WorldWideScience

Sample records for voltage-dependent charge movement

  1. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  2. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  3. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  4. Charge movement and depolarization-contraction coupling in arthropod vs. vertebrate skeletal muscle.

    OpenAIRE

    Scheuer, T; Gilly, W F

    1986-01-01

    Voltage-dependent charge movement has been characterized in arthropod skeletal muscle. Charge movement in scorpion (Centuroides sculpturatus) muscle is distinguishable from that in vertebrate skeletal muscle by criteria of kinetics, voltage dependence, and pharmacology. The function of scorpion charge movement is gating of calcium channels in the sarcolemma, and depolarization-contraction coupling relies on calcium influx through these channels.

  5. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  6. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  7. Charge Movement in a Fast Twitch Skeletal Muscle from Rat

    OpenAIRE

    Simon, B. J.; Beam, K. G.

    1983-01-01

    Voltage-dependent charge movement in the rat omohyoid muscle was investigated using the three microelectrode voltage clamp technique. The charge that moved during a depolarization from the holding potential (-90 mV) to the test potential, V, increased with increasing V, saturating around 0 mV. The charge vs. voltage relationship was well fitted by Q = Qmax/{1 + exp[-(V - V)/k]}, with Qmax = 28.5 nC/μF, V = -34.2 mV, and k = 8.7 mV. Repolarization of the fiber from the test potential back to t...

  8. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  9. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  10. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  11. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  12. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  13. The electrically silent Kv6.4 subunit confers hyperpolarized gating charge movement in Kv2.1/Kv6.4 heterotetrameric channels.

    Directory of Open Access Journals (Sweden)

    Elke Bocksteins

    Full Text Available The voltage-gated K(+ (Kv channel subunit Kv6.4 does not form functional homotetrameric channels but co-assembles with Kv2.1 to form functional Kv2.1/Kv6.4 heterotetrameric channels. Compared to Kv2.1 homotetramers, Kv6.4 exerts a ~40 mV hyperpolarizing shift in the voltage-dependence of Kv2.1/Kv6.4 channel inactivation, without a significant effect on activation gating. However, the underlying mechanism of this Kv6.4-induced modulation of Kv2.1 channel inactivation, and whether the Kv6.4 subunit participates in the voltage-dependent gating of heterotetrameric channels is not well understood. Here we report distinct gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels, compared to Kv2.1 homotetramers, as revealed by gating current recordings from mammalian cells expressing these channels. The gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels displayed an extra component around the physiological K(+ equilibrium potential, characterized by a second sigmoidal relationship of the voltage-dependence of gating charge movement. This distinct gating charge displacement reflects movement of the Kv6.4 voltage-sensing domain and has a voltage-dependency that matches the hyperpolarizing shift in Kv2.1/Kv6.4 channel inactivation. These results provide a mechanistic basis for the modulation of Kv2.1 channel inactivation gating kinetics by silent Kv6.4 subunits.

  14. The effects of tetracaine on charge movement in fast twitch rat skeletal muscle fibres.

    Science.gov (United States)

    Hollingworth, S; Marshall, M W; Robson, E

    1990-02-01

    1. The effects of tetracaine, a local anaesthetic that inhibits muscle contraction, on membrane potential and intramembrane charge movements were investigated in fast twitch rat muscle fibres (extensor digitorum longus). 2. The resting membrane potentials of surface fibres from muscles bathed in isotonic Ringer solution containing 2 mM-tetracaine were well maintained, but higher concentrations of tetracaine caused a time-dependent fall of potential. Muscle fibres bathed in hypertonic solutions containing 2 mM-tetracaine were rapidly depolarized. In both isotonic and hypertonic solutions, the depolarizing effect of tetracaine could not be reversed. 3. Charge movement measurements were made using the middle-of-the-fibre voltage clamp technique. The voltage dependence of charge movements measured in cold isotonic solutions was well fitted by a Boltzmann distribution (Q(V) = Qmax/(1 + exp(-(V-V)/k] where Qmax = 37.3 +/- 2.8 nC muF-1, V = -17.9 +/- 1.2 mV and k = 12.6 +/- 0.8 mV (n = 6, 2 degrees C; means +/- S.E. of means). Similar values were obtained when 2 mM-tetracaine was added to the isotonic bathing fluid (Qmax = 40.6 +/- 2.3 nC microF-1, V = -14.1 +/- 1.3 mV, k = 15.3 +/- 0.8 mV; n = 8, 2 degrees C). 4. Charge movements measured around mechanical threshold in muscle fibres bathed in hypertonic solutions were reduced when 2 mM-tetracaine was added to the bathing fluid. The tetracaine-sensitive component of charge was well fitted with an unconstrained Boltzmann distribution which gave: Qmax = 7.5 nC microF-1, V = -46.5 mV, k = 5.5 mV. The e-fold rise of the foot of the curve was 9.3 mV.

  15. Two interesting cases in spatial charge movement

    International Nuclear Information System (INIS)

    Novellino, R.A.

    1983-01-01

    The relation between current and voltage in a dielectric under radiation is obtained, assuming only one carrier to be mobile, recombination and injection of the mobile charge from the electrode. For this last boundary condition a constant charge density at the electrode-dielectric interface was chosen. The other problem treated is a generalization of the classic transient problem studied by Many-Rakavy, using the constant charge density boundary condition. Analytic solutions were obtained during the first transit time and computed ones for larger times. Some attention was given to the damped current oscilations approaching the steady state value. (Author) [pt

  16. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  17. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  18. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  19. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  20. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  1. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  2. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  3. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  4. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  5. Movement of a charged particle beam in the Earth magnetosphere

    International Nuclear Information System (INIS)

    Veselovskij, I.S.

    1977-01-01

    The motion of a charged particle beam injected into the Earth magnetosphere in a dipole magnetic field was investigated. Examined were the simplest stationary distributions of particles. The evolution of the distribution function after pulse injection of the beam into the magnetosphere was studied. It was shown that the pulse shape depends on its starting duration. A long pulse spreads on the base and narrows on the flat top with the distance away from the point of injection. A short pulse spreads both on the base and along the height. The flat top is not present. An analytical expression for the pulse shape as a time function is given

  6. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  7. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  8. A comparative study of charge movement in rat and frog skeletal muscle fibres.

    Science.gov (United States)

    Hollingworth, S; Marshall, M W

    1981-12-01

    1. The middle of the fibre voltage--clamp technique (Adrian & Marshall, 1977), modified where necessary for electrically short muscle fibres, has been used to measure non-linear charge movements in mammalian fast twitch (rat extensor digitorum longus), mammalian slow twitch (rat soleus) and frog (sartorius) muscles. 2. The maximum amount of charge moved in mammalian fast twitch muscle at 2 degrees C in hypertonic solution, was 3--5 times greater than in slow twitch muscle. The voltage distribution of fast twitch charge was 10--15 mV more positive when compared to slow twitch. 3. In both mammalian muscle types hypertonic Ringer solution negatively shifted the voltage distribution of charge some 6 mV. The steepness of charge moved around mechanical threshold was unaffected by hypertonicity. 4. The amount of charge in frog sartorius fibres at 2 degrees C in hypertonic solution was about half of that in rat fast twitch muscle; the voltage distribution of the frog charge was similar to rat soleus muscle. 5. Warming between 2 and 15 degrees C had no effect on either the amount of steady-state distribution of charge in mammalian or frog muscles. 6. At 2 degrees C, the kinetics of charge movement in fast and slow twitch mammalian muscles were similar and 2--3 times faster than frog muscle at the same temperature. In fast and slow mammalian fibres at 2 degrees C similar times were taken to shift the same fractions of the total amount of charge. The Q10 of charge movement kinetics was between 1.2 and 2.0 in the three muscles studied.

  9. Charge movements and transverse tubular ultrastructure in organ cultured skeletal muscle.

    Science.gov (United States)

    Cullen, M J; Hollingworth, S; Marshall, M W; Robson, E

    1990-04-01

    A study was made of charge movements and the transverse tubular systems in rat EDL and soleus muscle fibres maintained for up to five days in organ culture. In the cultured EDL muscle the maximum amount of charge moved was about one third of that in innervated muscle. Charge movements in innervated soleus fibres are small, less than 10 nC/microF, and difficult to resolve. They remain small following organ culturing. The ultrastructural study examined the concentration of junctional feet because of their proposed key role in excitation-contraction coupling. The general architecture of the triads and the spacing of the feet in both muscle types was largely unchanged by culturing. In cultured EDL muscles the small changes in feet concentration did not parallel the large fall in charge movement. The results reported here support a previous conclusion that, in mammalian muscle, there is not a simple relation between charge and feet. The stimulation of cultured soleus muscles with a fast twitch pattern of electrical activity produced no observable changes in morphology.

  10. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  11. Ionic currents and charge movements in organ-cultured rat skeletal muscle.

    Science.gov (United States)

    Hollingworth, S; Marshall, M W; Robson, E

    1984-12-01

    The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.

  12. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  13. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  14. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  15. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  16. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  17. Understanding optically stimulated charge movement in quartz and feldspar using time-resolved measurements

    International Nuclear Information System (INIS)

    Ankjaergaard, C.

    2010-02-01

    Thermoluminescence (TL) and optically stimulated luminescence (OSL) from quartz and feldspar are widely used in accident dosimetry and luminescence dating. In order to improve already existing methods or to develop new methods towards extending the current limits of the technique, it is important to understand the charge movement within these materials. Earlier studies have primarily focussed on examination of the trap behaviour; however, this only tells half of the story as OSL is a combination of charge stimulation and recombination. By using time-resolved OSL (TR-OSL), one can directly examine the recombination route(s), and thus obtain insight into the other half of the process involved in luminescence emission. This thesis studies the TR-OSL and optically stimulated phosphorescence signals from quartz and feldspars spanning several orders of magnitude in time (few ns to the seconds time scale) in order to identify various charge transport mechanisms in the different time regimes. The techniques employed are time-resolved OSL, continuous-wave OSL, TL, optically stimulated exo-electron (OSE) emission and time-resolved OSE. These different techniques are used in combination with variable thermal or optical stimulation energy. The thesis first delves into three main methodological developments, namely (i) research and development of the equipment for TR-OSL measurements, (ii) finding the best method for multiple-exponential analysis of a TR-OSL curve, and (iii) optimisation of the pulsing configuration for the best separation of quartz OSL from a mixed quarts-feldspar sample. It then proceeds to study the different charge transport mechanisms subsequent to an optical stimulation pulse in quartz and feldspars. The results obtained for quartz conclude that the main lifetime component in quartz represents an excited state lifetime of the recombination centre, and the more slowly decaying components on the millisecond to seconds time scale arise from charge recycling

  18. Understanding optically stimulated charge movement in quartz and feldspar using time-resolved measurements

    Energy Technology Data Exchange (ETDEWEB)

    Ankjaergaard, C.

    2010-02-15

    Thermoluminescence (TL) and optically stimulated luminescence (OSL) from quartz and feldspar are widely used in accident dosimetry and luminescence dating. In order to improve already existing methods or to develop new methods towards extending the current limits of the technique, it is important to understand the charge movement within these materials. Earlier studies have primarily focussed on examination of the trap behaviour; however, this only tells half of the story as OSL is a combination of charge stimulation and recombination. By using time-resolved OSL (TR-OSL), one can directly examine the recombination route(s), and thus obtain insight into the other half of the process involved in luminescence emission. This thesis studies the TR-OSL and optically stimulated phosphorescence signals from quartz and feldspars spanning several orders of magnitude in time (few ns to the seconds time scale) in order to identify various charge transport mechanisms in the different time regimes. The techniques employed are time-resolved OSL, continuous-wave OSL, TL, optically stimulated exo-electron (OSE) emission and time-resolved OSE. These different techniques are used in combination with variable thermal or optical stimulation energy. The thesis first delves into three main methodological developments, namely (i) research and development of the equipment for TR-OSL measurements, (ii) finding the best method for multiple-exponential analysis of a TR-OSL curve, and (iii) optimisation of the pulsing configuration for the best separation of quartz OSL from a mixed quarts-feldspar sample. It then proceeds to study the different charge transport mechanisms subsequent to an optical stimulation pulse in quartz and feldspars. The results obtained for quartz conclude that the main lifetime component in quartz represents an excited state lifetime of the recombination centre, and the more slowly decaying components on the millisecond to seconds time scale arise from charge recycling

  19. Influence of Low Speed Rolling Movement on High Electrical Breakdown for Water Dielectric with Microsecond Charging

    International Nuclear Information System (INIS)

    Zhang Zicheng; Zhang Jiande; Yang Jianhua

    2006-01-01

    By means of a coaxial apparatus, high electrical breakdown experiments are carried out in the rest state and the low speed rolling state with microsecond charging and the experimental results are analyzed. The conclusions are: (1) the breakdown stress of water dielectric in the rolling state is in good agreement with that in Martin formula, and so is that in the rest state; (2) the breakdown stress of water dielectric in the rolling state is about 5% higher than that in the rest state; (3) the results simulated with ANSYS demonstrate that the breakdown stress of water dielectric decreases when the bubbles appear near the surface of electrodes; (4) the primary mechanism to increase the breakdown stress of water dielectric in the rolling state is that the bubbles are driven away and the number of bubbles near the surface of electrodes is decreased by rolling movement

  20. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  1. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  2. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  3. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  4. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  5. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  6. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  7. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  8. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  9. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  10. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  11. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  12. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  13. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  14. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  15. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  16. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  17. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  18. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  19. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  20. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  1. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  2. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  3. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  4. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  5. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  6. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  7. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  8. Understanding optically stimulated charge movement in quartz and feldspar using time-resolved measurements

    DEFF Research Database (Denmark)

    Ankjærgaard, Christina

    . Although, results are only presented for some quartz and feldspar samples, they were found to be very similar within the each group during the course of this work.Thermoluminescence (TL) and optically stimulated luminescence (OSL) from quartz and feldspar are widely used in accident dosimetry...... stimulation energy. The thesis first delves into three main methodological developments, namely (i) research and development of the equipment for TR-OSL measurements, (ii) finding the best method for multiple-exponential analysis of a TR-OSL curve, and (iii) optimisation of the pulsing configuration...... of the equipment for TR-OSL measurements, (ii) finding the best method for multiple-exponential analysis of a TR-OSL curve, and (iii) optimisation of the pulsing configuration for the best separation of quartz OSL from a mixed quarts-feldspar sample. It then proceeds to study the different charge transport...

  9. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  10. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  11. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2008-06-01

    Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  13. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  14. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  15. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  16. A common pathway for charge transport through voltage-sensing domains.

    Science.gov (United States)

    Chanda, Baron; Bezanilla, Francisco

    2008-02-07

    Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

  17. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  18. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  20. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  1. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  2. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  3. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  4. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  5. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  6. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  7. Effect of a radial space-charge field on the movement of particles in a magneto-static field and under the influence of a circularly polarized wave

    International Nuclear Information System (INIS)

    Buffa, A.

    1967-06-01

    The effect of a circularly polarized wave on a cylindrical plasma in a axial magnetostatic field and a radial space-charge field proportional to r is studied. Single particle motion is considered. The electrostatic field produces a shift in the cyclotron resonance frequency and,in case of high charge density, a radial movement of the off-resonance particles. In these conditions a radio-frequency-particle resonance is also possible called 'drift-resonance'. The drift resonance can be produced, with whistler mode, and may be employed in ion acceleration. Afterwards parametrical resonances produced by space-charge field oscillations and collisional limits of theory are studied. Cases in which ion acceleration is possible are considered on the basis of a quantitative analysis of results. (author) [fr

  8. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  9. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  10. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  11. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  12. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  13. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  14. Charge immobilization of the voltage sensor in domain IV is independent of sodium current inactivation.

    Science.gov (United States)

    Sheets, Michael F; Hanck, Dorothy A

    2005-02-15

    Recovery from fast inactivation in voltage-dependent Na+ channels is associated with a slow component in the time course of gating charge during repolarization (i.e. charge immobilization), which results from the slow movement of the S4 segments in domains III and IV (S4-DIII and S4-DIV). Previous studies have shown that the non-specific removal of fast inactivation by the proteolytic enzyme pronase eliminated charge immobilization, while the specific removal of fast inactivation (by intracellular MTSET modification of a cysteine substituted for the phenylalanine in the IFM motif, ICMMTSET, in the inactivation particle formed by the linker between domains III and IV) only reduced the amount of charge immobilization by nearly one-half. To investigate the molecular origin of the remaining slow component of charge immobilization we studied the human cardiac Na+ channel (hH1a) in which the outermost arginine in the S4-DIV, which contributes approximately 20% to total gating charge (Qmax), was mutated to a cysteine (R1C-DIV). Gating charge could be fully restored in R1C-DIV by exposure to extracellular MTSEA, a positively charged methanethiosulphonate reagent. The RIC-DIV mutation was combined with ICMMTSET to remove fast inactivation, and the gating currents of R1C-DIV-ICM(MTSET) were recorded before and after modification with MTSEAo. Prior to MTSEAo, the time course of the gating charge during repolarization (off-charge) was best described by a single fast time constant. After MTSEA, the off-charge had both fast and slow components, with the slow component accounting for nearly 35% of Qmax. These results demonstrate that the slow movement of the S4-DIV during repolarization is not dependent upon the normal binding of the inactivation particle.

  15. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  16. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  17. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  20. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Chemical vapour deposition diamond. Charge carrier movement at low temperatures and use in time-critical applications

    International Nuclear Information System (INIS)

    Jansen, Hendrik

    2013-09-01

    Diamond, a wide band gap semiconductor with exceptional electrical properties, has found its way in diverse fields of application reaching from the usage as a sensor material for beam loss monitors at particle accelerator facilities, over laser windows, to UV light sensors in space applications, e.g. for space weather forecasting. Though often used at room temperature, little is known about the charge transport in diamond towards liquid helium temperatures. In this work the method of the transient current technique is employed at temperatures between room temperature and 2 K. The temperature and electric field strength dependence of the pulse shape, the charge carrier transit time, the drift velocity, the saturation velocity, and the low-field mobility is measured in detector-grade scCVD diamond. Furthermore, the usability of diamond in time-critical applications is tested, and the main results are presented.

  2. Chemical Vapour Deposition Diamond - Charge Carrier Movement at Low Temperatures and Use in Time-Critical Applications

    CERN Document Server

    Jansen, Hendrik; Pernegger, Heinz

    Diamond, a wide band gap semiconductor with exceptional electrical properties, has found its way in diverse fields of application reaching from the usage as a sensor material for beam loss monitors at particle accelerator facilities, to laser windows, to UV light sensors in space applications, e.g. for space weather forecasting. Though often used at room temperature, little is known about the charge transport in diamond towards liquid helium temperatures. In this work the method of the transient current technique is employed at temperatures between room temperature and 2 K. The temperature and electric field strength dependence of the pulse shape, the charge carrier transit time, the drift velocity, the saturation velocity, and the low-field mobility is measured in detector-grade scCVD diamond. Furthermore, the usability of diamond in time-critical applications is tested, and the main results are presented.

  3. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  4. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  5. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  6. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  7. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  8. Investigation of p-n-junctions in n-InP based on voltage dependence of differential capacity

    International Nuclear Information System (INIS)

    Agaev, Ja.; Atabaev, Kh.; Gazakov, O.; Sadykov, K.B.

    1976-01-01

    The barrier capacity of alloyed p-n transitions on n-InP crystals grown by the crystallization method has been investigated. The transitions have been obtained by fusing In + 3 - 10% Zn. Step-by-step distribution of the impurity concentration in the space charge layer takes place in the alloyed diodes under investigation. The coefficient characterizing the impurity distribution in the space charge layer has been determined. The well-expressed dependence of I/C 2 =f/u) observed both at a room temperature and at the temperature of liquid nitrogen indicates that the density of ground carriers in the p-n regions are constant at a definite distance from the p-n transition. The main parameters of p-n transitions have been determined

  9. Bias voltage dependence of molecular orientation of dialkyl ketone and fatty acid alkyl ester at the liquid–graphite interface

    Energy Technology Data Exchange (ETDEWEB)

    Hibino, Masahiro, E-mail: hibino@mmm.muroran-it.ac.jp [Department of Applied Sciences, Muroran Institute of Technology, 27-1 Mizumoto-cho, Muroran 050-8585 (Japan); Tsuchiya, Hiroshi [Department of Applied Physics, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan)

    2014-10-30

    Graphical abstract: - Highlights: • Self-assembled monolayers (SAMs) of 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) were formed on a graphite surface at the liquid–solid interface. • Orientations of the molecules in SAMs on the substrate were studied by scanning tunneling microscopy. • A perpendicular carbon skeleton-plane orientation with the CO pointing up on the surface is favorable for a substrate with negative charge and vice versa. - Abstract: Molecular orientations of self-assembled 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) monolayers adsorbed on a graphite surface were studied by scanning tunneling microscopy (STM) at the liquid–solid interface. At a positive sample bias, the central areas of the dialkyl ketone and fatty acid alkyl ester molecules in the STM images appeared as two bright regions on both sides of a dim spot and a bright region on one side of a dim spot, whereas at a negative sample bias, the areas appeared dim. This contrast variation indicates that a perpendicular carbon skeleton-plane orientation with the CO pointing down on the surface is favorable for a substrate with positive charge and vice versa because of the greater electronegativity of the oxygen atom. Upon the bias voltage reversal, the delay time for the STM image contrast change in the region was observed on a time scale of minutes. The difference between the delay time lengths for the direction of bias polarity change indicates that the perpendicular configuration with CO pointing up is more stable than that with CO pointing down. These results indicate that the use of an electric field along a direction vertical to the monolayer on the substrate provides control over the orientations of the molecules between two stable states at the liquid–solid interface.

  10. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  11. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  12. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  13. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  14. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  15. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  16. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  17. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  18. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  19. [Study on the movement of the carrier recombination region in organic light-emitting diodes (OLEDs) based on DPVBi/Alq3].

    Science.gov (United States)

    Yan, Guang; Zhao, Su-ling; Xu, Zheng; Zhang, Fu-jun; Kong, Chao; Liu, Xiao-dong; Gong, Wei; Gao, Li-yan

    2011-07-01

    Series of organic light emitting devices with basic structure of ITO/PCBM: PVK(x Wt%, approximately 40 nm)/DPVBi(30 nm)/Alq3 (30 nm)/Al were fabricated in order to investigate the carrier recombination region movement in these devices. The carrier injection-dependent, the carrier transport-dependent and the voltage-dependent carrier recombination region movements were investigated respectively by modifying cathode with lithium fluoride, by changing the doping concentration of PCBM and by changing the voltage on the devices. The physical mechanism behind the voltage-dependent carrier recombination region movement was discussed.

  20. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  1. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  4. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  5. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  6. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  7. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  8. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  9. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  10. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  11. Charge movement in a GaN-based hetero-structure field effect transistor structure with carbon doped buffer under applied substrate bias

    International Nuclear Information System (INIS)

    Pooth, Alexander; Uren, Michael J.; Cäsar, Markus; Kuball, Martin; Martin, Trevor

    2015-01-01

    Charge trapping and transport in the carbon doped GaN buffer of a GaN-based hetero-structure field effect transistor (HFET) has been investigated under both positive and negative substrate bias. Clear evidence of redistribution of charges in the carbon doped region by thermally generated holes is seen, with electron injection and capture observed during positive bias. Excellent agreement is found with simulations. It is shown that these effects are intrinsic to the carbon doped GaN and need to be controlled to provide reliable and efficient GaN-based power HFETs

  12. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  13. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  14. Bowel Movement

    Science.gov (United States)

    A bowel movement is the last stop in the movement of food through your digestive tract. Your stool passes out of ... what you eat and drink. Sometimes a bowel movement isn't normal. Diarrhea happens when stool passes ...

  15. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  16. Effect of a radial space-charge field on the movement of particles in a magneto-static field and under the influence of a circularly polarized wave; L'effet d'un champ de charge d'espace radial sur le mouvement des particules dans un champ magnetique statique et sous l'action d'une onde polarisee circulairement

    Energy Technology Data Exchange (ETDEWEB)

    Buffa, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1967-06-15

    The effect of a circularly polarized wave on a cylindrical plasma in a axial magnetostatic field and a radial space-charge field proportional to r is studied. Single particle motion is considered. The electrostatic field produces a shift in the cyclotron resonance frequency and,in case of high charge density, a radial movement of the off-resonance particles. In these conditions a radio-frequency-particle resonance is also possible called 'drift-resonance'. The drift resonance can be produced, with whistler mode, and may be employed in ion acceleration. Afterwards parametrical resonances produced by space-charge field oscillations and collisional limits of theory are studied. Cases in which ion acceleration is possible are considered on the basis of a quantitative analysis of results. (author) [French] On etudie l'effet d'une onde polarisee circulairement sur un plasma cylindrique place dans un champ magnetique axial constant, en supposant etre en presence d'un, champ de charge d'espace radial proportionnel a r. L'etude est faite du point de vue de la particule individuelle. Le champ electrostatique deplace la frequence de resonance cyclotron et, dans le cas de forte densite, donne lieu a un mouvement radial des particules qui ne sont pas en resonance. Dans ces champs, il peut aussi se produire une resonance qu'on a appele 'de derive', entre un R.F. et la particule. Cette resonance peut se produire avec le mode siffleur et peut etre utilisee pour l'acceleration des ions. On considere ensuite les resonances parametriques, qui se manifestent lorsque le champ de charge d'espace oscille, et les limites a la theorie posees par les collisions. Une discussion quantitative des resultats fait ressortir les cas dans lesquels on peut accelerer les ions. (auteur)

  17. Conservation of Charge and Conservation of Current

    OpenAIRE

    Eisenberg, Bob

    2016-01-01

    Conservation of current and conservation of charge are nearly the same thing: when enough is known about charge movement, conservation of current can be derived from conservation of charge, in ideal dielectrics, for example. Conservation of current is enforced implicitly in ideal dielectrics by theories that conserve charge. But charge movement in real materials like semiconductors or ionic solutions is never ideal. We present an apparently universal derivation of conservation of current and ...

  18. Movement - uncoordinated

    Science.gov (United States)

    ... Loss of coordination; Coordination impairment; Ataxia; Clumsiness; Uncoordinated movement ... Smooth graceful movement requires a balance between different muscle groups. A part of the brain called the cerebellum manages this balance.

  19. Slope movements

    International Nuclear Information System (INIS)

    Wagner, P.

    2009-01-01

    On this poster some reasons of slope movements on the territory of the Slovak Republic are presented. Slope movements induced deterioration of land and forests, endangering of towns villages, and communications as well as hydro-engineering structures. Methods of preventing and stabilisation of slope movements are presented.

  20. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

    Science.gov (United States)

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

    2017-08-29

    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  1. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  2. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  3. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  4. Movement - uncontrolled or slow

    Science.gov (United States)

    Dystonia; Involuntary slow and twisting movements; Choreoathetosis; Leg and arm movements - uncontrollable; Arm and leg movements - uncontrollable; Slow involuntary movements of large muscle groups; Athetoid movements

  5. Charge gradient microscopy

    Science.gov (United States)

    Roelofs, Andreas; Hong, Seungbum

    2018-02-06

    A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.

  6. Theory and experiment on charging and discharging a capacitor through a reverse-biased diode

    Science.gov (United States)

    Roy, Arijit; Mallick, Abhishek; Adhikari, Aparna; Guin, Priyanka; Chatterjee, Dibyendu

    2018-06-01

    The beauty of a diode lies in its voltage-dependent nonlinear resistance. The voltage on a charging and discharging capacitor through a reverse-biased diode is calculated from basic equations and is found to be in good agreement with experimental measurements. Instead of the exponential dependence of charging and discharging voltages with time for a resistor-capacitor circuit, a linear time dependence is found when the resistor is replaced by a reverse-biased diode. Thus, well controlled positive and negative ramp voltages are obtained from the charging and discharging diode-capacitor circuits. This experiment can readily be performed in an introductory physics and electronics laboratory.

  7. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  8. Protest movements

    International Nuclear Information System (INIS)

    Rucht, D.

    1989-01-01

    The author describes the development of protest movements in postwar Germay and outlines two essential overlapping 'flow cycles'. The first of these was characterised by the restaurative postwar years. It culminated and ended in the students' revolt. This revolt is at the same time the start of a second cycle of protest which encompasses all subsequent individual movement and is initated by an economic, political and sociocultural procrastination of modernisation. This cycle culminates in the late 70s and early 80s and clearly lost momentum over the last few years. The follwoing phases and themes are described profoundly: against restauration and armament in the 1950; the revolutionary impatience of the students' movement, politisation of everyday life by the womens' movement and citizens' action groups, antinuclear- and ecological movement, differentiation and stabilisation of the movement in the 70s and 80s; break-up and continuity in the German protest behaviour. The paper contains a detailed chronicle of protest activities since 1945. (orig.) [de

  9. Dosimeter charging apparatus

    International Nuclear Information System (INIS)

    Reuter, F.A.; Moorman, Ch.J.

    1985-01-01

    An apparatus for charging a dosimeter which has a capacitor connected between first and second electrodes and a movable electrode in a chamber electrically connected to the first electrode. The movable electrode deflects varying amounts depending upon the charge present on said capacitor. The charger apparatus includes first and second charger electrodes couplable to the first and second dosimeter electrodes. To charge the dosimeter, it is urged downwardly into a charging socket on the charger apparatus. The second dosimeter electrode, which is the dosimeter housing, is electrically coupled to the second charger electrode through a conductive ring which is urged upwardly by a spring. As the dosimeter is urged into the socket, the ring moves downwardly, in contact with the second charger electrode. As the dosimeter is further urged downwardly, the first dosimeter electrode and first charger electrode contact one another, and an insulator post carrying the first and second charger electrodes is urged downwardly. Downward movement of the post effects the application of a charging potential between the first and second charger electrodes. After the charging potential has been applied, the dosimeter is moved further into the charging socket against the force of a relatively heavy biasing spring until the dosimeter reaches a mechanical stop in the charging socket

  10. Charge imbalance

    International Nuclear Information System (INIS)

    Clarke, J.

    1981-01-01

    This article provides a long theoretical development of the main ideas of charge imbalance in superconductors. Concepts of charge imbalance and quasiparticle charge are introduced, especially in regards to the use of tunnel injection in producing and detecting charge imbalance. Various mechanisms of charge relaxation are discussed, including inelastic scattering processes, elastic scattering in the presence of energy-gap anisotropy, and various pair-breaking mechanisms. In each case, present theories are reviewed in comparison with experimental data

  11. Striking movements

    DEFF Research Database (Denmark)

    Dahl, Sofia

    2011-01-01

    Like all music performance, percussion playing requires high control over timing and sound properties. Specific to percussionists, however, is the need to adjust the movement to different instruments with varying physical properties and tactile feedback to the player. Furthermore, the well defined...... note onsets and short interaction times between player and instrument do not allow for much adjustment once a stroke is initiated. The paper surveys research that shows a close relationship between movement and sound production, and how playing conditions such as tempo and the rebound after impact...

  12. Movement disorders

    International Nuclear Information System (INIS)

    Leenders, K.L.

    1986-01-01

    This thesis describes the measurement of brain-tissue functions in patients with movement disorders using positron emission tomography (PET). This scanning technique is a method for direct in vivo quantitation of the regional tissue content of positron emitting radionuclides in brain (or other organs) in an essentially non-invasive way. Ch. 2 outlines some general features of PET and describes the scanner which has been used for the studies in this thesis. Also the tracer methodology, as applied to data investigations of movement disorders, are discussed. Ch. 3 contains the results of the PET investigations which were performed in the study of movement disorders. The results are presented in the form of 12 papers. The main goals of these studies were the understanding of the pathophysiology of Parkinson's disease, Huntington's chorea, Steele-Richardson-Olzewski syndrome and special case reports. Ch. 4 summarizes the results of these publications and Ch. 5 concludes the main part of this thesis with a general discussion of movement disorders in relation to PET investigations. 697 refs.; 60 figs.; 31 tabs

  13. Psychodynamic Movement

    DEFF Research Database (Denmark)

    Pedersen, Inge Nygaard

    2002-01-01

    This chapter/article describes the historical development of the disciplin Psychodynamic Movement. The importance of this disciplin for self-experience and for training in developing a therapist identy for the music therapy students are emphasized. Prototypeexercises developed and simplified...

  14. Mixed Movements

    DEFF Research Database (Denmark)

    Brabrand, Helle

    2010-01-01

    levels than those related to building, and this exploration is a special challenge and competence implicit artistic development work. The project Mixed Movements generates drawing-material, not primary as representation, but as a performance-based media, making the body being-in-the-media felt and appear...... as possible operational moves....

  15. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  16. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  17. Fractional charges

    International Nuclear Information System (INIS)

    Saminadayar, L.

    2001-01-01

    20 years ago fractional charges were imagined to explain values of conductivity in some materials. Recent experiments have proved the existence of charges whose value is the third of the electron charge. This article presents the experimental facts that have led theorists to predict the existence of fractional charges from the motion of quasi-particles in a linear chain of poly-acetylene to the quantum Hall effect. According to the latest theories, fractional charges are neither bosons nor fermions but anyons, they are submitted to an exclusive principle that is less stringent than that for fermions. (A.C.)

  18. Computational movement analysis

    CERN Document Server

    Laube, Patrick

    2014-01-01

    This SpringerBrief discusses the characteristics of spatiotemporal movement data, including uncertainty and scale. It investigates three core aspects of Computational Movement Analysis: Conceptual modeling of movement and movement spaces, spatiotemporal analysis methods aiming at a better understanding of movement processes (with a focus on data mining for movement patterns), and using decentralized spatial computing methods in movement analysis. The author presents Computational Movement Analysis as an interdisciplinary umbrella for analyzing movement processes with methods from a range of fi

  19. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Internal Charging

    Science.gov (United States)

    Minow, Joseph I.

    2014-01-01

    (1) High energy (>100keV) electrons penetrate spacecraft walls and accumulate in dielectrics or isolated conductors; (2) Threat environment is energetic electrons with sufficient flux to charge circuit boards, cable insulation, and ungrounded metal faster than charge can dissipate; (3) Accumulating charge density generates electric fields in excess of material breakdown strenght resulting in electrostatic discharge; and (4) System impact is material damage, discharge currents inside of spacecraft Faraday cage on or near critical circuitry, and RF noise.

