of 500 kg of powder was industrially fabricated, spray-granulized and pressed into tubes. The best operation conditions concerning energy consumption were calculated, and a module reactor was designed operating at 850 C, with an air pressure of 15-20 bar on the feed site and a low vacuum of about 0.8 bar on the permeate site. Special emphasis was placed on joining alternatives for ceramic tubes in metallic bottoms. A first laboratory module was tested with a membrane area of 1 m{sup 2} and then advanced to a pilot module with 570 tubes and a capability of more than 300 000 L of pure oxygen per day. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Directory of Open Access Journals (Sweden)
Yang Liu
2016-08-01
Full Text Available This theoretical study investigates the nonlinear ionic current-voltage characteristics of nano-channels that have weakly overlapping electrical double layers. Numerical simulations as well as a 1-D mathematical model are developed to reveal that the electro-osmotic flow (EOF interplays with the concentration-polarization process and depletes the ion concentration inside the channels, thus significantly suppressing the channel conductance. The conductance may be restored at high electrical biases in the presence of recirculating vortices within the channels. As a result of the EOF-driven ion depletion, a limiting-conductance behavior is identified, which is intrinsically different from the classical limiting-current behavior.
Kollarik, M; Sun, H; Herbstsomer, R A; Ru, F; Kocmalova, M; Meeker, S N; Undem, B J
2018-04-15
The action potential initiation in the nerve terminals and its subsequent conduction along the axons of afferent nerves are not necessarily dependent on the same voltage-gated sodium channel (Na V 1) subunits. The action potential initiation in jugular C-fibres within airway tissues is not blocked by TTX; nonetheless, conduction of action potentials along the vagal axons of these nerves is often dependent on TTX-sensitive channels. This is not the case for nodose airway Aδ-fibres and C-fibres, where both action potential initiation and conduction is abolished by TTX or selective Na V 1.7 blockers. The difference between the initiation of action potentials within the airways vs. conduction along the axons should be considered when developing Na V 1 blocking drugs for topical application to the respiratory tract. The action potential (AP) initiation in the nerve terminals and its subsequent AP conduction along the axons do not necessarily depend on the same subtypes of voltage-gated sodium channels (Na V 1s). We evaluated the role of TTX-sensitive and TTX-resistant Na V 1s in vagal afferent nociceptor nerves derived from jugular and nodose ganglia innervating the respiratory system. Single cell RT-PCR was performed on vagal afferent neurons retrogradely labelled from the guinea pig trachea. Almost all of the jugular neurons expressed the TTX-sensitive channel Na V 1.7 along with TTX-resistant Na V 1.8 and Na V 1.9. Tracheal nodose neurons also expressed Na V 1.7 but, less frequently, Na V 1.8 and Na V 1.9. Na V 1.6 were expressed in ∼40% of the jugular and 25% of nodose tracheal neurons. Other Na V 1 α subunits were only rarely expressed. Single fibre recordings were made from the vagal nodose and jugular nerve fibres innervating the trachea or lung in the isolated perfused vagally-innervated preparations that allowed for selective drug delivery to the nerve terminal compartment (AP initiation) or to the desheathed vagus nerve (AP conduction). AP initiation in
Anomalous length dependence of the conductance of graphene nanoribbons with zigzag edges
Bilić, Ante
2013-01-01
Charge transport through two sets of symmetric graphene nanoribbons with zigzag shaped edges in a two-terminal device has been investigated, using density functional theory combined with the non-equilibrium Green\\'s function method. The conductance has been explored as a function of nanoribbon length, bias voltage, and the strength of terminal coupling. The set of narrower nanoribbons, in the form of thiolated linear acenes, shows an anomalous length dependence of the conductance, which at first exhibits a drop and a minimum, followed by an evident rise. The length trend is shown to arise because of a gradual transformation in the transport mechanism, which changes from being governed by a continuum of out-of-plane π type and in-plane state channels to being fully controlled by a single, increasingly more resonant, occupied π state channel. For the set of nanoribbons with a wider profile, a steady increase is observed across the whole length range, owing to the absence of the former transport mechanism. The predicted trends are confirmed by the inclusion of self-interaction correction in the calculations. For both sets of nanoribbons the replacement of the strongly coupling thiol groups by weakly bonding phenathroline has been found to cause a strong attenuation with the length and a generally low conductance. © 2013 American Institute of Physics.
