A comparative study of charge movement in rat and frog skeletal muscle fibres.

Science.gov (United States)

Hollingworth, S; Marshall, M W

1981-12-01

1. The middle of the fibre voltage--clamp technique (Adrian & Marshall, 1977), modified where necessary for electrically short muscle fibres, has been used to measure non-linear charge movements in mammalian fast twitch (rat extensor digitorum longus), mammalian slow twitch (rat soleus) and frog (sartorius) muscles. 2. The maximum amount of charge moved in mammalian fast twitch muscle at 2 degrees C in hypertonic solution, was 3--5 times greater than in slow twitch muscle. The voltage distribution of fast twitch charge was 10--15 mV more positive when compared to slow twitch. 3. In both mammalian muscle types hypertonic Ringer solution negatively shifted the voltage distribution of charge some 6 mV. The steepness of charge moved around mechanical threshold was unaffected by hypertonicity. 4. The amount of charge in frog sartorius fibres at 2 degrees C in hypertonic solution was about half of that in rat fast twitch muscle; the voltage distribution of the frog charge was similar to rat soleus muscle. 5. Warming between 2 and 15 degrees C had no effect on either the amount of steady-state distribution of charge in mammalian or frog muscles. 6. At 2 degrees C, the kinetics of charge movement in fast and slow twitch mammalian muscles were similar and 2--3 times faster than frog muscle at the same temperature. In fast and slow mammalian fibres at 2 degrees C similar times were taken to shift the same fractions of the total amount of charge. The Q10 of charge movement kinetics was between 1.2 and 2.0 in the three muscles studied.

Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

Science.gov (United States)

Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

2013-11-01

As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

Ionic currents and charge movements in organ-cultured rat skeletal muscle.

Science.gov (United States)

Hollingworth, S; Marshall, M W; Robson, E

1984-12-01

The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.

Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

OpenAIRE

Dharia, Sameera; Rabbitt, Richard D.

2011-01-01

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

Intermediate state trapping of a voltage sensor

DEFF Research Database (Denmark)

Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

2012-01-01

Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.

Science.gov (United States)

Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco

2013-11-01

Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.

Charge immobilization of the voltage sensor in domain IV is independent of sodium current inactivation.

Science.gov (United States)

Sheets, Michael F; Hanck, Dorothy A

2005-02-15

Recovery from fast inactivation in voltage-dependent Na+ channels is associated with a slow component in the time course of gating charge during repolarization (i.e. charge immobilization), which results from the slow movement of the S4 segments in domains III and IV (S4-DIII and S4-DIV). Previous studies have shown that the non-specific removal of fast inactivation by the proteolytic enzyme pronase eliminated charge immobilization, while the specific removal of fast inactivation (by intracellular MTSET modification of a cysteine substituted for the phenylalanine in the IFM motif, ICMMTSET, in the inactivation particle formed by the linker between domains III and IV) only reduced the amount of charge immobilization by nearly one-half. To investigate the molecular origin of the remaining slow component of charge immobilization we studied the human cardiac Na+ channel (hH1a) in which the outermost arginine in the S4-DIV, which contributes approximately 20% to total gating charge (Qmax), was mutated to a cysteine (R1C-DIV). Gating charge could be fully restored in R1C-DIV by exposure to extracellular MTSEA, a positively charged methanethiosulphonate reagent. The RIC-DIV mutation was combined with ICMMTSET to remove fast inactivation, and the gating currents of R1C-DIV-ICM(MTSET) were recorded before and after modification with MTSEAo. Prior to MTSEAo, the time course of the gating charge during repolarization (off-charge) was best described by a single fast time constant. After MTSEA, the off-charge had both fast and slow components, with the slow component accounting for nearly 35% of Qmax. These results demonstrate that the slow movement of the S4-DIV during repolarization is not dependent upon the normal binding of the inactivation particle.

Charge dependence of the plasma travel length in atmospheric-pressure plasma

Energy Technology Data Exchange (ETDEWEB)

Yambe, Kiyoyuki; Konda, Kohmei; Masuda, Seiya [Graduate School of Science and Technology, Niigata University, Niigata 950-2181 (Japan)

2016-06-15

Plasma plume is generated using a quartz tube, helium gas, and foil electrode by applying AC high voltage under the atmosphere. The plasma plume is released into the atmosphere from inside of the quartz tube and is seen as the continuous movement of the plasma bullet. The travel length of plasma bullet is defined from plasma energy and force due to electric field. The drift velocity of plasma bullet has the upper limit under atmospheric-pressure because the drift velocity is determined from the balance between electric field and resistive force due to collisions between plasma and air. The plasma plume charge depends on the drift velocity. Consequently, in the laminar flow of helium gas flow state, the travel length of the plasma plume logarithmically depends on the plasma plume charge which changes with both the electric field and the resistive force.

Charge dependence of the plasma travel length in atmospheric-pressure plasma

International Nuclear Information System (INIS)

Yambe, Kiyoyuki; Konda, Kohmei; Masuda, Seiya

2016-01-01

Plasma plume is generated using a quartz tube, helium gas, and foil electrode by applying AC high voltage under the atmosphere. The plasma plume is released into the atmosphere from inside of the quartz tube and is seen as the continuous movement of the plasma bullet. The travel length of plasma bullet is defined from plasma energy and force due to electric field. The drift velocity of plasma bullet has the upper limit under atmospheric-pressure because the drift velocity is determined from the balance between electric field and resistive force due to collisions between plasma and air. The plasma plume charge depends on the drift velocity. Consequently, in the laminar flow of helium gas flow state, the travel length of the plasma plume logarithmically depends on the plasma plume charge which changes with both the electric field and the resistive force.

Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

Science.gov (United States)

Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.

2005-03-01

Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.

Solar photovoltaic charging of high voltage nickel metal hydride batteries using DC power conversion

Science.gov (United States)

Kelly, Nelson A.; Gibson, Thomas L.

There are an increasing number of vehicle choices available that utilize batteries and electric motors to reduce tailpipe emissions and increase fuel economy. The eventual production of electricity and hydrogen in a renewable fashion, such as using solar energy, can achieve the long-term vision of having no tailpipe environmental impact, as well as eliminating the dependence of the transportation sector on dwindling supplies of petroleum for its energy. In this report we will demonstrate the solar-powered charging of the high-voltage nickel-metal hydride (NiMH) battery used in the GM 2-mode hybrid system. In previous studies we have used low-voltage solar modules to produce hydrogen via the electrolysis of water and to directly charge lithium-ion battery modules. Our strategy in the present work was to boost low-voltage PV voltage to over 300 V using DC-DC converters in order to charge the high-voltage NiMH battery, and to regulate the battery charging using software to program the electronic control unit supplied with the battery pack. A protocol for high-voltage battery charging was developed, and the solar to battery charging efficiency was measured under a variety of conditions. We believe this is the first time such high-voltage batteries have been charged using solar energy in order to prove the concept of efficient, solar-powered charging for battery-electric vehicles.

Moderately nonlinear diffuse-charge dynamics under an ac voltage.

Science.gov (United States)

Stout, Robert F; Khair, Aditya S

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

Moderately nonlinear diffuse-charge dynamics under an ac voltage

Science.gov (United States)

Stout, Robert F.; Khair, Aditya S.

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

High Voltage Charge Pump

KAUST Repository

Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

2014-01-01

Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

High Voltage Charge Pump

KAUST Repository

Emira, Ahmed A.

2014-10-09

Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

50V All-PMOS Charge Pumps Using Low-Voltage Capacitors

KAUST Repository

Emira, Ahmed

2012-10-06

In this work, two high-voltage charge pumps are introduced. In order to minimize the area of the pumping capacitors, which dominates the overall area of the charge pump, high density capacitors have been utilized. Nonetheless, these high density capacitors suffer from low breakdown voltage which is not compatible with the targeted high voltage application. To circumvent the breakdown limitation, a special clocking scheme is used to limit the maximum voltage across any pumping capacitor. The two charge pump circuits were fabricated in a 0:6m CMOS technology with poly0-poly1 capacitors. The output voltage of the two charge pumps reached 42:8V and 51V while the voltage across any capacitor did not exceed the value of the input voltage. Compared to other designs reported in the literature, the proposed charge pump provides the highest output voltage which makes it more suitable for tuning MEMS devices.

50V All-PMOS Charge Pumps Using Low-Voltage Capacitors

KAUST Repository

Emira, Ahmed; AbdelGhany, M.; Elsayed, M.; Elshurafa, Amro M.; Sedky, S.; Salama, Khaled N.

2012-01-01

In this work, two high-voltage charge pumps are introduced. In order to minimize the area of the pumping capacitors, which dominates the overall area of the charge pump, high density capacitors have been utilized. Nonetheless, these high density capacitors suffer from low breakdown voltage which is not compatible with the targeted high voltage application. To circumvent the breakdown limitation, a special clocking scheme is used to limit the maximum voltage across any pumping capacitor. The two charge pump circuits were fabricated in a 0:6m CMOS technology with poly0-poly1 capacitors. The output voltage of the two charge pumps reached 42:8V and 51V while the voltage across any capacitor did not exceed the value of the input voltage. Compared to other designs reported in the literature, the proposed charge pump provides the highest output voltage which makes it more suitable for tuning MEMS devices.

Control Of Stepper Motor Movement By DC Voltage

International Nuclear Information System (INIS)

Gayani, Didi; Margono; Indasah, Iin; Sugito

2000-01-01

Instrumentation for controlling the power of reactor of TRIGA Mark II uses the stepper motor to move the control rod of neutron absorbers. The direction and speed of control rod movement are determined by the polarity and the amplitude of DC voltage as an error signal that is the difference of set point of power and the power of being measured on the control system. The unit of stepper motor controller of reactor instrumentation of TRIGA Mark II uses patent module of trade Mark of Vexta, USA. In this chance, the electronic circuit is made to function as the control of stepper motor movement by using the DC voltage to anticipate the problem may be faced in case of repair and maintenance of reactor instrumentation. As a result of experiment, it is stated that the control of motor movement by using DC voltage is performed into 2 stages. First, by making the oscillator that is proportional to the positive DC voltage. Secondly, by making the translator to translate the oscillator signal to be a logic pattern for controlling the movement of stepper motor. Translator and motor driver are made by using the L297 and L298 as a pair of stepper motor controller of SGS T HOMSON

Voltage-dependent gating in a "voltage sensor-less" ion channel.

Directory of Open Access Journals (Sweden)

Harley T Kurata

2010-02-01

Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

Directory of Open Access Journals (Sweden)

Samuel eGoodchild

2012-06-01

Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

International Nuclear Information System (INIS)

Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

2014-01-01

Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

Temperature dependent charge transport in poly(3-hexylthiophene) diodes

Science.gov (United States)

Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya

2018-04-01

In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.

Charge Distribution Dependency on Gap Thickness of CMS Endcap RPC

CERN Document Server

Park, Sung K.; Lee, Kyongsei

2016-01-01

We report a systematic study of charge distribution dependency of CMS Resistive Plate Chamber (RPC) on gap thickness. Prototypes of double-gap RPCs with six different gap thickness ranging from from 1.0 to 2.0 mm in 0.2-mm steps have been built with 2-mm-thick phenolic high-pressure-laminated plates. The efficiencies of the six gaps are measured as a function of the effective high voltages. We report that the strength of the electric fields of the gap is decreased as the gap thickness is increased. The distributions of charges in six gaps are measured. The space charge effect is seen in the charge distribution at the higher voltages. The logistic function is used to fit the charge distribution data. Smaller charges can be produced within smaller gas gap. But the digitization threshold should be also lowered to utilize these smaller charges.

Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

Science.gov (United States)

Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

2016-11-17

Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

Shaping charge excitations in chiral edge states with a time-dependent gate voltage

Science.gov (United States)

Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

2018-02-01

We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

Science.gov (United States)

Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

2017-08-29

Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

Science.gov (United States)

Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

2014-04-01

Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages

Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

Science.gov (United States)

Santos-Sacchi, Joseph; Song, Lei

2016-06-07

In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

Science.gov (United States)

Experton, Juliette; Martin, Charles R

2018-05-01

Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Decentralized energy management strategy based on predictive controllers for a medium voltage direct current photovoltaic electric vehicle charging station

International Nuclear Information System (INIS)

Torreglosa, Juan P.; García-Triviño, Pablo; Fernández-Ramirez, Luis M.; Jurado, Francisco

2016-01-01

Highlights: • Electric vehicle charging station supplied by photovoltaic, batteries and grid connection is analyzed. • The bus voltage is the key parameter for controlling the system by decentralized approach. • Decentralized control approach facilities the enlargement of the system. • Photovoltaic and battery systems are controlled by model predictive controllers. • Response by model predictive controllers improves that by PI controllers. - Abstract: The use of distributed charging stations based on renewable energy sources for electric vehicles has increased in recent years. Combining photovoltaic solar energy and batteries as energy storage system, directly tied into a medium voltage direct current bus, and with the grid support, results to be an interesting option for improving the operation and efficiency of electric vehicle charging stations. In this paper, an electric vehicle charging station supplied by photovoltaic solar panels, batteries and with grid connection is analysed and evaluated. A decentralized energy management system is developed for regulating the energy flow among the photovoltaic system, the battery and the grid in order to achieve the efficient charging of electric vehicles. The medium voltage direct current bus voltage is the key parameter for controlling the system. The battery is controlled by a model predictive controller in order to keep the bus voltage at its reference value. Depending on the state-of-charge of the battery and the bus voltage, the photovoltaic system can work at maximum power point tracking mode or at bus voltage sustaining mode, or even the grid support can be needed. The results demonstrate the proper operation and energy management of the electric vehicle charging station under study.

Enzyme domain affects the movement of the voltage sensor in ascidian and zebrafish voltage-sensing phosphatases.

Science.gov (United States)

Hossain, Md Israil; Iwasaki, Hirohide; Okochi, Yoshifumi; Chahine, Mohamed; Higashijima, Shinichi; Nagayama, Kuniaki; Okamura, Yasushi

2008-06-27

The ascidian voltage-sensing phosphatase (Ci-VSP) consists of the voltage sensor domain (VSD) and a cytoplasmic phosphatase region that has significant homology to the phosphatase and tensin homolog deleted on chromosome TEN (PTEN). The phosphatase activity of Ci-VSP is modified by the conformational change of the VSD. In many proteins, two protein modules are bidirectionally coupled, but it is unknown whether the phosphatase domain could affect the movement of the VSD in VSP. We addressed this issue by whole-cell patch recording of gating currents from a teleost VSP (Dr-VSP) cloned from Danio rerio expressed in tsA201 cells. Replacement of a critical cysteine residue, in the phosphatase active center of Dr-VSP, by serine sharpened both ON- and OFF-gating currents. Similar changes were produced by treatment with phosphatase inhibitors, pervanadate and orthovanadate, that constitutively bind to cysteine in the active catalytic center of phosphatases. The distinct kinetics of gating currents dependent on enzyme activity were not because of altered phosphatidylinositol 4,5-bisphosphate levels, because the kinetics of gating current did not change by depletion of phosphatidylinositol 4,5-bisphosphate, as reported by coexpressed KCNQ2/3 channels. These results indicate that the movement of the VSD is influenced by the enzymatic state of the cytoplasmic domain, providing an important clue for understanding mechanisms of coupling between the VSD and its effector.

Domain IV voltage-sensor movement is both sufficient and rate limiting for fast inactivation in sodium channels.

Science.gov (United States)

Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron

2013-08-01

Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.

On-chip high-voltage generator design design methodology for charge pumps

CERN Document Server

Tanzawa, Toru

2016-01-01

This book provides various design techniques for switched-capacitor on-chip high-voltage generators, including charge pump circuits, regulators, level shifters, references, and oscillators.  Readers will see these techniques applied to system design in order to address the challenge of how the on-chip high-voltage generator is designed for Flash memories, LCD drivers, and other semiconductor devices to optimize the entire circuit area and power efficiency with a low voltage supply, while minimizing the cost.  This new edition includes a variety of useful updates, including coverage of power efficiency and comprehensive optimization methodologies for DC-DC voltage multipliers, modeling of extremely low voltage Dickson charge pumps, and modeling and optimum design of AC-DC switched-capacitor multipliers for energy harvesting and power transfer for RFID.

Bias dependent charge trapping in MOSFETs during 1 and 6 MeV electron irradiation

Energy Technology Data Exchange (ETDEWEB)

Shinde, N.S. [Department of Chemical Engineering, Mie University, 5148507 (Japan); Kulkarni, V.R.; Mathakari, N.L.; Bhoraskar, V.N. [Department of Physics, Univeristy of Pune, Pune 411007 (India); Dhole, S.D. [Department of Physics, Univeristy of Pune, Pune 411007 (India)], E-mail: sanjay@physics.unipune.ernet.in

2008-06-15

To study irradiation-induced charge trapping in SiO{sub 2} and around the SiO{sub 2}-Si interface, depletion n-MOSFETs (metal-oxide-semiconductor field effect transistor) were used. The devices were gate biased during 1 and 6 MeV pulsed electron irradiation. The I{sub D}-V{sub DS} (drain current versus drain voltage) and I{sub D}-V{sub GS} (drain current versus gate voltage) characteristics were measured before and after irradiation. The shift in threshold voltage {delta}V{sub T} (difference in threshold voltage V{sub T} before and after irradiation) exhibited trends depending on the applied gate bias during 1 MeV electron irradiation. This behavior can be associated to the contribution of irradiation-induced negative charge {delta}N{sub IT} buildup around the SiO{sub 2}-Si interface to {delta}V{sub T}, which is sensitive to the electron tunneling from the substrates. However, only weak gate bias dependence was observed in 6 MeV electron irradiated devices. Independent of the energy loss and applied bias, the positive oxide trapped charge {delta}N{sub OT} is marginal and can be associated to thin and good quality of SiO{sub 2}. These results are explained using screening of free and acceptor states by the applied bias during irradiation, thereby reducing the total irradiation-induced charges.

Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles

Directory of Open Access Journals (Sweden)

Yan Jiang

2013-06-01

Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.

Modeling on oxide dependent 2DEG sheet charge density and threshold voltage in AlGaN/GaN MOSHEMT

Science.gov (United States)

Panda, J.; Jena, K.; Swain, R.; Lenka, T. R.

2016-04-01

We have developed a physics based analytical model for the calculation of threshold voltage, two dimensional electron gas (2DEG) density and surface potential for AlGaN/GaN metal oxide semiconductor high electron mobility transistors (MOSHEMT). The developed model includes important parameters like polarization charge density at oxide/AlGaN and AlGaN/GaN interfaces, interfacial defect oxide charges and donor charges at the surface of the AlGaN barrier. The effects of two different gate oxides (Al2O3 and HfO2) are compared for the performance evaluation of the proposed MOSHEMT. The MOSHEMTs with Al2O3 dielectric have an advantage of significant increase in 2DEG up to 1.2 × 1013 cm-2 with an increase in oxide thickness up to 10 nm as compared to HfO2 dielectric MOSHEMT. The surface potential for HfO2 based device decreases from 2 to -1.6 eV within 10 nm of oxide thickness whereas for the Al2O3 based device a sharp transition of surface potential occurs from 2.8 to -8.3 eV. The variation in oxide thickness and gate metal work function of the proposed MOSHEMT shifts the threshold voltage from negative to positive realizing the enhanced mode operation. Further to validate the model, the device is simulated in Silvaco Technology Computer Aided Design (TCAD) showing good agreement with the proposed model results. The accuracy of the developed calculations of the proposed model can be used to develop a complete physics based 2DEG sheet charge density and threshold voltage model for GaN MOSHEMT devices for performance analysis.

One-carrier free space charge motion under applied voltage

Energy Technology Data Exchange (ETDEWEB)

de ALMEIDA, L E.C.; FERREIRA, G F.L. [SAO PAULO UNIV., SAO CARLOS (BRAZIL). INSTITUTO DE FISICA E QUIMICA

1975-12-01

It is shown how to transform the system of partial differential equations, describing the free one-carrier space charge motion in solid dielectrics under a given applied voltage and while the charge distribution touches only one of the electrodes, into a first order ordinary differential equation from whose solution all the interesting quantities may be easily derived. It was found that some charge distributions can display current reversal.

Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

Directory of Open Access Journals (Sweden)

Mesbahus Saleheen

2016-05-01

Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

Study of electric field distorted by space charges under positive lightning impulse voltage

Science.gov (United States)

Wang, Zezhong; Geng, Yinan

2018-03-01

Actually, many insulation problems are related to electric fields. And measuring electric fields is an important research topic of high-voltage engineering. In particular, the electric field distortion caused by space charge is the basis of streamer theory, and thus quantitatively measuring the Poisson electric field caused by space charge is significant to researching the mechanism of air gap discharge. In this paper, we used our photoelectric integrated sensor to measure the electric field distribution in a 1-m rod-plane gap under positive lightning impulse voltage. To verify the reliability of this quantitative measurement, we compared the measured results with calculated results from a numerical simulation. The electric-field time domain waveforms on the axis of the 1-m rod-plane out of the space charge zone were measured with various electrodes. The Poisson electric fields generated by space charge were separated from the Laplace electric field generated by applied voltages, and the amplitudes and variations were measured for various applied voltages and at various locations. This work also supplies the feasible basis for directly measuring strong electric field under high voltage.

Direct evidence that scorpion α-toxins (site-3 modulate sodium channel inactivation by hindrance of voltage-sensor movements.

Directory of Open Access Journals (Sweden)

Zhongming Ma

Full Text Available The position of the voltage-sensing transmembrane segment, S4, in voltage-gated ion channels as a function of voltage remains incompletely elucidated. Site-3 toxins bind primarily to the extracellular loops connecting transmembrane helical segments S1-S2 and S3-S4 in Domain 4 (D4 and S5-S6 in Domain 1 (D1 and slow fast-inactivation of voltage-gated sodium channels. As S4 of the human skeletal muscle voltage-gated sodium channel, hNav1.4, moves in response to depolarization from the resting to the inactivated state, two D4S4 reporters (R2C and R3C, Arg1451Cys and Arg1454Cys, respectively move from internal to external positions as deduced by reactivity to internally or externally applied sulfhydryl group reagents, methane thiosulfonates (MTS. The changes in reporter reactivity, when cycling rapidly between hyperpolarized and depolarized voltages, enabled determination of the positions of the D4 voltage-sensor and of its rate of movement. Scorpion α-toxin binding impedes D4S4 segment movement during inactivation since the modification rates of R3C in hNav1.4 with methanethiosulfonate (CH3SO2SCH2CH2R, where R = -N(CH33 (+ trimethylammonium, MTSET and benzophenone-4-carboxamidocysteine methanethiosulfonate (BPMTS were slowed ~10-fold in toxin-modified channels. Based upon the different size, hydrophobicity and charge of the two reagents it is unlikely that the change in reactivity is due to direct or indirect blockage of access of this site to reagent in the presence of toxin (Tx, but rather is the result of inability of this segment to move outward to the normal extent and at the normal rate in the toxin-modified channel. Measurements of availability of R3C to internally applied reagent show decreased access (slower rates of thiol reaction providing further evidence for encumbered D4S4 movement in the presence of toxins consistent with the assignment of at least part of the toxin binding site to the region of D4S4 region of the voltage

Interactions between charged residues in the transmembrane segments of the voltage-sensing domain in the hERG channel.

Science.gov (United States)

Zhang, M; Liu, J; Jiang, M; Wu, D-M; Sonawane, K; Guy, H R; Tseng, G-N

2005-10-01

Studies on voltage-gated K channels such as Shaker have shown that positive charges in the voltage-sensor (S4) can form salt bridges with negative charges in the surrounding transmembrane segments in a state-dependent manner, and different charge pairings can stabilize the channels in closed or open states. The goal of this study is to identify such charge interactions in the hERG channel. This knowledge can provide constraints on the spatial relationship among transmembrane segments in the channel's voltage-sensing domain, which are necessary for modeling its structure. We first study the effects of reversing S4's positive charges on channel activation. Reversing positive charges at the outer (K525D) and inner (K538D) ends of S4 markedly accelerates hERG activation, whereas reversing the 4 positive charges in between either has no effect or slows activation. We then use the 'mutant cycle analysis' to test whether D456 (outer end of S2) and D411 (inner end of S1) can pair with K525 and K538, respectively. Other positive charges predicted to be able, or unable, to interact with D456 or D411 are also included in the analysis. The results are consistent with predictions based on the distribution of these charged residues, and confirm that there is functional coupling between D456 and K525 and between D411 and K538.

30 CFR 57.12071 - Movement or operation of equipment near high-voltage powerlines.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Movement or operation of equipment near high-voltage powerlines. 57.12071 Section 57.12071 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION...-voltage powerlines. When equipment must be moved or operated near energized high-voltage powerlines (other...