  1. Diagram representations of charge pumping processes in CMOS transistors

    International Nuclear Information System (INIS)

    Huang Xinyun; Jiao Guangfan; Cao Wei; Huang Darning; Li Mingfu; Shen Chen

    2010-01-01

    A diagram representation method is proposed to interpret the complicated charge pumping (CP) processes. The fast and slow traps in CP measurement are defined. Some phenomena such as CP pulse rise/fall time dependence, frequency dependence, the voltage dependence for the fast and slow traps, and the geometric CP component are clearly illustrated at a glance by the diagram representation. For the slow trap CP measurement, there is a transition stage and a steady stage due to the asymmetry of the electron and hole capture, and the CP current is determined by the lower capturing electron or hole component. The method is used to discuss the legitimacy of the newly developed modified charge pumping method. (semiconductor devices)

  2. Charge preamplifier

    International Nuclear Information System (INIS)

    Chaminade, R.; Passerieux, J.P.

    1961-01-01

    We describe a charge preamplifier having the following properties: - large open loop gain giving both stable gain and large input charge transfer; - stable input grid current with aging and without any adjustment; - fairly fast rise; - nearly optimum noise performance; - industrial material. (authors)

  3. Charge Meter

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 4. Charge Meter: Easy Way to Measure Charge and Capacitance: Some Interesting Electrostatic Experiments. M K Raghavendra V Venkataraman. Classroom Volume 19 Issue 4 April 2014 pp 376-390 ...

  4. Charging machine

    International Nuclear Information System (INIS)

    Medlin, J.B.

    1976-01-01

    A charging machine for loading fuel slugs into the process tubes of a nuclear reactor includes a tubular housing connected to the process tube, a charging trough connected to the other end of the tubular housing, a device for loading the charging trough with a group of fuel slugs, means for equalizing the coolant pressure in the charging trough with the pressure in the process tubes, means for pushing the group of fuel slugs into the process tube and a latch and a seal engaging the last object in the group of fuel slugs to prevent the fuel slugs from being ejected from the process tube when the pusher is removed and to prevent pressure liquid from entering the charging machine. 3 claims, 11 drawing figures

  5. Charge independence and charge symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Miller, G A [Washington Univ., Seattle, WA (United States). Dept. of Physics; van Oers, W T.H. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics; [TRIUMF, Vancouver, BC (Canada)

    1994-09-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed. (author). 145 refs., 3 tabs., 11 figs.

  6. Charge independence and charge symmetry

    International Nuclear Information System (INIS)

    Miller, G.A.

    1994-09-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed. (author). 145 refs., 3 tabs., 11 figs

  7. Functional Movement Disorder

    Science.gov (United States)

    ... Publications Patient Organizations International Parkinson and Movement Disorder Society National Institute of Mental Health (NIMH) See all related organizations Publications Order NINDS Publications Definition Psychogenic movement is an unwanted muscle movement such ...

  8. 49 CFR 229.9 - Movement of non-complying locomotives.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Movement of non-complying locomotives. 229.9... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.9 Movement of non... restrictions necessary for safely conducting the movement; (2)(i) The engineer in charge of the movement of the...

  9. Influence of unbalanced voltages on the movement of metallic ...

    Indian Academy of Sciences (India)

    Simulation is carried out on particle movement with balanced and unbalanced voltages and the ... dust, meteorological difficulties and safety. Hence ... work reported deals with the charge acquired by the particle due to macroscopic field at the.

  10. Net charge fluctuations and local charge compensation

    International Nuclear Information System (INIS)

    Fu Jinghua

    2006-01-01

    We propose net charge fluctuation as a measure of local charge correlation length. It is demonstrated that, in terms of a schematic multiperipheral model, net charge fluctuation satisfies the same Quigg-Thomas relation as satisfied by charge transfer fluctuation. Net charge fluctuations measured in finite rapidity windows depend on both the local charge correlation length and the size of the observation window. When the observation window is larger than the local charge correlation length, the net charge fluctuation only depends on the local charge correlation length, while forward-backward charge fluctuations always have strong dependence on the observation window size. Net charge fluctuations and forward-backward charge fluctuations measured in the present heavy ion experiments show characteristic features similar to those from multiperipheral models. But the data cannot all be understood within this simple model

  11. Simulating charge transport in flexible systems

    Directory of Open Access Journals (Sweden)

    Timothy Clark

    2015-12-01

    Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.

  12. Stereotypic movement disorder

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/001548.htm Stereotypic movement disorder To use the sharing features on this page, please enable JavaScript. Stereotypic movement disorder is a condition in which a person makes ...

  13. Eye Movement Disorders

    Science.gov (United States)

    ... work properly. There are many kinds of eye movement disorders. Two common ones are Strabismus - a disorder ... in "crossed eyes" or "walleye." Nystagmus - fast, uncontrollable movements of the eyes, sometimes called "dancing eyes" Some ...

  14. Overview of Movement Disorders

    Science.gov (United States)

    ... of Delirium Additional Content Medical News Overview of Movement Disorders By Hector A. Gonzalez-Usigli, MD, Professor ... Neurology, HE UMAE Centro Médico Nacional de Occidente; Movement Disorders Clinic, Neurology at IMSS Alberto Espay, MD, ...

  15. Independence of Movement Preparation and Movement Initiation.

    Science.gov (United States)

    Haith, Adrian M; Pakpoor, Jina; Krakauer, John W

    2016-03-09

    Initiating a movement in response to a visual stimulus takes significantly longer than might be expected on the basis of neural transmission delays, but it is unclear why. In a visually guided reaching task, we forced human participants to move at lower-than-normal reaction times to test whether normal reaction times are strictly necessary for accurate movement. We found that participants were, in fact, capable of moving accurately ∼80 ms earlier than their reaction times would suggest. Reaction times thus include a seemingly unnecessary delay that accounts for approximately one-third of their duration. Close examination of participants' behavior in conventional reaction-time conditions revealed that they generated occasional, spontaneous errors in trials in which their reaction time was unusually short. The pattern of these errors could be well accounted for by a simple model in which the timing of movement initiation is independent of the timing of movement preparation. This independence provides an explanation for why reaction times are usually so sluggish: delaying the mean time of movement initiation relative to preparation reduces the risk that a movement will be initiated before it has been appropriately prepared. Our results suggest that preparation and initiation of movement are mechanistically independent and may have a distinct neural basis. The results also demonstrate that, even in strongly stimulus-driven tasks, presentation of a stimulus does not directly trigger a movement. Rather, the stimulus appears to trigger an internal decision whether to make a movement, reflecting a volitional rather than reactive mode of control. Copyright © 2016 the authors 0270-6474/16/363007-10$15.00/0.

  16. Movement and Space

    DEFF Research Database (Denmark)

    Riisgaard Hansen, Thomas; Eriksson, Eva; Lykke-Olesen, Andreas

    2005-01-01

    In this paper we explore the space in which movement based interaction takes place. We have in several projects explored how fixed and mobile cameras can be used in movement based interaction and will shortly describe these projects. Based on our experience with working with movement......-based interaction we will briefly introduce and discuss how learning, mapping and multi-user interaction are important when designing movement based interaction....

  17. Recent crustal movements

    Science.gov (United States)

    Maelzer, H.

    Calculation of temporal height changes for the determination of recent vertical crustal movements in northern, western, and southern Germany is described. Precise geodetic measurements and their analysis for the determination of recent crustal movements in north-eastern Iceland, western Venezuela, and central Peru are described. Determination of recent vertical crustal movements by leveling and gravity data; geodetic modeling of deformations and recent crustal movements; geodetic modeling of plate motions; and instrumental developments in geodetic measuring are discussed.

  18. Social movements and science

    DEFF Research Database (Denmark)

    Jamison, Andrew

    2006-01-01

    The article examines the role of social movements in the development of scientific knowledge. Interactions between social movements and science in broad, historical terms are discussed. The relations between the new social movements of the 1960s and 1970s and changes in the contemporary scientific...

  19. Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.

    Science.gov (United States)

    Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco

    2013-11-01

    Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.

  20. CHARGE Association

    Directory of Open Access Journals (Sweden)

    Semanti Chakraborty

    2012-01-01

    Full Text Available We present here a case of 17-year-old boy from Kolkata presenting with obesity, bilateral gynecomastia, mental retardation, and hypogonadotrophic hypogonadism. The patient weighed 70 kg and was of 153 cm height. Facial asymmetry (unilateral facial palsy, gynecomastia, decreased pubic and axillary hair, small penis, decreased right testicular volume, non-palpable left testis, and right-sided congenital inguinal hernia was present. The patient also had disc coloboma, convergent squint, microcornea, microphthalmia, pseudohypertelorism, low set ears, short neck, and choanalatresia. He had h/o VSD repaired with patch. Laboratory examination revealed haemoglobin 9.9 mg/dl, urea 24 mg/dl, creatinine 0.68 mg/dl. IGF1 77.80 ng/ml (decreased for age, GH <0.05 ng/ml, testosterone 0.25 ng/ml, FSH-0.95 ΅IU/ml, LH 0.60 ΅IU/ml. ACTH, 8:00 A.M cortisol, FT3, FT4, TSH, estradiol, DHEA-S, lipid profile, and LFT was within normal limits. Prolactin was elevated at 38.50 ng/ml. The patient′s karyotype was 46XY. Echocardiography revealed ventricularseptal defect closed with patch, grade 1 aortic regurgitation, and ejection fraction 67%. Ultrasound testis showed small right testis within scrotal sac and undescended left testis within left inguinal canal. CT scan paranasal sinuses revealed choanalatresia and deviation of nasal septum to the right. Sonomammography revealed bilateral proliferation of fibroglandular elements predominantly in subareoalar region of breasts. MRI of brain and pituitary region revealed markedly atrophic pituitary gland parenchyma with preserved infundibulum and hypothalamus and widened suprasellar cistern. The CHARGE association is an increasingly recognized non-random pattern of congenital anomalies comprising of coloboma, heart defect, choanal atresia, retarded growth and development, genital hypoplasia, ear abnormalities, and/or deafness. [1] These anomalies have a higher probability of occurring together. In this report, we have

  1. Electrostatic charge bounds for ball lightning models

    International Nuclear Information System (INIS)

    Stephan, Karl D

    2008-01-01

    Several current theories concerning the nature of ball lightning predict a substantial electrostatic charge in order to account for its observed motion and shape (Turner 1998 Phys. Rep. 293 1; Abrahamson and Dinniss 2000 Nature 403 519). Using charged soap bubbles as a physical model for ball lightning, we show that the magnitude of charge predicted by some of these theories is too high to allow for the types of motion commonly observed in natural ball lightning, which includes horizontal motion above the ground and movement near grounded conductors. Experiments show that at charge levels of only 10-15 nC, 3-cm-diameter soap bubbles tend to be attracted by induced charges to the nearest grounded conductor and rupture. We conclude with a scaling rule that can be used to extrapolate these results to larger objects and surroundings

  2. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  3. Movement monitoring device

    International Nuclear Information System (INIS)

    Ichikawa, Takashi; Yoneda, Yasuaki; Hanatsumi, Masaharu.

    1997-01-01

    The present invention provides a device suitable to accurate recognition for the moving state of reactor core fuels as an object to be monitored in a nuclear power plant. Namely, the device of the present invention prepares each of scheduled paths for the movement of the object to be monitored and executed moving paths along with the movement based on the information of the movement obtained from scheduled information for the movement of the reactor core fuels as a object to be monitored and the actual movement of the object to be monitored. The results of the preparation are outputted. As an output mode, (1) the results of preparation for each of the paths for movement and the results of the monitoring obtained by monitoring the state of the object to be monitored are jointed and outputted, (2) images showing each of the paths for the movement are formed, and the formed images are displayed on a screen, and (3) each of the moving paths is prepared as an image, and the image is displayed together with the image of the regions before and after the movement of the object to be monitored. In addition, obtained images of each of the paths for the movement and the monitored images obtained by monitoring the state of the object to be monitored are joined and displayed. (I.S.)

  4. Classification of movement disorders.

    Science.gov (United States)

    Fahn, Stanley

    2011-05-01

    The classification of movement disorders has evolved. Even the terminology has shifted, from an anatomical one of extrapyramidal disorders to a phenomenological one of movement disorders. The history of how this shift came about is described. The history of both the definitions and the classifications of the various neurologic conditions is then reviewed. First is a review of movement disorders as a group; then, the evolving classifications for 3 of them--parkinsonism, dystonia, and tremor--are covered in detail. Copyright © 2011 Movement Disorder Society.

  5. Sensation of Movement

    DEFF Research Database (Denmark)

    Sensation of Movement will discuss the role of sensation in the control of action, bodily self-recognition, and sense of agency. Sensing movement is dependent on a range of information received by the brain, from signalling in the peripheral sensory organs to the establishment of higher order goals....... This volume will question whether one type of information is more relevant for the ability to sense and control movements, and demonstrate the importance of integrating neuroscientific knowledge with philosophical perspectives, in order to arrive at new insights into how sensation of movement can be studied...

  6. Numerical Schemes for Charged Particle Movement in PIC Simulations

    International Nuclear Information System (INIS)

    Kulhanek, P.

    2001-01-01

    A PIC model of plasma fibers is developed in the Department of Physics of the Czech Technical University for several years. The program code was written in FORTRAN 95, free-style (without compulsory columns). Fortran compiler and linker were used from Compaq Visual Fortran 6.1A embedded in the Microsoft Development studio GUI. Fully three-dimensional code with periodical boundary conditions was developed. Electromagnetic fields are localized on a grid and particles move freely through this grid. One of the partial problems of the PIC model is the numerical particle solver, which will be discussed in this paper. (author)

  7. Workplace Charging. Charging Up University Campuses

    Energy Technology Data Exchange (ETDEWEB)

    Giles, Carrie [ICF International, Fairfax, VA (United States); Ryder, Carrie [ICF International, Fairfax, VA (United States); Lommele, Stephen [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-03-01

    This case study features the experiences of university partners in the U.S. Department of Energy's (DOE) Workplace Charging Challenge with the installation and management of plug-in electric vehicle (PEV) charging stations.

  8. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  9. Exploring pedestrian movement patterns

    NARCIS (Netherlands)

    Orellana, D.A.

    2012-01-01

    The main objective of this thesis is to develop an approach for exploring, analysing and interpreting movement patterns of pedestrians interacting with the environment. This objective is broken down in sub-objectives related to four research questions. A case study of the movement of visitors in a

  10. [Dance/Movement Therapy.

    Science.gov (United States)

    Fenichel, Emily, Ed.

    1994-01-01

    This newsletter theme issue focuses on dance, play, and movement therapy for infants and toddlers with disabilities. Individual articles are: "Join My Dance: The Unique Movement Style of Each Infant and Toddler Can Invite Communication, Expression and Intervention" (Suzi Tortora); "Dynamic Play Therapy: An Integrated Expressive Arts Approach to…

  11. Dynamics of human movement

    NARCIS (Netherlands)

    Koopman, Hubertus F.J.M.

    2010-01-01

    The part of (bio)mechanics that studies the interaction of forces on the human skeletal system and its effect on the resulting movement is called rigid body dynamics. Some basic concepts are presented: A mathematical formulation to describe human movement and how this relates on the mechanical loads

  12. Islamic Puritanism Movements in Indonesia as Transnational Movements

    Directory of Open Access Journals (Sweden)

    Benny Baskara

    2017-04-01

    Full Text Available Islamic puritanism movements are the movements compelling to return to the teachings of Quran and Sunnah, as the pure teachings of Islam and abandon even abolish other teachings outside the teachings of Quran and Sunnah. The movements of Islamic puritanism can be considered as transnational movements because they spread their teachings and ideologies, create organizations, networks, and provide financial supports across nations. This paper describes Islamic puritanism movements in Indonesia and their transnational connections. Some Islamic puritanism movements in Indonesia can be considered as part of Islamic transnational movements, in which most of the movements are centered in the Middle East. In Indonesia, Islamic puritanism movements firstly appeared in the beginning of the nineteenth century, called Padri movement in West Sumatra. It was then continued to the emergence of Islamic organizations in the twentieth century. Recently, Islamic puritanism movements in Indonesia mostly take form as Salafism-Wahabism movements.

  13. The Irish Women's Movement

    OpenAIRE

    Cullen, Pauline

    2015-01-01

    Ireland’s long history of patriarchy is matched by the ongoing evolution of its women’s movements. Today’s complex, transnational feminism finds its precursor in the colonial era. The first wave of the Irish women’s movement dates from the mid-19th century, with the franchise secured for women in 1918 while still under British colonial rule. First-wave feminists played a role in the nationalist movement, but their demands were sidelined later, during the construction of a conserva...

  14. Music and movement

    OpenAIRE

    Nasev, Lence

    2012-01-01

    Rhythm is one of the fundamental elements without which music would not exist. In plays with singing, a child learns to synchronize its movements with the rhythm of music from a very early age. The skill of movement plays a major role in the learning of music and thus deserves an important place in the school curriculum. In this paper, an overview is made of the most important music pedagogues who introduced movement, and at the same time perceived its importance in learning musical conte...

  15. The French ecological movement

    International Nuclear Information System (INIS)

    Sansen, Bernard

    1977-01-01

    The analysis of the ecological Movement in France is presented: its organisation, its topics, its position with respect to the main political trends. The accent is put in particular on the antinuclear contestation [fr

  16. Modulation of nitrogen vacancy charge state and fluorescence in nanodiamonds using electrochemical potential.

    Science.gov (United States)

    Karaveli, Sinan; Gaathon, Ophir; Wolcott, Abraham; Sakakibara, Reyu; Shemesh, Or A; Peterka, Darcy S; Boyden, Edward S; Owen, Jonathan S; Yuste, Rafael; Englund, Dirk

    2016-04-12

    The negatively charged nitrogen vacancy (NV(-)) center in diamond has attracted strong interest for a wide range of sensing and quantum information processing applications. To this end, recent work has focused on controlling the NV charge state, whose stability strongly depends on its electrostatic environment. Here, we demonstrate that the charge state and fluorescence dynamics of single NV centers in nanodiamonds with different surface terminations can be controlled by an externally applied potential difference in an electrochemical cell. The voltage dependence of the NV charge state can be used to stabilize the NV(-) state for spin-based sensing protocols and provides a method of charge state-dependent fluorescence sensing of electrochemical potentials. We detect clear NV fluorescence modulation for voltage changes down to 100 mV, with a single NV and down to 20 mV with multiple NV centers in a wide-field imaging mode. These results suggest that NV centers in nanodiamonds could enable parallel optical detection of biologically relevant electrochemical potentials.

  17. Modulation of nitrogen vacancy charge state and fluorescence in nanodiamonds using electrochemical potential

    Science.gov (United States)

    Karaveli, Sinan; Gaathon, Ophir; Wolcott, Abraham; Sakakibara, Reyu; Shemesh, Or A.; Peterka, Darcy S.; Boyden, Edward S.; Owen, Jonathan S.; Yuste, Rafael; Englund, Dirk

    2016-04-01

    The negatively charged nitrogen vacancy (NV-) center in diamond has attracted strong interest for a wide range of sensing and quantum information processing applications. To this end, recent work has focused on controlling the NV charge state, whose stability strongly depends on its electrostatic environment. Here, we demonstrate that the charge state and fluorescence dynamics of single NV centers in nanodiamonds with different surface terminations can be controlled by an externally applied potential difference in an electrochemical cell. The voltage dependence of the NV charge state can be used to stabilize the NV- state for spin-based sensing protocols and provides a method of charge state-dependent fluorescence sensing of electrochemical potentials. We detect clear NV fluorescence modulation for voltage changes down to 100 mV, with a single NV and down to 20 mV with multiple NV centers in a wide-field imaging mode. These results suggest that NV centers in nanodiamonds could enable parallel optical detection of biologically relevant electrochemical potentials.

  18. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    International Nuclear Information System (INIS)

    Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke

    2010-01-01

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.

  19. Movement and personality development

    Directory of Open Access Journals (Sweden)

    Aida M. Aylamazyan

    2017-06-01

    Full Text Available The paper discusses the role of the movement in the process of shaping the personality, its importance as a mechanism for personality development is considered. The issue of the movement has always occupied a central place in Russian psychology. However, subsequently the movement began to be considered primarily as an executive action in human life. The role of movement in personality development can vary depending on the level it occupies in the hierarchical structure of activity, and also on the type of movement, its character, and the way it is constructed. Under certain conditions, the movement can express the attitude of the subject to the surrounding world and people. Many foreign and Russian psychologists point to a special place of the postural tonic component of the motor movement, the posture in personal regulation. The posture reflects his/her personal attitudes, the system of relationships, and, above all, the emotional attitude or emotional assessment of the current situation, the interest in the actions performed. Mastering the tonic level of motor management is based on the emotional regulation, so the ability to regulate one’s own pose is an important stage in the personality development. Posture tonic regulation of motor movements in humans reveals a qualitatively different character than in animals, this being due to the person’s facing the task of mastering his’her posture, arbitrary retention of the body in one or another position. Maintaining a vertical posture requires constant activity at an arbitrary and involuntary level of mental regulation. Mastering the posture of an unstable equilibrium presupposes the emergence of the «I» and is the last stage of the development. The way a person solves the motor task of maintaining the vertical position of the body reflects his/her specific personal strategy or attitude.

  20. Rooted in Movement

    DEFF Research Database (Denmark)

    The result of the synergy between four doctoral projects and an advanced MA-level course on Bronze Age Europe, this integrated assemblage of articles represents a variety of different subjects united by a single theme: movement. Ranging from theoretical discussion of the various responses to and ...... period of European prehistory. In so doing, the text not only addresses transmission and reception, but also the conceptualization of mobility within a world which was literally Rooted in Movement....

  1. Paraneoplastic autoimmune movement disorders.

    Science.gov (United States)

    Lim, Thien Thien

    2017-11-01

    To provide an overview of paraneoplastic autoimmune disorders presenting with various movement disorders. The spectrum of paraneoplastic autoimmune disorders has been expanding with the discovery of new antibodies against cell surface and intracellular antigens. Many of these paraneoplastic autoimmune disorders manifest as a form of movement disorder. With the discovery of new neuronal antibodies, an increasing number of idiopathic or neurodegenerative movement disorders are now being reclassified as immune-mediated movement disorders. These include anti-N-methyl-d-aspartate receptor (NMDAR) encephalitis which may present with orolingual facial dyskinesia and stereotyped movements, CRMP-5 IgG presenting with chorea, anti-Yo paraneoplastic cerebellar degeneration presenting with ataxia, anti-VGKC complex (Caspr2 antibodies) neuromyotonia, opsoclonus-myoclonus-ataxia syndrome, and muscle rigidity and episodic spasms (amphiphysin, glutamic acid decarboxylase, glycine receptor, GABA(A)-receptor associated protein antibodies) in stiff-person syndrome. Movement disorders may be a presentation for paraneoplastic autoimmune disorders. Recognition of these disorders and their common phenomenology is important because it may lead to the discovery of an occult malignancy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Nuclear movement in fungi.

    Science.gov (United States)

    Xiang, Xin

    2017-12-11

    Nuclear movement within a cell occurs in a variety of eukaryotic organisms including yeasts and filamentous fungi. Fungal molecular genetic studies identified the minus-end-directed microtubule motor cytoplasmic dynein as a critical protein for nuclear movement or orientation of the mitotic spindle contained in the nucleus. Studies in the budding yeast first indicated that dynein anchored at the cortex via its anchoring protein Num1 exerts pulling force on an astral microtubule to orient the anaphase spindle across the mother-daughter axis before nuclear division. Prior to anaphase, myosin V interacts with the plus end of an astral microtubule via Kar9-Bim1/EB1 and pulls the plus end along the actin cables to move the nucleus/spindle close to the bud neck. In addition, pushing or pulling forces generated from cortex-linked polymerization or depolymerization of microtubules drive nuclear movements in yeasts and possibly also in filamentous fungi. In filamentous fungi, multiple nuclei within a hyphal segment undergo dynein-dependent back-and-forth movements and their positioning is also influenced by cytoplasmic streaming toward the hyphal tip. In addition, nuclear movement occurs at various stages of fungal development and fungal infection of plant tissues. This review discusses our current understanding on the mechanisms of nuclear movement in fungal organisms, the importance of nuclear positioning and the regulatory strategies that ensure the proper positioning of nucleus/spindle. Published by Elsevier Ltd.

  3. Antiglobalization movements and their critics

    DEFF Research Database (Denmark)

    Corry, Olaf

    2012-01-01

    inequity, organize transnationally, and maintain a critical stance toward significant aspects of the state system. For this reason, many supporters favor other terms such as alterglobalization movement, global justice movement , or simply the movement of movements . Critics accuse the movements...... of ideological incoherence, self-interested protectionism, and illiberal and undemocratic political methods, and point to Western liberal elite dominance within the movements. The debate has ...

  4. Study of molecular movements in some organic crystals by NMR

    International Nuclear Information System (INIS)

    Alexandre, M.

    1971-01-01

    After a discussion on molecular crystals (generalities, movements within molecular solids, study of movements, complexes by charge transfer) and some specific ones (molecular complexes of trinitrobenzene or TNB), this research thesis reports the use of nuclear magnetic resonance (NMR) to study molecular movements: generalities on broadband NMR, spin relaxation and strong field network, observation of the absorption signal and measurement of the second moment. The last part reports and discusses experimental results obtained on TNB-naphthalene, on TNB-azulene, on TNB-benzothiophene, and on TNB-indole

  5. [Scenes in movement. Movement disorders on film].

    Science.gov (United States)

    Olivares Romero, J

    2010-03-01

    There are publications in which various neurological diseases are analysed on film. However, no references have been found on movement disorders in this medium. A total of 104 documents were collected and reviewed using the internet movie data base (IMDb). The majority were associated with dystonia, Parkinson's and tics, were American commercial productions, and the most common genre was drama. The cinema usually depicts old men with developed Parkinson's disease. However, motor complications only appear in 19% and non-motor symptoms in 14%. The image of dystonia is generally that of a young man, with disabling dystonia secondary to childhood cerebral palsy. Tics appear associated with Tourette's syndrome, with the excessive use of obscene expressions and with very few references to other important aspects of this syndrome, such as mood and behavioural changes. The majority of tremors portrayed on film are associated with Parkinsonism and are not pathological. Myoclonus appears anecdotically and is normally symptomatic. Parkinson's disease is the type of movement disorder that the cinema portrays with greater neurological honesty and in a more dignified manner.

  6. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  7. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  8. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  9. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  10. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  11. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  12. Charge storage and tunneling mechanism of Ni nanocrystals embedded HfOx film

    Science.gov (United States)

    Zhu, H. X.; Zhang, T.; Wang, R. X.; Zhang, Y. Y.; Li, L. T.; Qiu, X. Y.

    2016-05-01

    A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfOx film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfOx matrix. Pt/Ni-NCs embedded HfOx/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 1012 electrons/cm2, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 104 cycles and excellent retention performance of 105 s, fulfilling the requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.

  13. Charge storage and tunneling mechanism of Ni nanocrystals embedded HfO{sub x} film

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, H. X.; Zhang, T.; Wang, R. X.; Zhang, Y. Y.; Li, L. T.; Qiu, X. Y., E-mail: qxy2001@swu.edu.cn [School of Physical Science and Technology, Southwest University, Chongqing 400715 (China)

    2016-05-15

    A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfO{sub x} film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfO{sub x} matrix. Pt/Ni-NCs embedded HfO{sub x}/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 10{sup 12} electrons/cm{sup 2}, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 10{sup 4} cycles and excellent retention performance of 10{sup 5} s, fulfilling the requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.

  14. Studying Social Movements

    DEFF Research Database (Denmark)

    Uldam, Julie; McCurdy, Patrick

    2013-01-01

    The research method of participant observation has long been used by scholars interested in the motivations, dynamics, tactics and strategies of social movements from a movement perspective. Despite participant observation being a common research method, there have been very few efforts to bring...... together this literature, which has often been spread across disciplines. This makes it difficult to identify the various challenges (and their interrelation) facing participant observers. Consequently, this article first reviews how participant observation roles have been conceptualised in general...... and then draws specific links to how the method has been used in the study of activism and social movements. In doing so, this article brings together key academic debates on participant observation, which have been considered separately, such as insider/outsider and overt/covert, but not previously been brought...

  15. Movement as utopia.

    Science.gov (United States)

    Couton, Philippe; López, José Julián

    2009-10-01

    Opposition to utopianism on ontological and political grounds has seemingly relegated it to a potentially dangerous form of antiquated idealism. This conclusion is based on a restrictive view of utopia as excessively ordered panoptic discursive constructions. This overlooks the fact that, from its inception, movement has been central to the utopian tradition. The power of utopianism indeed resides in its ability to instantiate the tension between movement and place that has marked social transformations in the modern era. This tension continues in contemporary discussions of movement-based social processes, particularly international migration and related identity formations, such as open borders transnationalism and cosmopolitanism. Understood as such, utopia remains an ongoing and powerful, albeit problematic instrument of social and political imagination.

  16. Movement Without Boundaries

    Directory of Open Access Journals (Sweden)

    Jennifer Fortuna

    2017-10-01

    Full Text Available Johnson Simon, an artist based in West Palm Beach, FL, provided the cover art for the Fall 2017 edition of The Open Journal of Occupational Therapy (OJOT. “Dancing in Motion” is a 36” x 60” painting made from acrylic on canvas. Johnson always wanted to become a dancer. He was born with cerebral palsy, and therefore physical limitations make it difficult for Johnson to coordinate his body movements. Through use of vibrant colors and bold strokes, Johnson’s expressionist paintings evoke movement and motion. Occupational therapy helped Johnson discover his artistic abilities. Painting empowered him to move without limitations

  17. On Dust Charging Equation

    OpenAIRE

    Tsintsadze, Nodar L.; Tsintsadze, Levan N.

    2008-01-01

    A general derivation of the charging equation of a dust grain is presented, and indicated where and when it can be used. A problem of linear fluctuations of charges on the surface of the dust grain is discussed.

  18. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    Science.gov (United States)

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  19. Moderately nonlinear diffuse-charge dynamics under an ac voltage

    Science.gov (United States)

    Stout, Robert F.; Khair, Aditya S.

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  20. Linear shaped charge

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, David; Stofleth, Jerome H.; Saul, Venner W.

    2017-07-11

    Linear shaped charges are described herein. In a general embodiment, the linear shaped charge has an explosive with an elongated arrowhead-shaped profile. The linear shaped charge also has and an elongated v-shaped liner that is inset into a recess of the explosive. Another linear shaped charge includes an explosive that is shaped as a star-shaped prism. Liners are inset into crevices of the explosive, where the explosive acts as a tamper.

  1. Inversion of membrane surface charge by trivalent cations probed with a cation-selective channel.

    Science.gov (United States)

    Gurnev, Philip A; Bezrukov, Sergey M

    2012-11-13

    We demonstrate that the cation-selective channel formed by gramicidin A can be used as a reliable sensor for studying the multivalent ion accumulation at the surfaces of charged lipid membranes and the "charge inversion" phenomenon. In asymmetrically charged membranes with the individual leaflets formed from pure negative and positive lipids bathed by 0.1 M CsCl solutions the channel exhibits current rectification, which is comparable to that of a typical n/p semiconductor diode. We show that even at these highly asymmetrical conditions the channel conductance can be satisfactorily described by the electrodiffusion equation in the constant field approximation but, due to predictable limitations, only when the applied voltages do not exceed 50 mV. Analysis of the changes in the voltage-dependent channel conductance upon addition of trivalent cations allows us to gauge their interactions with the membrane surface. The inversion of the sign of the effective surface charge takes place at the concentrations, which correlate with the cation size. Specifically, these concentrations are close to 0.05 mM for lanthanum, 0.25 mM for hexaamminecobalt, and 4 mM for spermidine.

  2. Color and magnetic charge

    International Nuclear Information System (INIS)

    Kim, B.R.

    1976-01-01

    Schwinger's conjecture that the color degree of freedom of a quark is equivalent to its degree of freedom of taking different magnetic charges provides a plausible motivation for extending color to leptons. Leptons are just quarks with zero magnetic charges. It is shown that baryon number and lepton number can be replaced by fermion number and magnetic charge

  3. A movement ecology paradigm for unifying organismal movement research.

    Science.gov (United States)

    Nathan, Ran; Getz, Wayne M; Revilla, Eloy; Holyoak, Marcel; Kadmon, Ronen; Saltz, David; Smouse, Peter E

    2008-12-09

    Movement of individual organisms is fundamental to life, quilting our planet in a rich tapestry of phenomena with diverse implications for ecosystems and humans. Movement research is both plentiful and insightful, and recent methodological advances facilitate obtaining a detailed view of individual movement. Yet, we lack a general unifying paradigm, derived from first principles, which can place movement studies within a common context and advance the development of a mature scientific discipline. This introductory article to the Movement Ecology Special Feature proposes a paradigm that integrates conceptual, theoretical, methodological, and empirical frameworks for studying movement of all organisms, from microbes to trees to elephants. We introduce a conceptual framework depicting the interplay among four basic mechanistic components of organismal movement: the internal state (why move?), motion (how to move?), and navigation (when and where to move?) capacities of the individual and the external factors affecting movement. We demonstrate how the proposed framework aids the study of various taxa and movement types; promotes the formulation of hypotheses about movement; and complements existing biomechanical, cognitive, random, and optimality paradigms of movement. The proposed framework integrates eclectic research on movement into a structured paradigm and aims at providing a basis for hypothesis generation and a vehicle facilitating the understanding of the causes, mechanisms, and spatiotemporal patterns of movement and their role in various ecological and evolutionary processes. "Now we must consider in general the common reason for moving with any movement whatever." (Aristotle, De Motu Animalium, 4th century B.C.).

  4. Rationality in Human Movement.

    Science.gov (United States)

    O'Brien, Megan K; Ahmed, Alaa A

    2016-01-01

    It long has been appreciated that humans behave irrationally in economic decisions under risk: they fail to objectively consider uncertainty, costs, and rewards and instead exhibit risk-seeking or risk-averse behavior. We hypothesize that poor estimates of motor variability (influenced by motor task) and distorted probability weighting (influenced by relevant emotional processes) contribute to characteristic irrationality in human movement decisions.

  5. The Matter of Movement

    DEFF Research Database (Denmark)

    Ayres, Phil

    2015-01-01

    This contribution concerns itself with the design and realisation of architectures that operate with material dynamics. It presents this concern as a counter to the consideration of movement in architecture as something conceptualised from the position of the observer. The contribution draws upon...