International Nuclear Information System (INIS)
Liao Youhao; Rao Mumin; Li Weishan; Tan Chunlin; Yi Jin; Chen Lang
2009-01-01
Fumed silica was used as a dopant in the preparation of poly(methyl methacrylate-acrylonitrile-vinyl acetate) (P(MMA-AN-VAc)) to improve the ionic conductivity of the P(MMA-AN-VAc)-based gel polymer electrolyte (GPE). The performance of the P(MMA-AN-VAc) membrane and its GPE for lithium ion battery use were studied by XRD, SEM, TGA, LSV, CA, EIS, and charge/discharge test. It is found that the doping of fumed silica in the P(MMA-AN-VAc) changes the membrane from semi-crystal to amorphous state and the pore structure of the membrane. By the doping of 10 wt.% fumed silica in the membrane, the porosity of the membrane increases with the pore dispersed more uniformly and interconnected and having higher electrolyte uptake, resulting in the improvement in ionic conductivity of the GPE from 3.48 x 10 -3 to 5.13 x 10 -3 S cm -1 at ambient temperature. On the other hand, the thermal stability of the membrane, the electrochemical stability of the GPE, and the cyclic performance of the battery are also improved.
Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
Fabrication of Monolithic Dye-Sensitized Solar Cell Using Ionic Liquid Electrolyte
Directory of Open Access Journals (Sweden)
Seigo Ito
2012-01-01
Full Text Available To improve the durability of dye-sensitized solar cells (DSCs, monolithic DSCs with ionic liquid electrolyte were studied. Deposited by screen printing, a carbon layer was successfully fabricated that did not crack or peel when annealing was employed beforehand. Optimized electrodes exhibited photovoltaic characteristics of 0.608 V open-circuit voltage, 6.90 cm−2 mA short-circuit current, and 0.491 fill factor, yielding 2.06% power conversion efficiency. The monolithic DSC using ionic liquid electrolyte was thermally durable and operated stably for 1000 h at 80°C.
Resistance-Based Ceramic Ho123 Ionic Conductor for Oxygen Gas Sensing
Idrus, L. H.; Yahya, A. K.
2009-07-01
Oxygen sensing properties of HoBa2Cu3O7-δ ceramic rods utilizing hot-spot phenomenon have been characterized. The rods were prepared from high purity oxides using the conventional solid-state reaction method. I-V characterization showed increase in output current with voltage before the appearance of the hot spot. After the appearance of the hot-spot, the output current strongly depended on oxygen partial pressure. The rod showed stable sensing characteristics with good electrical stability and reproducibility with higher sensitivity at low oxygen partial pressure. The sensing property is associated with the absorption of oxygen and dissociation into holes and oxide ions. Ho123 is more sensitive at pO2 below 20% compared to Er123 possibly due to differences in oxygen activation energy related to RE ionic radius.
Resistance-Based Ceramic Ho123 Ionic Conductor for Oxygen Gas Sensing
International Nuclear Information System (INIS)
Idrus, L. H.; Yahya, A. K.
2009-01-01
Oxygen sensing properties of HoBa 2 Cu 3 O 7-δ ceramic rods utilizing hot-spot phenomenon have been characterized. The rods were prepared from high purity oxides using the conventional solid-state reaction method. I-V characterization showed increase in output current with voltage before the appearance of the hot spot. After the appearance of the hot-spot, the output current strongly depended on oxygen partial pressure. The rod showed stable sensing characteristics with good electrical stability and reproducibility with higher sensitivity at low oxygen partial pressure. The sensing property is associated with the absorption of oxygen and dissociation into holes and oxide ions. Ho123 is more sensitive at pO 2 below 20% compared to Er123 possibly due to differences in oxygen activation energy related to RE ionic radius.
Physicochemical characterization of a new family of small alkyl phosphonium imide ionic liquids
International Nuclear Information System (INIS)
Hilder, M.; Girard, G.M.A.; Whitbread, K.; Zavorine, S.; Moser, M.; Nucciarone, D.; Forsyth, M.; MacFarlane, D.R.; Howlett, P.C.