Voltage Dependence of a Neuromodulator-Activated Ionic Current123

Science.gov (United States)

2016-01-01

Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

Directory of Open Access Journals (Sweden)

Rajeev Gupta

2017-06-01

Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

Science.gov (United States)

Gupta, Rajeev; Ghosh, Subhendu

2017-06-01

Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

Two interesting cases in spatial charge movement

International Nuclear Information System (INIS)

Novellino, R.A.

1983-01-01

The relation between current and voltage in a dielectric under radiation is obtained, assuming only one carrier to be mobile, recombination and injection of the mobile charge from the electrode. For this last boundary condition a constant charge density at the electrode-dielectric interface was chosen. The other problem treated is a generalization of the classic transient problem studied by Many-Rakavy, using the constant charge density boundary condition. Analytic solutions were obtained during the first transit time and computed ones for larger times. Some attention was given to the damped current oscilations approaching the steady state value. (Author) [pt

Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

OpenAIRE

Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk

2005-01-01

Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...

The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

International Nuclear Information System (INIS)

Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

2013-01-01

Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

Depolarization of the conductance-voltage relationship in the NaV1.5 mutant, E1784K, is due to altered fast inactivation

Science.gov (United States)

Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.

2017-01-01

E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267

Depolarization of the conductance-voltage relationship in the NaV1.5 mutant, E1784K, is due to altered fast inactivation.

Directory of Open Access Journals (Sweden)

Colin H Peters

Full Text Available E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.

30 CFR 56.12071 - Movement or operation of equipment near high-voltage power lines.

Science.gov (United States)

2010-07-01

...-voltage power lines. 56.12071 Section 56.12071 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... NONMETAL MINES Electricity § 56.12071 Movement or operation of equipment near high-voltage power lines. When equipment must be moved or operated near energized high-voltage powerlines (other than trolley...

Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

Science.gov (United States)

Cui, Jianmin

2016-01-01

Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

Science.gov (United States)

Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

2014-07-01

Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

Charging and absorption characteristics of small particulates under alternative and electrostatic voltages in an electrostatic precipitator

International Nuclear Information System (INIS)

Jiang Xue-Dong; Xu He; Wang Xin

2014-01-01

The charge quantity of small particulates such as PM2.5 plays a key role in the collection efficiency of an electrostatic precipitator (ESP). Under a single electrostatic voltage, it is difficult to charge and absorb small particulates. A new method of superimposing an alternative voltage on the electrostatic voltage is provided in this paper. Characteristics of small particulates are analyzed under alternative and electrostatic voltages. It is demonstrated that an alternative voltage can significantly improve the collection efficiency in three aspects: preventing anti-corona, increasing the charge quantity of small particulates, and increasing the median particulate size by electric agglomeration. In addition, practical usage with the superposition of alternative voltage is provided, and the results are in agreement with the theoretical analysis. (physics of gases, plasmas, and electric discharges)

30 CFR 77.807-3 - Movement of equipment; minimum distance from high-voltage lines.

Science.gov (United States)

2010-07-01

... high-voltage lines. 77.807-3 Section 77.807-3 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... WORK AREAS OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.807-3 Movement of equipment; minimum distance from high-voltage lines. When any part of any equipment operated on the surface of any...

One-carrier free space charge motion under applied voltage

International Nuclear Information System (INIS)

Camargo, P.C.; Ferreira, G.F.L.

1976-01-01

The system of partial differential equations describing the one-carrier free space-charge motion under a given applied voltage is transformed into a system of two ordinary differential equations. The method is applied to find the external current injection [pt

Time-dependent mobility and recombination of the photoinduced charge carriers in conjugated polymer/fullerene bulk heterojunction solar cells

Science.gov (United States)

Mozer, A. J.; Dennler, G.; Sariciftci, N. S.; Westerling, M.; Pivrikas, A.; Österbacka, R.; Juška, G.

2005-07-01

Time-dependent mobility and recombination in the blend of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)- C61 (PCBM) is studied simultaneously using the photoinduced charge carrier extraction by linearly increasing voltage technique. The charge carriers are photogenerated by a strongly absorbed, 3 ns laser flash, and extracted by the application of a reverse bias voltage pulse after an adjustable delay time (tdel) . It is found that the mobility of the extracted charge carriers decreases with increasing delay time, especially shortly after photoexcitation. The time-dependent mobility μ(t) is attributed to the energy relaxation of the charge carriers towards the tail states of the density of states distribution. A model based on a dispersive bimolecular recombination is formulated, which properly describes the concentration decay of the extracted charge carriers at all measured temperatures and concentrations. The calculated bimolecular recombination coefficient β(t) is also found to be time-dependent exhibiting a power law dependence as β(t)=β0t-(1-γ) with increasing slope (1-γ) with decreasing temperatures. The temperature dependence study reveals that both the mobility and recombination of the photogenerated charge carriers are thermally activated processes with activation energy in the range of 0.1 eV. Finally, the direct comparison of μ(t) and β(t) shows that the recombination of the long-lived charge carriers is controlled by diffusion.

Space Charge Modulated Electrical Breakdown of Oil Impregnated Paper Insulation Subjected to AC-DC Combined Voltages

Directory of Open Access Journals (Sweden)

Yuanwei Zhu

2018-06-01

Full Text Available Based on the existing acknowledgment that space charge modulates AC and DC breakdown of insulating materials, this investigation promotes the related investigation into the situations of more complex electrical stress, i.e., AC-DC combined voltages. Experimentally, the AC-DC breakdown characteristics of oil impregnated paper insulation were systematically investigated. The effects of pre-applied voltage waveform, AC component ratio, and sample thickness on AC-DC breakdown characteristics were analyzed. After that, based on an improved bipolar charge transport model, the space charge profiles and the space charge induced electric field distortion during AC-DC breakdown were numerically simulated to explain the differences in breakdown characteristics between the pre-applied AC and pre-applied DC methods under AC-DC combined voltages. It is concluded that large amounts of homo-charges are accumulated during AC-DC breakdown, which results in significantly distorted inner electric field, leading to variations of breakdown characteristics of oil impregnated paper insulation. Therefore, space charges under AC-DC combined voltages must be considered in the design of converter transformers. In addition, this investigation could provide supporting breakdown data for insulation design of converter transformers and could promote better understanding on the breakdown mechanism of insulating materials subjected to AC-DC combined voltages.

Model for thickness dependence of radiation charging in MOS structures

Science.gov (United States)

Viswanathan, C. R.; Maserjian, J.

1976-01-01

The model considers charge buildup in MOS structures due to hole trapping in the oxide and the creation of sheet charge at the silicon interface. The contribution of hole trapping causes the flatband voltage to increase with thickness in a manner in which square and cube dependences are limiting cases. Experimental measurements on samples covering a 200 - 1000 A range of oxide thickness are consistent with the model, using independently obtained values of hole-trapping parameters. An important finding of our experimental results is that a negative interface charge contribution due to surface states created during irradiation compensates most of the positive charge in the oxide at flatband. The tendency of the surface states to 'track' the positive charge buildup in the oxide, for all thicknesses, applies both in creation during irradiation and in annihilation during annealing. An explanation is proposed based on the common defect origin of hole traps and potential surface states.

Induced voltage due to time-dependent magnetisation textures

International Nuclear Information System (INIS)

Kudtarkar, Santosh Kumar; Dhadwal, Renu

2010-01-01

We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

A high-voltage equipment (high voltage supply, high voltage pulse generators, resonant charging inductance, synchro-instruments for gyrotron frequency measurements) for plasma applications

International Nuclear Information System (INIS)

Spassov, Velin

1996-01-01

This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)

Quantum-well charge and voltage distribution in a metal–insulator–semiconductor structure upon resonant electron Tunneling

Energy Technology Data Exchange (ETDEWEB)

Vexler, M. I., E-mail: vexler@mail.ioffe.ru; Illarionov, Yu. Yu.; Grekhov, I. V. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation)

2017-04-15

The prerequisites for electron storage in the quantum well of a metal–oxide–p{sup +}-Si resonant-tunneling structure and the effect of the stored charge on the voltage distribution are theoretically investigated. Systems with SiO{sub 2}, HfO{sub 2}, and TiO{sub 2} insulators are studied. It is demonstrated that the occurrence of a charge in the well in the case of resonant transport can be expected in structures on substrates with an acceptor concentration from (5–6) × 10{sup 18} to (2–3) × 10{sup 19} cm{sup –3} in the range of oxide thicknesses dependent on this concentration. In particular, the oxide layer thickness in the structures with SiO{sub 2}/p{sup +}-Si(10{sup 19} cm{sup –3}) should exceed ~3 nm. The electron density in the well can reach ~10{sup 12} cm{sup –2} and higher. However, the effect of this charge on the electrostatics of the structure becomes noticeable only at relatively high voltages far above the activation of resonant transport through the first subband.

Achievable peak electrode voltage reduction by neurostimulators using descending staircase currents to deliver charge.

Science.gov (United States)

Halpern, Mark

2011-01-01

This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.

Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

International Nuclear Information System (INIS)

Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

2016-01-01

We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

Science.gov (United States)

Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

2014-01-01

The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

Charge movements and transverse tubular ultrastructure in organ cultured skeletal muscle.

Science.gov (United States)

Cullen, M J; Hollingworth, S; Marshall, M W; Robson, E

1990-04-01

A study was made of charge movements and the transverse tubular systems in rat EDL and soleus muscle fibres maintained for up to five days in organ culture. In the cultured EDL muscle the maximum amount of charge moved was about one third of that in innervated muscle. Charge movements in innervated soleus fibres are small, less than 10 nC/microF, and difficult to resolve. They remain small following organ culturing. The ultrastructural study examined the concentration of junctional feet because of their proposed key role in excitation-contraction coupling. The general architecture of the triads and the spacing of the feet in both muscle types was largely unchanged by culturing. In cultured EDL muscles the small changes in feet concentration did not parallel the large fall in charge movement. The results reported here support a previous conclusion that, in mammalian muscle, there is not a simple relation between charge and feet. The stimulation of cultured soleus muscles with a fast twitch pattern of electrical activity produced no observable changes in morphology.

Arginine side chain interactions and the role of arginine as a gating charge carrier in voltage sensitive ion channels

Science.gov (United States)

Armstrong, Craig T.; Mason, Philip E.; Anderson, J. L. Ross; Dempsey, Christopher E.

2016-02-01

Gating charges in voltage-sensing domains (VSD) of voltage-sensitive ion channels and enzymes are carried on arginine side chains rather than lysine. This arginine preference may result from the unique hydration properties of the side chain guanidinium group which facilitates its movement through a hydrophobic plug that seals the center of the VSD, as suggested by molecular dynamics simulations. To test for side chain interactions implicit in this model we inspected interactions of the side chains of arginine and lysine with each of the 19 non-glycine amino acids in proteins in the protein data bank. The arginine guanidinium interacts with non-polar aromatic and aliphatic side chains above and below the guanidinium plane while hydrogen bonding with polar side chains is restricted to in-plane positions. In contrast, non-polar side chains interact largely with the aliphatic part of the lysine side chain. The hydration properties of arginine and lysine are strongly reflected in their respective interactions with non-polar and polar side chains as observed in protein structures and in molecular dynamics simulations, and likely underlie the preference for arginine as a mobile charge carrier in VSD.

Domain cooperativity in the β1a subunit is essential for dihydropyridine receptor voltage sensing in skeletal muscle.

Science.gov (United States)

Dayal, Anamika; Bhat, Vinayakumar; Franzini-Armstrong, Clara; Grabner, Manfred

2013-04-30

The dihydropyridine receptor (DHPR) β1a subunit is crucial for enhancement of DHPR triad expression, assembly of DHPRs in tetrads, and elicitation of DHPRα1S charge movement--the three prerequisites of skeletal muscle excitation-contraction coupling. Despite the ability to fully target α1S into triadic junctions and tetradic arrays, the neuronal isoform β3 was unable to restore considerable charge movement (measure of α1S voltage sensing) upon expression in β1-null zebrafish relaxed myotubes, unlike the other three vertebrate β-isoforms (β1a, β2a, and β4). Thus, we used β3 for chimerization with β1a to investigate whether any of the five distinct molecular regions of β1a is dominantly involved in inducing the voltage-sensing function of α1S. Surprisingly, systematic domain swapping between β1a and β3 revealed a pivotal role of the src homology 3 (SH3) domain and C terminus of β1a in charge movement restoration. More interestingly, β1a SH3 domain and C terminus, when simultaneously engineered into β3 sequence background, were able to fully restore charge movement together with proper intracellular Ca(2+) release, suggesting cooperativity of these two domains in induction of the α1S voltage-sensing function in skeletal muscle excitation-contraction coupling. Furthermore, substitution of a proline by alanine in the putative SH3-binding polyproline motif in the proximal C terminus of β1a (also of β2a and β4) fully obstructed α1S charge movement. Consequently, we postulate a model according to which β subunits, probably via the SH3-C-terminal polyproline interaction, adapt a discrete conformation required to modify the α1S conformation apt for voltage sensing in skeletal muscle.