  6. Knowledge through movement

    DEFF Research Database (Denmark)

    Jensen, Søren Kjær; Moser, T.

    2003-01-01

    In: Children and adolescents in movement - perspectives and ideas. The Danish Ministry of Culture, pages 150 - 162. 2003 Short description: the article debunks a lot of the myths surrounding body and learning, and replace them with a vision about another kind of learning. The aim is to reintroduce...

  7. Mungiki as Youth Movement

    DEFF Research Database (Denmark)

    Rasmussen, Jacob

    2010-01-01

    Like many other African countries, Kenya has a large and growing youth population. Some of the youths are mobilized into militant and political networks; one of these is the Mungiki movement. The article explores Mungiki’s combination of politics, religion and Kikuyu traditions. Using the examples...

  8. The Evidence Movement

    DEFF Research Database (Denmark)

    Hansen, Hanne Foss; Rieper, Olaf

    2009-01-01

    The evidence movement and the idea of systematic reviews, defined as summaries of the results of already existing evaluation and research projects, have gained considerable support in recent years as many international as well as national evidence-producing organizations have been established...

  9. Managing Movement as Partnership

    Science.gov (United States)

    Kimbrell, Sinead

    2011-01-01

    The associate director of education at Hubbard Street Dance Chicago recounts her learning and teaching through managing the Movement as Partnership program. Included are detailed descriptions of encounters with teachers and students as they create choreography reflective of their inquiry into integrating dance and literacy arts curriculum in the…

  10. Music, Movement, and Poetry.

    Science.gov (United States)

    Carmichael, Karla D.

    This paper's premise is that music, movement, and poetry are unique and creative methods to be used by the counselor in working with both children and adults. Through these media, the counselor generates material for the counseling session that may not be available through more traditional "talk therapies." The choice of music as a counseling…

  11. Editorial: Body Movements

    Directory of Open Access Journals (Sweden)

    Carina Assuncao

    2018-01-01

    Full Text Available Today, the juxtaposition between physical bodies and the gameworld is ever more fluid. Virtual Reality headsets are available at game stores with more AAA games being created for the format. The release of the Nintendo Switch and its dynamic JoyCon controllers reintroduce haptic movement based controls.  Pokémon GO’s augmented reality took gamers outdoors and has encouraged the Harry Potter franchise to follow in its mobile footsteps. Each development encourages a step further into the digital world. At the same time, the movement of bodies always has political dimensions. We live in a world where walls seem like solutions to the movement of bodies, while the mere meeting of bodies elsewhere – for sex, marriage and other reasons – is still forbidden by many states’ rules. Games and game-like interfaces have shown the ability to bend those rules, and to sometimes project other worlds and rule systems over our world in order to make bodies move and meet. For this special issue on ‘Body Movements’, Press Start invited authors to focus on embodiment, body movements, political bodies, community bodies, virtual bodies, physical bodies, feminine, masculine, trans- bodies, agency or its lack, and anything else in between. The response to this invitation was variegated, and provocative, as outlined here.

  12. Morocco's February 20 Movement

    African Journals Online (AJOL)

    2018-02-20

    Feb 20, 2018 ... Council for the Development of Social Science Research in Africa, 2017 ... revolted several times, namely in big cities like Casablanca, Marrakech or .... region in order to take advantage of their experience and acquire a regional ..... Undoubtedly, with social networking, the dynamics of protest movements.

  13. [Architecture and movement].

    Science.gov (United States)

    Rivallan, Armel

    2012-01-01

    Leading an architectural project means accompanying the movement which it induces within the teams. Between questioning, uncertainty and fear, the organisational changes inherent to the new facility must be subject to constructive and ongoing exchanges. Ethics, safety and training are revised and the unit projects are sometimes modified.

  14. Space Charge Effects

    CERN Document Server

    Ferrario, M.; Palumbo, L.

    2014-12-19

    The space charge forces are those generated directly by the charge distribution, with the inclusion of the image charges and currents due to the interaction of the beam with a perfectly conducting smooth pipe. Space charge forces are responsible for several unwanted phenomena related to beam dynamics, such as energy loss, shift of the synchronous phase and frequency , shift of the betatron frequencies, and instabilities. We will discuss in this lecture the main feature of space charge effects in high-energy storage rings as well as in low-energy linacs and transport lines.

  15. Charged particle detector

    International Nuclear Information System (INIS)

    Hagen, R.D.

    1975-01-01

    A device for detecting the emission of charged particles from a specimen is described. The specimen is placed within an accumulator means which statically accumulates any charged particles emitted from the specimen. The accumulator means is pivotally positioned between a first capacitor plate having a positive electrical charge and a second capacitor plate having a negative electrical charge. The accumulator means is attracted to one capacitor plate and repelled from the other capacitor plate by an amount proportional to the amount and intensity of charged particles emitted by the specimen. (auth)

  16. Coulombic charge ice

    Science.gov (United States)

    McClarty, P. A.; O'Brien, A.; Pollmann, F.

    2014-05-01

    We consider a classical model of charges ±q on a pyrochlore lattice in the presence of long-range Coulomb interactions. This model first appeared in the early literature on charge order in magnetite [P. W. Anderson, Phys. Rev. 102, 1008 (1956), 10.1103/PhysRev.102.1008]. In the limit where the interactions become short ranged, the model has a ground state with an extensive entropy and dipolar charge-charge correlations. When long-range interactions are introduced, the exact degeneracy is broken. We study the thermodynamics of the model and show the presence of a correlated charge liquid within a temperature window in which the physics is well described as a liquid of screened charged defects. The structure factor in this phase, which has smeared pinch points at the reciprocal lattice points, may be used to detect charge ice experimentally. In addition, the model exhibits fractionally charged excitations ±q/2 which are shown to interact via a 1/r potential. At lower temperatures, the model exhibits a transition to a long-range ordered phase. We are able to treat the Coulombic charge ice model and the dipolar spin ice model on an equal footing by mapping both to a constrained charge model on the diamond lattice. We find that states of the two ice models are related by a staggering field which is reflected in the energetics of these two models. From this perspective, we can understand the origin of the spin ice and charge ice ground states as coming from a dipolar model on a diamond lattice. We study the properties of charge ice in an external electric field, finding that the correlated liquid is robust to the presence of a field in contrast to the case of spin ice in a magnetic field. Finally, we comment on the transport properties of Coulombic charge ice in the correlated liquid phase.

  17. [Neuropsychiatry Of Movement Disorders].

    Science.gov (United States)

    Orjuela-Rojas, Juan Manuel; Barrios Vincos, Gustavo Adolfo; Martínez Gallego, Melisa Alejandra

    2017-10-01

    Movement disorders can be defined as neurological syndromes presenting with excessive or diminished automatic or voluntary movements not related to weakness or spasticity. Both Parkinson's disease (PD) and Huntington's disease (HD) are well-known examples of these syndromes. The high prevalence of comorbid psychiatric symptoms like depression, anxiety, obsessive-compulsive symptoms, hallucinations, delusions, impulsivity, sleep disorders, apathy and cognitive impairment mean that these conditions must be regarded as neuropsychiatric diseases. In this article, we review neuroanatomical (structural and functional), psychopathological and neuropsychological aspects of PD and HD. The role of fronto-subcortical loops in non-motor functions is particularly emphasised in order to understand the clinical spectrum of both diseases, together with the influence of genetic, psychological and psychosocial aspects. A brief description of the main psychopharmacological approaches for both diseases is also included. Copyright © 2017 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  18. Monitoring underground movements

    CERN Multimedia

    Antonella Del Rosso

    2015-01-01

    On 16 September 2015 at 22:54:33 (UTC), an 8.3-magnitude earthquake struck off the coast of Chile. 11,650 km away, at CERN, a new-generation instrument – the Precision Laser Inclinometer (PLI) – recorded the extreme event. The PLI is being tested by a JINR/CERN/ATLAS team to measure the movements of underground structures and detectors.   The Precision Laser Inclinometer during assembly. The instrument has proven very accurate when taking measurements of the movements of underground structures at CERN.    The Precision Laser Inclinometer is an extremely sensitive device capable of monitoring ground angular oscillations in a frequency range of 0.001-1 Hz with a precision of 10-10 rad/Hz1/2. The instrument is currently installed in one of the old ISR transfer tunnels (TT1) built in 1970. However, its final destination could be the ATLAS cavern, where it would measure and monitor the fine movements of the underground structures, which can affect the precise posi...

  19. Anti-nuclear movements

    International Nuclear Information System (INIS)

    Ruedig, W.

    1990-01-01

    Nuclear power, heralded in the years after World War II as the answer to the world's energy needs, has in more recent times become the focus of intense ecological, political and economic debate. In this study, the current worldwide opposition to nuclear power is examined from its origins in expert dissent to the widespread development of grassroots activity. Chapter headings include: Social Movements: A Theoretical Framework; Creating the Preconditions for Public Protest; Local and Regional Opposition: Mobilizing the Grass Roots; Local Opposition and the Politicization of Nuclear Power; The Use of Local Opposition as a Political Resource; Local Opposition and Social Movement Analysis; The Removal of Political Stimuli: The Unpolitics of Nuclear Siting; Analyzing Host Community Attitudes: The Survey Evidence; Attitudes and Political Action of Nuclear Host Communities: Approaches and Explanations; Novel Siting Approaches and their Political Implications; Siting and Social Movement Analysis; Patterns and Outcomes of Nuclear Energy Conflicts; The Future of the Nuclear Energy Conflict. Throughout the text, analysis and theory are blended with detailed accounts of the growth and activities of individual anti-nuclear organizations in different countries. (author)

  20. Sleep-related movement disorders.

    Science.gov (United States)

    Merlino, Giovanni; Gigli, Gian Luigi

    2012-06-01

    Several movement disorders may occur during nocturnal rest disrupting sleep. A part of these complaints is characterized by relatively simple, non-purposeful and usually stereotyped movements. The last version of the International Classification of Sleep Disorders includes these clinical conditions (i.e. restless legs syndrome, periodic limb movement disorder, sleep-related leg cramps, sleep-related bruxism and sleep-related rhythmic movement disorder) under the category entitled sleep-related movement disorders. Moreover, apparently physiological movements (e.g. alternating leg muscle activation and excessive hypnic fragmentary myoclonus) can show a high frequency and severity impairing sleep quality. Clinical and, in specific cases, neurophysiological assessments are required to detect the presence of nocturnal movement complaints. Patients reporting poor sleep due to these abnormal movements should undergo non-pharmacological or pharmacological treatments.

  1. Jet Vertex Charge Reconstruction

    CERN Document Server

    Nektarijevic, Snezana; The ATLAS collaboration

    2015-01-01

    A newly developed algorithm called the jet vertex charge tagger, aimed at identifying the sign of the charge of jets containing $b$-hadrons, referred to as $b$-jets, is presented. In addition to the well established track-based jet charge determination, this algorithm introduces the so-called \\emph{jet vertex charge} reconstruction, which exploits the charge information associated to the displaced vertices within the jet. Furthermore, the charge of a soft muon contained in the jet is taken into account when available. All available information is combined into a multivariate discriminator. The algorithm has been developed on jets matched to generator level $b$-hadrons provided by $t\\bar{t}$ events simulated at $\\sqrt{s}$=13~TeV using the full ATLAS detector simulation and reconstruction.

  2. Social Movements and Institutions

    Directory of Open Access Journals (Sweden)

    Maria Francisca Pinheiro Coelho

    2017-04-01

    Full Text Available Abstract This study approaches the relationship between social movements and institutions in Brazil concerning three different stages of the process of re-democratization: the political transition; the National Constituent Assembly; and the new Constitutional Order. The general question is: what is the interface, reciprocity or conflict, between social movements and institutions in this context of social change? The paper examines the different roles of social movements and institutions in each specific period: in the pre-democratization moment, the movement for direct elections for president, Diretas-Já, is analyzed; in the National Constituent Assembly, the movement in defense for free public education is examined;  in the new constitutional order, the pro-reform political movement is studied.  The work focuses on the scope of the studies on social movements and democracy.  It belongs to the field of the studies about the representativeness and legitimacy of the demands of social movements in the context of democracy and its challenges. Key words: social movement, institution, reciprocity, conflict, democracy.   Social Movements and Institutions                               Resumen El estudio aborda la relación entre los movimientos sociales e instituciones en Brasil en tres etapas diferentes del proceso de redemocratización en las últimas décadas: la transición política; la Asamblea Nacional Constituyente; y el nuevo orden constitucional. La pregunta general es: ¿cuál es la relación, la reciprocidad o el conflito, entre los movimientos sociales y las instituciones en este contexto de cambio social? El artículo examina los diferentes roles de los movimientos sociales e instituciones en cada período específico: en el momento de la transición política analiza el movimiento de las elecciones directas para presidente, las Diretas-Já; en la Asamblea Nacional Constituyente aborda el movimiento en

  3. Charge Islands Through Tunneling

    Science.gov (United States)

    Robinson, Daryl C.

    2002-01-01

    It has been recently reported that the electrical charge in a semiconductive carbon nanotube is not evenly distributed, but rather it is divided into charge "islands." This paper links the aforementioned phenomenon to tunneling and provides further insight into the higher rate of tunneling processes, which makes tunneling devices attractive. This paper also provides a basis for calculating the charge profile over the length of the tube so that nanoscale devices' conductive properties may be fully exploited.

  4. Human preference for air movement

    DEFF Research Database (Denmark)

    Toftum, Jørn; Melikov, Arsen Krikor; Tynel, A.

    2002-01-01

    Human preference for air movement was studied at slightly cool, neutral, and slightly warm overall thermal sensations and at temperatures ranging from 18 deg.C to 28 deg.C. Air movement preference depended on both thermal sensation and temperature, but large inter-individual differences existed...... between subjects. Preference for less air movement was linearly correlated with draught discomfort, but the percentage of subjects who felt draught was lower than the percentage who preferred less air movement....

  5. Contractor Software Charges

    National Research Council Canada - National Science Library

    Granetto, Paul

    1994-01-01

    .... Examples of computer software costs that contractors charge through indirect rates are material management systems, security systems, labor accounting systems, and computer-aided design and manufacturing...

  6. Segmenting Trajectories by Movement States

    NARCIS (Netherlands)

    Buchin, M.; Kruckenberg, H.; Kölzsch, A.; Timpf, S.; Laube, P.

    2013-01-01

    Dividing movement trajectories according to different movement states of animals has become a challenge in movement ecology, as well as in algorithm development. In this study, we revisit and extend a framework for trajectory segmentation based on spatio-temporal criteria for this purpose. We adapt

  7. FUNdamental Movement in Early Childhood.

    Science.gov (United States)

    Campbell, Linley

    2001-01-01

    Noting that the development of fundamental movement skills is basic to children's motor development, this booklet provides a guide for early childhood educators in planning movement experiences for children between 4 and 8 years. The booklet introduces a wide variety of appropriate practices to promote movement skill acquisition and increased…

  8. Charge Screening in a Charged Condensate

    International Nuclear Information System (INIS)

    Gabadadze, Gregory; Rosen, Rachel A.

    2009-01-01

    We consider a highly dense system of helium-4 nuclei and electrons in which the helium-4 nuclei have condensed. We present the condensation mechanism in the framework of low energy effective field theory and discuss the screening of electric charge in the condensate.

  9. Surface Charging and Points of Zero Charge

    CERN Document Server

    Kosmulski, Marek

    2009-01-01

    Presents Points of Zero Charge data on well-defined specimen of materials sorted by trademark, manufacturer, and location. This text emphasizes the comparison between particular results obtained for different portions of the same or very similar material and synthesizes the information published in research reports over the past few decades

  10. Electric vehicle battery charging controller

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention provides an electric vehicle charging controller. The charging controller comprises a first interface connectable to an electric vehicle charge source for receiving a charging current, a second interface connectable to an electric vehicle for providing the charging current...... to a battery management system in the electric vehicle to charge a battery therein, a first communication unit for receiving a charging message via a communication network, and a control unit for controlling a charging current provided from the charge source to the electric vehicle, the controlling at least...... in part being performed in response to a first information associated with a charging message received by the first communication unit...

  11. Normal movement selectivity in autism.

    Science.gov (United States)

    Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J

    2010-05-13

    It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Movement selectivity is a defining characteristic of neurons involved in movement perception, including mirror neurons, and, as such, these findings argue against a mirror system dysfunction in autism. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Stereotypic movement disorders.

    Science.gov (United States)

    Singer, Harvey S

    2011-01-01

    Stereotypic movements are repetitive, rhythmic, fixed, patterned in form, amplitude, and localization, but purposeless (e.g., hand shaking, waving, body rocking, head nodding). They are commonly seen in children; both in normal children (primary stereotypy) and in individuals with additional behavioral or neurological signs and symptoms (secondary stereotypy). They should be differentiated from compulsions (OCD), tics (tic disorders), trichotillomania, skin picking disorder, or the direct physiological effect of a substance. There is increasing evidence to support a neurobiological mechanism. Response to behavioral and pharmacological therapies is variable. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. The tactile movement aftereffect.

    Science.gov (United States)

    Hollins, M; Favorov, O

    1994-01-01

    The existence of a tactile movement aftereffect was established in a series of experiments on the palmar surface of the hand and fingers of psychophysical observers. During adaptation, observers cupped their hand around a moving drum for up to 3 min; following this period of stimulation, they typically reported an aftereffect consisting of movement sensations located on and deep to the skin, and lasting for up to 1 min. Preliminary experiments comparing a number of stimulus materials mounted on the drum demonstrated that a surface approximating a low-spatial-frequency square wave, with a smooth microtexture, was especially effective at inducing the aftereffect; this adapting stimulus was therefore used throughout the two main experiments. In Experiment 1, the vividness of the aftereffect produced by 2 min of adaptation was determined under three test conditions: with the hand (1) remaining on the now stationary drum; (2) in contact with a soft, textured surface; or (3) suspended in air. Subjects' free magnitude estimates of the peak vividness of the aftereffect were not significantly different across conditions; each subject experienced the aftereffect at least once under each condition. Thus the tactile movement aftereffect does not seem to depend critically on the ponditions of stimulation that obtain while it is being experienced. In Experiment 2, the vividness and duration of the aftereffect were measured as a function of the duration of the adapting stimulus. Both measures increased steadily over the range of durations explored (30-180 sec). In its dependence on adapting duration, the aftereffect resembles the waterfall illusion in vision. An explanation for the tactile movement aftereffect is proposed, based on the model of cortical dynamics of Whitsel et al. (1989, 1991). With assumed modest variation of one parameter across individuals, this application of the model is able to account both for the data of the majority of subjects, who experienced the

  14. Fetal body movement monitoring.

    Science.gov (United States)

    Rayburn, W F

    1990-03-01

    Recording fetal activity serves as an indirect measure of central nervous system integrity and function. The coordination of whole body movement, which requires complex neurologic control, is likely similar to that of the newborn infant. Short-term observations of the fetus are best performed using real-time ultrasound imaging. Monitoring fetal motion has been shown to be clinically worthwhile in predicting impending death or compromise, especially when placental insufficiency is longstanding. The presence of a vigorous fetus is reassuring. Perceived inactivity requires a reassessment of any underlying antepartum complication and a more precise evaluation by fetal heart rate testing or real-time ultrasonography before delivery is contemplated.

  15. West African Antislavery Movements

    DEFF Research Database (Denmark)

    Hahonou, Eric Komlavi; Pelckmans, Lotte

    2011-01-01

    In the context of liberalization of West African political regimes, the upsurge of audacious political entrepreneurs who want to end chattel slavery in their nation-state, resulted in the legal criminalisation of slavery in both Mauritania (2007) and Niger (2003) and in a proposal to revise......-slavery movements had raised awareness, this political emergence was even easier. Indeed the fight against ‘slave mentalities’ was everywhere a major challenge and a crucial step to mobilize groups of slave status under a united force. As this article argues changes in political structures and changes in political...

  16. Spacecraft Surface Charging Handbook

    Science.gov (United States)

    1992-11-01

    Charging of Large Spwc Structure• . in Polut Otbil.’" Prweedings of thre Air For’e Grespykirs fitrano, W4r4 nop em Natural Charging of large Space Stru, ures...3, p. 1433- 1440, 1991. Bowman, C., Bogorad, A., Brucker, G., Seehra, S., and Lloyd, T., "ITO-Coated RF Transparent Materials for Antenna Sunscreen

  17. Unilateral CHARGE association

    NARCIS (Netherlands)

    Trip, J; van Stuijvenberg, M; Dikkers, FG; Pijnenburg, MWH

    A case with a predominantly unilateral CHARGE association is reported. The CHARGE association refers to a combination of congenital malformations. This boy had left-sided anomalies consisting of choanal atresia. coloboma and peripheral facial palsy. The infant had a frontal encephalocele. an anomaly

  18. Nondissipative optimum charge regulator

    Science.gov (United States)

    Rosen, R.; Vitebsky, J. N.

    1970-01-01

    Optimum charge regulator provides constant level charge/discharge control of storage batteries. Basic power transfer and control is performed by solar panel coupled to battery through power switching circuit. Optimum controller senses battery current and modifies duty cycle of switching circuit to maximize current available to battery.

  19. Modelling group dynamic animal movement

    DEFF Research Database (Denmark)

    Langrock, Roland; Hopcraft, J. Grant C.; Blackwell, Paul G.

    2014-01-01

    makes its movement decisions relative to the group centroid. The basic idea is framed within the flexible class of hidden Markov models, extending previous work on modelling animal movement by means of multi-state random walks. While in simulation experiments parameter estimators exhibit some bias......, to date, practical statistical methods which can include group dynamics in animal movement models have been lacking. We consider a flexible modelling framework that distinguishes a group-level model, describing the movement of the group's centre, and an individual-level model, such that each individual......Group dynamic movement is a fundamental aspect of many species' movements. The need to adequately model individuals' interactions with other group members has been recognised, particularly in order to differentiate the role of social forces in individual movement from environmental factors. However...

  20. Camera Movement in Narrative Cinema

    DEFF Research Database (Denmark)

    Nielsen, Jakob Isak

    2007-01-01

    section unearths what characterizes the literature on camera movement. The second section of the dissertation delineates the history of camera movement itself within narrative cinema. Several organizational principles subtending the on-screen effect of camera movement are revealed in section two...... but they are not organized into a coherent framework. This is the task that section three meets in proposing a functional taxonomy for camera movement in narrative cinema. Two presumptions subtend the taxonomy: That camera movement actively contributes to the way in which we understand the sound and images on the screen......, commentative or valuative manner. 4) Focalization: associating the movement of the camera with the viewpoints of characters or entities in the story world. 5) Reflexive: inviting spectators to engage with the artifice of camera movement. 6) Abstract: visualizing abstract ideas and concepts. In order...

  1. Charged corpuscular beam detector

    Energy Technology Data Exchange (ETDEWEB)

    Hikawa, H; Nishikawa, Y

    1970-09-29

    The present invention relates to a charged particle beam detector which prevents transient phenomena disturbing the path and focusing of a charged particle beam travelling through a mounted axle. The present invention provides a charged particle beam detector capable of decreasing its reaction to the charge in energy of the charged particle beam even if the relative angle between the mounted axle and the scanner is unstable. The detector is characterized by mounting electrically conductive metal pieces of high melting point onto the face of a stepped, heat-resistant electric insulating material such that the pieces partially overlap each other and individually provide electric signals, whereby the detector is no longer affected by the beam. The thickness of the metal piece is selected so that an eddy current is not induced therein by an incident beam, thus the incident beam is not affected. The detector is capable of detecting a misaligned beam since the metal pieces partially overlap each other.

  2. Genetics Home Reference: congenital mirror movement disorder

    Science.gov (United States)

    ... Health Conditions Congenital mirror movement disorder Congenital mirror movement disorder Printable PDF Open All Close All Enable ... view the expand/collapse boxes. Description Congenital mirror movement disorder is a condition in which intentional movements ...

  3. Charging equipment. Ladegeraet

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, E

    1981-09-17

    The invention refers to a charging equipment, particularly on board charging equipment for charging traction batteries of an electric vehicle from the AC mains supply, consisting of a DC converter, which contains a controlled power transistor, a switching off unloading circuit and a power transmitter, where the secondary winding is connected in series with a rectifier diode, and a smoothing capacitor is connected in parallel with this series circuit. A converter module is provided, which consists of two DC voltage converters, whose power transistors are controlled by a control circuit in opposition with a phase displacement of 180/sup 0/.

  4. Temporomandibular joint movement

    International Nuclear Information System (INIS)

    Maeda, M.; Itou, S.; Ishii, Y.; Yamamoto, K.; Kawamura, Y.; Matsuda, T.; Hayashi, N.; Ishii, J.

    1992-01-01

    Ten temporomandibular joints (TMJs) of 5 healthy volunteers and 19 TMJs of internal derangements in 16 patients with splint therapy were examined with MR imaging. T1-weighted images were obtained only in the closed mouth position, and gradient recalled acquisition in steady state (GRASS) images were obtained in active opening and closing phases, allowing a pseudodynamic display of TMJ movement. All patients received protrusive splint treatment. The usefulness of MR imaging to assess the efficacy of splint therapy was evaluated. Corrected disk position with the splint in place was clearly demonstrated in 9 TMJs, corresponding with elimination of reciprocal clicking. Ten other TMJs of anterior disk displacement without reduction showed uncorrected disk position by the splint. This information could confirm the therapeutic efficacy, or suggest other treatment alternatives. GRASS MR imaging can provide accurate and physiologic information about disk function in initial and follow-up assessment of protrusive splint therapy. (orig.)

  5. Tracking the Poster Movement

    DEFF Research Database (Denmark)

    Christensen, Line Hjorth

    2015-01-01

    Summary: This article considers the display of posters as a distinctive activity and defining aspect of British modernism between the two wars, looking to a cardinal event, the Exhibition of British and Foreign Posters at the Victoria and Albert Museum in 1931. This manifestation was the first...... in the Museum to expose the poster-image as a medium in its own artistic, technical, historical and popular right; the article examines the event as a sign holding core characteristics of a ‘poster movement’ prevailing during the interwar years. The period made a varied scene for exhibitions promoting...... commercial and graphic design of various kinds of which British and Foreign Posters offers a particularly rich example. The exhibition attracted commercial, artistic and curatorial forces substantiating the idea of a movement, and approached commercial art from a perspective that raised new awareness towards...

  6. The Circular Camera Movement

    DEFF Research Database (Denmark)

    Hansen, Lennard Højbjerg

    2014-01-01

    It has been an accepted precept in film theory that specific stylistic features do not express specific content. Nevertheless, it is possible to find many examples in the history of film in which stylistic features do express specific content: for instance, the circular camera movement is used...... repeatedly to convey the feeling of a man and a woman falling in love. This raises the question of why producers and directors choose certain stylistic features to narrate certain categories of content. Through the analysis of several short film and TV clips, this article explores whether...... or not there are perceptual aspects related to specific stylistic features that enable them to be used for delimited narrational purposes. The article further attempts to reopen this particular stylistic debate by exploring the embodied aspects of visual perception in relation to specific stylistic features...

  7. Material and Affective Movements

    DEFF Research Database (Denmark)

    Rasmussen, Lisa Rosén

    2014-01-01

    . The chapter traces the former pupil’s memories of physical and affective movements within the larger context of school and discovers surprisingly diverse modes of knowing, relating, and attending to things, teachers and classmates among and between the three generations. It thus taps into the rich realms...... of individual experiences of school and everyday school life as it unfolds in and beyond the formal teaching situations. The chapter follows in the wake of a growing attention to the aspects of everyday life and lived life at school in the history of education. It also develops tools for and demonstrates how...... the use of spoken memories is a rewarding source for the writing about school from the pupils’ perspective....

  8. Clinical features of movement disorders.

    Science.gov (United States)

    Yung, C Y

    1983-08-01

    The descriptive aspects of all types of movement disorders and their related syndromes and terminologies used in the literature are reviewed and described. This comprises the features of (a) movement disorders secondary to neurological diseases affecting the extrapyramidal motor system, such as: athetosis, chorea, dystonia, hemiballismus, myoclonus, tremor, tics and spasm, (b) drug induced movement disorders, such as: akathisia, akinesia, hyperkinesia, dyskinesias, extrapyramidal syndrome, and tardive dyskinesia, and (c) abnormal movements in psychiatric disorders, such as: mannerism, stereotyped behaviour and psychomotor retardation. It is intended to bring about a more comprehensive overview of these movement disorders from a phenomenological perspective, so that clinicians can familiarize with these features for diagnosis. Some general statements are made in regard to some of the characteristics of movement disorders.

  9. Normal Movement Selectivity in Autism

    OpenAIRE

    Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J.

    2010-01-01

    It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements, but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Moveme...

  10. Pion double charge exchange

    International Nuclear Information System (INIS)

    Cooper, M.D.

    1978-01-01

    The pion double charge exchange data on the oxygen isotopes is reviewed and new data on 9 Be, 12 C, 24 Mg, and 28 Si are presented. Where theoretical calculations exist, they are compared to the data. 9 references

  11. Water Quality Protection Charges

    Data.gov (United States)

    Montgomery County of Maryland — The Water Quality Protection Charge (WQPC) is a line item on your property tax bill. WQPC funds many of the County's clean water initiatives including: • Restoration...

  12. EV Charging Infrastructure Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Karner, Donald [Electric Transportation Inc., Rogers, AR (United States); Garetson, Thomas [Electric Transportation Inc., Rogers, AR (United States); Francfort, Jim [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-08-01

    As highlighted in the U.S. Department of Energy’s EV Everywhere Grand Challenge, vehicle technology is advancing toward an objective to “… produce plug-in electric vehicles that are as affordable and convenient for the average American family as today’s gasoline-powered vehicles …” [1] by developing more efficient drivetrains, greater battery energy storage per dollar, and lighter-weight vehicle components and construction. With this technology advancement and improved vehicle performance, the objective for charging infrastructure is to promote vehicle adoption and maximize the number of electric miles driven. The EV Everywhere Charging Infrastructure Roadmap (hereafter referred to as Roadmap) looks forward and assumes that the technical challenges and vehicle performance improvements set forth in the EV Everywhere Grand Challenge will be met. The Roadmap identifies and prioritizes deployment of charging infrastructure in support of this charging infrastructure objective for the EV Everywhere Grand Challenge

  13. Space-Charge Effect

    International Nuclear Information System (INIS)

    Chauvin, N

    2013-01-01

    First, this chapter introduces the expressions for the electric and magnetic space-charge internal fields and forces induced by high-intensity beams. Then, the root-mean-square equation with space charge is derived and discussed. In the third section, the one-dimensional Child-Langmuir law, which gives the maximum current density that can be extracted from an ion source, is exposed. Space-charge compensation can occur in the low-energy beam transport lines (located after the ion source). This phenomenon, which counteracts the spacecharge defocusing effect, is explained and its main parameters are presented. The fifth section presents an overview of the principal methods to perform beam dynamics numerical simulations. An example of a particles-in-cells code, SolMaxP, which takes into account space-charge compensation, is given. Finally, beam dynamics simulation results obtained with this code in the case of the IFMIF injector are presented. (author)

  14. Space-Charge Effect

    CERN Document Server

    Chauvin, N.

    2013-12-16

    First, this chapter introduces the expressions for the electric and magnetic space-charge internal fields and forces induced by high-intensity beams. Then, the root-mean-square equation with space charge is derived and discussed. In the third section, the one-dimensional Child-Langmuir law, which gives the maximum current density that can be extracted from an ion source, is exposed. Space-charge compensation can occur in the low-energy beam transport lines (located after the ion source). This phenomenon, which counteracts the spacecharge defocusing effect, is explained and its main parameters are presented. The fifth section presents an overview of the principal methods to perform beam dynamics numerical simulations. An example of a particles-in-cells code, SolMaxP, which takes into account space-charge compensation, is given. Finally, beam dynamics simulation results obtained with this code in the case of the IFMIF injector are presented.

  15. EV Charging Infrastructure Roadmap

    International Nuclear Information System (INIS)

    Karner, Donald; Garetson, Thomas; Francfort, Jim

    2016-01-01

    As highlighted in the U.S. Department of Energy's EV Everywhere Grand Challenge, vehicle technology is advancing toward an objective to ''... produce plug-in electric vehicles that are as affordable and convenient for the average American family as today's gasoline-powered vehicles ...'' [1] by developing more efficient drivetrains, greater battery energy storage per dollar, and lighter-weight vehicle components and construction. With this technology advancement and improved vehicle performance, the objective for charging infrastructure is to promote vehicle adoption and maximize the number of electric miles driven. The EV Everywhere Charging Infrastructure Roadmap (hereafter referred to as Roadmap) looks forward and assumes that the technical challenges and vehicle performance improvements set forth in the EV Everywhere Grand Challenge will be met. The Roadmap identifies and prioritizes deployment of charging infrastructure in support of this charging infrastructure objective for the EV Everywhere Grand Challenge

  16. The Explanatory Range of Movement

    DEFF Research Database (Denmark)

    Thrane, Torben

    2005-01-01

    Drawing a distinction between systemic and functional explanations of movement in general, I shall argue that the Chomskyan view of movement in language is originally functional. With the advent of the Minimimalist Program, however, it has become systemic, but no argument for this change has been...... forthcoming. I'll then present data (from Danish) to sustain the view that only functional type explanations of movement can be empirically motivated, and these only if movement is reinterpreted as transition states between representations of different kinds....

  17. Bewitched - The Tea Party Movement

    DEFF Research Database (Denmark)

    Ashbee, Edward

    2011-01-01

    This article considers the development of the Tea Party movement, the character of its thinking and the nature of the interests and constituencies to which it is tied. The article suggests that despite the importance of ideas and interests, and the process of interaction between them, the movement....... The political friction that this creates has contributed to the anger that has characterised the movement. While the Tea Party movement may, as such, have only an ephemeral existence, independent conservatives are likely to remain a significant and potent constituency and will, within the institutional...

  18. Charged weak currents

    International Nuclear Information System (INIS)

    Turlay, R.

    1979-01-01

    In this review of charged weak currents I shall concentrate on inclusive high energy neutrino physics. There are surely still things to learn from the low energy weak interaction but I will not discuss it here. Furthermore B. Tallini will discuss the hadronic final state of neutrino interactions. Since the Tokyo conference a few experimental results have appeared on charged current interaction, I will present them and will also comment on important topics which have been published during the last past year. (orig.)