2016-01-01
Despite their promising properties, phosphonium based ionic liquids have attracted little attention as compared to their nitrogen-based cation counterparts. This study focuses on the properties of a family of small phosphonium imide ionic liquids, as well as the effect of lithium salt addition to these. The 6 ionic liquids were either alkyl, cyclic or nitrile functionalised phoshonium cations with bis(trifluoromethanesulfonyl)imide, NTf_2, or bis(fluorosulfonyl)imide (FSI) as anion. Amongst the properties investigated were ionic conductivity, viscosity, thermal behaviour, electrochemical stability and the reversibility of electrochemical lithium cycling. All ionic liquids showed very promising properties e.g. having low transition temperatures, high electrochemical stabilities, low viscosities and high conductivities. Particularly the trimethyl phosphonium ionic liquids showed some of the highest conductivities reported amongst phosphonium ionic liquids generally. The combination of electrochemical stability, high conductivity and reversible lithium cycling makes them promising systems for energy storage devices such as lithium batteries.
Cantrell, A R; Scheuer, T; Catterall, W A
1999-07-01
Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.
Fast Measurement of Methanol Concentration in Ionic Liquids by Potential Step Method
Directory of Open Access Journals (Sweden)
Michael L. Hainstock
2015-01-01
Full Text Available The development of direct methanol fuel cells required the attention to the electrolyte. A good electrolyte should not only be ionic conductive but also be crossover resistant. Ionic liquids could be a promising electrolyte for fuel cells. Monitoring methanol was critical in several locations in a direct methanol fuel cell. Conductivity could be used to monitor the methanol content in ionic liquids. The conductivity of 1-butyl-3-methylimidazolium tetrafluoroborate had a linear relationship with the methanol concentration. However, the conductivity was significantly affected by the moisture or water content in the ionic liquid. On the contrary, potential step could be used in sensing methanol in ionic liquids. This method was not affected by the water content. The sampling current at a properly selected sampling time was proportional to the concentration of methanol in 1-butyl-3-methylimidazolium tetrafluoroborate. The linearity still stood even when there was 2.4 M water present in the ionic liquid.
Ion transport properties of lithium ionic liquids and their ion gels
International Nuclear Information System (INIS)
Shobukawa, Hitoshi; Tokuda, Hiroyuki; Susan, Md. Abu Bin Hasan; Watanabe, Masayoshi
2005-01-01
A new series of lithium ionic liquids were prepared by introducing of two electron-withdrawing trifluoroacetyl groups in borate salts containing two methoxy-oligo(ethylene oxide) groups in the structures. Successive substitution reactions of oligo-ethylene glycol monomethyl ether and trifluroacetic acid from LiBH 4 yielded the lithium salts, which were clear and colorless liquids at room temperature. The fundamental physicochemical properties, such as density, thermal property, viscosity, ionic conductivity, self-diffusion coefficients, and electrochemical stability, were measured. The lithium ionic liquids had self-dissociation ability and conducted ions even in the absence of organic solvents. New polymer electrolytes, named 'ion gels', were prepared by radical cross-linking reactions of a poly(ethylene oxide-co-propylene oxide)tri-acrylate macromonomer in the presence the lithium ionic liquid. An increase in the glass transition temperatures (T g ) of the ion gels was very small even with increasing lithium ionic liquid concentration, and the T g 's were lower than that of the ionic liquid itself. The ionic conductivity of the ion gels surpassed that of the lithium ionic liquid in the bulk at certain compositions
DEFF Research Database (Denmark)
Andersen, Niels Hessel; Clausen, Kurt Nørgaard; Kjems, Jørgen
1986-01-01
The ionic disorder in single crystals of the fluorite-type solid solutions Ba1-xLaxF2+x (with x=0.209 and x=0.492) has been studied in the temperature range from room temperature to 800 degrees C by diffuse neutron scattering, ionic conductivity, and specific heat measurements. From the diffuse...... neutron scattering it was found that the disorder was dominated by 222 clusters, which at low temperatures (T>10-10s), in agreement with NMB results which suggest a jump frequency below 75 MHz. The temperatures at which the steepest slopes are found in the loss of correlations and in the conductivity...... coincide at approximately 650 degrees C. At this temperature no clear anomaly is observed in the specific heat. Based on these findings the authors propose a conduction mechanisms where F- ions are moving through the lattice by means of rearrangements of the 222 clusters....
Ionic currents and charge movements in organ-cultured rat skeletal muscle.
Hollingworth, S; Marshall, M W; Robson, E
1984-12-01
The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.