Effect of applied DC voltages and temperatures on space charge behaviour of multi-layer oil-paper insulation

Energy Technology Data Exchange (ETDEWEB)

Tang Chao; Liao Ruijin [The State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University (China); Chen, G [School of Electronics and Computer Science, University of Southampton (United Kingdom); Fu, M, E-mail: tangchao_1981@163.co [AVERA T and D Technology Centre, Stafford (United Kingdom)

2009-08-01

In this paper, space charge in a multi-layer oil-paper insulation system was investigated using the pulsed electroacoustic (PEA) technique. A series of measurements had been carried following subjection of the insulation system to different applied voltages and different temperatures. Charge behaviours in the insulation system were analyzed and the influence of temperature on charge dynamics was discussed. The test results shows that homocharge injection takes place under all the test conditions, the applied DC voltage mainly affects the amount of space charge, while the temperature has greater influence on the distribution and mobility of space charge inside oil-paper samples.

Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

Science.gov (United States)

Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

2010-11-01

A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

Optimal Coordinated Management of a Plug-In Electric Vehicle Charging Station under a Flexible Penalty Contract for Voltage Security

Directory of Open Access Journals (Sweden)

Jip Kim

2016-07-01

Full Text Available The increasing penetration of plug-in electric vehicles (PEVs may cause a low-voltage problem in the distribution network. In particular, the introduction of charging stations where multiple PEVs are simultaneously charged at the same bus can aggravate the low-voltage problem. Unlike a distribution network operator (DNO who has the overall responsibility for stable and reliable network operation, a charging station operator (CSO may schedule PEV charging without consideration for the resulting severe voltage drop. Therefore, there is a need for the DNO to impose a coordination measure to induce the CSO to adjust its charging schedule to help mitigate the voltage problem. Although the current time-of-use (TOU tariff is an indirect coordination measure that can motivate the CSO to shift its charging demand to off-peak time by imposing a high rate at the peak time, it is limited by its rigidity in that the network voltage condition cannot be flexibly reflected in the tariff. Therefore, a flexible penalty contract (FPC for voltage security to be used as a direct coordination measure is proposed. In addition, the optimal coordinated management is formulated. Using the Pacific Gas and Electric Company (PG&E 69-bus test distribution network, the effectiveness of the coordination was verified by comparison with the current TOU tariff.

Mechanism of electromechanical coupling in voltage-gated potassium channels

Directory of Open Access Journals (Sweden)

Rikard eBlunck

2012-09-01

Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

Science.gov (United States)

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

Mapping the membrane-aqueous border for the voltage-sensing domain of a potassium channel.

Science.gov (United States)

Neale, Edward J; Rong, Honglin; Cockcroft, Christopher J; Sivaprasadarao, Asipu

2007-12-28

Voltage-sensing domains (VSDs) play diverse roles in biology. As integral components, they can detect changes in the membrane potential of a cell and couple these changes to activity of ion channels and enzymes. As independent proteins, homologues of the VSD can function as voltage-dependent proton channels. To sense voltage changes, the positively charged fourth transmembrane segment, S4, must move across the energetically unfavorable hydrophobic core of the bilayer, which presents a barrier to movement of both charged species and protons. To reduce the barrier to S4 movement, it has been suggested that aqueous crevices may penetrate the protein, reducing the extent of total movement. To investigate this hypothesis in a system containing fully functional channels in a native environment with an intact membrane potential, we have determined the contour of the membrane-aqueous border of the VSD of KvAP in Escherichia coli by examining the chemical accessibility of introduced cysteines. The results revealed the contour of the membrane-aqueous border of the VSD in its activated conformation. The water-inaccessible regions of S1 and S2 correspond to the standard width of the membrane bilayer (~28 A), but those of S3 and S4 are considerably shorter (> or = 40%), consistent with aqueous crevices pervading both the extracellular and intracellular ends. One face of S3b and the entire S3a were water-accessible, reducing the water-inaccessible region of S3 to just 10 residues, significantly shorter than for S4. The results suggest a key role for S3 in reducing the distance S4 needs to move to elicit gating.

Plasma surface treatment to improve surface charge accumulation and dissipation of epoxy resin exposed to DC and nanosecond-pulse voltages

Science.gov (United States)

Zhang, Cheng; Lin, Haofan; Zhang, Shuai; Xie, Qin; Ren, Chengyan; Shao, Tao

2017-10-01

In this paper, deposition by non-thermal plasma is used as a surface modification technique to change the surface characteristics of epoxy resin exposed to DC and nanosecond-pulse voltages. The corresponding surface characteristics in both cases of DC and nanosecond-pulse voltages before and after the modification are compared and investigated. The measurement of the surface potential provides the surface charge distribution, which is used to show the accumulation and dissipation process of the surface charges. Morphology observations, chemical composition and electrical parameters measurements are used to evaluate the treatment effects. The experimental results show that, before the plasma treatment, the accumulated surface charges in the case of the DC voltage are more than that in the case of the nanosecond-pulse voltage. Moreover, the decay rate of the surface charges for the DC voltage is higher than that for the nanosecond-pulse voltage. However, the decay rate is no more than 41% after 1800 s for both types of voltages. After the plasma treatment, the maximum surface potentials decrease to 57.33% and 32.57% of their values before treatment for the DC and nanosecond-pulse voltages, respectively, indicating a decrease in the accumulated surface charges. The decay rate exceeds 90% for both types of voltages. These changes are mainly attributed to a change in the surface nanostructure, an increase in conductivity, and a decrease in the depth of energy level.

Plasma surface treatment to improve surface charge accumulation and dissipation of epoxy resin exposed to DC and nanosecond-pulse voltages

International Nuclear Information System (INIS)

Zhang, Cheng; Lin, Haofan; Zhang, Shuai; Ren, Chengyan; Shao, Tao; Xie, Qin

2017-01-01

In this paper, deposition by non-thermal plasma is used as a surface modification technique to change the surface characteristics of epoxy resin exposed to DC and nanosecond-pulse voltages. The corresponding surface characteristics in both cases of DC and nanosecond-pulse voltages before and after the modification are compared and investigated. The measurement of the surface potential provides the surface charge distribution, which is used to show the accumulation and dissipation process of the surface charges. Morphology observations, chemical composition and electrical parameters measurements are used to evaluate the treatment effects. The experimental results show that, before the plasma treatment, the accumulated surface charges in the case of the DC voltage are more than that in the case of the nanosecond-pulse voltage. Moreover, the decay rate of the surface charges for the DC voltage is higher than that for the nanosecond-pulse voltage. However, the decay rate is no more than 41% after 1800 s for both types of voltages. After the plasma treatment, the maximum surface potentials decrease to 57.33% and 32.57% of their values before treatment for the DC and nanosecond-pulse voltages, respectively, indicating a decrease in the accumulated surface charges. The decay rate exceeds 90% for both types of voltages. These changes are mainly attributed to a change in the surface nanostructure, an increase in conductivity, and a decrease in the depth of energy level. (paper)

Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

Science.gov (United States)

Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

2018-03-01

Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-01-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

A new method for compensation of the effect of charging transformer's leakage inductance on PFN voltage regulation in Klystron pulse modulators

Energy Technology Data Exchange (ETDEWEB)

Patel, Akhil, E-mail: akhilpatel@rrcat.gov.in; Kale, Umesh; Shrivastava, Purushottam

2017-04-21

The Line type modulators have been widely used to generate high voltage rectangular pulses to power the klystron for high power RF generation. In Line type modulator, the Pulse Forming Network (PFN) which is a cascade combination of lumped capacitors and inductors is used to store the electrical energy. The charged PFN is then discharged into a klystron by firing a high voltage Thyratron switch. This discharge generates a high voltage rectangular pulse across the klystron electrodes. The amplitude and phase of Klystron's RF output is governed by the high voltage pulse amplitude. The undesired RF amplitude and phase stability issues arises at the klystron's output due to inter-pulse and during the pulse amplitude variations. To reduce inter-pulse voltage variations, the PFN is required to be charged at the same voltage after every discharge cycle. At present, the combination of widely used resonant charging and deQing method is used to regulate the pulse to pulse PFN voltage variations but the charging transformer's leakage inductance puts an upper bound on the regulation achievable by this method. Here we have developed few insights of the deQing process and devised a new compensation method to compensate this undesired effect of charging transformer's leakage inductance on the pulse to pulse PFN voltage stability. This compensation is accomplished by the controlled partial discharging of the split PFN capacitor using a low voltage MOSFET switch. Theoretically, very high values of pulse to pulse voltage stability may be achieved using this method. This method may be used in deQing based existing modulators or in new modulators, to increase the pulse to pulse voltage stability, without having a very tight bound on charging transformer's leakage inductance. Given a stable charging power supply, this method may be used to further enhance the inter-pulse voltage stability of modulators which employ the direct charging, after replacing the

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-07-05

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-01-01

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

Threshold voltage variation depending on single grain boundary and stored charges in an adjacent cell for vertical silicon–oxide–nitride–oxide–silicon NAND flash memory

Science.gov (United States)

Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo

2018-04-01

The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.

Charge distribution dependency on gap thickness of CMS endcap RPC

CERN Document Server

Park, Sung Keun

2016-01-01

We present a systematic study of charge distribution dependency of CMS Resistive Plate Chamber (RPC) on gap thickness.Prototypes of double-gap with five different gap thickness from 1.8mm to 1.0mm in 0.2mm steps have been built with 2mm thick phenolic high-pressure-laminated (HPL) plates. The charges of cosmic-muon signals induced on the detector strips are measured as a function of time using two four-channel 400-MHz fresh ADCs. In addition, the arrival time of the muons and the strip cluster sizes are measured by digitizing the signal using a 32-channel voltage-mode front-end-electronics and a 400-MHz 64-channel multi-hit TDC. The gain and the input impedance of the front-end-electronics were 200mV/mV and 20 Ohm, respectively.

A Uniform Voltage Gain Control for Alignment Robustness in Wireless EV Charging

Directory of Open Access Journals (Sweden)

Yabiao Gao

2015-08-01

Full Text Available The efficiency of wireless power transfer is sensitive to the horizontal and vertical distances between the transmitter and receiver coils due to the magnetic coupling change. To address the output voltage variation and efficiency drop caused by misalignment, a uniform voltage gain frequency control is implemented to improve the power delivery and efficiency of wireless power transfer under misalignment. The frequency is tuned according to the amplitude and phase-frequency characteristics of coupling variations in order to maintain a uniform output voltage in the receiver coil. Experimental comparison of three control methods, including fixed frequency control, resonant frequency control, and the proposed uniform gain control was conducted and demonstrated that the uniform voltage gain control is the most robust method for managing misalignment in wireless charging applications.

A High-Gain Reflex-Based Bidirectional DC Charger with Efficient Energy Recycling for Low-Voltage Battery Charging-Discharging Power Control

Directory of Open Access Journals (Sweden)

Ching-Ming Lai

2018-03-01

Full Text Available This study proposes a high-gain reflex-charging-based bidirectional DC charger (RC-BDC to enhance the battery charging efficiency of light electric vehicles (LEV in a DC-microgrid. The proposed charger topology consists of an unregulated level converter (ULC and a two-phase interleaved buck-boost charge-pump converter (IBCPC, which together provide low ripple and high voltage conversion ratio. As the high-gain RC-BDC charges, the LEV’s battery with reflex charging currents, high battery charging efficiency, and prolonged battery life cycles are achieved. This is possible due to the recovering of negative pulse energy of reflex charging currents to reduce charge dissipations within LEV’s batteries. Derivations of the operating principles of the high-gain RC-BDC, analyses of its topology, and the closed-loop control designs were presented. Simulations and experiments were implemented with battery voltage of 48 V and DC-bus voltage of 400 V for a 500 W prototype. The results verify the feasibility of the proposed concept and were compared with the typical constant-current/constant-voltage (CC/CV charger. The comparison shows that the proposed high gain RC-BDC improves battery charging speed and reduces the battery thermal deterioration effect by about 12.7% and 25%, respectively.