  19. Relativistic charged Bose gas

    International Nuclear Information System (INIS)

    Hines, D.F.; Frankel, N.E.

    1979-01-01

    The charged Bose has been previously studied as a many body problem of great intrinsic interest which can also serve as a model of some real physical systems, for example, superconductors, white dwarf stars and neutron stars. In this article the excitation spectrum of a relativistic spin-zero charged Bose gas is obtained in a dielectric response formulation. Relativity introduces a dip in the spectrum and consequences of this dip for the thermodynamic functions are discussed

  20. Movement Matters: Observing the Benefits of Movement Practice

    Science.gov (United States)

    Fuchs, Melani Alexander

    2015-01-01

    Montessori's first premise is that movement and cognition are closely entwined, and movement can enhance thinking and learning (Lillard, 2005). Children must move, and practice moving, to develop strength, balance, and the stability needed to fully participate in the rigors of daily life. It is imperative for young children's motor…

  1. Social-movement analysis of the American antinuclear movement

    International Nuclear Information System (INIS)

    Ladd, A.E.

    1981-01-01

    Utilizing data from a survey of participants at the May 6, 1979 antinuclear rally in Washington, DC (N = 420), this dissertation explored some of the major structural and ideological characteristics of the American Antinuclear Movement. By organizing the data around three of the key analytical concepts in the study of social movements - mobilization, recruitment, and ideology - the author was able to derive from the demonstration sample a descriptive and illustrative analysis of those individuals, organizations, and processes involved in the national antinuclear crusade. Given that few researchers have actively studied the antinuclear movement beyond the scope of local or regional protests, this work constitutes the only empirical study to date examining a cross section of the movement's participants from a sociological perspective. It is also one of the few attempts to use a national demonstration as a social laboratory for the study of a social movement in general. In terms of the mobilization variables examined in the study, it was found that organizational networks, past movement activism, and individual resources were important factors in the May 6 mobilization effort. While less than one-half of the demonstrators were part of the antinuclear organizational network per se, most of them had been active in the major protest movements of the 1960's and 1970's. The demonstrators were relatively high in socio-economic resources and had occupational or educational schedules conducive to creating the necessary discretionary time for movement participation

  2. Ion trajectories calculation in a three dimensional beam subjected to a space charge

    International Nuclear Information System (INIS)

    Tauth, T.

    1978-04-01

    Physical and geometrical conditions allowing a first approximation of necessary sizes to numerical integration of the ions movement equations subjected to electrical and magnetic crossed fields and space charge action are investigated here. To take into consideration the effect of the last one, two artifices are put forward: replacing charged particles by equivalent particles in calculating the coulomb force, electrical field calculation produced in different points situated on the beam envelope by the uniform charges distribution [fr

  3. MOSFET Electric-Charge Sensor

    Science.gov (United States)

    Robinson, Paul A., Jr.

    1988-01-01

    Charged-particle probe compact and consumes little power. Proposed modification enables metal oxide/semiconductor field-effect transistor (MOSFET) to act as detector of static electric charges or energetic charged particles. Thickened gate insulation acts as control structure. During measurements metal gate allowed to "float" to potential of charge accumulated in insulation. Stack of modified MOSFET'S constitutes detector of energetic charged particles. Each gate "floats" to potential induced by charged-particle beam penetrating its layer.

  4. Sleep staging with movement-related signals.

    Science.gov (United States)

    Jansen, B H; Shankar, K

    1993-05-01

    Body movement related signals (i.e., activity due to postural changes and the ballistocardiac effort) were recorded from six normal volunteers using the static-charge-sensitive bed (SCSB). Visual sleep staging was performed on the basis of simultaneously recorded EEG, EMG and EOG signals. A statistical classification technique was used to determine if reliable sleep staging could be performed using only the SCSB signal. A classification rate of between 52% and 75% was obtained for sleep staging in the five conventional sleep stages and the awake state. These rates improved from 78% to 89% for classification between awake, REM and non-REM sleep and from 86% to 98% for awake versus asleep classification.

  5. Charge-balanced biphasic electrical stimulation inhibits neurite extension of spiral ganglion neurons.

    Science.gov (United States)

    Shen, Na; Liang, Qiong; Liu, Yuehong; Lai, Bin; Li, Wen; Wang, Zhengmin; Li, Shufeng

    2016-06-15

    Intracochlear application of exogenous or transgenic neurotrophins, such as neurotrophin-3 (NT-3) and brain derived neurotrophic factor (BDNF), could promote the resprouting of spiral ganglion neuron (SGN) neurites in deafened animals. These resprouting neurites might reduce the gap between cochlear implant electrodes and their targeting SGNs, allowing for an improvement of spatial resolution of electrical stimulation. This study is to investigate the impact of electrical stimulation employed in CI on the extension of resprouting SGN neurites. We established an in vitro model including the devices delivering charge-balanced biphasic electrical stimulation, and spiral ganglion (SG) dissociated culture treated with BDNF and NT-3. After electrical stimulation with varying durations and intensities, we quantified neurite lengths and Schwann cell densities in SG cultures. Stimulations that were greater than 50μA or longer than 8h significantly decreased SG neurite length. Schwann cell density under 100μA electrical stimulation for 48h was significantly lower compared to that in non-stimulated group. These electrical stimulation-induced decreases of neurite extension and Schwann cell density were attenuated by various types of voltage-dependent calcium channel (VDCC) blockers, or completely prevented by their combination, cadmium or calcium-free medium. Our study suggested that charge-balanced biphasic electrical stimulation inhibited the extension of resprouting SGN neurites and decreased Schwann cell density in vitro. Calcium influx through multiple types of VDCCs was involved in the electrical stimulation-induced inhibition. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Spatial memory and animal movement.

    Science.gov (United States)

    Fagan, William F; Lewis, Mark A; Auger-Méthé, Marie; Avgar, Tal; Benhamou, Simon; Breed, Greg; LaDage, Lara; Schlägel, Ulrike E; Tang, Wen-wu; Papastamatiou, Yannis P; Forester, James; Mueller, Thomas

    2013-10-01

    Memory is critical to understanding animal movement but has proven challenging to study. Advances in animal tracking technology, theoretical movement models and cognitive sciences have facilitated research in each of these fields, but also created a need for synthetic examination of the linkages between memory and animal movement. Here, we draw together research from several disciplines to understand the relationship between animal memory and movement processes. First, we frame the problem in terms of the characteristics, costs and benefits of memory as outlined in psychology and neuroscience. Next, we provide an overview of the theories and conceptual frameworks that have emerged from behavioural ecology and animal cognition. Third, we turn to movement ecology and summarise recent, rapid developments in the types and quantities of available movement data, and in the statistical measures applicable to such data. Fourth, we discuss the advantages and interrelationships of diverse modelling approaches that have been used to explore the memory-movement interface. Finally, we outline key research challenges for the memory and movement communities, focusing on data needs and mathematical and computational challenges. We conclude with a roadmap for future work in this area, outlining axes along which focused research should yield rapid progress. © 2013 John Wiley & Sons Ltd/CNRS.

  7. Eye Movements in Gaze Interaction

    DEFF Research Database (Denmark)

    Møllenbach, Emilie; Hansen, John Paulin; Lillholm, Martin

    2013-01-01

    Gaze as a sole input modality must support complex navigation and selection tasks. Gaze interaction combines specific eye movements and graphic display objects (GDOs). This paper suggests a unifying taxonomy of gaze interaction principles. The taxonomy deals with three types of eye movements...

  8. Compensatory eye movements in mice

    NARCIS (Netherlands)

    A.M. van Alphen (Arjan)

    2002-01-01

    textabstractThis thesis will address the generation of compensatory eye movements in naturally mutated or genetically modified mice. The reason for generating compensatory eye movements is solely related to the requirements for good vision. In a subject moving through its environment the projection

  9. Movement Patterns in Educational Games

    DEFF Research Database (Denmark)

    Rehm, Matthias; Christensen, Bianca Clavio; Nielsen, Thorsten B.

    2018-01-01

    Although movement is essential in location-based games to get from one point of interest to the next, it is seldom taken into account for the game design and the selection of locations. Instead, player movement is usually analyzed after the fact, i.e. when the game is ready to play. In this paper......-based educational games....

  10. Music and Movement. Beginnings Workshop.

    Science.gov (United States)

    Smith, Cindy; Moore, Thomas; Carlton, Elizabeth B.; Kranowitz, Carol Stock

    2000-01-01

    Four articles address music and movement in early childhood education: (1) "For the Love of Music--and Children"(Cindy Smith); (2) "Music: The Great Connector" (Thomas Moore); (3) "Learning through Music: The Support of Brain Research" (Elizabeth B. Carlton); and (4) "Music and Movement Bring Together Children of…

  11. The ecological movement in France

    International Nuclear Information System (INIS)

    Taccoen, L.B.C.

    1977-01-01

    The anti-nuclear movements in France are part of a broader movement which, following common usage, the author calls the Ecological Movement. In France, the movement can be divided into a fairly small politically oriented core, numerous and varied associations for the defence of the environment, and a number of consumer associations. The movement cannot be classified politically, which accounts for the attitude of the political parties - distrust of the ''ecologists'', but considerable interest in them as voters. Those with responsibility for power generation must explain to the population at large the energy problem and the importance of economic growth in raising wages and reducing unemployment. They must also explain why nuclear power generation is one of the safest technologies existing at present. (author)

  12. On Biometrics With Eye Movements.

    Science.gov (United States)

    Zhang, Youming; Juhola, Martti

    2017-09-01

    Eye movements are a relatively novel data source for biometric identification. When video cameras applied to eye tracking become smaller and more efficient, this data source could offer interesting opportunities for the development of eye movement biometrics. In this paper, we study primarily biometric identification as seen as a classification task of multiple classes, and secondarily biometric verification considered as binary classification. Our research is based on the saccadic eye movement signal measurements from 109 young subjects. In order to test the data measured, we use a procedure of biometric identification according to the one-versus-one (subject) principle. In a development from our previous research, which also involved biometric verification based on saccadic eye movements, we now apply another eye movement tracker device with a higher sampling frequency of 250 Hz. The results obtained are good, with correct identification rates at 80-90% at their best.

  13. Eye movement perimetry in glaucoma.

    Science.gov (United States)

    Trope, G E; Eizenman, M; Coyle, E

    1989-08-01

    Present-day computerized perimetry is often inaccurate and unreliable owing to the need to maintain central fixation over long periods while repressing the normal response to presentation of peripheral stimuli. We tested a new method of perimetry that does not require prolonged central fixation. During this test eye movements were encouraged on presentation of a peripheral target. Twenty-three eyes were studied with an Octopus perimeter, with a technician monitoring eye movements. The sensitivity was 100% and the specificity 23%. The low specificity was due to the technician's inability to accurately monitor small eye movements in the central 6 degrees field. If small eye movements are monitored accurately with an eye tracker, eye movement perimetry could become an alternative method to standard perimetry.

  14. Domain IV voltage-sensor movement is both sufficient and rate limiting for fast inactivation in sodium channels.

    Science.gov (United States)

    Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron

    2013-08-01

    Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.

  15. Quick charge battery

    Energy Technology Data Exchange (ETDEWEB)

    Parise, R.J.

    1998-07-01

    Electric and hybrid electric vehicles (EVs and HEVs) will become a significant reality in the near future of the automotive industry. Both types of vehicles will need a means to store energy on board. For the present, the method of choice would be lead-acid batteries, with the HEV having auxiliary power supplied by a small internal combustion engine. One of the main drawbacks to lead-acid batteries is internal heat generation as a natural consequence of the charging process as well as resistance losses. This limits the re-charging rate to the battery pack for an EV which has a range of about 80 miles. A quick turnaround on recharge is needed but not yet possible. One of the limiting factors is the heat buildup. For the HEV the auxiliary power unit provides a continuous charge to the battery pack. Therefore heat generation in the lead-acid battery is a constant problem that must be addressed. Presented here is a battery that is capable of quick charging, the Quick Charge Battery with Thermal Management. This is an electrochemical battery, typically a lead-acid battery, without the inherent thermal management problems that have been present in the past. The battery can be used in an all-electric vehicle, a hybrid-electric vehicle or an internal combustion engine vehicle, as well as in other applications that utilize secondary batteries. This is not restricted to only lead-acid batteries. The concept and technology are flexible enough to use in any secondary battery application where thermal management of the battery must be addressed, especially during charging. Any battery with temperature constraints can benefit from this advancement in the state of the art of battery manufacturing. This can also include nickel-cadmium, metal-air, nickel hydroxide, zinc-chloride or any other type of battery whose performance is affected by the temperature control of the interior as well as the exterior of the battery.

  16. Charge transfer in astrophysical nebulae

    International Nuclear Information System (INIS)

    Shields, G.A.

    1990-01-01

    Charge transfer has become a standard ingredient in models of ionized nebulae, supernovae remnants and active galactic nuclei. Charge transfer rate coefficients and the physics of ionized nebulae are considered. Charge transfer is applied to the ionization structure and line emission of ionized nebulae. Photoionized nebulae observations are used to test theoretical predictions of charge transfer rates. (author)

  17. Sources for charged particles

    International Nuclear Information System (INIS)

    Arianer, J.

    1997-01-01

    This document is a basic course on charged particle sources for post-graduate students and thematic schools on large facilities and accelerator physics. A simple but precise description of the creation and the emission of charged particles is presented. This course relies on every year upgraded reference documents. Following relevant topics are considered: electronic emission processes, technological and practical considerations on electron guns, positron sources, production of neutral atoms, ionization, plasma and discharge, different types of positive and negative ion sources, polarized particle sources, materials for the construction of ion sources, low energy beam production and transport. (N.T.)

  18. Charge pulse preamplifier

    International Nuclear Information System (INIS)

    Libs, Gerard.

    1973-01-01

    A charge pulse preamplifier with very low background noise is described. The inlet stage of that preamplifier comprises a cooled field-effect transistor receiving the signal to be amplified at its gate input. Preferably, the charge resistor of said transistor is a field effect transistor, the source inlet of which is connected to the drain inlet of the former transistor through a self-induction coil and a resistor mounted in series. This can be applied to the treatment of the signals delivered by a particle detector in the form of a semi-conductor [fr

  19. Movement disorders in hereditary ataxias.

    Science.gov (United States)

    Garcia Ruiz, Pedro J; Mayo, David; Hernandez, Jaime; Cantarero, Susana; Ayuso, Carmen

    2002-10-15

    Movement disorders are well known features of some dominant hereditary ataxias (HA), specially SCA3/Machado-Joseph disease and dentatorubropallidolusyan atrophy. However, little is known about the existence and classification of movement disorders in other dominant and recessive ataxias. We prospectively studied the presence of movement disorders in patients referred for HA over the last 3 years. Only those patients with a confirmed family history of ataxia were included. We studied 84 cases of HA, including 46 cases of recessive and 38 cases of dominant HA. Thirty out of 46 cases of recessive HA could be classified as: Friedreich ataxia (FA), 29 cases; vitamin E deficiency, 1 case. Twenty-three out of 38 cases of dominant HA could be classified as: SCA 2, 4 cases; SCA 3, 8 cases; SCA 6, 4 cases; SCA 7, 6 cases and SCA 8, 1 case. We observed movement disorders in 20/38 (52%) patients with dominant HA and 25/46 (54%) cases with recessive HA, including 16 patients (16/29) with FA. In general, postural tremor was the most frequent observed movement disorder (27 cases), followed by dystonia (22 cases). Five patients had akinetic rigid syndrome, and in 13 cases, several movement disorders coexisted. Movement disorders are frequent findings in HA, not only in dominant HA but also in recessive HA. Copyright 2002 Elsevier Science B.V.

  20. Does the cerebellum initiate movement?

    Science.gov (United States)

    Thach, W T

    2014-02-01

    Opinion is divided on what the exact function of the cerebellum is. Experiments are summarized that support the following views: (1) the cerebellum is a combiner of multiple movement factors; (2) it contains anatomically fixed permanent focal representation of individual body parts (muscles and segments) and movement modes (e.g., vestibular driven vs. cognitive driven); (3) it contains flexible changing representations/memory of physical properties of the body parts including muscle strength, segment inertia, joint viscosity, and segmental interaction torques (dynamics); (4) it contains mechanisms for learning and storage of the properties in item no. 3 through trial-and-error practice; (5) it provides for linkage of body parts, motor modes, and motordynamics via the parallel fiber system; (6) it combines and integrates the many factors so as to initiate coordinated movements of the many body parts; (7) it is thus enabled to play the unique role of initiating coordinated movements; and (8) this unique causative role is evidenced by the fact that: (a) electrical stimulation of the cerebellum can initiate compound coordinated movements; (b) in naturally initiated compound movements, cerebellar discharge precedes that in downstream target structures such as motor cerebral cortex; and (c) cerebellar ablation abolishes the natural production of compound movements in the awake alert individuals.

  1. Jellyfish movement data - Determining Movement Patterns of Jellyfish

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This project is to determine horizontal and vertical movement patterns of two jellyfish species in Hood Canal, in relation to environmental variables. It is being...

  2. Magnetoencephalographic study on facial movements

    Directory of Open Access Journals (Sweden)

    Kensaku eMiki

    2014-07-01

    Full Text Available In this review, we introduced our three studies that focused on facial movements. In the first study, we examined the temporal characteristics of neural responses elicited by viewing mouth movements, and assessed differences between the responses to mouth opening and closing movements and an averting eyes condition. Our results showed that the occipitotemporal area, the human MT/V5 homologue, was active in the perception of both mouth and eye motions. Viewing mouth and eye movements did not elicit significantly different activity in the occipitotemporal area, which indicated that perception of the movement of facial parts may be processed in the same manner, and this is different from motion in general. In the second study, we investigated whether early activity in the occipitotemporal region evoked by eye movements was influenced by a face contour and/or features such as the mouth. Our results revealed specific information processing for eye movements in the occipitotemporal region, and this activity was significantly influenced by whether movements appeared with the facial contour and/or features, in other words, whether the eyes moved, even if the movement itself was the same. In the third study, we examined the effects of inverting the facial contour (hair and chin and features (eyes, nose, and mouth on processing for static and dynamic face perception. Our results showed the following: (1 In static face perception, activity in the right fusiform area was affected more by the inversion of features while that in the left fusiform area was affected more by a disruption in the spatial relationship between the contour and features, and (2 In dynamic face perception, activity in the right occipitotemporal area was affected by the inversion of the facial contour.

  3. Dance movement therapy for dementia.

    Science.gov (United States)

    Karkou, Vicky; Meekums, Bonnie

    2017-02-03

    Dementia is a collective name for different degenerative brain syndromes which, according to Alzheimer's Disease International, affects approximately 35.6 million people worldwide. The latest NICE guideline for dementia highlights the value of diverse treatment options for the different stages and symptoms of dementia including non-pharmacological treatments. Relevant literature also argues for the value of interventions that acknowledge the complexity of the condition and address the person as a whole, including their physical, emotional, social and cognitive processes. At the same time, there is growing literature that highlights the capacity of the arts and embodied practices to address this complexity. Dance movement therapy is an embodied psychological intervention that can address complexity and thus, may be useful for people with dementia, but its effectiveness remains unclear. To assess the effects of dance movement therapy on behavioural, social, cognitive and emotional symptoms of people with dementia in comparison to no treatment, standard care or any other treatment. Also, to compare different forms of dance movement therapy (e.g. Laban-based dance movement therapy, Chacian dance movement therapy or Authentic Movement). Searches took place up to March 2016 through ALOIS, Cochrane Dementia and Cognitive Improvement's Specialized Register, which covers CENTRAL, a number of major healthcare databases and trial registers, and grey literature sources. We checked bibliographies of relevant studies and reviews, and contacted professional associations, educational programmes and experts from around the world. We considered randomised controlled trials (RCTs) in any language, including cross-over design and cluster-RCTs for inclusion. Studies considered had to include people with dementia, in any age group and in any setting, with interventions delivered by a dance movement therapy practitioner who (i) had received formal training (ii) was a dance movement

  4. Air movement - good or bad?

    DEFF Research Database (Denmark)

    Toftum, Jørn

    2004-01-01

    when air movement is desirable and when it is not. At temperatures up to 22-23oC, at sedentary activity and with occupants feeling neutral or cooler there is a risk of air movement being perceived as unacceptable, even at low velocities. In particular, a cool overall thermal sensation negatively...... influences the subjective perception of air movement. With occupants feeling warmer than neutral, at temperatures above 23oC or at raised activity levels, humans generally do not feel draught at air velocities typical for indoor environments (up to around 0.4 m/s). In the higher temperature range, very high...

  5. Charge transport problem

    International Nuclear Information System (INIS)

    Lee, E.P.

    1977-01-01

    In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop

  6. Resonance charge exchange processes

    International Nuclear Information System (INIS)

    Duman, E.L.; Evseev, A.V.; Eletskij, A.V.; Radtsig, A.A.; Smirnov, B.M.

    1979-01-01

    The calculation results for the resonance charge exchange cross sections for positive and negative atomic and molecular ions are given. The calculations are performed on the basis of the asymptotic theory. The factors affecting the calculation accuracy are analysed. The calculation data for 28 systems are compared with the experiment

  7. Charged particle beams

    CERN Document Server

    Humphries, Stanley

    2013-01-01

    Detailed enough for a text and sufficiently comprehensive for a reference, this volume addresses topics vital to understanding high-power accelerators and high-brightness-charged particle beams. Subjects include stochastic cooling, high-brightness injectors, and the free electron laser. Humphries provides students with the critical skills necessary for the problem-solving insights unique to collective physics problems. 1990 edition.

  8. Charged fluids with symmetries

    Indian Academy of Sciences (India)

    It is possible to introduce many types of symmetries on the manifold which restrict the ... metric tensor field and generate constants of the motion along null geodesics .... In this analysis we have studied the role of symmetries for charged perfect ...

  9. Charged singularities: repulsive effects

    Energy Technology Data Exchange (ETDEWEB)

    De Felice, F; Nobili, L [Padua Univ. (Italy). Ist. di Fisica; Calvani, M [Padua Univ. (Italy). Ist. di Astronomia

    1980-07-01

    The repulsive phenomena which a particle experiences in the vicinity of a naked singularity are investigated in the Kerr-Newman space-time. The aim is to extend the knowledge of this fact to charged solutions and to have a direct indication of how, in these situations, the gravitational and electrostatic interactions are competing.

  10. Fractional charge search

    International Nuclear Information System (INIS)

    Innes, W.; Klein, S.; Perl, M.; Price, J.C.

    1982-06-01

    A device to search for fractional charge in matter is described. The sample is coupled to a low-noise amplifier by a periodically varying capacitor and the resulting signal is synchronously detected. The varying capacitor is constructed as a rapidly spinning wheel. Samples of any material in volumes of up to 0.05 ml may be searched in less than an hour

  11. Surgical management of movement disorders

    African Journals Online (AJOL)

    together as movement disorders (e.g. Parkinson's disease, dystonia, essential tremor) is with medication and, in some, with ... Stereotactic lesioning of basal ganglia and/or thalamic targets ... and there is some concern related to suicide.

  12. Neuroimaging findings in movement disorders

    International Nuclear Information System (INIS)

    Topalov, N.

    2015-01-01

    Full text: Neuroimaging methods are of great importance for the differential diagnostic delimitation of movement disorders associated with structural damage (neoplasms, ischemic lesions, neuroinfections) from those associated with specific pathophysiological mechanisms (dysmetabolic disorders, neurotransmitter disorders). Learning objective: Presentation of typical imaging findings contributing to nosological differentiation in groups of movement disorders with similar clinical signs. In this presentation are discussed neuroimaging findings in Parkinson‘s disease, atypical parkinsonian syndromes (multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration), parkinsonism in genetically mediated diseases (Wilson’s disease, pantothenate kinase-associated neurodegeneration – PKAN), vascular parkinsonism, hyperkinetic movement disorders (palatal tremor, Huntington‘s chorea, symptomatic chorea in ischemic stroke and diabetes, rubral tremor, ballismus, hemifacial spasm). Contemporary neuroimaging methods enable support for diagnostic and differential diagnostic precision of a number of hypo- and hyperkinetic movement disorders, which is essential for neurological clinical practice

  13. Eye Movements When Viewing Advertisements

    Directory of Open Access Journals (Sweden)

    Emily eHiggins

    2014-03-01

    Full Text Available In this selective review, we examine key findings on eye movements when viewing advertisements. We begin with a brief, general introduction to the properties and neural underpinnings of saccadic eye movements. Next, we provide an overview of eye movement behavior during reading, scene perception, and visual search, since each of these activities is, at various times, involved in viewing ads. We then review the literature on eye movements when viewing print ads and warning labels (of the kind that appear on alcohol and tobacco ads, before turning to a consideration of advertisements in dynamic media (television and the Internet. Finally, we propose topics and methodological approaches that may prove to be useful in future research.

  14. Healthy Movements: Your Body's Mechanics

    Science.gov (United States)

    ... body, are governed by the same basic physical laws,” says Dr. Jeffrey Weiss, a biomechanics expert at ... for movement disorders such as cerebral palsy and Parkinson’s disease. Joints are a common source of problems ...

  15. Game Movement as Enactive Focalization

    Directory of Open Access Journals (Sweden)

    Yotam Shibolet

    2018-01-01

    Full Text Available This paper integrates thought on game narrative and embodied cognition, in order to consider the significance of movement to the embodied narrative experience of games. If games are a mode of ‘environmental storytelling’, determining the player’s mobile situatedness within the gamespace is of crucial importance. The metaphor of game design as narrative architecture should be expanded to include te the design of movement dynamics, alongside geographical gamespace. I suggest a theoretical infrastructure that aims to enable further analysis of movement design’s role in this scope. The theory of enactive perception asserts that all perception is inherently negotiated through embodied understanding of moving within environment. According to this model, by giving meaning to perception, movement is also directly related to the structure of consciousness and thought. Cognitive definitions of ‘narrative’ that integrate embodiment are applied to argue it can relevantly account for part of thought’s role in enactive perception. Mieke Bal’s concept of focalization (1997 broaches narrative perspective by underscoring the constant “movement of the look”. For enactive perception, such mobility should be understood as inseparable from the movement of the body even when perspective could appear detached from embodiment. Therefore, I offer the supplementary concept of “enactive focalization” – narrative perception as interpreted through the interconnected dynamics or perspectival and physical movement. To exemplify my ideas and the potential of future research in this scope, I discuss the uniquely effective and affective movement dynamic design of Journey. This paper concludes by reflecting on enactive focalization in light of the increased utilization of embodiment in the contemporary digital media landscape.

  16. Study of talcum charging status in parallel plate electrostatic separator based on particle trajectory analysis

    Science.gov (United States)

    Yunxiao, CAO; Zhiqiang, WANG; Jinjun, WANG; Guofeng, LI

    2018-05-01

    Electrostatic separation has been extensively used in mineral processing, and has the potential to separate gangue minerals from raw talcum ore. As for electrostatic separation, the particle charging status is one of important influence factors. To describe the talcum particle charging status in a parallel plate electrostatic separator accurately, this paper proposes a modern images processing method. Based on the actual trajectories obtained from sequence images of particle movement and the analysis of physical forces applied on a charged particle, a numerical model is built, which could calculate the charge-to-mass ratios represented as the charging status of particle and simulate the particle trajectories. The simulated trajectories agree well with the experimental results obtained by images processing. In addition, chemical composition analysis is employed to reveal the relationship between ferrum gangue mineral content and charge-to-mass ratios. Research results show that the proposed method is effective for describing the particle charging status in electrostatic separation.

  17. Effect of surface topography and morphology on space charge packets in polyethylene

    International Nuclear Information System (INIS)

    Zhou Yuanxiang; Wang Yunshan; Sun Qinghua; Wang Ninghua

    2009-01-01

    Polyethylene (PE) is a major kind of internal insulating material. With great progresses of space charge measurement technologies in the last three decades, lots of researches are focused on space charge in PE. The heat pressing and annealing condition of polyethylene affect its morphology obviously. During the heat pressing, the surface of PE forms different surface topographies because of different substrate materials. Surface topography has great relation to the epitaxial crystallization layer and influences the space charge characteristic of PE dramatically. This paper studied the formation process of different surface topographies and their micrographic characters in low density polyethylene (LDPE). pulsed electro-acoustic (PEA) method was used to measure the space charge distribution of samples with different surface topographies and morphologies in LDPE. The effect of surface topography and morphology to space charge packet were studied. The surface topography has great influence on space charge packet polarity and morphology has influence on both movement speed rate and polarity of space charge packet.

  18. THE MOVEMENT SYSTEM IN EDUCATION.

    Science.gov (United States)

    Hoogenboom, Barbara J; Sulavik, Mark

    2017-11-01

    Although many physical therapists have begun to focus on movement and function in clinical practice, a significant number continue to focus on impairments or pathoanatomic models to direct interventions. This paradigm may be driven by the current models used to direct and guide curricula used for physical therapist education. The methods by which students are educated may contribute to a focus on independent systems, rather than viewing the body as a functional whole. Students who enter practice must be able to integrate information across multiple systems that affect a patient or client's movement and function. Such integration must be taught to students and it is the responsibility of those in physical therapist education to embrace and teach the next generation of students this identifying professional paradigm of the movement system. The purpose of this clinical commentary is to describe the current state of the movement system in physical therapy education, suggest strategies for enhancing movement system focus in entry level education, and envision the future of physical therapy education related to the movement system. Contributions by a student author offer depth and perspective to the ideas and suggestions presented. 5.

  19. The movement ecology of seagrasses.

    Science.gov (United States)

    McMahon, Kathryn; van Dijk, Kor-Jent; Ruiz-Montoya, Leonardo; Kendrick, Gary A; Krauss, Siegfried L; Waycott, Michelle; Verduin, Jennifer; Lowe, Ryan; Statton, John; Brown, Eloise; Duarte, Carlos

    2014-11-22

    A movement ecology framework is applied to enhance our understanding of the causes, mechanisms and consequences of movement in seagrasses: marine, clonal, flowering plants. Four life-history stages of seagrasses can move: pollen, sexual propagules, vegetative fragments and the spread of individuals through clonal growth. Movement occurs on the water surface, in the water column, on or in the sediment, via animal vectors and through spreading clones. A capacity for long-distance dispersal and demographic connectivity over multiple timeframes is the novel feature of the movement ecology of seagrasses with significant evolutionary and ecological consequences. The space-time movement footprint of different life-history stages varies. For example, the distance moved by reproductive propagules and vegetative expansion via clonal growth is similar, but the timescales range exponentially, from hours to months or centuries to millennia, respectively. Consequently, environmental factors and key traits that interact to influence movement also operate on vastly different spatial and temporal scales. Six key future research areas have been identified.

  20. Movement games in sports training of children

    OpenAIRE

    Komoň, Tomáš

    2015-01-01

    Title: Movement Games in Sports Training of Children Objectives: Create a systemized inventory of movement games. Movement games categorized according to which football skills can developed. Verify popularity of the each movement game in simple questionnaire. Methods: The literature search and data analysis. Also, quantitative research in the form of a simple questionnaire. Results: Systematized inventory of 39 movement games with methodological descriptions. Each movement game has feedback i...

  1. Irrational Charge from Topological Order

    Science.gov (United States)

    Moessner, R.; Sondhi, S. L.

    2010-10-01

    Topological or deconfined phases of matter exhibit emergent gauge fields and quasiparticles that carry a corresponding gauge charge. In systems with an intrinsic conserved U(1) charge, such as all electronic systems where the Coulombic charge plays this role, these quasiparticles are also characterized by their intrinsic charge. We show that one can take advantage of the topological order fairly generally to produce periodic Hamiltonians which endow the quasiparticles with continuously variable, generically irrational, intrinsic charges. Examples include various topologically ordered lattice models, the three-dimensional resonating valence bond liquid on bipartite lattices as well as water and spin ice. By contrast, the gauge charges of the quasiparticles retain their quantized values.

  2. Effects of Discrete Charge Clustering in Simulations of Charged Interfaces.

    Science.gov (United States)

    Grime, John M A; Khan, Malek O

    2010-10-12

    A system of counterions between charged surfaces is investigated, with the surfaces represented by uniform charged planes and three different arrangements of discrete surface charges - an equispaced grid and two different clustered arrangements. The behaviors of a series of systems with identical net surface charge density are examined, with particular emphasis placed on the long ranged corrections via the method of "charged slabs" and the effects of the simulation cell size. Marked differences are observed in counterion distributions and the osmotic pressure dependent on the particular representation of the charged surfaces; the uniformly charged surfaces and equispaced grids of discrete charge behave in a broadly similar manner, but the clustered systems display a pronounced decrease in osmotic pressure as the simulation size is increased. The influence of the long ranged correction is shown to be minimal for all but the very smallest of system sizes.

  3. Trap-controlled charge transport in corona-charged Teflon

    International Nuclear Information System (INIS)

    Gross, B.; Giacometti, J.A.; Ferreira, G.F.L.; Moreno A, R.A.

    1980-01-01

    The stability of negatively charged Teflon electrets is discussed. It is stated that it can only be explained by the assumption that the transport of excess charge is trap - controlled rather than mobility - controlled. (I.C.R.) [pt

  4. Charge exchange cross-sections for multiply charged ions

    International Nuclear Information System (INIS)

    Midha, J.M.; Gupta, S.C.

    1990-01-01

    A new empirical relation for charge exchange cross-section has been proposed for different charge states of C, N and O colliding with neutral hydrogen. Results are compared with the experimental data. (Author)

  5. Understanding movement data and movement processes: current and emerging directions.

    Science.gov (United States)

    Schick, Robert S; Loarie, Scott R; Colchero, Fernando; Best, Benjamin D; Boustany, Andre; Conde, Dalia A; Halpin, Patrick N; Joppa, Lucas N; McClellan, Catherine M; Clark, James S

    2008-12-01

    Animal movement has been the focus on much theoretical and empirical work in ecology over the last 25 years. By studying the causes and consequences of individual movement, ecologists have gained greater insight into the behavior of individuals and the spatial dynamics of populations at increasingly higher levels of organization. In particular, ecologists have focused on the interaction between individuals and their environment in an effort to understand future impacts from habitat loss and climate change. Tools to examine this interaction have included: fractal analysis, first passage time, Lévy flights, multi-behavioral analysis, hidden markov models, and state-space models. Concurrent with the development of movement models has been an increase in the sophistication and availability of hierarchical bayesian models. In this review we bring these two threads together by using hierarchical structures as a framework for reviewing individual models. We synthesize emerging themes in movement ecology, and propose a new hierarchical model for animal movement that builds on these emerging themes. This model moves away from traditional random walks, and instead focuses inference on how moving animals with complex behavior interact with their landscape and make choices about its suitability.