Ionic Liquid-Doped Gel Polymer Electrolyte for Flexible Lithium-Ion Polymer Batteries
Zhang, Ruisi; Chen, Yuanfen; Montazami, Reza
2015-01-01
Application of gel polymer electrolytes (GPE) in lithium-ion polymer batteries can address many shortcomings associated with liquid electrolyte lithium-ion batteries. Due to their physical structure, GPEs exhibit lower ion conductivity compared to their liquid counterparts. In this work, we have investigated and report improved ion conductivity in GPEs doped with ionic liquid. Samples containing ionic liquid at a variety of volume percentages (vol %) were characterized for their electrochemical and ionic properties. It is concluded that excess ionic liquid can damage internal structure of the batteries and result in unwanted electrochemical reactions; however, samples containing 40–50 vol % ionic liquid exhibit superior ionic properties and lower internal resistance compared to those containing less or more ionic liquids.
Directory of Open Access Journals (Sweden)
Darya V. Radziuk
2011-03-01
Full Text Available The conductivity mechanism is studied in the LiCF3SO3-doped polyethylene oxide by monitoring the vibrations of sulfate groups and mobility of Li+ ion along the polymeric chain at different EO/Li molar ratios in the temperature range from 16 to 90 °С. At the high EO/Li ratio (i.e., 30, the intensity of bands increases and a triplet appears at 1,045 cm−1, indicating the presence of free anions, ionic pairs and aggregates. The existence of free ions in the polymeric electrolyte is also proven by the red shift of bands in Raman spectra and a band shift to the low frequency Infra-red region at 65 < T < 355 °С. Based on quantum mechanical modeling, (method MNDO/d, the energies (minimum and maximum correspond to the most probable and stable positions of Li+ along the polymeric chain. At room temperature, Li+ ion overcomes the intermediate state (minimum energy through non-operating transitions (maximum energy due to permanent intrapolymeric rotations (rotation of C, H and O atoms around each other. In solid electrolyte (Li2SO4 the mobility of Li+ ions increases in the temperature range from 20 to 227 °С, yielding higher conductivity. The results of the present work can be practically applied to a wide range of compact electronic devices, which are based on polymeric or solid electrolytes.
There’s no place like Ohm: conduction in oxide thin films
International Nuclear Information System (INIS)
Scott, J F
2014-01-01
A pedagogical essay is given that alerts researchers to the errors inherent in assigning linear I(V) current–voltage dependences to Ohmic conduction. Such a linear I(V) is necessary but not sufficient, since other mechanisms, including Simmons’ modification of the basic Schottky emission theory, also give linear I(V) at small applied voltages. Discrimination among Ohmic, Schottky, space-charge limited, and other models requires accurate thickness dependence I(d) data, where for Ohmic conduction I = a/d, whereas for interface-limited mechanisms such as Simmons/Schottky, I is nearly independent of d. (fast track communications)
Electrical conductivity in polyacrylonitrile and perbunan
International Nuclear Information System (INIS)
Migahed, M.D.; Bakr, N.A.; Tawansi, A.
1981-07-01
The electrical conduction in Ag-PAN-Ag and Ag-NBR-Ag sandwich samples is studied measuring the dependence of current on the applied voltage and temperature. The conduction mechanism depends on the polymer type. A bulk polarization contribution is suggested in the conduction mechanism at high temperatures besides the Schottky emission in the case of PAN and simple carrier jump model in the case of NBR at room temperature. NBR(28) is proved to be more semiconducting than both NBR(38) and PAN. This is attributed to the lowering of the nitrile group content in NBR(28). (author)
Zinc-dependent multi-conductance channel activity in mitochondria isolated from ischemic brain.