Charge-sharing SAR ADCs for low-voltage low-power applications

CERN Document Server

Rabuske, Taimur

2017-01-01

This book introduces readers to the potential of charge-sharing (CS) successive approximation register (SAR) analog-to-digital converters (ADCs), while providing extensive analysis of the factors that limit the performance of the CS topology. The authors present guidelines and useful techniques for mitigating the limitations of the architecture, while focusing on the implementation under restricted power budgets and voltage supplies.

Measurement of magnetically insulated line voltage using a Thomson Parabola Charged Particle Analyser

International Nuclear Information System (INIS)

Stanley, T.D.; Stinnett, R.W.

1981-01-01

The absence of direct measurements of magnetically insulated line voltage necessitated reliance on inferred voltages based on theoretical calculation and current measurements. This paper presents some of the first direct measurements of magnetically insulated transmission line peak voltages. These measurements were made on the Sandia National Laboratories HydraMITE facility. The peak voltage is measured by observing the energy of negative ions produced at the line cathode and accelerated through the line voltage. The ion energy and the charge-to-mass ratio are measured using the Thomson Parabola mass spectrometry technique. This technique uses parallel E and B fields to deflect the ions. The deflected ions are detected using a microchannel plate coupled to a phosphor screen and photographic film. The Thomson Parabola results are compared to Faraday Cup measurements and to calculated voltages based on current measurements. In addition, the significance of observed positive ions is discussed

Optimal Design of DC Fast-Charging Stations for EVs in Low Voltage Grids

DEFF Research Database (Denmark)

Gjelaj, Marjan; Træholt, Chresten; Hashemi Toghroljerdi, Seyedmostafa

2017-01-01

DC Fast Charging Station (DCFCS) is essential for widespread use of Electric Vehicle (EVs). It can recharge EVs in direct current in a short period of time. In recent years, the increasing penetration of EVs and their charging systems are going through a series of changes. This paper addresses...... on the power grid through the application of electrical storage systems within the DC fast charging stations. The proposed solution decreases the charging time and the impact on the low voltage (LV) grid significantly. The charger can be used as a multifunctional grid-utility such as congestion management...

The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

Science.gov (United States)

Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

2017-08-01

Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

The use of charge extraction by linearly increasing voltage in polar organic light-emitting diodes

Science.gov (United States)

Züfle, Simon; Altazin, Stéphane; Hofmann, Alexander; Jäger, Lars; Neukom, Martin T.; Schmidt, Tobias D.; Brütting, Wolfgang; Ruhstaller, Beat

2017-05-01

We demonstrate the application of the CELIV (charge carrier extraction by linearly increasing voltage) technique to bilayer organic light-emitting devices (OLEDs) in order to selectively determine the hole mobility in N,N0-bis(1-naphthyl)-N,N0-diphenyl-1,10-biphenyl-4,40-diamine (α-NPD). In the CELIV technique, mobile charges in the active layer are extracted by applying a negative voltage ramp, leading to a peak superimposed to the measured displacement current whose temporal position is related to the charge carrier mobility. In fully operating devices, however, bipolar carrier transport and recombination complicate the analysis of CELIV transients as well as the assignment of the extracted mobility value to one charge carrier species. This has motivated a new approach of fabricating dedicated metal-insulator-semiconductor (MIS) devices, where the extraction current contains signatures of only one charge carrier type. In this work, we show that the MIS-CELIV concept can be employed in bilayer polar OLEDs as well, which are easy to fabricate using most common electron transport layers (ETLs), like Tris-(8-hydroxyquinoline)aluminum (Alq3). Due to the macroscopic polarization of the ETL, holes are already injected into the hole transport layer below the built-in voltage and accumulate at the internal interface with the ETL. This way, by a standard CELIV experiment only holes will be extracted, allowing us to determine their mobility. The approach can be established as a powerful way of selectively measuring charge mobilities in new materials in a standard device configuration.

Impact of Distribution Feeders that do not have Voltage Regulators on the number of Charged Electric Vehicles using IEEE 34 Bus Test Feeder

Energy Technology Data Exchange (ETDEWEB)

Allehyani, Ahmed [University of Southern California, Department of Electrical Engineering; Beshir, Mohammed [University of Southern California, Department of Electrical Engineering

2015-02-01

Voltage regulators help maintain an acceptable voltage profile for the system. This paper discusses the effect of installing voltage regulators to the system to fix the voltage drop resulting from the electrical vehicles loading increase when they are being charged. The effect will be studied in the afternoon, when the peak load occurs, using the IEEE 34 bus test feeder. First, only one spot node is used to charge the electric vehicles while a voltage regulator is present. Second, five spot nodes are loaded at the same time to charge the electric vehicles while voltage regulators are installed at each node. After that, the impact of electric vehicles on distribution feeders that do not have voltage regulators will appear.

Charge Gain, Voltage Gain, and Node Capacitance of the SAPHIRA Detector Pixel by Pixel

Science.gov (United States)

Pastrana, Izabella M.; Hall, Donald N. B.; Baker, Ian M.; Jacobson, Shane M.; Goebel, Sean B.

2018-01-01

The University of Hawai`i Institute for Astronomy has partnered with Leonardo (formerly Selex) in the development of HgCdTe linear mode avalanche photodiode (L-APD) SAPHIRA detectors. The SAPHIRA (Selex Avalanche Photodiode High-speed Infra-Red Array) is ideally suited for photon-starved astronomical observations, particularly near infrared (NIR) adaptive optics (AO) wave-front sensing. I have measured the stability, and linearity with current, of a 1.7-um (10% spectral bandpass) infrared light emitting diode (IR LED) used to illuminate the SAPHIRA and have then utilized this source to determine the charge gain (in e-/ADU), voltage gain (in uV/ADU), and node capacitance (in fF) for each pixel of the 320x256@24um SAPHIRA. These have previously only been averages over some sub-array. Determined from the ratio of the temporal averaged signal level to variance under constant 1.7-um LED illumination, I present the charge gain pixel-by-pixel in a 64x64 sub-array at the center of the active area of the SAPHIRA (analyzed separately as four 32x32 sub-arrays) to be about 1.6 e-/ADU (σ=0.5 e-/ADU). Additionally, the standard technique of varying the pixel reset voltage (PRV) in 10 mV increments and recording output frames for the same 64x64 subarray found the voltage gain per pixel to be about 11.7 uV/ADU (σ=0.2 uV/ADU). Finally, node capacitance was found to be approximately 23 fF (σ=6 fF) utilizing the aforementioned charge and voltage gain measurements. I further discuss the linearity measurements of the 1.7-um LED used in the charge gain characterization procedure.

Theory and experiment on charging and discharging a capacitor through a reverse-biased diode

Science.gov (United States)

Roy, Arijit; Mallick, Abhishek; Adhikari, Aparna; Guin, Priyanka; Chatterjee, Dibyendu

2018-06-01

The beauty of a diode lies in its voltage-dependent nonlinear resistance. The voltage on a charging and discharging capacitor through a reverse-biased diode is calculated from basic equations and is found to be in good agreement with experimental measurements. Instead of the exponential dependence of charging and discharging voltages with time for a resistor-capacitor circuit, a linear time dependence is found when the resistor is replaced by a reverse-biased diode. Thus, well controlled positive and negative ramp voltages are obtained from the charging and discharging diode-capacitor circuits. This experiment can readily be performed in an introductory physics and electronics laboratory.

[Study on the movement of the carrier recombination region in organic light-emitting diodes (OLEDs) based on DPVBi/Alq3].

Science.gov (United States)

Yan, Guang; Zhao, Su-ling; Xu, Zheng; Zhang, Fu-jun; Kong, Chao; Liu, Xiao-dong; Gong, Wei; Gao, Li-yan

2011-07-01

Series of organic light emitting devices with basic structure of ITO/PCBM: PVK(x Wt%, approximately 40 nm)/DPVBi(30 nm)/Alq3 (30 nm)/Al were fabricated in order to investigate the carrier recombination region movement in these devices. The carrier injection-dependent, the carrier transport-dependent and the voltage-dependent carrier recombination region movements were investigated respectively by modifying cathode with lithium fluoride, by changing the doping concentration of PCBM and by changing the voltage on the devices. The physical mechanism behind the voltage-dependent carrier recombination region movement was discussed.

Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

International Nuclear Information System (INIS)

Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

2015-01-01

Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

A thermoelectric voltage effect in polyethylene oxide

International Nuclear Information System (INIS)

Martin, Bjoern; Wagner, Achim; Kliem, Herbert

2003-01-01

The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

Nonlinear electrokinetics at large voltages

Energy Technology Data Exchange (ETDEWEB)

Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

2009-07-15

The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

Thermoelectric charge imbalance in superconducting aluminum

International Nuclear Information System (INIS)

Heidel, D.F.; Garland, J.C.

1981-01-01

The charge imbalance voltage produced in superconducting aluminum by the presence of a temperature gradient and an electric current has been studied over the temperature range 0.5-1.2 K. Measurements were obtained of the magnitude and temperature dependence of the charge imbalance voltage of seven samples, two of which contained magnetic impurities. The data are compared with recent theoretical models of the effect

Enhanced charge efficiency and reduced energy use in capacitive deionization by increasing the discharge voltage.

Science.gov (United States)

Kim, T; Dykstra, J E; Porada, S; van der Wal, A; Yoon, J; Biesheuvel, P M

2015-05-15

Capacitive deionization (CDI) is an electrochemical method for water desalination using porous carbon electrodes. A key parameter in CDI is the charge efficiency, Λ, which is the ratio of salt adsorption over charge in a CDI-cycle. Values for Λ in CDI are typically around 0.5-0.8, significantly less than the theoretical maximum of unity, due to the fact that not only counterions are adsorbed into the pores of the carbon electrodes, but at the same time coions are released. To enhance Λ, ion-exchange membranes (IEMs) can be implemented. With membranes, Λ can be close to unity because the membranes only allow passage for the counterions. Enhancing the value of Λ is advantageous as this implies a lower electrical current and (at a fixed charging voltage) a reduced energy use. We demonstrate how, without the need to include IEMs, the charge efficiency can be increased to values close to the theoretical maximum of unity, by increasing the cell voltage during discharge, with only a small loss of salt adsorption capacity per cycle. In separate constant-current CDI experiments, where after some time the effluent salt concentration reaches a stable value, this value is reached earlier with increased discharge voltage. We compare the experimental results with predictions of porous electrode theory which includes an equilibrium Donnan electrical double layer model for salt adsorption in carbon micropores. Our results highlight the potential of modified operational schemes in CDI to increase charge efficiency and reduce energy use of water desalination. Copyright © 2014 Elsevier Inc. All rights reserved.

Charge collection and space charge distribution in neutron-irradiated epitaxial silicon detectors

International Nuclear Information System (INIS)

Poehlsen, Thomas

2010-04-01

In this work epitaxial n-type silicon diodes with a thickness of 100 μm and 150 μm are investigated. After neutron irradiation with fluences between 10 14 cm -2 and 4 x 10 15 cm -2 annealing studies were performed. CV-IV curves were taken and the depletion voltage was determined for different annealing times. All investigated diodes with neutron fluences greater than 2 x 10 14 cm -2 showed type inversion due to irradiation. Measurements with the transient current technique (TCT) using a pulsed laser were performed to investigate charge collection effects for temperatures of -40 C, -10 C and 20 C. The charge correction method was used to determine the effective trapping time τ eff . Inconsistencies of the results could be explained by assuming field dependent trapping times. A simulation of charge collection could be used to determine the field dependent trapping time τ eff (E) and the space charge distribution in the detector bulk. Assuming a linear field dependence of the trapping times and a linear space charge distribution the data could be described. Indications of charge multiplication were seen in the irradiated 100 μm thick diodes for all investigated fluences at voltages above 800 V. The space charge distribution extracted from TCT measurements was compared to the results of the CV measurements and showed good agreement. (orig.)

Towards an understanding of induced-charge electrokinetics at large applied voltages in concentrated solutions.