  6. Measurement of Neutrino Induced, Charged Current, Charged Pion Production

    Energy Technology Data Exchange (ETDEWEB)

    Wilking, Michael Joseph [Univ. of Colorado, Boulder, CO (United States)

    2009-05-01

    Neutrinos are among the least understood particles in the standard model of particle physics. At neutrino energies in the 1 GeV range, neutrino properties are typically determined by observing the outgoing charged lepton produced in a charged current quasi-elastic interactions. The largest charged current background to these measurements comes from charged current pion production interactions, for which there is very little available data.

  7. Effects of Macroion Geometry and Charge Discretization in Charge Reversal

    OpenAIRE

    Mukherjee, Arup K.

    2008-01-01

    The effects of discrete macroion surface charge distribution and valences of these surface charges and counterions on charge reversal have been studied for macroions of three different geometries and compared with those of continuous surface charge distributions. The geometry of the macroion has been observed to play an important role in overcharging in these cases. The interplay of valences of discrete microions and counterions have noticeable effects on overcharging efficiency. For some val...

  8. Charged particle accelerator

    International Nuclear Information System (INIS)

    Ress, T.I.; Nolde, G.V.

    1974-01-01

    A charged particle accelerator is described. It is made of an enclosure arranged for channeling a stream of charged particles along a predetermined path, and propelling means juxtaposed to said enclosure for generating therein a magnetic field moving in a predetermined direction with respect to each point of said path, the magnetic flux vector of that field being transverse to that path at every point, which gives the particles, along said path, a velocity connected to that of the mobile field by a predetermined relation. This can be applied to the fast production of chemical compounds, to the emission of neutrons and of thermal energy, and to the production of mechanical energy for propelling space ships [fr

  9. Charged particle accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Ress, T I; Nolde, G V

    1974-11-25

    A charged particle accelerator is described. It is made of an enclosure arranged for channeling a stream of charged particles along a predetermined path, and propelling means juxtaposed to the enclosure for generating a magnetic field moving in a predetermined direction with respect to each point of the path, the magnetic flux vector of that field being transverse to that path at every point, which gives the particles, along said path, a velocity connected to that of the mobile field by a predetermined relation. This can be applied to the fast production of chemical compounds, to the emission of neutrons and of thermal energy, and to the production of mechanical energy for propelling space ships.

  10. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  11. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  12. Spacecraft Charge Monitor

    Science.gov (United States)

    Goembel, L.

    2003-12-01

    We are currently developing a flight prototype Spacecraft Charge Monitor (SCM) with support from NASA's Small Business Innovation Research (SBIR) program. The device will use a recently proposed high energy-resolution electron spectroscopic technique to determine spacecraft floating potential. The inspiration for the technique came from data collected by the Atmosphere Explorer (AE) satellites in the 1970s. The data available from the AE satellites indicate that the SCM may be able to determine spacecraft floating potential to within 0.1 V under certain conditions. Such accurate measurement of spacecraft charge could be used to correct biases in space plasma measurements. The device may also be able to measure spacecraft floating potential in the solar wind and in orbit around other planets.

  13. The quasilocalized charge approximation

    International Nuclear Information System (INIS)

    Kalman, G J; Golden, K I; Donko, Z; Hartmann, P

    2005-01-01

    The quasilocalized charge approximation (QLCA) has been used for some time as a formalism for the calculation of the dielectric response and for determining the collective mode dispersion in strongly coupled Coulomb and Yukawa liquids. The approach is based on a microscopic model in which the charges are quasilocalized on a short-time scale in local potential fluctuations. We review the conceptual basis and theoretical structure of the QLC approach and together with recent results from molecular dynamics simulations that corroborate and quantify the theoretical concepts. We also summarize the major applications of the QLCA to various physical systems, combined with the corresponding results of the molecular dynamics simulations and point out the general agreement and instances of disagreement between the two

  14. Extremally charged line

    International Nuclear Information System (INIS)

    Ryzner, Jirí; Žofka, Martin

    2016-01-01

    We investigate the properties of a static, cylindrically symmetric Majumdar–Papapetrou-type solution of Einstein–Maxwell equations. We locate its singularities, establish its algebraic type, find its asymptotic properties and weak-field limit, study the structure of electrogeodesics, and determine the mass and charge of its sources. We provide an interpretation of the spacetime and discuss the parameter appearing in the metric. (paper)

  15. Hidden charged dark matter

    International Nuclear Information System (INIS)

    Feng, Jonathan L.; Kaplinghat, Manoj; Tu, Huitzu; Yu, Hai-Bo

    2009-01-01

    Can dark matter be stabilized by charge conservation, just as the electron is in the standard model? We examine the possibility that dark matter is hidden, that is, neutral under all standard model gauge interactions, but charged under an exact (\\rm U)(1) gauge symmetry of the hidden sector. Such candidates are predicted in WIMPless models, supersymmetric models in which hidden dark matter has the desired thermal relic density for a wide range of masses. Hidden charged dark matter has many novel properties not shared by neutral dark matter: (1) bound state formation and Sommerfeld-enhanced annihilation after chemical freeze out may reduce its relic density, (2) similar effects greatly enhance dark matter annihilation in protohalos at redshifts of z ∼ 30, (3) Compton scattering off hidden photons delays kinetic decoupling, suppressing small scale structure, and (4) Rutherford scattering makes such dark matter self-interacting and collisional, potentially impacting properties of the Bullet Cluster and the observed morphology of galactic halos. We analyze all of these effects in a WIMPless model in which the hidden sector is a simplified version of the minimal supersymmetric standard model and the dark matter is a hidden sector stau. We find that charged hidden dark matter is viable and consistent with the correct relic density for reasonable model parameters and dark matter masses in the range 1 GeV ∼ X ∼< 10 TeV. At the same time, in the preferred range of parameters, this model predicts cores in the dark matter halos of small galaxies and other halo properties that may be within the reach of future observations. These models therefore provide a viable and well-motivated framework for collisional dark matter with Sommerfeld enhancement, with novel implications for astrophysics and dark matter searches

  16. Controlling charge on levitating drops.

    Science.gov (United States)

    Hilger, Ryan T; Westphall, Michael S; Smith, Lloyd M

    2007-08-01

    Levitation technologies are used in containerless processing of materials, as microscale manipulators and reactors, and in the study of single drops and particles. Presented here is a method for controlling the amount and polarity of charge on a levitating drop. The method uses single-axis acoustic levitation to trap and levitate a single, initially neutral drop with a diameter between 400 microm and 2 mm. This drop is then charged in a controllable manner using discrete packets of charge in the form of charged drops produced by a piezoelectric drop-on-demand dispenser equipped with a charging electrode. The magnitude of the charge on the dispensed drops can be adjusted by varying the voltage applied to the charging electrode. The polarity of the charge on the added drops can be changed allowing removal of charge from the trapped drop (by neutralization) and polarity reversal. The maximum amount of added charge is limited by repulsion of like charges between the drops in the trap. This charging scheme can aid in micromanipulation and the study of charged drops and particles using levitation.

  17. Mindful movement and skilled attention

    Science.gov (United States)

    Clark, Dav; Schumann, Frank; Mostofsky, Stewart H.

    2015-01-01

    Bodily movement has long been employed as a foundation for cultivating mental skills such as attention, self-control or mindfulness, with recent studies documenting the positive impacts of mindful movement training, such as yoga and tai chi. A parallel “mind-body connection” has also been observed in many developmental disorders. We elaborate a spectrum of mindfulness by considering ADHD, in which deficient motor control correlates with impaired (disinhibited) behavioral control contributing to defining features of excessive distractibility and impulsivity. These data provide evidence for an important axis of variation for wellbeing, in which skillful cognitive control covaries with a capacity for skillful movement. We review empirical and theoretical literature on attention, cognitive control, mind wandering, mindfulness and skill learning, endorsing a model of skilled attention in which motor plans, attention, and executive goals are seen as mutually co-defining aspects of skilled behavior that are linked by reciprocal inhibitory and excitatory connections. Thus, any movement training should engage “higher-order” inhibition and selection and develop a repertoire of rehearsed procedures that coordinate goals, attention and motor plans. However, we propose that mindful movement practice may improve the functional quality of rehearsed procedures, cultivating a transferrable skill of attention. We adopt Langer’s spectrum of mindful learning that spans from “mindlessness” to engagement with the details of the present task and contrast this with the mental attitudes cultivated in standard mindfulness meditation. We particularly follow Feldenkrais’ suggestion that mindful learning of skills for organizing the body in movement might transfer to other forms of mental activity. The results of mindful movement training should be observed in multiple complementary measures, and may have tremendous potential benefit for individuals with ADHD and other

  18. Mindful Movement and Skilled Attention

    Directory of Open Access Journals (Sweden)

    Dav eClark

    2015-06-01

    Full Text Available Bodily movement has long been employed as a foundation for cultivating mental skills such as attention, self-control or mindfulness, with recent studies documenting the positive impacts of mindful movement training, such as yoga and tai chi. A parallel mind-body connection has also been observed in many developmental disorders. We elaborate a spectrum of mindfulness by considering ADHD, in which deficient motor control correlates with impaired (disinhibited behavioral control contributing to defining features of excessive distractibility and impulsivity. These data provide evidence for an important axis of variation for wellbeing, in which skillful cognitive control covaries with a capacity for skillful movement. We review empirical and theoretical literature on attention, cognitive control, mind wandering, mindfulness and skill learning, endorsing a model of skilled attention in which motor plans, attention, and executive goals are seen as mutually co-defining aspects of skilled behavior that are linked by reciprocal inhibitory and excitatory connections. Thus, any movement training should engage higher-order inhibition and selection and develop a repertoire of rehearsed procedures that coordinate goals, attention and motor plans. However, we propose that mindful movement practice may improve the functional quality of rehearsed procedures, cultivating a transferrable skill of attention. We adopt Langer’s spectrum of mindful learning that spans from mindlessness to engagement with the details of the present task and contrast this with the mental attitudes cultivated in standard mindfulness meditation. We particularly follow Feldenkrais’ suggestion that mindful learning of skills for organizing the body in movement might transfer to other forms of mental activity. The results of mindful movement training should be observed in multiple complementary measures, and may have tremendous potential benefit for individuals with ADHD and other

  19. Charge states of ions, and mechanisms of charge ordering transitions

    Science.gov (United States)

    Pickett, Warren E.; Quan, Yundi; Pardo, Victor

    2014-07-01

    To gain insight into the mechanism of charge ordering transitions, which conventionally are pictured as a disproportionation of an ion M as 2Mn+→M(n+1)+ + M(n-1)+, we (1) review and reconsider the charge state (or oxidation number) picture itself, (2) introduce new results for the putative charge ordering compound AgNiO2 and the dual charge state insulator AgO, and (3) analyze the cationic occupations of the actual (not formal) charge, and work to reconcile the conundrums that arise. We establish that several of the clearest cases of charge ordering transitions involve no disproportion (no charge transfer between the cations, and hence no charge ordering), and that the experimental data used to support charge ordering can be accounted for within density functional-based calculations that contain no charge transfer between cations. We propose that the charge state picture retains meaning and importance, at least in many cases, if one focuses on Wannier functions rather than atomic orbitals. The challenge of modeling charge ordering transitions with model Hamiltonians isdiscussed.

  20. Search for fractional charge

    International Nuclear Information System (INIS)

    Turner, R.E.

    1984-01-01

    A search was made for fractional charges of the form Z plus two-thirds e, where Z is an integer. It was assumed that the charges exist in natural form bound with other fractional charges in neutral molecules. It was further assumed that these neutral molecules are present in air. Two concentration schemes were employed. One sample was derived from the waste gases from a xenon distillation plant. This assumes that high mass, low vapor pressure components of air are concentrated along with the xenon. The second sample involved ionizing air, allowing a brief recombination period, and then collecting residual ions on the surface of titanium discs. Both samples were analyzed at the University of Rochester in a system using a tandem Van de Graff to accelerate particles through an essentially electrostatic beam handling system. The detector system employed both a Time of Flight and an energy-sensitive gas ionization detector. In the most sensitive mode of analysis, a gas absorber was inserted in the beam path to block the intense background. The presence of an absorber limited the search to highly penetrating particles. Effectively, this limited the search to particles with low Z and masses greater than roughly fifty GeV. The final sensitivities attained were on the order of 1 x 10 -20 for the ionized air sample and 1 x 10 -21 for the gas sample. A discussion of the caveats that could reduce the actual level of sensitivity is included

  1. Charged Particle Radiography

    International Nuclear Information System (INIS)

    Morris, Chris

    2004-01-01

    The Coulomb multiple scattering of charged particles as they pass through material allows them to be used as a radiographic probe. This forms the basis for a new kind of radiography that is finding application where conventional x-ray radiography is limited by flux or backgrounds. Charged-particle radiography is providing a versatile new probe that has advantages over conventional x-ray radiography for some unique application. Proton radiography has been used to make quantitative motion pictures of high explosive driven experiments and proves to be of great value for radiographing experiments that mock up nuclear weapon primaries for stockpile certification. By taking advantage of magnetic lens to magnify images and by using the very bright beams that can be made with electrons, charged-particle radiography may be useful for studying the fine spatial detail and very fast motion in laser driven implosion experiments at the National Ignition Facility. Finally, radiographs can be made using cosmic-ray muons for searching vehicles and cargo containers for surreptitious cargo of high z materials such as uranium or plutonium.

  2. Submerged AUV Charging Station

    Science.gov (United States)

    Jones, Jack A.; Chao, Yi; Curtin, Thomas

    2014-01-01

    Autonomous Underwater Vehicles (AUVs) are becoming increasingly important for military surveillance and mine detection. Most AUVs are battery powered and have limited lifetimes of a few days to a few weeks. This greatly limits the distance that AUVs can travel underwater. Using a series of submerged AUV charging stations, AUVs could travel a limited distance to the next charging station, recharge its batteries, and continue to the next charging station, thus traveling great distances in a relatively short time, similar to the Old West “Pony Express.” One solution is to use temperature differences at various depths in the ocean to produce electricity, which is then stored in a submerged battery. It is preferred to have the upper buoy submerged a reasonable distance below the surface, so as not to be seen from above and not to be inadvertently destroyed by storms or ocean going vessels. In a previous invention, a phase change material (PCM) is melted (expanded) at warm temperatures, for example, 15 °C, and frozen (contracted) at cooler temperatures, for example, 8 °C. Tubes containing the PCM, which could be paraffin such as pentadecane, would be inserted into a container filled with hydraulic oil. When the PCM is melted (expanded), it pushes the oil out into a container that is pressurized to about 3,000 psi (approx equals 20.7 MPa). When a valve is opened, the high-pressure oil passes through a hydraulic motor, which turns a generator and charges a battery. The low-pressure oil is finally reabsorbed into the PCM canister when the PCM tubes are frozen (contracted). Some of the electricity produced could be used to control an external bladder or a motor to the tether line, such that depth cycling is continued for a very long period of time. Alternatively, after the electricity is generated by the hydraulic motor, the exiting low-pressure oil from the hydraulic motor could be vented directly to an external bladder on the AUV, such that filling of the bladder

  3. Gravitational field of charged gyratons

    Energy Technology Data Exchange (ETDEWEB)

    Frolov, Valeri P [Theoretical Physics Institute, University of Alberta, Edmonton, Alberta, T6G 2J1 (Canada); Zelnikov, Andrei [Theoretical Physics Institute, University of Alberta, Edmonton, Alberta, T6G 2J1 (Canada); Lebedev Physics Institute, Leninsky prospect 53, 119 991, Moscow (Russian Federation)

    2006-03-21

    We study relativistic gyratons which carry an electric charge. The Einstein-Maxwell equations in arbitrary dimensions are solved exactly in the case of a charged gyraton propagating in an asymptotically flat metric.

  4. Antinuclear movement in Middle Tennessee

    International Nuclear Information System (INIS)

    Dwyer, L.E.

    1977-01-01

    This is a social anthropological analysis of the antinuclear movement in Middle Tennessee. This social movement was determined to halt the construction of proposed nuclear power plants in Tennessee, especially one the Tennessee Valley Authority (TVA) intended to build in Middle Tennessee. The data for the study were gathered by participant-observation interviewing, and the examination of documents from February 1973 through March 1975. The treatment of the data is based on transactional analysis and portions of the network model. This social movement was composed of a series of informally organized cells connected by a loose network of people who visited and talked with one another. Individual cells tended to be organized on a geographical basis, as was communication. Activity-initiators, however, often contacted antinuclear personnel in other Middle Tennessee cells. Movement activity for many of the antinuclear activists was short-lived. The strategic maneuvers of the movement utilized all the structurally and legally possible alternatives and the nuclear opponents hoped that the public would pressure public officials to oppose nuclear plants. Although the antinuclear activists worked very hard, they did not succeed in halting the planned construction of the Middle Tennessee nuclear plant. Indeed, they had not succeeded in the summer of 1977

  5. Space charge effects of CSR

    International Nuclear Information System (INIS)

    Liu Yong; Xia Jiawen; Xu Xiangyang; Lu Xiaowen; Wu Junli

    2000-01-01

    Cooler Storage Ring (CSR), and upgrading program planned at the Heavy Ion Research Facility in Lanzhou (HIRFL), will supply beams with higher quality and intensity. Space charge effects should be considered due to this magnitude of intensity in CSR. The concept and some phenomena of space charge effects are discussed. Space charge intensity limit and space charge tune shift of normal CSR operation are given. It is of significance for the construction and operation of the future facility

  6. Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films

    Science.gov (United States)

    Röhr, Jason A.; Moia, Davide; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny

    2018-03-01

    Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

  7. Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films.

    Science.gov (United States)

    Röhr, Jason A; Moia, Davide; Haque, Saif A; Kirchartz, Thomas; Nelson, Jenny

    2018-03-14

    Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

  8. Charging Users for Library Service.

    Science.gov (United States)

    Cooper, Michael D.

    1978-01-01

    Examines the question of instituting direct charges for library service, using on-line bibliographic searching as an example, and contrasts this with the current indirect charging system where services are paid for by taxes. Information, as a merit good, should be supplied with or without direct charges, depending upon user status. (CWM)

  9. Tools for charged Higgs bosons

    International Nuclear Information System (INIS)

    Staal, Oscar

    2010-12-01

    We review the status of publicly available software tools applicable to charged Higgs physics. A selection of codes are highlighted in more detail, focusing on new developments that have taken place since the previous charged Higgs workshop in 2008. We conclude that phenomenologists now have the tools ready to face the LHC data. A new web page collecting charged Higgs resources is presented. (orig.)

  10. Detecting rapid mass movements using electrical self-potential measurements

    Science.gov (United States)

    Heinze, Thomas; Limbrock, Jonas; Pudasaini, Shiva P.; Kemna, Andreas

    2017-04-01

    Rapid mass movements are a latent danger for lives and infrastructure in almost any part of the world. Often such mass movements are caused by increasing pore pressure, for example, landslides after heavy rainfall or dam breaking after intrusion of water in the dam. Among several other geophysical methods used to observe water movement, the electrical self-potential method has been applied to a broad range of monitoring studies, especially focusing on volcanism and dam leakage but also during hydraulic fracturing and for earthquake prediction. Electrical self-potential signals may be caused by various mechanisms. Though, the most relevant source of the self-potential field in the given context is the streaming potential, caused by a flowing electrolyte through porous media with electrically charged internal surfaces. So far, existing models focus on monitoring water flow in non-deformable porous media. However, as the self-potential is sensitive to hydraulic parameters of the soil, any change in these parameters will cause an alteration of the electric signal. Mass movement will significantly influence the hydraulic parameters of the solid as well as the pressure field, assuming that fluid movement is faster than the pressure diffusion. We will present results of laboratory experiments under drained and undrained conditions with fluid triggered as well as manually triggered mass movements, monitored with self-potential measurements. For the undrained scenarios, we observe a clear correlation between the mass movements and signals in the electric potential, which clearly differ from the underlying potential variations due to increased saturation and fluid flow. In the drained experiments, we do not observe any measurable change in the electric potential. We therefore assume that change in fluid properties and release of the load causes disturbances in flow and streaming potential. We will discuss results of numerical simulations reproducing the observed effect. Our

  11. Charge orders in organic charge-transfer salts

    International Nuclear Information System (INIS)

    Kaneko, Ryui; Valentí, Roser; Tocchio, Luca F; Becca, Federico

    2017-01-01

    Motivated by recent experimental suggestions of charge-order-driven ferroelectricity in organic charge-transfer salts, such as κ -(BEDT-TTF) 2 Cu[N(CN) 2 ]Cl, we investigate magnetic and charge-ordered phases that emerge in an extended two-orbital Hubbard model on the anisotropic triangular lattice at 3/4 filling. This model takes into account the presence of two organic BEDT-TTF molecules, which form a dimer on each site of the lattice, and includes short-range intramolecular and intermolecular interactions and hoppings. By using variational wave functions and quantum Monte Carlo techniques, we find two polar states with charge disproportionation inside the dimer, hinting to ferroelectricity. These charge-ordered insulating phases are stabilized in the strongly correlated limit and their actual charge pattern is determined by the relative strength of intradimer to interdimer couplings. Our results suggest that ferroelectricity is not driven by magnetism, since these polar phases can be stabilized also without antiferromagnetic order and provide a possible microscopic explanation of the experimental observations. In addition, a conventional dimer-Mott state (with uniform density and antiferromagnetic order) and a nonpolar charge-ordered state (with charge-rich and charge-poor dimers forming a checkerboard pattern) can be stabilized in the strong-coupling regime. Finally, when electron–electron interactions are weak, metallic states appear, with either uniform charge distribution or a peculiar 12-site periodicity that generates honeycomb-like charge order. (paper)

  12. Yarbus, Eye Movements, and Vision

    Directory of Open Access Journals (Sweden)

    Benjamin W Tatler

    2010-04-01

    Full Text Available The impact of Yarbus's research on eye movements was enormous following the translation of his book Eye Movements and Vision into English in 1967. In stark contrast, the published material in English concerning his life is scant. We provide a brief biography of Yarbus and assess his impact on contemporary approaches to research on eye movements. While early interest in his work focused on his study of stabilised retinal images, more recently this has been replaced with interest in his work on the cognitive influences on scanning patterns. We extended his experiment on the effect of instructions on viewing a picture using a portrait of Yarbus rather than a painting. The results obtained broadly supported those found by Yarbus.

  13. 45 CFR 400.119 - Interstate movement.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false Interstate movement. 400.119 Section 400.119... Services § 400.119 Interstate movement. After the initial placement of an unaccompanied minor, the same procedures that govern the movement of nonrefugee foster cases to other States apply to the movement of...

  14. Conceptualizing Learning in the Climate Justice Movement

    Science.gov (United States)

    Kluttz, Jenalee; Walter, Pierre

    2018-01-01

    This article extends Scandrett et al.'s conceptual framework for social movement learning to understand learning and knowledge creation in the climate justice movement. Drawing on radical pluralist theoretical approaches to social movement learning, learning in the climate justice movement is conceptualized at the micro, meso, and macro levels,…

  15. Followership in Ecology/Environment Social Movements.

    Science.gov (United States)

    Clavner, Jerry B.; Sumodi, Veronica R.

    The paper analyzes the failure of the ecology/environmental movement to develop into a social movement and to generate a mass following. The movement has had difficulty not only in organizing collective behavior but also in maintaining the necessary momentum to change into a full-fledged social movement. Obvious reasons are that ecologists…

  16. Correcting slightly less simple movements

    Directory of Open Access Journals (Sweden)

    M.P. Aivar

    2005-01-01

    Full Text Available Many studies have analysed how goal directed movements are corrected in response to changes in the properties of the target. However, only simple movements to single targets have been used in those studies, so little is known about movement corrections under more complex situations. Evidence from studies that ask for movements to several targets in sequence suggests that whole sequences of movements are planned together. Planning related segments of a movement together makes it possible to optimise the whole sequence, but it means that some parts are planned quite long in advance, so that it is likely that they will have to be modified. In the present study we examined how people respond to changes that occur while they are moving to the first target of a sequence. Subjects moved a stylus across a digitising tablet. They moved from a specified starting point to two targets in succession. The first of these targets was always at the same position but it could have one of two sizes. The second target could be in one of two different positions and its size was different in each case. On some trials the first target changed size, and on some others the second target changed size and position, as soon as the subject started to move. When the size of the first target changed the subjects slowed down the first segment of their movements. Even the peak velocity, which was only about 150 ms after the change in size, was lower. Beside this fast response to the change itself, the dwell time at the first target was also affected: its duration increased after the change. Changing the size and position of the second target did not influence the first segment of the movement, but also increased the dwell time. The dwell time was much longer for a small target, irrespective of its initial size. If subjects knew in advance which target could change, they moved faster than if they did not know which could change. Taken together, these

  17. Charge sniffer for electrostatics demonstrations

    Science.gov (United States)

    Dinca, Mihai P.

    2011-02-01

    An electronic electroscope with a special design for demonstrations and experiments on static electricity is described. It operates as an electric charge sniffer by detecting slightly charged objects when they are brought to the front of its sensing electrode. The sniffer has the advantage of combining high directional sensitivity with a logarithmic bar display. It allows for the identification of electric charge polarity during charge separation by friction, peeling, electrostatic induction, batteries, or secondary coils of power transformers. Other experiments in electrostatics, such as observing the electric field of an oscillating dipole and the distance dependence of the electric field generated by simple charge configurations, are also described.

  18. Fuel charging machine

    International Nuclear Information System (INIS)

    Uchikawa, Sadao.

    1978-01-01

    Purpose: To enable continuous fuel discharging and charging steps in a bwr type reactor by effecting positioning only for once by providing a plurality of fuel assembly grippers and their drives co-axially on a rotatable surface. Constitution: A plurality of fuel assembly grippers and their drives are provided co-axially on a rotatable surface. For example, a gripper A, a drive B, a gripper C and a drive D are arranged co-axially in symmetric positions on a disk rotated on rails by wheels and rotational drives. A new fuel in a fuel pool is gripped by the gripper A and transported above the reactor core. Then, the disk is positioned so that the gripper C can grip the spent fuel in the core, and the fuel to be discharged is gripped and raised by the gripper C. Then the disk is rotated by 180 0 and the new fuel in the gripper A is charged into the position from which the old fuel has been discharged and, finally, the discharged fuel is sent to the fuel pool for storage. (Seki, T.)

  19. Delayed Auditory Feedback and Movement

    Science.gov (United States)

    Pfordresher, Peter Q.; Dalla Bella, Simone

    2011-01-01

    It is well known that timing of rhythm production is disrupted by delayed auditory feedback (DAF), and that disruption varies with delay length. We tested the hypothesis that disruption depends on the state of the movement trajectory at the onset of DAF. Participants tapped isochronous rhythms at a rate specified by a metronome while hearing DAF…

  20. Noun Phrase Structure and Movement

    DEFF Research Database (Denmark)

    Wood, Johanna; Vikner, Sten

    2011-01-01

    /solch to follow the article. We discuss two possible syntactic derivations, predicate raising (e.g. Corver 1998, Bennis, Corver & den Dikken 1998) and XP movement from an attributive adjective position within the nominal (e.g. Matushansky 2002). The analysis links up with the morphological agreement facts...

  1. Ketotic hyperglycemia with movement disorder

    Directory of Open Access Journals (Sweden)

    Disha Awasthi

    2012-01-01

    Full Text Available Chorea, hemichorea-hemiballismus and severe partial seizures may be the presenting features of nonketotic hyperglycemia in older adults with type 2 diabetes, but cases in young adults with type 1 diabetes are rare. We hereby report a very rare case of diabetic ketosis with movement disorder in a young patient.

  2. Population consequences of aggregative movement

    Science.gov (United States)

    Peter Turchin

    1989-01-01

    Gregarious behaviour is an important factor influencing survival and reproduction of animals, as well as population interactions. In this paper I develop a model of movement with attraction or repulsion between conspecifics. To facilitate its use in empirical studies, the model is based on experimentally measurable features of individual behaviour.

  3. Actuating movement in refined wearables

    NARCIS (Netherlands)

    Toeters, M.J.; Feijs, L.M.G.

    2014-01-01

    Nowadays it is quite possible to deploy textiles as sensors and avoid traditional hard sensors. Actuation (movement) turns out more difficult. It is advantageous to combine sensing and actuation, similar to ecological perception theory. Although several actuators are known: SMA, voice coil, motors,

  4. THE INTERNATIONAL WALDORF SCHOOL MOVEMENT.

    Science.gov (United States)

    VON BARAVALLE, HERMANN

    AN HISTORICAL REVIEW OF THE WALDORF SCHOOL PLAN TRACES THE MOVEMENT FROM ITS FOUNDING IN STUTTGART, GERMANY IN 1919, BY THE WALDORF ASTORIA COMPANY AND UNDER THE DIRECTION OF RUDOLF STEINER, TO ITS INTRODUCTION INTO SWITZERLAND, OTHER EUROPEAN COUNTRIES, THE AMERICAS, AUSTRALIA, NEW ZEALAND, AND SOUTH AFRICA, A TOTAL OF 175 SCHOOLS AS OF 1963. THE…

  5. Battery charging control methods, electric vehicle charging methods, battery charging apparatuses and rechargeable battery systems

    Science.gov (United States)

    Tuffner, Francis K [Richland, WA; Kintner-Meyer, Michael C. W. [Richland, WA; Hammerstrom, Donald J [West Richland, WA; Pratt, Richard M [Richland, WA

    2012-05-22

    Battery charging control methods, electric vehicle charging methods, battery charging apparatuses and rechargeable battery systems. According to one aspect, a battery charging control method includes accessing information regarding a presence of at least one of a surplus and a deficiency of electrical energy upon an electrical power distribution system at a plurality of different moments in time, and using the information, controlling an adjustment of an amount of the electrical energy provided from the electrical power distribution system to a rechargeable battery to charge the rechargeable battery.

  6. Surface charge compensation for a highly charged ion emission microscope

    International Nuclear Information System (INIS)

    McDonald, J.W.; Hamza, A.V.; Newman, M.W.; Holder, J.P.; Schneider, D.H.G.; Schenkel, T.

    2003-01-01

    A surface charge compensation electron flood gun has been added to the Lawrence Livermore National Laboratory (LLNL) highly charged ion (HCI) emission microscope. HCI surface interaction results in a significant charge residue being left on the surface of insulators and semiconductors. This residual charge causes undesirable aberrations in the microscope images and a reduction of the Time-Of-Flight (TOF) mass resolution when studying the surfaces of insulators and semiconductors. The benefits and problems associated with HCI microscopy and recent results of the electron flood gun enhanced HCI microscope are discussed

  7. Sequential charged particle reaction

    International Nuclear Information System (INIS)

    Hori, Jun-ichi; Ochiai, Kentaro; Sato, Satoshi; Yamauchi, Michinori; Nishitani, Takeo

    2004-01-01

    The effective cross sections for producing the sequential reaction products in F82H, pure vanadium and LiF with respect to the 14.9-MeV neutron were obtained and compared with the estimation ones. Since the sequential reactions depend on the secondary charged particles behavior, the effective cross sections are corresponding to the target nuclei and the material composition. The effective cross sections were also estimated by using the EAF-libraries and compared with the experimental ones. There were large discrepancies between estimated and experimental values. Additionally, we showed the contribution of the sequential reaction on the induced activity and dose rate in the boundary region with water. From the present study, it has been clarified that the sequential reactions are of great importance to evaluate the dose rates around the surface of cooling pipe and the activated corrosion products. (author)

  8. Charge parity exotic mesons

    International Nuclear Information System (INIS)

    Burden, C.J.

    1998-01-01

    Full text: Evidence for a meson with exotic quantum numbers J PC 1 -+ , the ρ(1405), has been observed at the AGS at Brookhaven and Crystal Barrel at CERN. This meson is exotic to the extent that its quantum numbers are not consistent with the generalised Pauli exclusion principle applied to the naive constituent quark model. In a fully relativistic field theoretic treatment, however, there is nothing in principle to preclude the existence of charge parity exotics. Using our earlier covariant Bethe-Salpeter model of light-quark mesons with no new parameter fitting we demonstrate the existence of a q - q-bar bound state with the quantum numbers of the ρ

  9. Battery charging stations

    Energy Technology Data Exchange (ETDEWEB)

    Bergey, M.

    1997-12-01

    This paper discusses the concept of battery charging stations (BCSs), designed to service rural owners of battery power sources. Many such power sources now are transported to urban areas for recharging. A BCS provides the opportunity to locate these facilities closer to the user, is often powered by renewable sources, or hybrid systems, takes advantage of economies of scale, and has the potential to provide lower cost of service, better service, and better cost recovery than other rural electrification programs. Typical systems discussed can service 200 to 1200 people, and consist of stations powered by photovoltaics, wind/PV, wind/diesel, or diesel only. Examples of installed systems are presented, followed by cost figures, economic analysis, and typical system design and performance numbers.

  10. Reactor fuel charging equipment

    International Nuclear Information System (INIS)

    Wade, Elman.

    1977-01-01

    In many types of reactor fuel charging equipment, tongs or a grab, attached to a trolley, housed in a guide duct, can be used for withdrawing from the core a selected spent fuel assembly or to place a new fuel assembly in the core. In these facilities, the trolley may have wheels that roll on rails in the guide duct. This ensures the correct alignment of the grab, the trolley and fuel assembly when this fuel assembly is being moved. By raising or lowering such a fuel assembly, the trolley can be immerged in the coolant bath of the reactor, whereas at other times it can be at a certain level above the upper surface of the coolant bath. The main object of the invention is to create a fuel handling apparatus for a sodium cooled reactor with bearings lubricated by the sodium coolant and in which the contamination of these bearings is prevented [fr

  11. Early Christian movements: Jesus movements and the renewal of Israel

    Directory of Open Access Journals (Sweden)

    Richard A. Horsley

    2006-10-01

    Full Text Available This article investigates the origins and development of the earliest Jesus movements within the context of persistent conflict between the Judean and Galilean peasantry and their Jerusalem and Roman rulers. It explores the prominence of popular prophetic and messianic movements and shows how the earliest movements that formed in response to Jesus’ mission exhibit similar features and patterns. Jesus is not treated as separate from social roles and political-economic relationships. Viewing Jesus against the background of village communities in which people lived, the Gospels are understood as genuine communication with other people in historical social contexts. The article argues that the net effect of these interrelated factors of theologically determined New Testament interpretation is a combination of assumptions and procedures that would be unacceptable in the regular investigation of history. Another version of the essay was published in Horsley, Richard A (ed, A people’s history of Christianity, Volume 1: Christian origins, 23-46. Minneapolis, MN: Fortress.