Bonanni, Laura; Chachar, Mushtaque; Jover-Mengual, Teresa; Li, Hongmei; Jones, Adrienne; Yokota, Hidenori; Ofengeim, Dimitry; Flannery, Richard J; Miyawaki, Takahiro; Cho, Chang-Hoon; Polster, Brian M; Pypaert, Marc; Hardwick, J Marie; Sensi, Stefano L; Zukin, R Suzanne; Jonas, Elizabeth A
2006-06-21
Transient global ischemia is a neuronal insult that induces delayed cell death. A hallmark event in the early post-ischemic period is enhanced permeability of mitochondrial membranes. The precise mechanisms by which mitochondrial function is disrupted are, as yet, unclear. Here we show that global ischemia promotes alterations in mitochondrial membrane contact points, a rise in intramitochondrial Zn2+, and activation of large, multi-conductance channels in mitochondrial outer membranes by 1 h after insult. Mitochondrial channel activity was associated with enhanced protease activity and proteolytic cleavage of BCL-xL to generate its pro-death counterpart, deltaN-BCL-xL. The findings implicate deltaN-BCL-xL in large, multi-conductance channel activity. Consistent with this, large channel activity was mimicked by introduction of recombinant deltaN-BCL-xL to control mitochondria and blocked by introduction of a functional BCL-xL antibody to post-ischemic mitochondria via the patch pipette. Channel activity was also inhibited by nicotinamide adenine dinucleotide, indicative of a role for the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane. In vivo administration of the membrane-impermeant Zn2+ chelator CaEDTA before ischemia or in vitro application of the membrane-permeant Zn2+ chelator tetrakis-(2-pyridylmethyl) ethylenediamine attenuated channel activity, suggesting a requirement for Zn2+. These findings reveal a novel mechanism by which ischemic insults disrupt the functional integrity of the outer mitochondrial membrane and implicate deltaN-BCL-xL and VDAC in the large, Zn2+-dependent mitochondrial channels observed in post-ischemic hippocampal mitochondria.
Zhang, Yanxiang; Chen, Yu; Yan, Mufu
2017-07-01
The open circuit voltage (OCV) of solid oxide fuel cells is generally overestimated by the Nernst equation and the Wagner equation, due to the polarization losses at electrodes. Considering both the electronic conduction of electrolyte and the electrode polarization losses, we express the OCV as an implicit function of the characteristic oxygen pressure of electrolyte (p* [atm], at which the electronic and ionic conductivities are the same), and the relative polarization resistance of electrodes (rc = Rc/Ri and ra = Ra/Ri, where Ri/c/a [Ωcm2] denotes the ionic resistance of electrolyte, and the polarization resistances of cathode and anode, respectively). This equation approaches to the Wagner equation when the electrodes are highly active (rc and ra → 0), and approaches to the Nernst equation when the electrolyte is a purely ionic conductor (p* → 0). For the fuel cells whose OCV is well below the prediction of the Wagner equation, for example with thin doped ceria electrolyte, it is demonstrated that the combination of OCV and impedance spectroscopy measurements allows the determination of p*, Rc and Ra. This equation can serve as a simple yet powerful tool to study the internal losses in the cell under open circuit condition.
Directory of Open Access Journals (Sweden)
Guoqiang Zhong
2017-05-01
Full Text Available In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2 is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge of the crossing molecules.
Zhong, Guoqiang; Akoum, Nazem; Appadurai, Daniel A.; Hayrapetyan, Volodya; Ahmed, Osman; Martinez, Agustin D.; Beyer, Eric C.; Moreno, Alonso P.
2017-01-01
In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2) is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj) for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge) of the crossing molecules. PMID:28611680
Fernandez, Fernando R.; Malerba, Paola; White, John A.
2015-01-01
The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971
Chakrabarti, Somsubhra; Ginnaram, Sreekanth; Jana, Surajit; Wu, Zong-Yi; Singh, Kanishk; Roy, Anisha; Kumar, Pankaj; Maikap, Siddheswar; Qiu, Jian-Tai; Cheng, Hsin-Ming; Tsai, Ling-Na; Chang, Ya-Ling; Mahapatra, Rajat; Yang, Jer-Ren
2017-07-05
Negative voltage modulated multi-level resistive switching with quantum conductance during staircase-type RESET and its transport characteristics in Cr/BaTiO x /TiN structure have been investigated for the first time. The as-deposited amorphous BaTiO x film has been confirmed by high-resolution transmission electron microscopy. X-ray photo-electron spectroscopy shows different oxidation states of Ba in the switching material, which is responsible for tunable more than 10 resistance states by varying negative stop voltage owing to slow decay value of RESET slope (217.39 mV/decade). Quantum conductance phenomenon has been observed in staircase RESET cycle of the memory devices. By inspecting the oxidation states of Ba + and Ba 2+ through measuring H 2 O 2 with a low concentration of 1 nM in electrolyte/BaTiO x /SiO 2 /p-Si structure, the switching mechanism of each HRS level as well as the multi-level phenomenon has been explained by gradual dissolution of oxygen vacancy filament. Along with negative stop voltage modulated multi-level, current compliance dependent multi-level has also been demonstrated and resistance ratio up to 2000 has been achieved even for a thin (voltage switching curve has been simulated as well. Hence, multi-level resistive switching of Cr/BaTiO x /TiN structure implies the promising applications in high dense, multistate non-volatile memories in near future.