Science.gov (United States)

Bazant, Martin Z; Kilic, Mustafa Sabri; Storey, Brian D; Ajdari, Armand

2009-11-30

The venerable theory of electrokinetic phenomena rests on the hypothesis of a dilute solution of point-like ions in quasi-equilibrium with a weakly charged surface, whose potential relative to the bulk is of order the thermal voltage (kT/e approximately 25 mV at room temperature). In nonlinear electrokinetic phenomena, such as AC or induced-charge electro-osmosis (ACEO, ICEO) and induced-charge electrophoresis (ICEP), several V approximately 100 kT/e are applied to polarizable surfaces in microscopic geometries, and the resulting electric fields and induced surface charges are large enough to violate the assumptions of the classical theory. In this article, we review the experimental and theoretical literatures, highlight discrepancies between theory and experiment, introduce possible modifications of the theory, and analyze their consequences. We argue that, in response to a large applied voltage, the "compact layer" and "shear plane" effectively advance into the liquid, due to the crowding of counterions. Using simple continuum models, we predict two general trends at large voltages: (i) ionic crowding against a blocking surface expands the diffuse double layer and thus decreases its differential capacitance, and (ii) a charge-induced viscosity increase near the surface reduces the electro-osmotic mobility; each trend is enhanced by dielectric saturation. The first effect is able to predict high-frequency flow reversal in ACEO pumps, while the second may explain the decay of ICEO flow with increasing salt concentration. Through several colloidal examples, such as ICEP of an uncharged metal sphere in an asymmetric electrolyte, we show that nonlinear electrokinetic phenomena are generally ion-specific. Similar theoretical issues arise in nanofluidics (due to confinement) and ionic liquids (due to the lack of solvent), so the paper concludes with a general framework of modified electrokinetic equations for finite-sized ions.

Characterization of nitride hole lateral transport in a charge trap flash memory by using a random telegraph signal method

Science.gov (United States)

Liu, Yu-Heng; Jiang, Cheng-Min; Lin, Hsiao-Yi; Wang, Tahui; Tsai, Wen-Jer; Lu, Tao-Cheng; Chen, Kuang-Chao; Lu, Chih-Yuan

2017-07-01

We use a random telegraph signal method to investigate nitride trapped hole lateral transport in a charge trap flash memory. The concept of this method is to utilize an interface oxide trap and its associated random telegraph signal as an internal probe to detect a local channel potential change resulting from nitride charge lateral movement. We apply different voltages to the drain of a memory cell and vary a bake temperature in retention to study the electric field and temperature dependence of hole lateral movement in a nitride. Thermal energy absorption by trapped holes in lateral transport is characterized. Mechanisms of hole lateral transport in retention are investigated. From the measured and modeled results, we find that thermally assisted trap-to-band tunneling is a major trapped hole emission mechanism in nitride hole lateral transport.

Time-dependent density functional theory for the charging kinetics of electric double layer containing room-temperature ionic liquids.

Science.gov (United States)

Lian, Cheng; Zhao, Shuangliang; Liu, Honglai; Wu, Jianzhong

2016-11-28

Understanding the charging kinetics of electric double layers is of fundamental importance for the design and development of novel electrochemical devices such as supercapacitors and field-effect transistors. In this work, we study the dynamic behavior of room-temperature ionic liquids using a classical time-dependent density functional theory that accounts for the molecular excluded volume effects, the electrostatic correlations, and the dispersion forces. While the conventional models predict a monotonic increase of the surface charge with time upon application of an electrode voltage, our results show that dispersion between ions results in a non-monotonic increase of the surface charge with the duration of charging. Furthermore, we investigate the effects of van der Waals attraction between electrode/ionic-liquid interactions on the charging processes.

Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device.

Science.gov (United States)

Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V

2015-05-01

A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

Symmetry-Breaking Charge Transfer in a Zinc Chlorodipyrrin Acceptor for High Open Circuit Voltage Organic Photovoltaics

KAUST Repository

Bartynski, Andrew N.

2015-04-29

© 2015 American Chemical Society. Low open-circuit voltages significantly limit the power conversion efficiency of organic photovoltaic devices. Typical strategies to enhance the open-circuit voltage involve tuning the HOMO and LUMO positions of the donor (D) and acceptor (A), respectively, to increase the interfacial energy gap or to tailor the donor or acceptor structure at the D/A interface. Here, we present an alternative approach to improve the open-circuit voltage through the use of a zinc chlorodipyrrin, ZCl [bis(dodecachloro-5-mesityldipyrrinato)zinc], as an acceptor, which undergoes symmetry-breaking charge transfer (CT) at the donor/acceptor interface. DBP/ZCl cells exhibit open-circuit voltages of 1.33 V compared to 0.88 V for analogous tetraphenyldibenzoperyflanthrene (DBP)/C60-based devices. Charge transfer state energies measured by Fourier-transform photocurrent spectroscopy and electroluminescence show that C60 forms a CT state of 1.45 ± 0.05 eV in a DBP/C60-based organic photovoltaic device, while ZCl as acceptor gives a CT state energy of 1.70 ± 0.05 eV in the corresponding device structure. In the ZCl device this results in an energetic loss between ECT and qVOC of 0.37 eV, substantially less than the 0.6 eV typically observed for organic systems and equal to the recombination losses seen in high-efficiency Si and GaAs devices. The substantial increase in open-circuit voltage and reduction in recombination losses for devices utilizing ZCl demonstrate the great promise of symmetry-breaking charge transfer in organic photovoltaic devices.

Current–voltage characteristics of manganite–titanite perovskite junctions

Directory of Open Access Journals (Sweden)

Benedikt Ifland

2015-07-01

Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-10-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

Science.gov (United States)

Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

2012-01-01

The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

Science.gov (United States)

Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

2016-02-25

Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Charge collection and space charge distribution in neutron-irradiated epitaxial silicon detectors

Energy Technology Data Exchange (ETDEWEB)

Poehlsen, Thomas

2010-04-15

In this work epitaxial n-type silicon diodes with a thickness of 100 {mu}m and 150 {mu}m are investigated. After neutron irradiation with fluences between 10{sup 14} cm{sup -2} and 4 x 10{sup 15} cm{sup -2} annealing studies were performed. CV-IV curves were taken and the depletion voltage was determined for different annealing times. All investigated diodes with neutron fluences greater than 2 x 10{sup 14} cm{sup -2} showed type inversion due to irradiation. Measurements with the transient current technique (TCT) using a pulsed laser were performed to investigate charge collection effects for temperatures of -40 C, -10 C and 20 C. The charge correction method was used to determine the effective trapping time {tau}{sub eff}. Inconsistencies of the results could be explained by assuming field dependent trapping times. A simulation of charge collection could be used to determine the field dependent trapping time {tau}{sub eff}(E) and the space charge distribution in the detector bulk. Assuming a linear field dependence of the trapping times and a linear space charge distribution the data could be described. Indications of charge multiplication were seen in the irradiated 100 {mu}m thick diodes for all investigated fluences at voltages above 800 V. The space charge distribution extracted from TCT measurements was compared to the results of the CV measurements and showed good agreement. (orig.)

Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

International Nuclear Information System (INIS)

Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

1993-01-01

The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

Crossing regimes of temperature dependence in animal movement.

Science.gov (United States)

Gibert, Jean P; Chelini, Marie-Claire; Rosenthal, Malcolm F; DeLong, John P

2016-05-01

A pressing challenge in ecology is to understand the effects of changing global temperatures on food web structure and dynamics. The stability of these complex ecological networks largely depends on how predator-prey interactions may respond to temperature changes. Because predators and prey rely on their velocities to catch food or avoid being eaten, understanding how temperatures may affect animal movement is central to this quest. Despite our efforts, we still lack a mechanistic understanding of how the effect of temperature on metabolic processes scales up to animal movement and beyond. Here, we merge a biomechanical approach, the Metabolic Theory of Ecology and empirical data to show that animal movement displays multiple regimes of temperature dependence. We also show that crossing these regimes has important consequences for population dynamics and stability, which depend on the parameters controlling predator-prey interactions. We argue that this dependence upon interaction parameters may help explain why experimental work on the temperature dependence of interaction strengths has so far yielded conflicting results. More importantly, these changes in the temperature dependence of animal movement can have consequences that go well beyond ecological interactions and affect, for example, animal communication, mating, sensory detection, and any behavioral modality dependent on the movement of limbs. Finally, by not taking into account the changes in temperature dependence reported here we might not be able to properly forecast the impact of global warming on ecological processes and propose appropriate mitigation action when needed. © 2016 John Wiley & Sons Ltd.

Charged particle transport in gaseous nitrogen at intermediate E/N using the voltage transient method

International Nuclear Information System (INIS)

Purdie, P.H.; Fletcher, J.

1992-01-01

A pulsed swarm of charged particles crossing an inter-electrode gap under the influence of an applied electric field E will produce a pulsed current in the external circuit which, when integrated over time, will result in a transient voltage pulse, the shape and magnitude of which is characteristic of the number of type of charged particles. This voltage transient technique has been used to investigate a gas discharge in nitrogen gas at values of E/N (the ratio of applied electric field to gas number density), such that ionization is non-negligible. The voltage transients have been subjected to a theoretical analysis, which has previously been reported, which includes not only cathode and anode image terms but also both electron and ion diffusion terms. Electron transport parameters are reported for E/N ≤ 350 Td (1 Td = 10 -17 V cm 2 ). Data are also obtained for the drift velocities and diffusion coefficients of the ions operative within the nitrogen discharge. An estimate is obtained for the collisional decay rate of N 2 + . 21 refs., 7 figs

Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

Science.gov (United States)

Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

1988-08-01

Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

Charging system of ECRH high-voltage power supply and its control system

International Nuclear Information System (INIS)

Hu Guofu; Ding Tonghai; Liu Baohua; Jiang Shufang

2003-01-01

High-voltage power supply (HVPS) of Electron Cyclotron Resonance Heating (ECRH) for HT-7 and HT-7U is presently being constructed. The high voltage (100 kV) energy of HVPS is stored in the capacitor banks, and they can power one or two gyrotrons. All the operation of the charging system will be done by the control system, where the field signals are interfaced to programmable logic controller (PLC). The use of PLC not only simplifies the control system, but also enhances the reliability. The software written by using configuration software installed in the master computer allows for remote and multiple operator control, and the status and data information is also remotely available

Azimuthal angle dependence of the charge imbalance from charge conservation effects

Science.gov (United States)

BoŻek, Piotr

2018-03-01

The experimental search for the chiral magnetic effect in heavy-ion collisions is based on charge-dependent correlations between emitted particles. Recently, a sensitive observable comparing event-by-event distributions of the charge splitting projected on the directions along and perpendicular to the direction of the elliptic flow has been proposed. The results of a (3 + 1)-dimensional hydrodynamic model show that the preliminary experimental data of the STAR Collaboration can be explained as due to background effects, such as resonance decays and local charge conservation in the particle production. A related observable based on the third-order harmonic flow is proposed to further investigate such background effects in charge-dependent correlations.

Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

Science.gov (United States)

Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

2018-04-01

In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

Kinetics of charged particles in a high-voltage gas discharge in a nonuniform electrostatic field

Energy Technology Data Exchange (ETDEWEB)

Kolpakov, V. A., E-mail: kolpakov683@gmail.com; Krichevskii, S. V.; Markushin, M. A. [Korolev Samara National Research University (Russian Federation)

2017-01-15

A high-voltage gas discharge is of interest as a possible means of generating directed flows of low-temperature plasma in the off-electrode space distinguished by its original features [1–4]. We propose a model for calculating the trajectories of charges particles in a high-voltage gas discharge in nitrogen at a pressure of 0.15 Torr existing in a nonuniform electrostatic field and the strength of this field. Based on the results of our calculations, we supplement and refine the extensive experimental data concerning the investigation of such a discharge published in [1, 2, 5–8]; good agreement between the theory and experiment has been achieved. The discharge burning is initiated and maintained through bulk electron-impact ionization and ion–electron emission. We have determined the sizes of the cathode surface regions responsible for these processes, including the sizes of the axial zone involved in the discharge generation. The main effect determining the kinetics of charged particles consists in a sharp decrease in the strength of the field under consideration outside the interelectrode space, which allows a free motion of charges with specific energies and trajectories to be generated in it. The simulation results confirm that complex electrode systems that allow directed plasma flows to be generated at a discharge current of hundreds or thousands of milliamperes and a voltage on the electrodes of 0.3–1 kV can be implemented in practice [3, 9, 10].