  12. Eye-movements and ongoing task processing.

    Science.gov (United States)

    Burke, David T; Meleger, Alec; Schneider, Jeffrey C; Snyder, Jim; Dorvlo, Atsu S S; Al-Adawi, Samir

    2003-06-01

    This study tests the relation between eye-movements and thought processing. Subjects were given specific modality tasks (visual, gustatory, kinesthetic) and assessed on whether they responded with distinct eye-movements. Some subjects' eye-movements reflected ongoing thought processing. Instead of a universal pattern, as suggested by the neurolinguistic programming hypothesis, this study yielded subject-specific idiosyncratic eye-movements across all modalities. Included is a discussion of the neurolinguistic programming hypothesis regarding eye-movements and its implications for the eye-movement desensitization and reprocessing theory.

  13. Solar Charged Stand Alone Inverter

    OpenAIRE

    M.Vasugi; Prof R.Jayaraman

    2014-01-01

    This paper deals with solar powered stand alone inverter which converts the variable dc output of a photovoltaic solar panel into ac that can be fed to loads. Stand alone inverters are used in systems where the inverter get its energy from batteries charged by photo voltaic arrays. A charge controller limits the rate at which electric current is added to or drawn from electric batteries. This charge discharge controller is needed to prevent the battery from being overcharged o...

  14. Zero-gravity movement studies

    Science.gov (United States)

    Badler, N. I.; Fishwick, P.; Taft, N.; Agrawala, M.

    1985-01-01

    The use of computer graphics to simulate the movement of articulated animals and mechanisms has a number of uses ranging over many fields. Human motion simulation systems can be useful in education, medicine, anatomy, physiology, and dance. In biomechanics, computer displays help to understand and analyze performance. Simulations can be used to help understand the effect of external or internal forces. Similarly, zero-gravity simulation systems should provide a means of designing and exploring the capabilities of hypothetical zero-gravity situations before actually carrying out such actions. The advantage of using a simulation of the motion is that one can experiment with variations of a maneuver before attempting to teach it to an individual. The zero-gravity motion simulation problem can be divided into two broad areas: human movement and behavior in zero-gravity, and simulation of articulated mechanisms.

  15. Experiments on Dust Grain Charging

    Science.gov (United States)

    Abbas, M. N.; Craven, P. D.; Spann, J. F.; Tankosic, D.; LeClair, A.; West, E. A.

    2004-01-01

    Dust particles in various astrophysical environments are charged by a variety of mechanisms generally involving collisional processes with other charged particles and photoelectric emission with UV radiation from nearby sources. The sign and the magnitude of the particle charge are determined by the competition between the charging processes by UV radiation and collisions with charged particles. Knowledge of the particle charges and equilibrium potentials is important for understanding of a number of physical processes. The charge of a dust grain is thus a fundamental parameter that influences the physics of dusty plasmas, processes in the interplanetary medium and interstellar medium, interstellar dust clouds, planetary rings, cometary and outer atmospheres of planets etc. In this paper we present some results of experiments on charging of dust grains carried out on a laboratory facility capable levitating micron size dust grains in an electrodynamic balance in simulated space environments. The charging/discharging experiments were carried out by exposing the dust grains to energetic electron beams and UV radiation. Photoelectric efficiencies and yields of micron size dust grains of SiO2, and lunar simulates obtained from NASA-JSC will be presented.

  16. Fractional Charge Definitions and Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Goldhaber, A.S.

    2004-06-04

    Fractional charge is known through theoretical and experimental discoveries of isolable objects carrying fractions of familiar charge units--electric charge Q, spin S, and the difference of baryon and lepton numbers B-L. With a few simple assumptions all these effects may be described using a generalized version of charge renormalization for locally conserved charges, in which medium correlations yield familiar adiabatic, continuous renormalization, or sometimes nonadiabatic, discrete renormalization. Fractional charges may be carried by fundamental particles or fundamental solitons. Either picture works for the simplest fractional-quantum-Hall-effect quasiholes, though the particle description is far more general. The only known fundamental solitons in three or fewer space dimensions d are the kink (d = 1), the vortex (d = 2), and the magnetic monopole (d = 3). Further, for a charge not intrinsically coupled to the topological charge of a soliton, only the kink and the monopole may carry fractional values. The same reasoning enforces fractional values of B-L for electrically charged elementary particles.

  17. Fractional charge definitions and conditions

    International Nuclear Information System (INIS)

    Goldhaber, Alfred Scharff

    2003-01-01

    The phenomenon of fractional charge has come to prominence in recent decades through theoretical and experimental discoveries of isolable objects which carry fractions of familiar charge units--electric charge Q, spin S, baryon number B and lepton number L. It is shown here on the basis of a few simple assumptions that all these effects may be described using a generalized version of charge renormalization for locally conserved charges, in which many-body correlations can produce familiar adiabatic, continuous renormalization, and in some circumstances nonadiabatic, discrete renormalization. The fractional charges may be carried either by fundamental particles or by fundamental solitons. This excludes nontopological solitons and also skyrmions: The only known fundamental solitons in three or fewer space dimensions d are the kink (d=1), the vortex (d=2), and the magnetic monopole (d=3). Further, for a charge which is not intrinsically coupled to the topological charge of a soliton, only the kink and the monopole may carry fractional values. The same reasoning enforces fractional local values of B-L for electrically charged elementary particles

  18. Fractional Charge Definitions and Conditions

    International Nuclear Information System (INIS)

    Goldhaber, A.S.

    2004-01-01

    Fractional charge is known through theoretical and experimental discoveries of isolable objects carrying fractions of familiar charge units--electric charge Q, spin S, and the difference of baryon and lepton numbers B-L. With a few simple assumptions all these effects may be described using a generalized version of charge renormalization for locally conserved charges, in which medium correlations yield familiar adiabatic, continuous renormalization, or sometimes nonadiabatic, discrete renormalization. Fractional charges may be carried by fundamental particles or fundamental solitons. Either picture works for the simplest fractional-quantum-Hall-effect quasiholes, though the particle description is far more general. The only known fundamental solitons in three or fewer space dimensions d are the kink (d = 1), the vortex (d = 2), and the magnetic monopole (d = 3). Further, for a charge not intrinsically coupled to the topological charge of a soliton, only the kink and the monopole may carry fractional values. The same reasoning enforces fractional values of B-L for electrically charged elementary particles

  19. Low-charge-state linac

    Energy Technology Data Exchange (ETDEWEB)

    Shepard, K.W.; Kim, J.W.

    1995-08-01

    A design is being developed for a low-charge-state linac suitable for injecting ATLAS with a low-charge-state, radioactive beam. Initial work indicates that the existing ATLAS interdigital superconducting accelerating structures, together with the superconducting quadrupole transverse focussing element discussed above, provides a basis for a high-performance low-charge-state linac. The initial 2 or 3 MV of such a linac could be based on a normally-conducting, low-frequency RFQ, possibly combined with 24-MHz superconducting interdigital structures. Beam dynamics studies of the whole low-charge-state post-accelerator section were carried out in early FY 1995.

  20. Exoskeleton for assisting human movement

    OpenAIRE

    García Armada, Elena; Cestari, Manuel; Sanz Merodio, Daniel; Carrillo, Xavier Alberto

    2015-01-01

    [EN] The invention relates to an exoskeleton for assisting human movement, which can be fitted to the user in terms of dimensions, tension and ranges of joint motion, either manually or automatically. Said exoskeleton can be fitted to the user in the anteroposterior direction in the sagittal plane, with the user in a horizontal or sitting position, without requiring a functional transfer. The exoskeleton has a modular design which is compatible with human biomechanics and reproduces a natural...

  1. Movement of global warming issues

    International Nuclear Information System (INIS)

    Sugiyama, Taishi

    2015-01-01

    This paper summarizes the report of IPCC (Intergovernmental Panel on Climate Change), and the movement of the global warming issues as seen from the United Nations Framework Convention on Climate Change (Conference of the Parties: COP) and the policy discussions in Japan. From the Fifth Assessment Report published by IPCC, it shows the following items: (1) increasing trends of greenhouse effect gas emissions during 1970 and 2010, (2) trends in world's greenhouse effect gas emissions according to income segment, and (3) factor analysis of changes in greenhouse effect gas emissions. Next, it takes up the greenhouse gas emission scenario of IPCC, shows the scenario due to temperature rise pattern, and introduces the assumption of emission reduction due to BECCS. Regarding the 2 deg. scenario that has become a hot topic in international negotiations, it describes the reason for difficulties in its implementation. In addition, as the international trends of global warming, it describes the agreement of numerical targets for emissions at COP3 (Kyoto Conference) and the subsequent movements. Finally, it introduces Japan's measures against global warming, as well as the future movement. (A.O.)

  2. Charge migration and charge transfer in molecular systems

    Directory of Open Access Journals (Sweden)

    Hans Jakob Wörner

    2017-11-01

    Full Text Available The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review.

  3. Bounds on charged lepton mixing with exotic charged leptons Ф

    Indian Academy of Sciences (India)

    imposing the constraints that the amplitude should not exceed the perturbative unitarity limit at high energy (. Ф. × = A), we obtain bounds on light heavy charged lepton mixing parameter sin. 2. (2 a. L) where a. L is the mixing angle of the ordinary charged lepton with its exotic partner. For A = 1 TeV, no bound is obtained on ...

  4. Charge Pricing Optimization Model for Private Charging Piles in Beijing

    Directory of Open Access Journals (Sweden)

    Xingping Zhang

    2017-11-01

    Full Text Available This paper develops a charge pricing model for private charging piles (PCPs by considering the environmental and economic effects of private electric vehicle (PEV charging energy sources and the impact of PCP charging load on the total load. This model simulates users’ responses to different combinations of peak-valley prices based on the charging power of PCPs and user charging transfer rate. According to the regional power structure, it calculates the real-time coal consumption, carbon dioxide emissions reduction, and power generation costs of PEVs on the power generation side. The empirical results demonstrate that the proposed peak-valley time-of-use charging price can not only minimize the peak-valley difference of the total load but also improve the environmental effects of PEVs and the economic income of the power system. The sensitivity analysis shows that the load-shifting effect of PCPs will be more obvious when magnifying the number of PEVs by using the proposed charging price. The case study indicates that the proposed peak, average, and valley price in Beijing should be 1.8, 1, and 0.4 yuan/kWh, which can promote the large-scale adoption of PEVs.

  5. Charge transport in nanoscale "all-inorganic" networks of semiconductor nanorods linked by metal domains.

    Science.gov (United States)

    Lavieville, Romain; Zhang, Yang; Casu, Alberto; Genovese, Alessandro; Manna, Liberato; Di Fabrizio, Enzo; Krahne, Roman

    2012-04-24

    Charge transport across metal-semiconductor interfaces at the nanoscale is a crucial issue in nanoelectronics. Chains of semiconductor nanorods linked by Au particles represent an ideal model system in this respect, because the metal-semiconductor interface is an intrinsic feature of the nanosystem and does not manifest solely as the contact to the macroscopic external electrodes. Here we investigate charge transport mechanisms in all-inorganic hybrid metal-semiconductor networks fabricated via self-assembly in solution, in which CdSe nanorods were linked to each other by Au nanoparticles. Thermal annealing of our devices changed the morphology of the networks and resulted in the removal of small Au domains that were present on the lateral nanorod facets, and in ripening of the Au nanoparticles in the nanorod junctions with more homogeneous metal-semiconductor interfaces. In such thermally annealed devices the voltage dependence of the current at room temperature can be well described by a Schottky barrier lowering at a metal semiconductor contact under reverse bias, if the spherical shape of the gold nanoparticles is considered. In this case the natural logarithm of the current does not follow the square-root dependence of the voltage as in the bulk, but that of V(2/3). From our fitting with this model we extract the effective permittivity that agrees well with theoretical predictions for the permittivity near the surface of CdSe nanorods. Furthermore, the annealing improved the network conductance at cryogenic temperatures, which could be related to the reduction of the number of trap states.

  6. Intrinsic space charge resonances and the space charge limit

    International Nuclear Information System (INIS)

    Parzen, G.

    1990-01-01

    A study has been done of the dependence of the space charge limit on the choice of ν-values using a simulation program. This study finds a strong dependence of the space charge limit on the location of the ν-values relative to the intrinsic space charge resonances, which are driven by the space charge forces due to the beam itself. Four accelerators were studied. For some of these accelerators the study suggest that the space charge limit can be increased by about a factor of 2 proper choice of the ν-values. The lower order 1/2 and 1/4 intrinsic resonances appear to be the important resonances. There is some evidence for effects due to the 1/6 and 1/8 intrinsic resonances, particularly for larger synchrotrons. 5 figs

  7. Bond charges and electronic charge transfer in ternary semiconductors

    International Nuclear Information System (INIS)

    Pietsch, U.

    1986-01-01

    By means of a simple molecule-theoretic model of 'linear superposition of two-electron molecules' the bond charges between nearest neighbours and the effective charges of ions are calculated for ternary zinc-blende structure alloys as well as chalcopyrite semiconductors. Taking into account both, the charge transfer among the ions caused by the differences of electronegativities of atoms used and between the bonds created by the internal stress of the lattice a nearly unvaried averaged bond charge amount of the alloy is found, but rather dramatically changed local bond charge parameters in comparison with the respective values of binary compounds used. This fact should influence the noncentral force interaction in such semiconductors. (author)

  8. Radiation by moving charges

    International Nuclear Information System (INIS)

    Geloni, Gianluca; Kocharyan, Vitali; Saldin, Evgeni

    2017-04-01

    It is generally accepted that in order to describe the dynamics of relativistic particles in the laboratory (lab) frame it is sufficient to take into account the relativistic dependence of the particle momenta on the velocity. This solution of the dynamics problem in the lab frame makes no reference to Lorentz transformations. For this reason they are not discussed in particle tracking calculations in accelerator and plasma physics. It is generally believed that the electrodynamics problem can be treated within the same ''single inertial frame'' description without reference to Lorentz transformations. In particular, in order to evaluate radiation fields arising from charged particles in motion we need to know their velocities and positions as a function of the lab frame time t. The relativistic motion of a particle in the lab frame is described by Newton's second law ''corrected'' for the relativistic dependence of momentum on velocity. It is assumed in all standard derivations that one can perform identification of the trajectories in the source part of the usual Maxwell's equations with the trajectories vector x(t) measured (or calculated by using the corrected Newton's second law) in the lab frame. This way of coupling fields and particles is considered since more than a century as the relativistically correct procedure.We argue that this procedure needs to be changed, and we demonstrate the following, completely counterintuitive statement: the results of conventional theory of radiation by relativistically moving charges are not consistent with the principle of relativity. In order to find the trajectory of a particle in the lab frame consistent with the usual Maxwell's equations, one needs to solve the dynamic equation inmanifestly covariant form by using the coordinate-independent proper time τ to parameterize the particle world-line in space-time. We show that there is a difference between ''true'' particle trajectory vector x(t) calculated or measured in

  9. Immersion in Movement-Based Interaction

    Science.gov (United States)

    Pasch, Marco; Bianchi-Berthouze, Nadia; van Dijk, Betsy; Nijholt, Anton

    The phenomenon of immersing oneself into virtual environments has been established widely. Yet to date (to our best knowledge) the physical dimension has been neglected in studies investigating immersion in Human-Computer Interaction (HCI). In movement-based interaction the user controls the interface via body movements, e.g. direct manipulation of screen objects via gestures or using a handheld controller as a virtual tennis racket. It has been shown that physical activity affects arousal and that movement-based controllers can facilitate engagement in the context of video games. This paper aims at identifying movement features that influence immersion. We first give a brief survey on immersion and movement-based interfaces. Then, we report results from an interview study that investigates how users experience their body movements when interacting with movement-based interfaces. Based on the interviews, we identify four movement-specific features. We recommend them as candidates for further investigation.

  10. Communication Theory and the Consumer Movement-

    Science.gov (United States)

    Newsom, Doug

    1977-01-01

    Defines and traces the origins of the consumer movement and uses communication theories to explain the effects of the movement. Available from: Public Relations Review, Ray Hiebert, Dean, College of Journalism, University of Maryland, College Park, MD 20742. (MH)

  11. Functional jerks, tics, and paroxysmal movement disorders

    NARCIS (Netherlands)

    Dreissen, Y. E. M.; Cath, D C; Tijssen, M A J; Hallet, Mark; Stone, Jon; Carson, Alan

    2017-01-01

    Functional jerks are among the most common functional movement disorders. The diagnosis of functional jerks is mainly based on neurologic examination revealing specific positive clinical signs. Differentiation from other jerky movements, such as tics, organic myoclonus, and primary paroxysmal

  12. Gravity effects on endogenous movements

    Science.gov (United States)

    Johnsson, Anders; Antonsen, Frank

    Gravity effects on endogenous movements A. Johnsson * and F. Antonsen *+ * Department of Physics, Norwegian University of Science and Technology,NO-7491, Trond-heim, Norway, E-mail: anders.johnsson@ntnu.no + Present address: Statoil Research Center Trondheim, NO-7005, Trondheim, Norway Circumnutations in stems/shoots exist in many plants and often consists of more or less regular helical movements around the plumb line under Earth conditions. Recent results on circumnu-tations of Arabidopsis in space (Johnsson et al. 2009) showed that minute amplitude oscilla-tions exist in weightlessness, but that centripetal acceleration (mimicking the gravity) amplified and/or created large amplitude oscillations. Fundamental mechanisms underlying these results will be discussed by modeling the plant tissue as a cylinder of cells coupled together. As a starting point we have modeled (Antonsen 1998) standing waves on a ring of biological cells, as first discussed in a classical paper (Turing 1952). If the coupled cells can change their water content, an `extension' wave could move around the ring. We have studied several, stacked rings of cells coupled into a cylinder that together represent a cylindrical plant tissue. Waves of extensions travelling around the cylinder could then represent the observable circumnutations. The coupling between cells can be due to cell-to-cell diffusion, or to transport via channels, and the coupling can be modeled to vary in both longitudinal and transversal direction of the cylinder. The results from ISS experiments indicate that this cylindrical model of coupled cells should be able to 1) show self-sustained oscillations without the impact of gravity (being en-dogenous) and 2) show how an environmental factor like gravity can amplify or generate the oscillatory movements. Gravity has been introduced in the model by a negative, time-delayed feed-back transport across the cylinder. This represents the physiological reactions to acceler

  13. Initial charge reactor core

    International Nuclear Information System (INIS)

    Kiyono, Takeshi

    1984-01-01

    Purpose: To effectivity burn fuels and improve the economical performance in an inital charge reactor core of BWR type reactors or the likes. Constitution: In a reactor core constituted with a plurality of fuel assemblies which are to be partially replaced upon fuel replacement, the density of the fissionable materials and the moderator - fuel ratio of a fuel assembly is set corresponding to the period till that fuel assembly is replaced, in which the density of the nuclear fissionable materials is lowered and the moderator - fuel ratio is increased for the fuel assembly with a shorter period from the fueling to the fuel exchange and, while on the other hand, the density of the fissionable materials is increased and the moderator - fuel ratio is decreased for the fuel assembly with a longer period from the fueling to the replacement. Accordingly, since the moderator - fuel ratio is increased for the fuel assembly to be replaced in a shorter period, the neutrons moderating effect is increased to increase the reactivity. (Horiuchi, T.)

  14. Charged particle accelerator

    International Nuclear Information System (INIS)

    Arakawa, Kazuo.

    1969-01-01

    An accelerator is disclosed having a device which permits the electrodes of an accelerator tube to be readily conditioned in an uncomplicated manner before commencing operation. In particle accelerators, it is necessary to condition the accelerator electrodes before a stable high voltage can be applied. Large current accelerators of the cockcroft-walton type require a complicated manual operation which entails applying to the electrodes a low voltage which is gradually increased to induce a vacuum discharge and then terminated. When the discharge attains an extremely low level, the voltage is again impressed and again raised to a high value in low current type accelerators, a high voltage power supply charges the electrodes once to induce discharge followed by reapplying the voltage when the vacuum discharge reaches a low level, according to which high voltage is automatically applied. This procedure, however, requires that the high voltage power supply be provided with a large internal resistance to limit the current to within several milliamps. The present invention connects a high voltage power supply and an accelerator tube through a discharge current limiting resistor wired in parallel with a switch. Initially, the switch is opened enabling the power supply to impress a voltage limited to a prescribed value by a suitably chosen resistor. Conditioning is effected by allowing the voltage between electrodes to increase and is followed by closing the switch through which high voltage is applied directly to the accelerator for operation. (K.J. Owens)

  15. Quantum charged rigid membrane

    Energy Technology Data Exchange (ETDEWEB)

    Cordero, Ruben [Departamento de Fisica, Escuela Superior de Fisica y Matematicas del I.P.N., Unidad Adolfo Lopez Mateos, Edificio 9, 07738 Mexico, D.F. (Mexico); Molgado, Alberto [Unidad Academica de Fisica, Universidad Autonoma de Zacatecas, Zacatecas Zac. (Mexico); Rojas, Efrain, E-mail: cordero@esfm.ipn.mx, E-mail: amolgado@fisica.uaz.edu.mx, E-mail: efrojas@uv.mx [Departamento de Fisica, Facultad de Fisica e Inteligencia Artificial, Universidad Veracruzana, 91000 Xalapa, Veracruz (Mexico)

    2011-03-21

    The early Dirac proposal to model the electron as a charged membrane is reviewed. A rigidity term, instead of the natural membrane tension, involving linearly the extrinsic curvature of the worldvolume swept out by the membrane is considered in the action modeling the bubble in the presence of an electromagnetic field. We set up this model as a genuine second-order derivative theory by considering a non-trivial boundary term which plays a relevant part in our formulation. The Lagrangian in question is linear in the bubble acceleration and by means of the Ostrogradski-Hamiltonian approach, we observed that the theory comprises the management of both first- and second-class constraints. We thus show that our second-order approach is robust allowing for a proper quantization. We found an effective quantum potential which permits us to compute bounded states for the system. We comment on the possibility of describing brane world universes by invoking this kind of second-order correction terms.

  16. Quantum charged rigid membrane

    International Nuclear Information System (INIS)

    Cordero, Ruben; Molgado, Alberto; Rojas, Efrain

    2011-01-01

    The early Dirac proposal to model the electron as a charged membrane is reviewed. A rigidity term, instead of the natural membrane tension, involving linearly the extrinsic curvature of the worldvolume swept out by the membrane is considered in the action modeling the bubble in the presence of an electromagnetic field. We set up this model as a genuine second-order derivative theory by considering a non-trivial boundary term which plays a relevant part in our formulation. The Lagrangian in question is linear in the bubble acceleration and by means of the Ostrogradski-Hamiltonian approach, we observed that the theory comprises the management of both first- and second-class constraints. We thus show that our second-order approach is robust allowing for a proper quantization. We found an effective quantum potential which permits us to compute bounded states for the system. We comment on the possibility of describing brane world universes by invoking this kind of second-order correction terms.

  17. Movement and Character. Lecture, London, 1946

    Science.gov (United States)

    Montesorri, Maria

    2013-01-01

    Dr. Montessori's words from the 1946 London Lectures describe principles of intelligence and character, the work of the hand, and movement with a purpose as being integral to self-construction. The perfection of movement is spiritual, says Dr. Montessori. Repetition of practical life exercises are exercises in movement with the dignity of human…

  18. 49 CFR 195.424 - Pipe movement.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Pipe movement. 195.424 Section 195.424... PIPELINE Operation and Maintenance § 195.424 Pipe movement. (a) No operator may move any line pipe, unless... in the line section involved are joined by welding unless— (1) Movement when the pipeline does not...

  19. 30 CFR 250.602 - Equipment movement.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Equipment movement. 250.602 Section 250.602... OPERATIONS IN THE OUTER CONTINENTAL SHELF Oil and Gas Well-Workover Operations § 250.602 Equipment movement. The movement of well-workover rigs and related equipment on and off a platform or from well to well on...

  20. 49 CFR 236.776 - Movement, trailing.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Movement, trailing. 236.776 Section 236.776 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Movement, trailing. The movement of a train over the points of a switch which face in the direction in...

  1. 30 CFR 250.502 - Equipment movement.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Equipment movement. 250.502 Section 250.502... OPERATIONS IN THE OUTER CONTINENTAL SHELF Oil and Gas Well-Completion Operations § 250.502 Equipment movement. The movement of well-completion rigs and related equipment on and off a platform or from well to well...

  2. 49 CFR 236.774 - Movement, facing.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Movement, facing. 236.774 Section 236.774 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Movement, facing. The movement of a train over the points of a switch which face in a direction opposite to...

  3. 9 CFR 92.3 - Movement restrictions.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Movement restrictions. 92.3 Section 92... ANIMAL PRODUCTS: PROCEDURES FOR REQUESTING RECOGNITION OF REGIONS § 92.3 Movement restrictions. Whenever... exist and the EC imposes prohibitions or other restrictions on the movement of animals or animal...

  4. Mixed movements/performance-based drawing

    DEFF Research Database (Denmark)

    Brabrand, Helle

    2011-01-01

    Mixed Movements is a research project engaged in performance-based architectural drawing. As one in a series working with architectonic implementation in relation to body and movements, the actual project relates body-movement and dynamic drawing and presents the material as interactive ‘space-time-tables’....

  5. Transformers: Movement Experiences for Early Childhood Classrooms

    Science.gov (United States)

    Vagovic, Julia

    2008-01-01

    Transformers are simple movement experiences for the classroom that engage the mind and body, focus energy, and help children transition to the next activity. Teachers can use them throughout the day, every day. The author explains the basic movements and suggests ways to build on them. They range from deep breathing to gentle wake-up movements to…

  6. Movement Education Framework (MEF) Made EZ!

    Science.gov (United States)

    Weiller-Abels, Karen; Bridges, Jennifer

    2011-01-01

    All physical educators want to provide lessons that foster success. Particularly essential to the movement education framework is not only providing lessons that foster motor success, but also to develop knowledge about movement to help the learner develop skill in executing all different types of movement. The framework and examples provided in…

  7. Salmon carcass movements in forest streams

    Science.gov (United States)

    Burke Strobel; Daniel R. Shivley; Brett B. Roper

    2009-01-01

    The movements of salmon carcasses over time were studied in two forest streams in the context of a large-scale salmon carcass supplementation program. The objectives were to assess both the level of treatment after stream flows had displaced carcasses and to evaluate whether the magnitude of carcass movements outside of a given reach could be predicted. The movements...

  8. Cathodic hydrogen charging of zinc

    International Nuclear Information System (INIS)

    Panagopoulos, C.N.; Georgiou, E.P.; Chaliampalias, D.

    2014-01-01

    Highlights: •Incorporation of hydrogen into zinc and formation of zinc hydrides. •Investigation of surface residual stresses due to hydrogen diffusion. •Effect of hydrogen diffusion and hydride formation on mechanical properties of Zn. •Hydrogen embrittlement phenomena in zinc. -- Abstract: The effect of cathodic hydrogen charging on the structural and mechanical characteristics of zinc was investigated. Hardening of the surface layers of zinc, due to hydrogen incorporation and possible formation of ZnH 2 , was observed. In addition, the residual stresses brought about by the incorporation of hydrogen atoms into the metallic matrix, were calculated by analyzing the obtained X-ray diffraction patterns. Tensile testing of the as-received and hydrogen charged specimens revealed that the ductility of zinc decreased significantly with increasing hydrogen charging time, for a constant value of charging current density, and with increasing charging current density, for a constant value of charging time. However, the ultimate tensile strength of this material was slightly affected by the hydrogen charging procedure. The cathodically charged zinc exhibited brittle transgranular fracture at the surface layers and ductile intergranular fracture at the deeper layers of the material

  9. Filling of charged cylindrical capillaries

    NARCIS (Netherlands)

    Das, Siddhartha; Chanda, Sourayon; Eijkel, J.C.T.; Tas, N.R.; Chakraborty, Suman; Mitra, Sushanta K.

    2014-01-01

    We provide an analytical model to describe the filling dynamics of horizontal cylindrical capillaries having charged walls. The presence of surface charge leads to two distinct effects: It leads to a retarding electrical force on the liquid column and also causes a reduced viscous drag force because

  10. Charge transport in organic semiconductors.

    Science.gov (United States)

    Bässler, Heinz; Köhler, Anna

    2012-01-01

    Modern optoelectronic devices, such as light-emitting diodes, field-effect transistors and organic solar cells require well controlled motion of charges for their efficient operation. The understanding of the processes that determine charge transport is therefore of paramount importance for designing materials with improved structure-property relationships. Before discussing different regimes of charge transport in organic semiconductors, we present a brief introduction into the conceptual framework in which we interpret the relevant photophysical processes. That is, we compare a molecular picture of electronic excitations against the Su-Schrieffer-Heeger semiconductor band model. After a brief description of experimental techniques needed to measure charge mobilities, we then elaborate on the parameters controlling charge transport in technologically relevant materials. Thus, we consider the influences of electronic coupling between molecular units, disorder, polaronic effects and space charge. A particular focus is given to the recent progress made in understanding charge transport on short time scales and short length scales. The mechanism for charge injection is briefly addressed towards the end of this chapter.

  11. Geometric origin of central charges

    International Nuclear Information System (INIS)

    Lukierski, J.; Rytel, L.

    1981-05-01

    The complete set of N(N-1) central charge generators for D=4 N-extended super Poincare algebra is obtained by suitable contraction of OSp (2N; 4) superalgebra. The superspace realizations of the spinorial generators with central charges are derived. The conjugate set of N(N-1) additional bosonic superspace coordinates is introduced in an unique and geometric way. (author)

  12. Environmental charges in airline markets

    Energy Technology Data Exchange (ETDEWEB)

    Carlsson, Fredrik [Goeteborg Univ., Dept. of Economics, Goeteborg (Sweden)

    2002-07-01

    Over the last two decades many airline markets have been deregulated, resulting in increased competition and use of different types of networks. At the same time there has been an intense discussion on environmental taxation of airline traffic. It is likely that an optimal environmental charge and the effects of a charge differ between different types of aviation markets. In this paper, we derive optimal flight (environmental) charges for different types of airline markets. The first type of market is a multiproduct monopoly airline operating either a point-to-point network or a hub-and-spoke network. The optimal charge is shown to be similar in construction to an optimal charge for a monopolist. We also compare the environmental impact of the two types of networks. Given no differences in marginal damages between airports we find that an airline will always choose the network with the highest environmental damages. The second type of market we investigate is a multiproduct duopoly, where two airlines compete in both passengers and flights. The formulation of the optimal charge is similar to the optimal charge of a single product oligopoly. However, we also show that it is, because of strategic effects, difficult to determine the effects of the charge on the number of flights. (Author)

  13. Charge Master: Friend or Foe?

    Science.gov (United States)

    Wan, Wenshuai; Itri, Jason

    2016-01-01

    Prices charged for imaging services can be found in the charge master, a catalog of retail list prices for medical goods and services. This article reviews the evolution of reimbursement in the United States and provides a balanced discussion of the factors that influence charge master prices. Reduced payments to hospitals have pressured hospitals to generate additional revenue by increasing charge master prices. An unfortunate consequence is that those least able to pay for health care, the uninsured, are subjected to the highest charges. Yet, differences in pricing also represent an opportunity for radiology practices, which provide imaging services that are larger in scope or superior in quality to promote product differentiation. Physicians, hospital executives, and policy makers need to work together to improve the existing reimbursement system to promote high-quality, low-cost imaging. Copyright © 2016 Mosby, Inc. All rights reserved.

  14. Search for free fractional charge

    International Nuclear Information System (INIS)

    Heilig, S.J.

    1985-01-01

    Recent results of searches for free fractional charge have been null with the exception of the experiment at Stanford under the leadership of W. Fairbank. His experiment, while claiming the observation of free fractional charge, has yet to show that this observation was not spurious. The need for a confirming experiment with a different physical system is the motivation for the current work. A torsional pendulum has been constructed of a fused silica fiber with an attached fused silica crossbar. A transverse electric field is applied to the end of the crossbar, and the resulting deflection of the crossbar is used to measure the torque applied by the field. To date the limit of measurement for the charge on the crossbar (without sample) is 0 +/- 24 electronic charges. The history of this experiment is discussed, along with plans for pushing the limits of measurement to below the single-charge level

  15. Balance and Self-Efficacy of Balance in Children with CHARGE Syndrome

    Science.gov (United States)

    Haibach, Pamela S.; Lieberman, Lauren J.