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
International Nuclear Information System (INIS)
Nazarpour, S.; Langenberg, E.; Jambois, O.; Ferrater, C.; Garcia-Cuenca, M.V.; Polo, M.C.; Varela, M.
2009-01-01
Electrical conductivity dependence of thin metallic films of Au and Pd over the different perovskites was investigated. It is found from electrical properties that crystallographic growth orientation of Au and Pd thin layers attained from X-ray diffraction results indicate the slop of current (I)-voltage (V) plots. Besides, surface morphology and topography was considered using Field Emission Scanning Electron Microscopy and Atomic Force Microscopy, respectively. Obtained results showed the Stranski-Krastanov growth of the Pd and Au. Indeed, diminishing of the root-mean-square roughness of Pd/BiMnO 3 /SrTiO 3 following by Au deposition should be concerned due to growth of Au onto the crack-like parts of the substrate. These crack-like parts appeared due to parasitic phases of the Bi-Mn-O system mainly Mn 3 O 4 (l 0 l) and Mn 3 O 4 (0 0 4 l). The different response in the electrical properties of heterostructures suggests that electrical conductance of the Au and Pd thin metallic films have the crystallographic orientation dependence. Furthermore, polycrystallinity of the thin metallic films are desired in electrode applications due to increase the conductivity of the metallic layers.
Ionic Liquid-Doped Gel Polymer Electrolyte for Flexible Lithium-Ion Polymer Batteries
Directory of Open Access Journals (Sweden)
Ruisi Zhang
2015-05-01
Full Text Available Application of gel polymer electrolytes (GPE in lithium-ion polymer batteries can address many shortcomings associated with liquid electrolyte lithium-ion batteries. Due to their physical structure, GPEs exhibit lower ion conductivity compared to their liquid counterparts. In this work, we have investigated and report improved ion conductivity in GPEs doped with ionic liquid. Samples containing ionic liquid at a variety of volume percentages (vol % were characterized for their electrochemical and ionic properties. It is concluded that excess ionic liquid can damage internal structure of the batteries and result in unwanted electrochemical reactions; however, samples containing 40–50 vol % ionic liquid exhibit superior ionic properties and lower internal resistance compared to those containing less or more ionic liquids.
Ionic liquids and their hosting by polymers for HT-PEMFC membranes
Energy Technology Data Exchange (ETDEWEB)
Hana, M.; Martinez, M.; Cointeaux, L.; Lepretre, J.C. [LEPMI-ELSA, PHELMA, UMR 5631, CNRS, Grenoble INP, UJF, Saint-Martin-d' Heres (France); Molmeret, Y.; El Kissi, N. [Laboratoire de Rheologie, UMR 5520 CNRS-INPG-UJF, ENSHMG, Grenoble (France); Teles, J.; Judeinstein, P. [Institut de Chimie Moleculaire et des Materiaux d' Orsay, CNRS 8182, Orsay (France); Iojoiu, C.; Sanchez, J.Y.
2010-10-15
The paper deals with proton-conducting ionic liquids (PCILs) for use, in combination with functional polymers, in membranes operating in high temperature PEMFC. Monoammoniums derived from monoamines and half-neutralised diamines were investigated in the form of triflates. Promising results were obtained with the half-neutralised diamine-based PCIL, its conduction being governed by both Grotthuss-like and vehicular mechanisms, the respective contributions of which depend on temperature. In addition, their blending with Nafion results in a distinct reinforcement of the membrane. (Abstract Copyright [2010], Wiley Periodicals, Inc.)
Thermophysical Properties of Nanoparticle-Enhanced Ionic Liquids (NEILs) Heat-Transfer Fluids
Energy Technology Data Exchange (ETDEWEB)
Fox, Elise B.; Visser, Ann E.; Bridges, Nicholas J.; Amoroso, Jake W.
2013-06-20
An experimental investigation was completed on nanoparticle enhanced ionic liquid heat transfer fluids as an alternative to conventional organic based heat transfer fluids (HTFs). These nanoparticle-based HTFs have the potential to deliver higher thermal conductivity than the base fluid without a significant increase in viscosity at elevated temperatures. The effect of nanoparticle morphology and chemistry on thermophysical properties was examined. Whisker shaped nanomaterials were found to have the largest thermal conductivity temperature dependence and were also less likely to agglomerate in the base fluid than spherical shaped nanomaterials.