Study on the characters of high voltage charging power supply system for diagnostics neutral beam on HT-7 Tokamak

International Nuclear Information System (INIS)

Zhang Jian; Huang Yiyun; Liu Baohua; Guo Wenjun; Shen Xiaoling; Wei Wei

2011-01-01

A high voltage power supply system has been developed for the diagnostic neutral beam on the HT-7 experimental Tokamak, and the over-voltage phenomenon of storage capacitor was founded in the experiment. In order to analyse and resolve this problem, the structure and principle of high voltage power supply is described and the primary high voltage charging power supply system is introduced in detail. The phenomenon of over-voltage on the capacitors is also studied with circuit model, and the conclusion is obtained that the leakage inductance is the mA in reason which causes the over-voltage on the capacitors. (authors)

Scorpion β-toxin interference with NaV channel voltage sensor gives rise to excitatory and depressant modes

Science.gov (United States)

Leipold, Enrico; Borges, Adolfo

2012-01-01

Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

Science.gov (United States)

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

Spin-charge coupled dynamics driven by a time-dependent magnetization

Science.gov (United States)

Tölle, Sebastian; Eckern, Ulrich; Gorini, Cosimo

2017-03-01

The spin-charge coupled dynamics in a thin, magnetized metallic system are investigated. The effective driving force acting on the charge carriers is generated by a dynamical magnetic texture, which can be induced, e.g., by a magnetic material in contact with a normal-metal system. We consider a general inversion-asymmetric substrate/normal-metal/magnet structure, which, by specifying the precise nature of each layer, can mimic various experimentally employed setups. Inversion symmetry breaking gives rise to an effective Rashba spin-orbit interaction. We derive general spin-charge kinetic equations which show that such spin-orbit interaction, together with anisotropic Elliott-Yafet spin relaxation, yields significant corrections to the magnetization-induced dynamics. In particular, we present a consistent treatment of the spin density and spin current contributions to the equations of motion, inter alia, identifying a term in the effective force which appears due to a spin current polarized parallel to the magnetization. This "inverse-spin-filter" contribution depends markedly on the parameter which describes the anisotropy in spin relaxation. To further highlight the physical meaning of the different contributions, the spin-pumping configuration of typical experimental setups is analyzed in detail. In the two-dimensional limit the buildup of dc voltage is dominated by the spin-galvanic (inverse Edelstein) effect. A measuring scheme that could isolate this contribution is discussed.

Evolution of density-dependent movement during experimental range expansions.

Science.gov (United States)

Fronhofer, E A; Gut, S; Altermatt, F

2017-12-01

Range expansions and biological invasions are prime examples of transient processes that are likely impacted by rapid evolutionary changes. As a spatial process, range expansions are driven by dispersal and movement behaviour. Although it is widely accepted that dispersal and movement may be context-dependent, for instance density-dependent, and best represented by reaction norms, the evolution of density-dependent movement during range expansions has received little experimental attention. We therefore tested current theory predicting the evolution of increased movement at low densities at range margins using highly replicated and controlled range expansion experiments across multiple genotypes of the protist model system Tetrahymena thermophila. Although rare, we found evolutionary changes during range expansions even in the absence of initial standing genetic variation. Range expansions led to the evolution of negatively density-dependent movement at range margins. In addition, we report the evolution of increased intrastrain competitive ability and concurrently decreased population growth rates in range cores. Our findings highlight the importance of understanding movement and dispersal as evolving reaction norms and plastic life-history traits of central relevance for range expansions, biological invasions and the dynamics of spatially structured systems in general. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

Charge collection and charge pulse formation in highly irradiated silicon planar detectors

International Nuclear Information System (INIS)

Dezillie, B.; Li, Z.; Eremin, V.

1998-06-01

The interpretation of experimental data and predictions for future experiments for high-energy physics have been based on conventional methods like capacitance versus voltage (C-V) measurements. Experiments carried out on highly irradiated detectors show that the kinetics of the charge collection and the dependence of the charge pulse amplitude on the applied bias are deviated too far from those predicted by the conventional methods. The described results show that in highly irradiated detectors, at a bias lower than the real full depletion voltage (V fd ), the kinetics of the charge collection (Q) contains a fast and a slow component. At V = V fd *, which is the full depletion voltage traditionally determined by the extrapolation of the fast component amplitude of q versus bias to the maximum value or from the standard C-V measurements, the pulse has a slow component with significant amplitude. This slow component can only be eliminated by applying additional bias that amounts to the real full depletion voltage (V fd ) or more. The above mentioned regularities are explained in this paper in terms of a model of an irradiated detector with multiple regions. This model allows one to use C-V, in a modified way, as well as TChT (transient charge technique) measurements to determine the V fd for highly irradiated detectors

Charge carrier transport in Cu(In,Ga)Se2 thin-film solar-cells studied by electron beam induced current and temperature and illumination dependent current voltage analysis

International Nuclear Information System (INIS)

Nichterwitz, Melanie

2012-01-01

This work contributes to the understanding of generation dependent charge-carrier transport properties in Cu(In,Ga)Se 2 (CIGSe)/ CdS/ ZnO solar cells and a consistent model for the electronic band diagram of the heterojunction region of the device is developed. Cross section electron-beam induced current (EBIC) and temperature and illumination dependent current voltage (IV) measurements are performed on CIGSe solar cells with varying absorber layer compositions and CdS thickness. For a better understanding of possibilities and limitations of EBIC measurements applied on CIGSe solar cells, detailed numerical simulations of cross section EBIC profiles for varying electron beam and solar cell parameters are performed and compared to profiles obtained from an analytical description. Especially the effects of high injection conditions are considered. Even though the collection function of the solar cell is not independent of the generation function of the electron beam, the local electron diffusion length in CIGSe can still be extracted. Grain specific values ranging from (480±70) nm to (2.3±0.2) μm are determined for a CuInSe 2 absorber layer and a value of (2.8±0.3) μm for CIGSe with a Ga-content of 0.3. There are several models discussed in literature to explain generation dependent charge carrier transport, all assuming a high acceptor density either located in the CIGSe layer close to the CIGSe/CdS interface (p + layer), within the CdS layer or at the CdS/ZnO interface. In all models, a change in charge carrier collection properties is caused by a generation dependent occupation probability of the acceptor type defect state and the resulting potential distribution throughout the device. Numerical simulations of EBIC and IV data are performed with parameters according to these models. The model that explains the experimental data best is that of a p + layer at the CIGSe/CdS interface and acceptor type defect states at the CdS/ZnO interface. The p + layer leads

Charge carrier dynamics investigation of CuInS{sub 2} quantum dots films using injected charge extraction by linearly increasing voltage (i-CELIV): the role of ZnS Shell

Energy Technology Data Exchange (ETDEWEB)

Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui, E-mail: yinghui-wang@outlook.com; Liu, Qinghui, E-mail: liuqinghui@jlu.edu.cn; Tan, Mingrui [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China); Zhou, Qiang [Jilin University, Key Laboratory of Superhard Materials, College of Physics (China); Zhang, Hanzhuang, E-mail: zhanghz@jlu.edu.cn [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China)

2016-12-15

The role of ZnS shell on the photo-physical properties within CuInS{sub 2}/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS{sub 2} and CuInS{sub 2}/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.

Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

Science.gov (United States)

Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

2008-01-01

External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

Science.gov (United States)

Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

2008-11-01

External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

The relation of electrode voltages to charge position in SLC arc and final focus beam position monitors

International Nuclear Information System (INIS)

Fordham, C.

1989-01-01

The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs

Magnetic field and contact resistance dependence of non-local charge imbalance

International Nuclear Information System (INIS)

Kleine, A; Baumgartner, A; Trbovic, J; Schoenenberger, C; Golubev, D S; Zaikin, A D

2010-01-01

Crossed Andreev reflection (CAR) in metallic nanostructures, a possible basis for solid-state electron entangler devices, is usually investigated by detecting non-local voltages in multi-terminal superconductor/normal metal devices. This task is difficult because other subgap processes may mask the effects of CAR. One of these processes is the generation of charge imbalance (CI) and the diffusion of non-equilibrium quasi-particles in the superconductor. Here we demonstrate a characteristic dependence of non-local CI on a magnetic field applied parallel to the superconducting wire, which can be understood by a generalization of the standard description of CI to non-local experiments. These results can be used to distinguish CAR and CI and to extract CI relaxation times in superconducting nanostructures. In addition, we investigate the dependence of non-local CI on the resistance of the injector and detector contacts and demonstrate a quantitative agreement with a recent theory using only material and junction characteristics extracted from separate direct measurements.

Effect of Coercive Voltage and Charge Injection on Performance of a Ferroelectric-Gate Thin-Film Transistor

Directory of Open Access Journals (Sweden)

P. T. Tue

2013-01-01

Full Text Available We adopted a lanthanum oxide capping layer between semiconducting channel and insulator layers for fabrication of a ferroelectric-gate thin-film transistor memory (FGT which uses solution-processed indium-tin-oxide (ITO and lead-zirconium-titanate (PZT film as a channel layer and a gate insulator, respectively. Good transistor characteristics such as a high “on/off” current ratio, high channel mobility, and a large memory window of 108, 15.0 cm2 V−1 s−1, and 3.5 V were obtained, respectively. Further, a correlation between effective coercive voltage, charge injection effect, and FGT’s memory window was investigated. It is found that the charge injection from the channel to the insulator layer, which occurs at a high electric field, dramatically influences the memory window. The memory window’s enhancement can be explained by a dual effect of the capping layer: (1 a reduction of the charge injection and (2 an increase of effective coercive voltage dropped on the insulator.

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

Science.gov (United States)

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

Science.gov (United States)

Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

2016-03-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

International Nuclear Information System (INIS)

Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

2016-01-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

Local anesthetics disrupt energetic coupling between the voltage-sensing segments of a sodium channel.

Science.gov (United States)

Muroi, Yukiko; Chanda, Baron

2009-01-01

Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.

Comparative Study of Online Open Circuit Voltage Estimation Techniques for State of Charge Estimation of Lithium-Ion Batteries

Directory of Open Access Journals (Sweden)

Hicham Chaoui

2017-04-01

Full Text Available Online estimation techniques are extensively used to determine the parameters of various uncertain dynamic systems. In this paper, online estimation of the open-circuit voltage (OCV of lithium-ion batteries is proposed by two different adaptive filtering methods (i.e., recursive least square, RLS, and least mean square, LMS, along with an adaptive observer. The proposed techniques use the battery’s terminal voltage and current to estimate the OCV, which is correlated to the state of charge (SOC. Experimental results highlight the effectiveness of the proposed methods in online estimation at different charge/discharge conditions and temperatures. The comparative study illustrates the advantages and limitations of each online estimation method.

Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.

Science.gov (United States)

Freites, J Alfredo; Tobias, Douglas J

2015-06-01

Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.

Monitoring operating temperature and supply voltage in achieving high system dependability

NARCIS (Netherlands)

Khan, M.A.; Kerkhoff, Hans G.

2013-01-01

System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

Directory of Open Access Journals (Sweden)

S. Demirezen

Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

Science.gov (United States)

White, William E.

2013-01-01

Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

Voltage regulator for generator

Energy Technology Data Exchange (ETDEWEB)

Naoi, K

1989-01-17

It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

Optimal placement, sizing, and daily charge/discharge of battery energy storage in low voltage distribution network with high photovoltaic penetration

DEFF Research Database (Denmark)

Jannesar, Mohammad Rasol; Sedighi, Alireza; Savaghebi, Mehdi

2018-01-01

when photovoltaic penetration is increased in low voltage distribution network. Local battery energy storage system can mitigate these disadvantages and as a result, improve the system operation. For this purpose, battery energy storage system is charged when production of photovoltaic is more than...... consumers’ demands and discharged when consumers’ demands are increased. Since the price of battery energy storage system is high, economic, environmental, and technical objectives should be considered together for its placement and sizing. In this paper, optimal placement, sizing, and daily (24 h) charge......Proper installation of rooftop photovoltaic generation in distribution networks can improve voltage profile, reduce energy losses, and enhance the reliability. But, on the other hand, some problems regarding harmonic distortion, voltage magnitude, reverse power flow, and energy losses can arise...

Voltage Scheduling Droop Control for State-of-Charge Balance of Distributed Energy Storage in DC Microgrids

DEFF Research Database (Denmark)

Li, Chendan; Dragicevic, Tomislav; Aldana, Nelson Leonardo Diaz

2014-01-01

Due to higher power quality, lower conversion loss, and more DC loads, there has been an increasing awareness on DC microgrid. Previous emphasis has been on equal power sharing among different units in the DC microgrid, while overlooking the coordination of the energy storage units to maintain...... the State-of-Charge balance. In this paper, a new droop method based on voltage scheduling for State-of-Charge balance is proposed to keep the SoC balance for the energy storage units. The proposed method has the advantage of avoiding the stability problem existed in traditional methods based on droop gain...... scheduling. Simulation experiment is taken in Matlab on a DC microgrid with two distributed energy storage units. The simulation results show that the proposed method has successfully achieved SoC balance during the load changes while maintaining the DC bus voltage within the allowable range....