    2013-01-01

    Introduction: Balance is a critical component of daily living, because it affects all movements and the ability to function independently. Children with CHARGE syndrome have sensory and motor impairments that could negatively affect their balance and postural control. The purpose of the study presented in this article was to assess the balance and…

  16. Improved non-invasive method for aerosol particle charge measurement employing in-line digital holography

    Science.gov (United States)

    Tripathi, Anjan Kumar

    Electrically charged particles are found in a wide range of applications ranging from electrostatic powder coating, mineral processing, and powder handling to rain-producing cloud formation in atmospheric turbulent flows. In turbulent flows, particle dynamics is influenced by the electric force due to particle charge generation. Quantifying particle charges in such systems will help in better predicting and controlling particle clustering, relative motion, collision, and growth. However, there is a lack of noninvasive techniques to measure particle charges. Recently, a non-invasive method for particle charge measurement using in-line Digital Holographic Particle Tracking Velocimetry (DHPTV) technique was developed in our lab, where charged particles to be measured were introduced to a uniform electric field, and their movement towards the oppositely charged electrode was deemed proportional to the amount of charge on the particles (Fan Yang, 2014 [1]). However, inherent speckle noise associated with reconstructed images was not adequately removed and therefore particle tracking data was contaminated. Furthermore, particle charge calculation based on particle deflection velocity neglected the particle drag force and rebound effect of the highly charged particles from the electrodes. We improved upon the existing particle charge measurement method by: 1) hologram post processing, 2) taking drag force into account in charge calculation, 3) considering rebound effect. The improved method was first fine-tuned through a calibration experiment. The complete method was then applied to two different experiments, namely conduction charging and enclosed fan-driven turbulence chamber, to measure particle charges. In all three experiments conducted, the particle charge was found to obey non-central t-location scale family of distribution. It was also noted that the charge distribution was insensitive to the change in voltage applied between the electrodes. The range of voltage

  17. What makes a movement a gesture?

    Science.gov (United States)

    Novack, Miriam A; Wakefield, Elizabeth M; Goldin-Meadow, Susan

    2016-01-01

    Theories of how adults interpret the actions of others have focused on the goals and intentions of actors engaged in object-directed actions. Recent research has challenged this assumption, and shown that movements are often interpreted as being for their own sake (Schachner & Carey, 2013). Here we postulate a third interpretation of movement-movement that represents action, but does not literally act on objects in the world. These movements are gestures. In this paper, we describe a framework for predicting when movements are likely to be seen as representations. In Study 1, adults described one of three scenes: (1) an actor moving objects, (2) an actor moving her hands in the presence of objects (but not touching them) or (3) an actor moving her hands in the absence of objects. Participants systematically described the movements as depicting an object-directed action when the actor moved objects, and favored describing the movements as depicting movement for its own sake when the actor produced the same movements in the absence of objects. However, participants favored describing the movements as representations when the actor produced the movements near, but not on, the objects. Study 2 explored two additional features-the form of an actor's hands and the presence of speech-like sounds-to test the effect of context on observers' classification of movement as representational. When movements are seen as representations, they have the power to influence communication, learning, and cognition in ways that movement for its own sake does not. By incorporating representational gesture into our framework for movement analysis, we take an important step towards developing a more cohesive understanding of action-interpretation. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Portable refrigerant charge meter and method for determining the actual refrigerant charge in HVAC systems

    Science.gov (United States)

    Gao, Zhiming; Abdelaziz, Omar; LaClair, Tim L.

    2017-08-08

    A refrigerant charge meter and a method for determining the actual refrigerant charge in HVAC systems are described. The meter includes means for determining an optimum refrigerant charge from system subcooling and system component parameters. The meter also includes means for determining the ratio of the actual refrigerant charge to the optimum refrigerant charge. Finally, the meter includes means for determining the actual refrigerant charge from the optimum refrigerant charge and the ratio of the actual refrigerant charge to the optimum refrigerant charge.

  19. Radiation by moving charges

    Energy Technology Data Exchange (ETDEWEB)

    Geloni, Gianluca [European XFEL GmbH, Hamburg (Germany); Kocharyan, Vitali; Saldin, Evgeni [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2017-04-15

    It is generally accepted that in order to describe the dynamics of relativistic particles in the laboratory (lab) frame it is sufficient to take into account the relativistic dependence of the particle momenta on the velocity. This solution of the dynamics problem in the lab frame makes no reference to Lorentz transformations. For this reason they are not discussed in particle tracking calculations in accelerator and plasma physics. It is generally believed that the electrodynamics problem can be treated within the same ''single inertial frame'' description without reference to Lorentz transformations. In particular, in order to evaluate radiation fields arising from charged particles in motion we need to know their velocities and positions as a function of the lab frame time t. The relativistic motion of a particle in the lab frame is described by Newton's second law ''corrected'' for the relativistic dependence of momentum on velocity. It is assumed in all standard derivations that one can perform identification of the trajectories in the source part of the usual Maxwell's equations with the trajectories vector x(t) measured (or calculated by using the corrected Newton's second law) in the lab frame. This way of coupling fields and particles is considered since more than a century as the relativistically correct procedure.We argue that this procedure needs to be changed, and we demonstrate the following, completely counterintuitive statement: the results of conventional theory of radiation by relativistically moving charges are not consistent with the principle of relativity. In order to find the trajectory of a particle in the lab frame consistent with the usual Maxwell's equations, one needs to solve the dynamic equation inmanifestly covariant form by using the coordinate-independent proper time τ to parameterize the particle world-line in space-time. We show that there is a difference between &apos

  20. Heavy charged particle therapy

    International Nuclear Information System (INIS)

    Mizoe, Jun-etsu

    1995-01-01

    A pilot study of heavy charged particles with heavy ion medical accelerator in Chiba (HIMAC) for advanced H and N cancer has been carried out from June 1994 at National Institute of Radiological Sciences (NIRS). As of the beginning of August 1994, three patients were treated by 290 MeV carbon ions. The patients had adenocarcinoma of the cheek mucosa, squamous cell carcinoma of the ethmoid sinus and adenoid cystic carcinoma of the sublingual gland. Patients were immobilized by individual head coach and thermosplint facial shell. Individual collimators and bolus were also prepared for each ports. Dose fractionation for the initial pilot study group was 16.2 GyE/18 fractions/6 weeks, which would be equivalent to standard fractionation of 60.0 Gy/30 fractions/6 weeks with photons. This dose fractionation was considered to be 20% lesser than 75 GyE/37.5 fractions/7.5 weeks, which is estimated to be maximum tolerance dose for advanced H and N cancers. HIMAC worked well and there was no major trouble causing any treatment delay. Acute skin reactions of 3 patients were 2 cases of bright erythema with patchy moist desquamation and one of dull erythema, which were evaluated as equivalent reaction with irradiated dose. Acute mucosa reactions appeared to have lesser reaction than predicted mucositis. Tumor reactions of three patients were partial reaction (PR) at the end of treatment and nearly complete remission (CR) after 6 months of treatment. From October 1994, we started to treat patients with advanced H and N cancer with 10% high dose than previous dose. And new candidates of pilot study with non small cell lung cancer, brain tumor and carcinoma of the tongue were entered into pilot study. At the end of February 1995, a total of 21 patients were treated by carbon ions. (J.P.N.)

  1. Numerical modelling of needle-grid electrodes for negative surface corona charging system

    International Nuclear Information System (INIS)

    Zhuang, Y; Chen, G; Rotaru, M

    2011-01-01

    Surface potential decay measurement is a simple and low cost tool to examine electrical properties of insulation materials. During the corona charging stage, a needle-grid electrodes system is often used to achieve uniform charge distribution on the surface of the sample. In this paper, a model using COMSOL Multiphysics has been developed to simulate the gas discharge. A well-known hydrodynamic drift-diffusion model was used. The model consists of a set of continuity equations accounting for the movement, generation and loss of charge carriers (electrons, positive and negative ions) coupled with Poisson's equation to take into account the effect of space and surface charges on the electric field. Four models with the grid electrode in different positions and several mesh sizes are compared with a model that only has the needle electrode. The results for impulse current and surface charge density on the sample clearly show the effect of the extra grid electrode with various positions.

  2. Examining Age-Related Movement Representations for Sequential (Fine-Motor) Finger Movements

    Science.gov (United States)

    Gabbard, Carl; Cacola, Priscila; Bobbio, Tatiana

    2011-01-01

    Theory suggests that imagined and executed movement planning relies on internal models for action. Using a chronometry paradigm to compare the movement duration of imagined and executed movements, we tested children aged 7-11 years and adults on their ability to perform sequential finger movements. Underscoring this tactic was our desire to gain a…

  3. Effect of the source charge on charged-boson interferometry

    International Nuclear Information System (INIS)

    Shoppa, T. D.; Koonin, S. E.; Seki, R.

    2000-01-01

    We investigate quantal perturbations of the interferometric correlations of charged bosons by the Coulomb field of an instantaneous, charged source. The source charge increases the apparent source size by weakening the correlation at nonzero relative momenta. The effect is strongest for pairs with a small total momentum and is stronger for kaons than for pions of the same momenta. The low-energy data currently available are well described by this effect. A simple expression is proposed to account for the effect. (c) 2000 The American Physical Society

  4. Stereotypic movement disorder: easily missed.

    Science.gov (United States)

    Freeman, Roger D; Soltanifar, Atefeh; Baer, Susan

    2010-08-01

    To expand the understanding of stereotypic movement disorder (SMD) and its differentiation from tics and autistic stereotypies. Forty-two children (31 males, mean age 6y 3mo, SD 2y 8mo; 11 females, mean age 6y 7mo, SD 1y 9mo) consecutively diagnosed with SMD, without-self-injurious behavior, intellectual disability, sensory impairment, or an autistic spectrum disorder (ASD), were assessed in a neuropsychiatry clinic. A list of probe questions on the nature of the stereotypy was administered to parents (and to children if developmentally ready). Questionnaires administered included the Stereotypy Severity Scale, Short Sensory Profile, Strengths and Difficulties Questionnaire, Repetitive Behavior Scale--Revised, and the Developmental Coordination Disorder Questionnaire. The stereotyped movement patterns were directly observed and in some cases further documented by video recordings made by parents. The probe questions were used again on follow-up at a mean age of 10 years 7 months (SD 4y 4mo). Mean age at onset was 17 months. Males exceeded females by 3:1. Family history of a pattern of SMD was reported in 13 and neuropsychiatric comorbidity in 30 (attention-deficit-hyperactivity disorder in 16, tics in 18, and developmental coordination disorder in 16). Obsessive-compulsive disorder occurred in only two. The Short Sensory Profile correlated with comorbidity (p<0.001), the Stereotypy Severity Scale (p=0.009), and the Repetitive Behavior Scale (p<0.001); the last correlated with the Stereotypy Severity Scale (p=0.001). Children (but not their parents) liked their movements, which were usually associated with excitement or imaginative play. Mean length of follow-up was 4 years 8 months (SD 2y 10mo). Of the 39 children followed for longer than 6 months, the behavior stopped or was gradually shaped so as to occur primarily privately in 25. Misdiagnosis was common: 26 were initially referred as tics, 10 as ASD, five as compulsions, and one as epilepsy. Co-occurring facial

  5. Brownian movement and molecular reality

    CERN Document Server

    Perrin, Jean

    2005-01-01

    How do we know that molecules really exist? An important clue came from Brownian movement, a concept developed in 1827 by botanist Robert Brown, who noticed that tiny objects like pollen grains shook and moved erratically when viewed under a microscope. Nearly 80 years later, in 1905, Albert Einstein explained this ""Brownian motion"" as the result of bombardment by molecules. Einstein offered a quantitative explanation by mathematically estimating the average distance covered by the particles over time as a result of molecular bombardment. Four years later, Jean Baptiste Perrin wrote Brownia

  6. Case vignettes of movement disorders.

    Science.gov (United States)

    Yung, C Y

    1983-08-01

    This paper reports five movement disorders cases to serve as a basis for discussion of the problems encountered in the clinical management of these cases, and the pathophysiological mechanisms involved in these disorders as presented. Case 1 is a description of the subjective experience of a patient with acute orofacial dystonia from promethazine. Case 2 is the use of clonazepam is post-head injury tics. Case 3 is the complication from discontinuation of haloperidol and benztropine mesylate treatment. Case 4 is myoclonus in subacute sclerosing Panencephalitis, and Case 5 is rebound tremor from withdrawal of a beta-adrenergic blocker.

  7. Matrix-operator method for calculation of dynamics of intense beams of charged particles

    International Nuclear Information System (INIS)

    Kapchinskij, M.I.; Korenev, I.L.; Rinskij, L.A.

    1989-01-01

    Calculation algorithm for particle dynamics in high-current cyclic and linear accelerators is suggested. Particle movement in six-dimensional phase space is divided into coherent and incoherent components. Incoherent movement is described by envelope method; particle cluster is considered to be even-charged by tri-axial ellipsoid. Coherent movement is described in para-axial approximation; each structure element of the accelerator transport channel is characterized by six-dimensional matrix of phase coordinate transformation of cluster centre and by shift vector resulting from deviation of focusing element parameters from calculated values. Effect of space charge reflected forces is taken into account in the element matrix. Algorithm software is realized using well-known TRANSPORT program

  8. Movement of the diaphragm during radiation treatment

    International Nuclear Information System (INIS)

    Nishioka, Masayuki; Fujioka, Tomio; Sakurai, Makoto; Nakajima, Toshifumi; Onoyama, Yasuto.

    1991-01-01

    Movement of the target volume during the exposure to radiation results in decreased accuracy in radiotherapy. We carried out the quantitative evaluation of the movement of the diaphragm during the radiation therapy. Seventy seven patients, who received radiation therapy for lung cancer from December 1988 to February 1990 at the Osaka-prefectural Habikino Hospital, were studied. The movement was recorded with a sonoprinter at the time of treatment planning for radiotherapy, and the length of movement was evaluated at 6 points on the diaphragm. In a study of 402 points in 77 patients, the average movement was 12 mm, and the maximum movement was 40 mm. At the 17% of the points, the movement exceeded 20 mm. The largest movement was observed at the outer point of the right lung. Movement was greater in men than in women. Performance status was not related to the degree of movement. We concluded that in chest and abdominal irradiation, movement caused by respiration is not negligible, and synchronized radiotherapy should be developed in the future. (author)

  9. Position sensitive proportional counter for measurement of tritium labelled gas movement

    International Nuclear Information System (INIS)

    Mori, Chizuo; Nakamoto, Makihiko; Uritani, Akira; Watanabe, Tamaki

    1984-01-01

    A position sensitive proportional counter of a charge division type with a single resistive anode wire was constructed for the measurement of the movement of 3 H labelled gas which is flowing or diffusing in a pipe. The introduction of resistors between the anode wire and pre-amplifiers brought a uniform detection efficiency for 3 H β-rays throughout the counter. The position resolution was 3.1 mm FWHM. Detection efficiency was almost 100% uniformly over about 700 mm in the total anode length of 740 mm. The movement of 3 H labelled gas could be measured effectively. (author)

  10. Big break for charge symmetry

    CERN Document Server

    Miller, G A

    2003-01-01

    Two new experiments have detected charge-symmetry breaking, the mechanism responsible for protons and neutrons having different masses. Symmetry is a crucial concept in the theories that describe the subatomic world because it has an intimate connection with the laws of conservation. The theory of the strong interaction between quarks - quantum chromodynamics - is approximately invariant under what is called charge symmetry. In other words, if we swap an up quark for a down quark, then the strong interaction will look almost the same. This symmetry is related to the concept of sup i sospin sup , and is not the same as charge conjugation (in which a particle is replaced by its antiparticle). Charge symmetry is broken by the competition between two different effects. The first is the small difference in mass between up and down quarks, which is about 200 times less than the mass of the proton. The second is their different electric charges. The up quark has a charge of +2/3 in units of the proton charge, while ...

  11. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  12. Electron-beam-charged dielectrics: Internal charge distribution

    Science.gov (United States)

    Beers, B. L.; Pine, V. W.

    1981-01-01

    Theoretical calculations of an electron transport model of the charging of dielectrics due to electron bombardment are compared to measurements of internal charge distributions. The emphasis is on the distribution of Teflon. The position of the charge centroid as a function of time is not monotonic. It first moves deeper into the material and then moves back near to the surface. In most time regimes of interest, the charge distribution is not unimodal, but instead has two peaks. The location of the centroid near saturation is a function of the incident current density. While the qualitative comparison of theory and experiment are reasonable, quantitative comparison shows discrepancies of as much as a factor of two.

  13. New spectrometer for charged particles

    International Nuclear Information System (INIS)

    Wajsfelner, Rene

    1970-02-01

    This thesis is devoted to the study and development of an electrostatic spectrometer which is not only more accurate for the determination of size distributions of electrically charged radio-active atmospheric aerosols, but which can also be used for measuring the grain-size distribution of any cloud of particles which will previously have been charged according to a known, reproducible law. An experimental study has been made of the development of this precipitator and also of its calibration. The electrical charge on spherical polystyrene latex particles suspended in air by atomization has been studied; a theoretical explanation of these results is put forward. (author) [fr

  14. Charge density waves in solids

    CERN Document Server

    Gor'kov, LP

    2012-01-01

    The latest addition to this series covers a field which is commonly referred to as charge density wave dynamics.The most thoroughly investigated materials are inorganic linear chain compounds with highly anisotropic electronic properties. The volume opens with an examination of their structural properties and the essential features which allow charge density waves to develop.The behaviour of the charge density waves, where interesting phenomena are observed, is treated both from a theoretical and an experimental standpoint. The role of impurities in statics and dynamics is considered and an

  15. Electrostatic field and charge distribution in small charged dielectric droplets

    Science.gov (United States)

    Storozhev, V. B.

    2004-08-01

    The charge distribution in small dielectric droplets is calculated on the basis of continuum medium approximation. There are considered charged liquid spherical droplets of methanol in the range of nanometer sizes. The problem is solved by the following way. We find the free energy of some ion in dielectric droplet, which is a function of distribution of other ions in the droplet. The probability of location of the ion in some element of volume in the droplet is a function of its free energy in this element of volume. The same approach can be applied to other ions in the droplet. The obtained charge distribution differs considerably from the surface distribution. The curve of the charge distribution in the droplet as a function of radius has maximum near the surface. Relative concentration of charges in the vicinity of the center of the droplet does not equal to zero, and it is the higher, the less is the total charge of the droplet. According to the estimates the model is applicable if the droplet radius is larger than 10 nm.

  16. Electrostatic field and charge distribution in small charged dielectric droplets

    International Nuclear Information System (INIS)

    Storozhev, V.B.

    2004-01-01

    The charge distribution in small dielectric droplets is calculated on the basis of continuum medium approximation. There are considered charged liquid spherical droplets of methanol in the range of nanometer sizes. The problem is solved by the following way. We find the free energy of some ion in dielectric droplet, which is a function of distribution of other ions in the droplet. The probability of location of the ion in some element of volume in the droplet is a function of its free energy in this element of volume. The same approach can be applied to other ions in the droplet. The obtained charge distribution differs considerably from the surface distribution. The curve of the charge distribution in the droplet as a function of radius has maximum near the surface. Relative concentration of charges in the vicinity of the center of the droplet does not equal to zero, and it is the higher, the less is the total charge of the droplet. According to the estimates the model is applicable if the droplet radius is larger than 10 nm

  17. VT Data - Electric Charging Stations

    Data.gov (United States)

    Vermont Center for Geographic Information — Locations of Electric Charging Stations provided by the NREL national laboratory of the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy....

  18. ESA's tools for internal charging

    International Nuclear Information System (INIS)

    Soerensen, J.; Rodgers, D.J.; Ryden, K.A.; Latham, P.M.; Wrenn, G.L.; Levy, L.; Panabiere, G.

    1999-01-01

    Electrostatic discharges, caused by bulk charging of spacecraft insulating materials, are a major cause of satellite anomalies. This is a presentation of ESA's tools to assess whether a given structure is liable to experience electrostatic discharges. (authors)

  19. Measurements of W Charge Asymmetry

    Energy Technology Data Exchange (ETDEWEB)

    Holzbauer, J. L. [Mississippi U.

    2015-10-06

    We discuss W boson and lepton charge asymmetry measurements from W decays in the electron channel, which were made using 9.7 fb$^{-1}$ of RunII data collected by the D0 detector at the Fermilab Tevatron Collider. The electron charge asymmetry is presented as a function of pseudo-rapidity out to |$\\eta$| $\\le$ 3.2, in five symmetric and asymmetric kinematic bins of electron transverse momentum and the missing transverse energy of the event. We also give the W charge asymmetry as a function of W boson rapidity. The asymmetries are compared with next-to-leading order perturbative quantum chromodynamics calculations. These charge asymmetry measurements will allow more accurate determinations of the proton parton distribution functions and are the most precise to date.

  20. Fluorescence-tracking of activation gating in human ERG channels reveals rapid S4 movement and slow pore opening.

    Directory of Open Access Journals (Sweden)

    Zeineb Es-Salah-Lamoureux

    2010-05-01

    Full Text Available hERG channels are physiologically important ion channels which mediate cardiac repolarization as a result of their unusual gating properties. These are very slow activation compared with other mammalian voltage-gated potassium channels, and extremely rapid inactivation. The mechanism of slow activation is not well understood and is investigated here using fluorescence as a direct measure of S4 movement and pore opening.Tetramethylrhodamine-5-maleimide (TMRM fluorescence at E519 has been used to track S4 voltage sensor movement, and channel opening and closing in hERG channels. Endogenous cysteines (C445 and C449 in the S1-S2 linker bound TMRM, which caused a 10 mV hyperpolarization of the V((1/2 of activation to -27.5+/-2.0 mV, and showed voltage-dependent fluorescence signals. Substitution of S1-S2 linker cysteines with valines allowed unobstructed recording of S3-S4 linker E519C and L520C emission signals. Depolarization of E519C channels caused rapid initial fluorescence quenching, fit with a double Boltzmann relationship, F-V(ON, with V((1/2 (,1 = -37.8+/-1.7 mV, and V((1/2 (,2 = 43.5+/-7.9 mV. The first phase, V((1/2 (,1, was approximately 20 mV negative to the conductance-voltage relationship measured from ionic tail currents (G-V((1/2 = -18.3+/-1.2 mV, and relatively unchanged in a non-inactivating E519C:S620T mutant (V((1/2 = -34.4+/-1.5 mV, suggesting the fast initial fluorescence quenching tracked S4 voltage sensor movement. The second phase of rapid quenching was absent in the S620T mutant. The E519C fluorescence upon repolarization (V((1/2 = -20.6+/-1.2, k = 11.4 mV and L520C quenching during depolarization (V((1/2 = -26.8+/-1.0, k = 13.3 mV matched the respective voltage dependencies of hERG ionic tails, and deactivation time constants from -40 to -110 mV, suggesting they detected pore-S4 rearrangements related to ionic current flow during pore opening and closing.THE DATA INDICATE: 1 that rapid environmental changes occur at the

  1. Charged particle acceleration with plasmas

    International Nuclear Information System (INIS)

    Bravo O, A.

    1989-01-01

    Under certain conditions it is possible to create spatial charge waves (OCE) in a plasma (ionized gas) through some disturbance mechanism, the phenomenon produces electric fields of high intensity that are propagated at velocities near to a c. When charged particles are connected to such OCE they may be accelerated to very high energies in short distances. At present electric fields of approximately 10 7 V/cm have been observed. (Author). 4 refs

  2. Electrically charged dilatonic black rings

    International Nuclear Information System (INIS)

    Kunduri, Hari K.; Lucietti, James

    2005-01-01

    In this Letter we present (electrically) charged dilatonic black ring solutions of the Einstein-Maxwell-dilaton theory in five dimensions and we consider their physical properties. These solutions are static and as in the neutral case possess a conical singularity. We show how one may remove the conical singularity by application of a Harrison transformation, which physically corresponds to supporting the charged ring with an electric field. Finally, we discuss the slowly rotating case for arbitrary dilaton coupling

  3. Autonomous Electrical Vehicles’ Charging Station

    OpenAIRE

    Józef Paska; Mariusz Kłos; Łukasz Rosłaniec; Rafał Bielas; Magdalena Błędzińska

    2016-01-01

    This paper presents a model of an autonomous electrical vehicles’ charging station. It consists of renewable energy sources: wind turbine system, photovoltaic cells, as well as an energy storage, load, and EV charging station. In order to optimise the operating conditions, power electronic converters were added to the system. The model was implemented in the Homer Energy programme. The first part of the paper presents the design assumptions and technological solutions. Further in the paper...

  4. Sodium vapor charge exchange cell

    International Nuclear Information System (INIS)

    Hiddleston, H.R.; Fasolo, J.A.; Minette, D.C.; Chrien, R.E.; Frederick, J.A.

    1976-01-01

    An operational sequential charge-exchange ion source yielding a 50 MeV H - current of approximately 8 mA is planned for use with the Argonne 500 MeV booster synchrotron. We report on the progress for development of a sodium vapor charge-exchange cell as part of that planned effort. Design, fabrication, and operating results to date are presented and discussed. (author)

  5. Constraints on voltage sensor movement in the shaker K+ channel.

    Science.gov (United States)

    Darman, Rachel B; Ivy, Allison A; Ketty, Vina; Blaustein, Robert O

    2006-12-01

    In nerve and muscle cells, the voltage-gated opening and closing of cation-selective ion channels is accompanied by the translocation of 12-14 elementary charges across the membrane's electric field. Although most of these charges are carried by residues in the S4 helix of the gating module of these channels, the precise nature of their physical movement is currently the topic of spirited debate. Broadly speaking, two classes of models have emerged: those that suggest that small-scale motions can account for the extensive charge displacement, and those that invoke a much larger physical movement. In the most recent incarnation of the latter type of model, which is based on structural and functional data from the archaebacterial K(+) channel KvAP, a "voltage-sensor paddle" comprising a helix-turn-helix of S3-S4 translocates approximately 20 A through the bilayer during the gating cycle (Jiang, Y., A. Lee, J. Chen, V. Ruta, M. Cadene, B.T. Chait, and R. MacKinnon. 2003. Nature. 423:33-41; Jiang, Y., V. Ruta, J. Chen, A. Lee, and R. MacKinnon. 2003. Nature. 423:42-48.; Ruta, V., J. Chen, and R. MacKinnon. 2005. Cell. 123:463-475). We used two methods to test for analogous motions in the Shaker K(+) channel, each examining the aqueous exposure of residues near S3. In the first, we employed a pore-blocking maleimide reagent (Blaustein, R.O., P.A. Cole, C. Williams, and C. Miller. 2000. Nat. Struct. Biol. 7:309-311) to probe for state-dependent changes in the chemical reactivity of substituted cysteines; in the second, we tested the state-dependent accessibility of a tethered biotin to external streptavidin (Qiu, X.Q., K.S. Jakes, A. Finkelstein, and S.L. Slatin. 1994. J. Biol. Chem. 269:7483-7488; Slatin, S.L., X.Q. Qiu, K.S. Jakes, and A. Finkelstein. 1994. Nature. 371:158-161). In both types of experiments, residues predicted to lie near the top of S3 did not exhibit any change in aqueous exposure during the gating cycle. This lack of state dependence argues against

  6. Laser-driven micro-Coulomb charge movement and energy conversion to relativistic electrons

    Czech Academy of Sciences Publication Activity Database

    Cobble, J. A.; Palaniyappan, S.; Johnson, R. P.; Shimada, T.; Huang, C.; Gautier, D. C.; Clark, D. D.; Falk, Kateřina; Jung, D.

    2016-01-01

    Roč. 23, č. 9 (2016), s. 1-12, č. článku 093113. ISSN 1070-664X R&D Projects: GA MŠk LQ1606; GA MŠk EF15_008/0000162 Grant - others:ELI Beamlines(XE) CZ.02.1.01/0.0/0.0/15_008/0000162 Institutional support: RVO:68378271 Keywords : x-ray applications * ignition * plasma * fusion * gain * ionization * target Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.115, year: 2016

  7. Measuring momentum for charged particle tomography

    Science.gov (United States)

    Morris, Christopher; Fraser, Andrew Mcleod; Schultz, Larry Joe; Borozdin, Konstantin N.; Klimenko, Alexei Vasilievich; Sossong, Michael James; Blanpied, Gary

    2010-11-23

    Methods, apparatus and systems for detecting charged particles and obtaining tomography of a volume by measuring charged particles including measuring the momentum of a charged particle passing through a charged particle detector. Sets of position sensitive detectors measure scattering of the charged particle. The position sensitive detectors having sufficient mass to cause the charged particle passing through the position sensitive detectors to scatter in the position sensitive detectors. A controller can be adapted and arranged to receive scattering measurements of the charged particle from the charged particle detector, determine at least one trajectory of the charged particle from the measured scattering; and determine at least one momentum measurement of the charged particle from the at least one trajectory. The charged particle can be a cosmic ray-produced charged particle, such as a cosmic ray-produced muon. The position sensitive detectors can be drift cells, such as gas-filled drift tubes.

  8. Methods for studying plasma charge transport across a magnetic field

    International Nuclear Information System (INIS)

    Popovich, A.S.

    1978-01-01

    A comparative analysis of experimental methods for the diffusion transfer of plasma charged particles accross the magnetic field at the study of its confinement effectiveness, instability effect is carried out. Considered are the methods based on the analysis of particle balance in the charge and possibilities of diffusion coefficient determination according to measuring parameters of density gradient and particle flow on the wall, rate of plasma decay after switching off ionization source radial profile of plasma density outside the active region of stationary charge. Much attension is payed to the research methods of diffusion transfer, connected with the study of propagation of periodic and aperiodic density perturbation in a plasma. Analysed is the Golubev and Granovsky method of diffusion waves and its different modifications, phase analysis method of ''test charges'' movement, as well as different modifications of correlation methods. Considered are physical preconditions of the latter and criticized is unilateral interpretation of correlation measurings, carried out in a number of works. The analysis of study possibilities of independent (non-ambipolar) diffusion of electrons and ions in a plasma in the magnetic field is executed

  9. Deriving Animal Movement Behaviors Using Movement Parameters Extracted from Location Data

    Directory of Open Access Journals (Sweden)

    Maryam Teimouri

    2018-02-01

    Full Text Available We present a methodology for distinguishing between three types of animal movement behavior (foraging, resting, and walking based on high-frequency tracking data. For each animal we quantify an individual movement path. A movement path is a temporal sequence consisting of the steps through space taken by an animal. By selecting a set of appropriate movement parameters, we develop a method to assess movement behavioral states, reflected by changes in the movement parameters. The two fundamental tasks of our study are segmentation and clustering. By segmentation, we mean the partitioning of the trajectory into segments, which are homogeneous in terms of their movement parameters. By clustering, we mean grouping similar segments together according to their estimated movement parameters. The proposed method is evaluated using field observations (done by humans of movement behavior. We found that on average, our method agreed with the observational data (ground truth at a level of 80.75% ± 5.9% (SE.

  10. Interactions between charged spherical macroions

    International Nuclear Information System (INIS)

    Stevens, M.J.; Falk, M.L.; Robbins, M.O.

    1996-01-01

    Monte Carlo (MC) simulations were used to study the screened interactions between charged spherical macroions surrounded by discrete counterions, and to test previous theories of screening. The simulations were performed in the primitive cell of the bcc lattice, and in the spherical Wigner endash Seitz cell that is commonly used in approximate calculations. We found that the Wigner endash Seitz approximation is valid even at high volume fractions φ and large macroion charges Z, because the macroion charge becomes strongly screened. Pressures calculated from Poisson endash Boltzmann theory and local density functional theory deviate from MC values as φ and Z increase, but continue to provide upper and lower bounds for the MC results. While Debye endash Hueckel (DH) theory fails badly when the bare charge is used, MC pressures can be fit with an effective DH charge, Z DH , that is nearly independent of volume fraction. As Z diverges, Z DH saturates at zψ max R m /λ, where z is the counterion charge, R m is the macroion radius, λ is the Bjerrum length, and ψ max is a constant of order 10. copyright 1996 American Institute of Physics

  11. Cosmology of a charged universe

    International Nuclear Information System (INIS)

    Barnes, A.

    1979-01-01

    The Proca generalization of electrodynamics admits the possibility that the universe could possess a net electric charge uniformly distributed throughout space, while possessing no electric field. A charged intergalactic (and intragalactic) medium of this kind could contain enough energy to be of cosmological importance. A general-relativistic model of cosmological expansion dominated by such a charged background has been calculated, and is consistent with present observational limits on the Hubble constant, the decleration parameter, and the age of the universe. However, if this cosmology applied at the present epoch, the very early expansion of the universe would have been much more rapid than in conventional ''big bang'' cosmologies, too rapid for cosmological nucleosynthesis or thermalization of the background radiation to have occurred. Hence, domination of the present expansion by background charge appears to be incompatible with the 3 K background and big-bang production of light elements. If the present background charge density were sufficiently small (but not strictly zero), expansion from the epoch of nucleosynthesis would proceed according to the conventional scenario, but the energy due to the background charge would have dominated at some earlier epoch. This last possibility leads to equality of pressure and energy density in the primordial universe, a condition of special significance in certain cosmological theories

  12. Enabling fast charging - Vehicle considerations

    Science.gov (United States)

    Meintz, Andrew; Zhang, Jiucai; Vijayagopal, Ram; Kreutzer, Cory; Ahmed, Shabbir; Bloom, Ira; Burnham, Andrew; Carlson, Richard B.; Dias, Fernando; Dufek, Eric J.; Francfort, James; Hardy, Keith; Jansen, Andrew N.; Keyser, Matthew; Markel, Anthony; Michelbacher, Christopher; Mohanpurkar, Manish; Pesaran, Ahmad; Scoffield, Don; Shirk, Matthew; Stephens, Thomas; Tanim, Tanvir

    2017-11-01

    To achieve a successful increase in the plug-in battery electric vehicle (BEV) market, it is anticipated that a significant improvement in battery performance is required to increase the range that BEVs can travel and the rate at which they can be recharged. While the range that BEVs can travel on a single recharge is improving, the recharge rate is still much slower than the refueling rate of conventional internal combustion engine vehicles. To achieve comparable recharge times, we explore the vehicle considerations of charge rates of at least 400 kW. Faster recharge is expected to significantly mitigate the perceived deficiencies for long-distance transportation, to provide alternative charging in densely populated areas where overnight charging at home may not be possible, and to reduce range anxiety for travel within a city when unplanned charging may be required. This substantial increase in charging rate is expected to create technical issues in the design of the battery system and the vehicle's electrical architecture that must be resolved. This work focuses on vehicle system design and total recharge time to meet the goals of implementing improved charge rates and the impacts of these expected increases on system voltage and vehicle components.

  13. The Anti-Doping Movement.

    Science.gov (United States)

    Willick, Stuart E; Miller, Geoffrey D; Eichner, Daniel

    2016-03-01

    Historical reports of doping in sports date as far back as the ancient Greek Olympic Games. The anti-doping community considers doping in sports to be cheating and a violation of the spirit of sport. During the past century, there has been an increasing awareness of the extent of doping in sports and the health risks of doping. In response, the anti-doping movement has endeavored to educate athletes and others about the health risks of doping and promote a level playing field. Doping control is now undertaken in most countries around the world and at most elite sports competitions. As athletes have found new ways to dope, however, the anti-doping community has endeavored to strengthen its educational and deterrence efforts. It is incumbent upon sports medicine professionals to understand the health risks of doping and all doping control processes. Copyright © 2016 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

  14. Teaching Movement Activities as Performativity

    DEFF Research Database (Denmark)

    Jensen, Jens-Ole

    2017-01-01

    subjects the teaching style should be characterized by more variation and motivate the pupils. Research has shown that there is a correlation between physical activity and intellectual capital (e.g. educational attainment and academic performance), physical capital (e.g. physical fitness and reduction...... of the risk for diseases and risk factors) and emotional capital (e.g. fun, enjoyment and self-esteem) (Bailey, Hillman, Arent, & Petitpas, 2013). The school reform prescribes that all pupils from grade 1-9 must have at least 45 minutes of movement activities in average every day.Next to the well-known PE...... without prerequisites but part of discourses and at the same time individual interpretations of specific practices. The teaching role is something that is constantly produced and reproduced in the bodily interaction. Understanding teaching as performativity means that teachers are not acting in certain...

  15. Plant movements and climate warming

    DEFF Research Database (Denmark)

    De Frenne, Pieter; Coomes, David A.; De Schrijver, An

    2014-01-01

    environments can establish in nonlocal sites. •We assess the intraspecific variation in growth responses to nonlocal soils by planting a widespread grass of deciduous forests (Milium effusum) into an experimental common garden using combinations of seeds and soil sampled in 22 sites across its distributional...... range, and reflecting movement scenarios of up to 1600 km. Furthermore, to determine temperature and forest-structural effects, the plants and soils were experimentally warmed and shaded. •We found significantly positive effects of the difference between the temperature of the sites of seed and soil...... collection on growth and seedling emergence rates. Migrant plants might thus encounter increasingly favourable soil conditions while tracking the isotherms towards currently ‘colder’ soils. These effects persisted under experimental warming. Rising temperatures and light availability generally enhanced plant...

  16. A Novel Methodology for Charging Station Deployment

    Science.gov (United States)

    Sun, Zhonghao; Zhao, Yunwei; He, Yueying; Li, Mingzhe

    2018-02-01

    Lack of charging stations has been a main obstacle to the promotion of electric vehicles. This paper studies deploying charging stations in traffic networks considering grid constraints to balance the charging demand and grid stability. First, we propose a statistical model for charging demand. Then we combine the charging demand model with power grid constraints and give the formulation of the charging station deployment problem. Finally, we propose a theoretical solution for the problem by transforming it to a Markov Decision Process.

  17. Parametric HMMs for Movement Recognition and Synthesis

    DEFF Research Database (Denmark)

    Herzog, Dennis; Krüger, Volker

    2009-01-01

    , we develop an exemplar-based parametric hidden Markov model (PHMM) that allows to represent movements of a particular type. Since we use model interpolation to reduce the necessary amount of training data, we had to develop a method to setup local models in a synchronized way. In our experiments we......A common problem in human movement recognition is the recognition of movements of a particular type (semantic). E.g., grasping movements have a particular semantic (grasping) but the actual movements usually have very different appearances due to, e.g., different grasping directions. In this paper...... to recover the movement type, and, e.g., the object position a human is pointing at. Our experiments show the flexibility of the PHMMs in terms of the amount of training data and its robustness in terms of noisy observation data. In addition, we compare our PHMM to an other kind of PHMM, which has been...

  18. Integrating individual movement behaviour into dispersal functions.

    Science.gov (United States)

    Heinz, Simone K; Wissel, Christian; Conradt, Larissa; Frank, Karin

    2007-04-21

    Dispersal functions are an important tool for integrating dispersal into complex models of population and metapopulation dynamics. Most approaches in the literature are very simple, with the dispersal functions containing only one or two parameters which summarise all the effects of movement behaviour as for example different movement patterns or different perceptual abilities. The summarising nature of these parameters makes assessing the effect of one particular behavioural aspect difficult. We present a way of integrating movement behavioural parameters into a particular dispersal function in a simple way. Using a spatial individual-based simulation model for simulating different movement behaviours, we derive fitting functions for the functional relationship between the parameters of the dispersal function and several details of movement behaviour. This is done for three different movement patterns (loops, Archimedean spirals, random walk). Additionally, we provide measures which characterise the shape of the dispersal function and are interpretable in terms of landscape connectivity. This allows an ecological interpretation of the relationships found.

  19. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

    Science.gov (United States)

    Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

    2005-08-15

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

  20. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

    International Nuclear Information System (INIS)

    Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana; Mingarro, Ismael; Pallas, Vicente

    2005-01-01

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed

  1. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements

    DEFF Research Database (Denmark)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar

    2008-01-01

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...

  2. Rapid charging of nickel-cadmium accumulators

    Energy Technology Data Exchange (ETDEWEB)

    Bruck, F

    1972-01-01

    Four types of charging of gas-tight Ni-Cd accumulators (a) normal; (b) accelerated; (c) rapid; and (d) ultra-rapid are described. For rapid charging, a built-in temperature sensor cuts off charging current at a prescribed point. In ultra-rapid charging, 50% charge can be attained in 3.5 min. and 25% charge within 50 sec. In the second phase of ultra-rapid charging, a surplus of oxygen is released at the positive electrode and a safety valve is provided for pressure reduction. Characteristic curves are given for various rates of charging and some data on discharge rates is also given.

  3. Adaptability and Prediction of Anticipatory Muscular Activity Parameters to Different Movements in the Sitting Position.

    Science.gov (United States)

    Chikh, Soufien; Watelain, Eric; Faupin, Arnaud; Pinti, Antonio; Jarraya, Mohamed; Garnier, Cyril

    2016-08-01

    Voluntary movement often causes postural perturbation that requires an anticipatory postural adjustment to minimize perturbation and increase the efficiency and coordination during execution. This systematic review focuses specifically on the relationship between the parameters of anticipatory muscular activities and movement finality in sitting position among adults, to study the adaptability and predictability of anticipatory muscular activities parameters to different movements and conditions in sitting position in adults. A systematic literature search was performed using PubMed, Science Direct, Web of Science, Springer-Link, Engineering Village, and EbscoHost. Inclusion and exclusion criteria were applied to retain the most rigorous and specific studies, yielding 76 articles, Seventeen articles were excluded at first reading, and after the application of inclusion and exclusion criteria, 23 were retained. In a sitting position, central nervous system activity precedes movement by diverse anticipatory muscular activities and shows the ability to adapt anticipatory muscular activity parameters to the movement direction, postural stability, or charge weight. In addition, these parameters could be adapted to the speed of execution, as found for the standing position. Parameters of anticipatory muscular activities (duration, order, and amplitude of muscle contractions constituting the anticipatory muscular activity) could be used as a predictive indicator of forthcoming movement. In addition, this systematic review may improve methodology in empirical studies and assistive technology for people with disabilities. © The Author(s) 2016.

  4. Movement-based Interaction in Camera Spaces

    DEFF Research Database (Denmark)

    Eriksson, Eva; Riisgaard Hansen, Thomas; Lykke-Olesen, Andreas

    2006-01-01

    In this paper we present three concepts that address movement-based interaction using camera tracking. Based on our work with several movement-based projects we present four selected applications, and use these applications to leverage our discussion, and to describe our three main concepts space......, relations, and feedback. We see these as central for describing and analysing movement-based systems using camera tracking and we show how these three concepts can be used to analyse other camera tracking applications....

  5. Outcomes of Social Movements and Protest Activities

    OpenAIRE

    Giugni, Marco; Bosi, Lorenzo; Uba, Katrin

    2013-01-01

    Scholarship has left the study of the consequences of social movements in the background for a long time, focusing instead on movement emergence, characteristics, and dynamics. Since the mid-1970s, however, scholars have paid an increasing interest in how social movements and protest activities may produce change at various levels. The existing literature can be ordered according to the kind of consequence addressed. In this regard, one can roughly distinguish between political, biographical,...

  6. Subthalamic nucleus detects unnatural android movement.

    Science.gov (United States)

    Ikeda, Takashi; Hirata, Masayuki; Kasaki, Masashi; Alimardani, Maryam; Matsushita, Kojiro; Yamamoto, Tomoyuki; Nishio, Shuichi; Ishiguro, Hiroshi

    2017-12-19

    An android, i.e., a realistic humanoid robot with human-like capabilities, may induce an uncanny feeling in human observers. The uncanny feeling about an android has two main causes: its appearance and movement. The uncanny feeling about an android increases when its appearance is almost human-like but its movement is not fully natural or comparable to human movement. Even if an android has human-like flexible joints, its slightly jerky movements cause a human observer to detect subtle unnaturalness in them. However, the neural mechanism underlying the detection of unnatural movements remains unclear. We conducted an fMRI experiment to compare the observation of an android and the observation of a human on which the android is modelled, and we found differences in the activation pattern of the brain regions that are responsible for the production of smooth and natural movement. More specifically, we found that the visual observation of the android, compared with that of the human model, caused greater activation in the subthalamic nucleus (STN). When the android's slightly jerky movements are visually observed, the STN detects their subtle unnaturalness. This finding suggests that the detection of unnatural movements is attributed to an error signal resulting from a mismatch between a visual input and an internal model for smooth movement.

  7. Airport Movement Area Closure Planner, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This SBIR research develops an automation tool improving temporary and permanent runway closure management. The Movement Area Closure Planner (MACP) provides airport...

  8. Degeneration of rapid eye movement sleep circuitry underlies rapid eye movement sleep behavior disorder.

    Science.gov (United States)

    McKenna, Dillon; Peever, John

    2017-05-01

    During healthy rapid eye movement sleep, skeletal muscles are actively forced into a state of motor paralysis. However, in rapid eye movement sleep behavior disorder-a relatively common neurological disorder-this natural process is lost. A lack of motor paralysis (atonia) in rapid eye movement sleep behavior disorder allows individuals to actively move, which at times can be excessive and violent. At first glance this may sound harmless, but it is not because rapid eye movement sleep behavior disorder patients frequently injure themselves or the person they sleep with. It is hypothesized that the degeneration or dysfunction of the brain stem circuits that control rapid eye movement sleep paralysis is an underlying cause of rapid eye movement sleep behavior disorder. The link between brain stem degeneration and rapid eye movement sleep behavior disorder stems from the fact that rapid eye movement sleep behavior disorder precedes, in the majority (∼80%) of cases, the development of synucleinopathies such as Parkinson's disease, dementia with Lewy bodies, and multiple system atrophy, which are known to initially cause degeneration in the caudal brain stem structures where rapid eye movement sleep circuits are located. Furthermore, basic science and clinical evidence demonstrate that lesions within the rapid eye movement sleep circuits can induce rapid eye movement sleep-specific motor deficits that are virtually identical to those observed in rapid eye movement sleep behavior disorder. This review examines the evidence that rapid eye movement sleep behavior disorder is caused by synucleinopathic neurodegeneration of the core brain stem circuits that control healthy rapid eye movement sleep and concludes that rapid eye movement sleep behavior disorder is not a separate clinical entity from synucleinopathies but, rather, it is the earliest symptom of these disorders. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and

  9. Charge-exchange collisions of multiply charged ions with atoms

    International Nuclear Information System (INIS)

    Grozdanov, T.P.; Janev, R.K.

    1978-01-01

    The problem of electron transfer between neutral atoms and multiply charged ions is considered at low and medium energies. It is assumed that a large number of final states are available for the electron transition so that the electron-capture process is treated as a tunnel effect caused by the strong attractive Coulomb field of the multicharged ions. The electron transition probability is obtained in a closed form using the modified-comparison-equation method to solve the Schroedinger equation. An approximately linear dependence of the one-electron transfer cross section on the charge of multicharged ion is found. Cross-section calculations of a number of charge-exchange reactions are performed

  10. Tokamak rotation and charge exchange

    International Nuclear Information System (INIS)

    Hazeltine, R.D.; Rowan, W.L.; Solano, E.R.; Valanju, P.M.

    1991-01-01

    In the absence of momentum input, tokamak toroidal rotation rates are typically small - no larger in particular than poloidal rotation - even when the radial electric field is strong, as near the plasma edge. This circumstance, contradicting conventional neoclassical theory, is commonly attributed to the rotation damping effect of charge exchange, although a detailed comparison between charge-exchange damping theory and experiment is apparently unavailable. Such a comparison is attempted here in the context of recent TEXT experiments, which compare rotation rates, both poloidal and toroidal, in helium and hydrogen discharges. The helium discharges provide useful data because they are nearly free of ion-neutral charge exchange; they have been found to rotate toroidally in reasonable agreement with neoclassical predictions. The hydrogen experiments show much smaller toroidal motion as usual. The theoretical calculation uses the full charge-exchange operator and assumes plateau collisionality, roughly consistent with the experimental conditions. The authors calculate the ion flow as a function of v cx /v c , where v cx is the charge exchange rate and v c the Coulomb collision frequency. The results are in reasonable accord with the observations. 1 ref

  11. Nuclear fuel pellet charging device

    International Nuclear Information System (INIS)

    Komuro, Kojiro.

    1990-01-01

    The present invention concerns a nuclear fuel pellet loading device, in which nuclear fuel pellets are successively charged from an open end of a fuel can while rotating the can. That is, a fuel can sealed at one end with an end plug and opened at the other end is rotated around its pipe axis as the center on a rotationally diriving table. During rotation of the fuel can, nuclear fuel pellets are successively charged by means of a feed rod of a feeding device to the inside of the fuel can. The fuel can is rotated while being supported horizontally and the fuel pellets are charged from the open end thereof. Alternatively, the fuel can is rotated while being supported obliquely and the fuel pellets are charged gravitationally into the fuel can. In this way, the damages to the barrier of the fuel can can be reduce. Further, since the fuel pellets can be charged gravitationally by rotating the fuel can while being supported obliquely, the damages to the barrier can be reduced remarkably. (I.S.)

  12. Diffusive charge transport in graphene

    Science.gov (United States)

    Chen, Jianhao

    The physical mechanisms limiting the mobility of graphene on SiO 2 are studied and printed graphene devices on a flexible substrate are realized. Intentional addition of charged scattering impurities is used to study the effects of charged impurities. Atomic-scale defects are created by noble-gas ions irradiation to study the effect of unitary scatterers. The results show that charged impurities and atomic-scale defects both lead to conductivity linear in density in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates. While charged impurities cause intravalley scattering and induce a small change in the minimum conductivity, defects in graphene scatter electrons between the valleys and suppress the minimum conductivity below the metallic limit. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a small resistivity which is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO2 substrate give rise to an activated, carrier density-dependent resistivity. Graphene is also made into high mobility transparent and flexible field effect device via the transfer-printing method. Together the results paint a complete picture of charge carrier transport in graphene on SiO2 in the diffusive regime, and show the promise of graphene as a novel electronic material that have potential applications not only on conventional inorganic substrates, but also on flexible substrates.

  13. Dynamics of Current, Charge and Mass

    Directory of Open Access Journals (Sweden)

    Eisenberg Bob

    2017-10-01

    Full Text Available Electricity plays a special role in our lives and life. The dynamics of electrons allow light to flow through a vacuum. The equations of electron dynamics are nearly exact and apply from nuclear particles to stars. These Maxwell equations include a special term, the displacement current (of a vacuum. The displacement current allows electrical signals to propagate through space. Displacement current guarantees that current is exactly conserved from inside atoms to between stars, as long as current is defined as the entire source of the curl of the magnetic field, as Maxwell did.We show that the Bohm formulation of quantum mechanics allows the easy definition of the total current, and its conservation, without the dificulties implicit in the orthodox quantum theory. The orthodox theory neglects the reality of magnitudes, like the currents, during times that they are not being explicitly measured.We show how conservation of current can be derived without mention of the polarization or dielectric properties of matter. We point out that displacement current is handled correctly in electrical engineering by ‘stray capacitances’, although it is rarely discussed explicitly. Matter does not behave as physicists of the 1800’s thought it did. They could only measure on a time scale of seconds and tried to explain dielectric properties and polarization with a single dielectric constant, a real positive number independent of everything. Matter and thus charge moves in enormously complicated ways that cannot be described by a single dielectric constant,when studied on time scales important today for electronic technology and molecular biology. When classical theories could not explain complex charge movements, constants in equations were allowed to vary in solutions of those equations, in a way not justified by mathematics, with predictable consequences. Life occurs in ionic solutions where charge is moved by forces not mentioned or described in the

  14. Fetal Eye Movements on Magnetic Resonance Imaging

    Science.gov (United States)

    Woitek, Ramona; Kasprian, Gregor; Lindner, Christian; Stuhr, Fritz; Weber, Michael; Schöpf, Veronika; Brugger, Peter C.; Asenbaum, Ulrika; Furtner, Julia; Bettelheim, Dieter; Seidl, Rainer; Prayer, Daniela

    2013-01-01

    Objectives Eye movements are the physical expression of upper fetal brainstem function. Our aim was to identify and differentiate specific types of fetal eye movement patterns using dynamic MRI sequences. Their occurrence as well as the presence of conjugated eyeball motion and consistently parallel eyeball position was systematically analyzed. Methods Dynamic SSFP sequences were acquired in 72 singleton fetuses (17–40 GW, three age groups [17–23 GW, 24–32 GW, 33–40 GW]). Fetal eye movements were evaluated according to a modified classification originally published by Birnholz (1981): Type 0: no eye movements; Type I: single transient deviations; Type Ia: fast deviation, slower reposition; Type Ib: fast deviation, fast reposition; Type II: single prolonged eye movements; Type III: complex sequences; and Type IV: nystagmoid. Results In 95.8% of fetuses, the evaluation of eye movements was possible using MRI, with a mean acquisition time of 70 seconds. Due to head motion, 4.2% of the fetuses and 20.1% of all dynamic SSFP sequences were excluded. Eye movements were observed in 45 fetuses (65.2%). Significant differences between the age groups were found for Type I (p = 0.03), Type Ia (p = 0.031), and Type IV eye movements (p = 0.033). Consistently parallel bulbs were found in 27.3–45%. Conclusions In human fetuses, different eye movement patterns can be identified and described by MRI in utero. In addition to the originally classified eye movement patterns, a novel subtype has been observed, which apparently characterizes an important step in fetal brainstem development. We evaluated, for the first time, eyeball position in fetuses. Ultimately, the assessment of fetal eye movements by MRI yields the potential to identify early signs of brainstem dysfunction, as encountered in brain malformations such as Chiari II or molar tooth malformations. PMID:24194885

  15. Fetal eye movements on magnetic resonance imaging.

    Science.gov (United States)

    Woitek, Ramona; Kasprian, Gregor; Lindner, Christian; Stuhr, Fritz; Weber, Michael; Schöpf, Veronika; Brugger, Peter C; Asenbaum, Ulrika; Furtner, Julia; Bettelheim, Dieter; Seidl, Rainer; Prayer, Daniela

    2013-01-01

    Eye movements are the physical expression of upper fetal brainstem function. Our aim was to identify and differentiate specific types of fetal eye movement patterns using dynamic MRI sequences. Their occurrence as well as the presence of conjugated eyeball motion and consistently parallel eyeball position was systematically analyzed. Dynamic SSFP sequences were acquired in 72 singleton fetuses (17-40 GW, three age groups [17-23 GW, 24-32 GW, 33-40 GW]). Fetal eye movements were evaluated according to a modified classification originally published by Birnholz (1981): Type 0: no eye movements; Type I: single transient deviations; Type Ia: fast deviation, slower reposition; Type Ib: fast deviation, fast reposition; Type II: single prolonged eye movements; Type III: complex sequences; and Type IV: nystagmoid. In 95.8% of fetuses, the evaluation of eye movements was possible using MRI, with a mean acquisition time of 70 seconds. Due to head motion, 4.2% of the fetuses and 20.1% of all dynamic SSFP sequences were excluded. Eye movements were observed in 45 fetuses (65.2%). Significant differences between the age groups were found for Type I (p = 0.03), Type Ia (p = 0.031), and Type IV eye movements (p = 0.033). Consistently parallel bulbs were found in 27.3-45%. In human fetuses, different eye movement patterns can be identified and described by MRI in utero. In addition to the originally classified eye movement patterns, a novel subtype has been observed, which apparently characterizes an important step in fetal brainstem development. We evaluated, for the first time, eyeball position in fetuses. Ultimately, the assessment of fetal eye movements by MRI yields the potential to identify early signs of brainstem dysfunction, as encountered in brain malformations such as Chiari II or molar tooth malformations.

  16. FUNCTIONAL MOVEMENT SCREENING: THE USE OF FUNDAMENTAL MOVEMENTS AS AN ASSESSMENT OF FUNCTION ‐ PART 1

    OpenAIRE

    Cook, Gray; Burton, Lee; Hoogenboom, Barbara J.; Voight, Michael

    2014-01-01

    To prepare an athlete for the wide variety of activities needed to participate in or return to their sport, the analysis of fundamental movements should be incorporated into screening in order to determine who possesses, or lacks, the ability to perform certain essential movements. In a series of two articles, the background and rationale for the analysis of fundamental movement will be provided. The Functional Movement Screen (FMS™) will be described, and any evidence related to its use will...

  17. THE INFLUENCE OF LOWER LIMB MOVEMENT ON UPPER LIMB MOVEMENT SYMMETRY WHILE SWIMMING THE BREASTSTROKE

    OpenAIRE

    M. Jaszczak

    2011-01-01

    This study 1) examined the influence of lower limb movement on upper limb movement symmetry, 2) determined the part of the propulsion phase displaying the greatest hand movement asymmetry, 3) diagnosed the range of upper limb propulsion phase which is the most prone to the influence of the lower limbs while swimming the breaststroke. Twenty-four participants took part in two tests. Half of them performed an asymmetrical leg movement. The propulsion in the first test was generated by four limb...

  18. Coulomb interactions in charged fluids.

    Science.gov (United States)

    Vernizzi, Graziano; Guerrero-García, Guillermo Iván; de la Cruz, Monica Olvera

    2011-07-01

    The use of Ewald summation schemes for calculating long-range Coulomb interactions, originally applied to ionic crystalline solids, is a very common practice in molecular simulations of charged fluids at present. Such a choice imposes an artificial periodicity which is generally absent in the liquid state. In this paper we propose a simple analytical O(N(2)) method which is based on Gauss's law for computing exactly the Coulomb interaction between charged particles in a simulation box, when it is averaged over all possible orientations of a surrounding infinite lattice. This method mitigates the periodicity typical of crystalline systems and it is suitable for numerical studies of ionic liquids, charged molecular fluids, and colloidal systems with Monte Carlo and molecular dynamics simulations.

  19. Charged particle traps II applications

    CERN Document Server

    Werth, Günther; Major, Fouad G

    2009-01-01

    This, the second volume of Charged Particle Traps, is devoted to applications, complementing the first volume’s comprehensive treatment of the theory and practice of charged particle traps, their many variants and refinements. In recent years, applications of far reaching importance have emerged ranging from the ultra-precise mass determinations of elementary particles and their antiparticles and short-lived isotopes, to high-resolution Zeeman spectroscopy on multiply-charged ions, to microwave and optical spectroscopy, some involving "forbidden" transitions from metastable states of such high resolution that optical frequency standards are realized by locking lasers to them. Further the potential application of trapped ions to quantum computing is explored, based on the extraordinary quantum state coherence made possible by the particle isolation. Consideration is given to the Paul and Penning traps as potential quantum information processors.

  20. Alternator control for battery charging

    Energy Technology Data Exchange (ETDEWEB)

    Brunstetter, Craig A.; Jaye, John R.; Tallarek, Glen E.; Adams, Joseph B.

    2015-07-14

    In accordance with an aspect of the present disclosure, an electrical system for an automotive vehicle has an electrical generating machine and a battery. A set point voltage, which sets an output voltage of the electrical generating machine, is set by an electronic control unit (ECU). The ECU selects one of a plurality of control modes for controlling the alternator based on an operating state of the vehicle as determined from vehicle operating parameters. The ECU selects a range for the set point voltage based on the selected control mode and then sets the set point voltage within the range based on feedback parameters for that control mode. In an aspect, the control modes include a trickle charge mode and battery charge current is the feedback parameter and the ECU controls the set point voltage within the range to maintain a predetermined battery charge current.

  1. Price Based Electric Vehicle Charging

    DEFF Research Database (Denmark)

    Mahat, Pukar; Handl, Martin; Kanstrup, Kenneth

    2012-01-01

    It is expected that a lot of the new light vehicles in the future will be electrical vehicles (EV). The storage capacity of these EVs has the potential to complement renewable energy resources and mitigate its intermittency. However, EV charging may have negative impact on the power grid. This pa......It is expected that a lot of the new light vehicles in the future will be electrical vehicles (EV). The storage capacity of these EVs has the potential to complement renewable energy resources and mitigate its intermittency. However, EV charging may have negative impact on the power grid...... method where distribution system operator (DSO) optimizes the cost of EV charging while taking substation transformer capacity into account....

  2. Charge Fluctuations in Nanoscale Capacitors

    Science.gov (United States)

    Limmer, David T.; Merlet, Céline; Salanne, Mathieu; Chandler, David; Madden, Paul A.; van Roij, René; Rotenberg, Benjamin

    2013-09-01

    The fluctuations of the charge on an electrode contain information on the microscopic correlations within the adjacent fluid and their effect on the electronic properties of the interface. We investigate these fluctuations using molecular dynamics simulations in a constant-potential ensemble with histogram reweighting techniques. This approach offers, in particular, an efficient, accurate, and physically insightful route to the differential capacitance that is broadly applicable. We demonstrate these methods with three different capacitors: pure water between platinum electrodes and a pure as well as a solvent-based organic electrolyte each between graphite electrodes. The total charge distributions with the pure solvent and solvent-based electrolytes are remarkably Gaussian, while in the pure ionic liquid the total charge distribution displays distinct non-Gaussian features, suggesting significant potential-driven changes in the organization of the interfacial fluid.

  3. Charge fluctuations in nanoscale capacitors.

    Science.gov (United States)

    Limmer, David T; Merlet, Céline; Salanne, Mathieu; Chandler, David; Madden, Paul A; van Roij, René; Rotenberg, Benjamin

    2013-09-06

    The fluctuations of the charge on an electrode contain information on the microscopic correlations within the adjacent fluid and their effect on the electronic properties of the interface. We investigate these fluctuations using molecular dynamics simulations in a constant-potential ensemble with histogram reweighting techniques. This approach offers, in particular, an efficient, accurate, and physically insightful route to the differential capacitance that is broadly applicable. We demonstrate these methods with three different capacitors: pure water between platinum electrodes and a pure as well as a solvent-based organic electrolyte each between graphite electrodes. The total charge distributions with the pure solvent and solvent-based electrolytes are remarkably Gaussian, while in the pure ionic liquid the total charge distribution displays distinct non-Gaussian features, suggesting significant potential-driven changes in the organization of the interfacial fluid.

  4. The clinical approach to movement disorders.

    NARCIS (Netherlands)

    Abdo, W.F.; Warrenburg, B.P.C. van de; Burn, D.J.; Quinn, N.P.; Bloem, B.R.

    2010-01-01

    Movement disorders are commonly encountered in the clinic. In this Review, aimed at trainees and general neurologists, we provide a practical step-by-step approach to help clinicians in their 'pattern recognition' of movement disorders, as part of a process that ultimately leads to the diagnosis.

  5. Detecting movement patterns using Brownian bridges

    NARCIS (Netherlands)

    Buchin, K.; Sijben, S.; Arseneau, T.J.-M.; Willems, E.P.

    2012-01-01

    In trajectory data a low sampling rate leads to high uncertainty in between sampling points, which needs to be taken into account in the analysis of such data. However, current algorithms for movement analysis ignore this uncertainty and assume linear movement between sample points. In this paper we

  6. Towards a discursive analytics of movement

    DEFF Research Database (Denmark)

    Frello, Birgitta

    2008-01-01

    examples taken from Danish media, it is shown that the study of movement cannot be separated from that of discursive power. Access to and control over physical movement is unequally distributed. However, so is access to and control over assessing which activities can meaningfully be given the label...

  7. Rapid eye movement sleep behavior disorder

    DEFF Research Database (Denmark)

    Schenck, C H; Montplaisir, J Y; Frauscher, B

    2013-01-01

    We aimed to provide a consensus statement by the International Rapid Eye Movement Sleep Behavior Disorder Study Group (IRBD-SG) on devising controlled active treatment studies in rapid eye movement sleep behavior disorder (RBD) and devising studies of neuroprotection against Parkinson disease (PD...

  8. Movement initiation in groups of feral horses

    NARCIS (Netherlands)

    Krueger, Konstanze; Flauger, Birgit; Farmer, Kate; Hemelrijk, Charlotte

    Herds of ungulates, flocks of birds, swarms of insects and schools of fish move in coordinated groups. Computer models show that only one or very few animals are needed to initiate and direct movement. To investigate initiation mechanisms further, we studied two ways in which movement can be

  9. Orthodontic Tooth Movement: A Historic Prospective.

    Science.gov (United States)

    Will, Leslie A

    2016-01-01

    The earliest report on orthodontic tooth movement in the English literature was published in 1911. Oppenheim carried out studies on baboons to determine what histologic changes occurred during tooth movement. Reitan and many others carried out research into the nature of tooth movement. The pressure-tension model of tooth movement developed from these studies, whereby the two sides of the tooth responded to forces as if in isolation. A second theory, proposed by Stuteville in 1938, was the hydraulic theory of tooth movement. In this theory, fluid from the vasculature, lymphatic system and intercellular spaces responds to the forces of tooth movement, damping the force and limiting movement. Bien and Baumrind expanded on this theory with their own studies in the 1960s. It is clear that both the pressure-tension and fluid flow concepts have merit, but considerable work needs to be done to ascertain the details so that tooth movement can be managed and controlled. © 2016 S. Karger AG, Basel.

  10. ANALYSING SURFACE MOVEMENT DELAYS IN AN AIRPORT

    Directory of Open Access Journals (Sweden)

    Volodymyr Kharchenko

    2014-07-01

    Full Text Available Queuing effect can be in the different components of ground operations. Causes of surface – movement delays are long taxi – in and taxi – out operations during departure and arrival of aircraft. Surface movement delays in an airport are analyzed

  11. Historical Development of the Olympic Movement

    Directory of Open Access Journals (Sweden)

    Violeta Šiljak

    2017-10-01

    Full Text Available The Olympic Movement is a term that covers all areas related to the phenomenon of Olympism. From its creation, the Olympic Movement has had to follow and to respond to numerous challenges and changes of the 20th and 21st century. The successful work of the International Olympic Committee (IOC on the implementation of their projects related to world peace, the education of youth, equal inclusion of women in every aspect of the Movement, the establishment of the Women’s Commission, the Sport for All Commission, and the Sports and the Environment Commission are facts indicating that the IOC has a significant impact on the values of the Olympic Movement. In addition to equal participation of all athletes, today, the Olympic Movement provides Olympic solidarity, education and other programs. The basic method that was used in this study was the historical method, which includes heuristic, empirical and theoretical study of the origin and development of the IOC and its operation as part of the Olympic Movement. Research results indicate that the management of the IOCas a sporting organization that manages this Movement is directed at achieving the goal to contribute to building a more peaceful and better world by educating young people through sports, and in accordance with the Olympic values. With proper management, the IOChas improved sports and has grown into an organization that is at the head of the Olympic Movement.

  12. Active Movement Warm-Up Routines

    Science.gov (United States)

    Walter, Teri; Quint, Ashleigh; Fischer, Kim; Kiger, Joy

    2011-01-01

    This article presents warm-ups that are designed to physiologically and psychologically prepare students for vigorous physical activity. An active movement warm-up routine is made up of three parts: (1) active warm-up movement exercises, (2) general preparation, and (3) the energy system. These warm-up routines can be used with all grade levels…

  13. Fundamental Movement Skills and Autism Spectrum Disorders

    Science.gov (United States)

    Staples, Kerri L.; Reid, Greg

    2010-01-01

    Delays and deficits may both contribute to atypical development of movement skills by children with ASD. Fundamental movement skills of 25 children with autism spectrum disorders (ASD) (ages 9-12 years) were compared to three typically developing groups using the "Test of Gross Motor Development" ("TGMD-2"). The group matched on chronological age…

  14. Implementing Intervention Movement Programs for Kindergarten Children

    Science.gov (United States)

    Deli, Eleni; Bakle, Iliana; Zachopoulou, Evridiki

    2006-01-01

    The reported study aimed to identify the effects of two 10-week intervention programs on fundamental locomotor skill performance in kindergarten children. Seventy-five children with mean age 5.4 plus or minus 0.5 years participated. Experimental Group A followed a movement program, experimental Group B followed a music and movement program, and…

  15. Fundamental Movement Skill Proficiency amongst Adolescent Youth

    Science.gov (United States)

    O' Brien, Wesley; Belton, Sarahjane; Issartel, Johann

    2016-01-01

    Background: Literature suggests that physical education programmes ought to provide intense instruction towards basic movement skills needed to enjoy a variety of physical activities. Fundamental movement skills (FMS) are basic observable patterns of behaviour present from childhood to adulthood (e.g. run, skip and kick). Recent evidence indicates…

  16. Introduction: The Future of Social Movement Research

    NARCIS (Netherlands)

    Stekelenburg, Jacquelien Van; Roggeband, Conny; Stekelenburg, Jacquelien Van; Roggeband, Conny; Klandermans, Bert

    2013-01-01

    In The Future of Social Movement Research, some of the most influential scholars in the field provide a wide-ranging understanding of how social movements arise and persist, engendering unanswered questions pointing to new theoretical strands and fields of research. The resulting work is

  17. Using a developmental movement programme to enhance ...

    African Journals Online (AJOL)

    Brain research has shown that the brain is “plastic” in that it can adapt continuously, and its structure can be changed by certain kinds of stimulation, including movement. The body is a sensory-motor response system that causes the brain to organize itself. Movement is essential to learning and can be regarded as the door ...

  18. Social Movement Theory: Past, Present and Prospects

    NARCIS (Netherlands)

    van Stekelenburg, Jacquelien

    2009-01-01

    Mobilization against apartheid in South Africa, the campaign against blood diamonds, the women's movement in Liberia where Africa's first female head of State was elected in 2005 - these are all examples of socially based movements that have had a major effect on Africa's recent history. Yet the

  19. Movers and shakers : social movements in Africa

    NARCIS (Netherlands)

    Ellis, S.; Kessel, van W.M.J.

    2009-01-01

    Mobilization against apartheid in South Africa, the campaign against blood diamonds, the women's movement in Liberia where Africa's first female head of State was elected in 2005 - these are all examples of socially based movements that have had a major effect on Africa's recent history. Yet the

  20. Surgical management of movement disorders | Enslin | South ...

    African Journals Online (AJOL)

    Movement disorders are usually treated by neurologists, and appropriately so. The first-line management of all conditions that are grouped together as movement disorders (e.g. Parkinson's disease, dystonia, essential tremor) is with medication and, in some, with rehabilitative strategies, such as occupational therapy, ...