Operating modes of high-Tc composite superconductors and thermal runaway conditions under current charging

International Nuclear Information System (INIS)

Romanovskii, V R; Watanabe, K

2006-01-01

The operating thermal and electric modes of a high-T c superconducting composite in partially and fully penetrated states induced by the charging current are investigated. They were studied under conditions in which the current charging rate, the volume fraction of the superconductor in a composite or the temperature of the cooling bath were changed. The transient behaviour of the voltage-current dependence, which is characteristic during stable and unstable increases in electric field inside the composite under a continuous current charging, is discussed. Simulations were done using zero- and one-dimensional steady and unsteady thermoelectric models with a power equation describing the virgin voltage-current characteristic of a superconductor. It is found that some thermoelectric trends underlie the shape of the voltage-current characteristic of the high-T c superconducting composite. These have to be considered during experiments in which the critical or quench currents are defined. First, in the initial stage of the fully penetrated regime (in the low voltage range), the electric field distribution does not have a uniform character. These states depend on the volume fraction of the superconductor and the current charging rate: the higher these quantities, the higher the heterogeneity of the electric field. Second, during the stable over-critical regime (in the high voltage range) occurring in complete penetration modes, the evolution of the electric field may depend on the relevant temperature increase of a composite according to the corresponding increase in its temperature-dependent heat capacity. Consequently, the shape of the voltage-current characteristic of a composite high-T c superconductor during continuous current charging, both before and after thermal runaway, has only a positive slope. Moreover, it is proved that the growth of the fully penetrated part of the voltage-current characteristic becomes less intensive when the current charging rate or the

Anomalous Threshold Voltage Variability of Nitride Based Charge Storage Nonvolatile Memory Devices

Directory of Open Access Journals (Sweden)

Meng Chuan Lee

2013-01-01

Full Text Available Conventional technology scaling is implemented to meet the insatiable demand of high memory density and low cost per bit of charge storage nonvolatile memory (NVM devices. In this study, effect of technology scaling to anomalous threshold voltage ( variability is investigated thoroughly on postcycled and baked nitride based charge storage NVM devices. After long annealing bake of high temperature, cell’s variability of each subsequent bake increases within stable distribution and found exacerbate by technology scaling. Apparent activation energy of this anomalous variability was derived through Arrhenius plots. Apparent activation energy (Eaa of this anomalous variability is 0.67 eV at sub-40 nm devices which is a reduction of approximately 2 times from 110 nm devices. Technology scaling clearly aggravates this anomalous variability, and this poses reliability challenges to applications that demand strict control, for example, reference cells that govern fundamental program, erase, and verify operations of NVM devices. Based on critical evidence, this anomalous variability is attributed to lateral displacement of trapped charges in nitride storage layer. Reliability implications of this study are elucidated. Moreover, potential mitigation methods are proposed to complement technology scaling to prolong the front-runner role of nitride based charge storage NVM in semiconductor flash memory market.

Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

Science.gov (United States)

Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

2018-04-01

Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

Reward-dependent modulation of movement variability.

Science.gov (United States)

Pekny, Sarah E; Izawa, Jun; Shadmehr, Reza

2015-03-04

Movement variability is often considered an unwanted byproduct of a noisy nervous system. However, variability can signal a form of implicit exploration, indicating that the nervous system is intentionally varying the motor commands in search of actions that yield the greatest success. Here, we investigated the role of the human basal ganglia in controlling reward-dependent motor variability as measured by trial-to-trial changes in performance during a reaching task. We designed an experiment in which the only performance feedback was success or failure and quantified how reach variability was modulated as a function of the probability of reward. In healthy controls, reach variability increased as the probability of reward decreased. Control of variability depended on the history of past rewards, with the largest trial-to-trial changes occurring immediately after an unrewarded trial. In contrast, in participants with Parkinson's disease, a known example of basal ganglia dysfunction, reward was a poor modulator of variability; that is, the patients showed an impaired ability to increase variability in response to decreases in the probability of reward. This was despite the fact that, after rewarded trials, reach variability in the patients was comparable to healthy controls. In summary, we found that movement variability is partially a form of exploration driven by the recent history of rewards. When the function of the human basal ganglia is compromised, the reward-dependent control of movement variability is impaired, particularly affecting the ability to increase variability after unsuccessful outcomes. Copyright © 2015 the authors 0270-6474/15/354015-10$15.00/0.

High voltage pulse generator. [Patent application

Science.gov (United States)

Fasching, G.E.

1975-06-12

An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.

Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

Energy Technology Data Exchange (ETDEWEB)

Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

2011-07-29

Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

High voltage generator circuit with low power and high efficiency applied in EEPROM

International Nuclear Information System (INIS)

Liu Yan; Zhang Shilin; Zhao Yiqiang

2012-01-01

This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

Science.gov (United States)

Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

2012-01-01

The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

Science.gov (United States)

Held, Katharina; Voets, Thomas; Vriens, Joris

2016-01-01

Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

Control and operation of power sources in a medium-voltage direct-current microgrid for an electric vehicle fast charging station with a photovoltaic and a battery energy storage system

International Nuclear Information System (INIS)

García-Triviño, Pablo; Torreglosa, Juan P.; Fernández-Ramírez, Luis M.; Jurado, Francisco

2016-01-01

Although electric vehicles (EVs) are experiencing a considerable upsurge, the technology associated with them is still under development. This study focused on the control and operation of a medium-voltage direct-current (MVDC) microgrid with an innovative decentralized control system, which was used as a fast charging station (FCS) for EVs. The FCS was composed of a photovoltaic (PV) system, a Li-ion battery energy storage system (BESS), two 48 kW fast charging units for EVs, and a connection to the local grid. With this configuration and thanks to its decentralized control, the FCS was able to work as a stand-alone system most of the time though with occasional grid support. This paper presents a new decentralized energy management system (EMS) with two options to control the power sources of the FCS. The choice of the power source depends on the MVDC bus voltage, the state-of-charge (SOC) of the BESS, and the control option of the EMS. This control was tested by simulating the FCS, when connected to several EVs and under different sun irradiance conditions. Simulation results showed that the FCS operated smoothly and effectively, which confirms the feasibility of using this technology in EVs. - Highlights: • This paper studies a MVDC microgrid for fast charging station of EV. • It is composed of a PV system, a BESS, two EV charging stations and a grid connection. • A decentralized control scheme is applied to control the power sources. • The MVDC bus voltage is the key parameter for controlling the system. • The results demonstrate the feasibility of the system and control under study.

Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

OpenAIRE

Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

2000-01-01

We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

Modulation of nitrogen vacancy charge state and fluorescence in nanodiamonds using electrochemical potential.

Science.gov (United States)

Karaveli, Sinan; Gaathon, Ophir; Wolcott, Abraham; Sakakibara, Reyu; Shemesh, Or A; Peterka, Darcy S; Boyden, Edward S; Owen, Jonathan S; Yuste, Rafael; Englund, Dirk

2016-04-12

The negatively charged nitrogen vacancy (NV(-)) center in diamond has attracted strong interest for a wide range of sensing and quantum information processing applications. To this end, recent work has focused on controlling the NV charge state, whose stability strongly depends on its electrostatic environment. Here, we demonstrate that the charge state and fluorescence dynamics of single NV centers in nanodiamonds with different surface terminations can be controlled by an externally applied potential difference in an electrochemical cell. The voltage dependence of the NV charge state can be used to stabilize the NV(-) state for spin-based sensing protocols and provides a method of charge state-dependent fluorescence sensing of electrochemical potentials. We detect clear NV fluorescence modulation for voltage changes down to 100 mV, with a single NV and down to 20 mV with multiple NV centers in a wide-field imaging mode. These results suggest that NV centers in nanodiamonds could enable parallel optical detection of biologically relevant electrochemical potentials.

Modulation of nitrogen vacancy charge state and fluorescence in nanodiamonds using electrochemical potential

Science.gov (United States)

Karaveli, Sinan; Gaathon, Ophir; Wolcott, Abraham; Sakakibara, Reyu; Shemesh, Or A.; Peterka, Darcy S.; Boyden, Edward S.; Owen, Jonathan S.; Yuste, Rafael; Englund, Dirk

2016-04-01

The negatively charged nitrogen vacancy (NV-) center in diamond has attracted strong interest for a wide range of sensing and quantum information processing applications. To this end, recent work has focused on controlling the NV charge state, whose stability strongly depends on its electrostatic environment. Here, we demonstrate that the charge state and fluorescence dynamics of single NV centers in nanodiamonds with different surface terminations can be controlled by an externally applied potential difference in an electrochemical cell. The voltage dependence of the NV charge state can be used to stabilize the NV- state for spin-based sensing protocols and provides a method of charge state-dependent fluorescence sensing of electrochemical potentials. We detect clear NV fluorescence modulation for voltage changes down to 100 mV, with a single NV and down to 20 mV with multiple NV centers in a wide-field imaging mode. These results suggest that NV centers in nanodiamonds could enable parallel optical detection of biologically relevant electrochemical potentials.

Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

International Nuclear Information System (INIS)

Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

2006-01-01

An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

Effect of volume and surface charges on discharge structure of glow dielectric barrier discharge

Energy Technology Data Exchange (ETDEWEB)

Xu, Shao-Wei; He, Feng; Wang, Yu; Li, Lulu; Ouyang, Ji-Ting [School of Physics, Beijing Institute of Technology, Beijing 100081 (China)

2013-08-15

The effect of volume and surface charges on the structure of glow dielectric barrier discharge (DBD) has been investigated numerically by using two-dimensional (2D) fluid modeling. The local increase of volume or surface charges induces a kind of activation-inhibition effect, which enhances the local volume discharge and inhibits the discharge in neighborhoods, resulting in non-uniform discharge. The activation-inhibition effect due to the non-uniform volume and/or surface charges depends on the non-uniformity itself and the applied voltage. The activation-inhibition of non-uniform charges has different effects on the volume charges and the accumulated surface charges. The distribution of remaining free charges (seed electrons) in volume at the beginning of voltage pulse plays a key role for the glow DBD structure, resulting in a patterned DBD, when the seed electrons are non-uniform at higher frequency and moderate voltage or uniform DBD, when the seed electrons are uniform at lower frequency or high voltage. The distribution of surface charges is not the determining factor but a result of the formed DBD structure.

Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

Science.gov (United States)

Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

2003-03-01

The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

International Nuclear Information System (INIS)

Yamacli, Serhan; Avci, Mutlu

2009-01-01

In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

Voltage Support from Electric Vehicles in Distribution Grid

DEFF Research Database (Denmark)

Huang, Shaojun; Pillai, Jayakrishnan Radhakrishna; Bak-Jensen, Birgitte

2013-01-01

The paper evaluates the voltage support functions from electric vehicles (EVs) on a typical Danish distribution grid with high EV penetration. In addition to the popular voltage control modes, such as voltage droop charging (low voltage level leads to low charging power) and reactive power support...

Voltage quantization by ballistic vortices in two-dimensional superconductors

International Nuclear Information System (INIS)

Orlando, T.P.; Delin, K.A.

1991-01-01

The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions

Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

KAUST Repository

Kim, Younggy

2011-01-01

Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

Directory of Open Access Journals (Sweden)

Seok-Yong Lee

2009-03-01

Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

Use of the Charge/Discharge (C/D) ratio to aument voltage limit (V sub T) charge control in the ERBS spacecraft

Science.gov (United States)

Halpert, G.

1982-01-01

A 50-ampere hour nickel cadmium cell test pack was operated in a power profile simulating the orbit of the Earth Radiation Budget Satellite (ERBS). The objective was to determine the ability of the temperature compensated voltage limit (V sub T) charge control system to maintain energy balance in the half sine wave-type current profile expected of this mission. The four-cell pack (50 E) was tested at the Naval Weapons Support Center (NWSC) at Crane, Indiana. The ERBS evaluation test consisted of two distinct operating sequences, each having a specific purpose. The first phase was a parametric test involving the effect of V sub T level, temperature, and Beta angle on the charge/discharge (C/D) ratio, an indicator of the amount of overcharge. The second phase of testing made use of the C/D ratio limit to augment the V sub T charge limit control. When the C/D limit was reached, the current was switched from the taper mode to a C/67 (0.75 A) trickle charge. The use of an ampere hour integrator limiting the overcharge to a C/67 rate provided a fine tuning of the charge control technique which eliminated the sensitivity problems noted in the initial operating sequence.

Voltage-sensing phosphatase modulation by a C2 domain.

Science.gov (United States)

Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

2015-01-01

The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

MOS Capacitance—Voltage Characteristics III. Trapping Capacitance from 2-Charge-State Impurities

International Nuclear Information System (INIS)

Jie Binbin; Sah Chihtang

2011-01-01

Low-frequency and high-frequency capacitance—voltage curves of Metal—Oxide—Semiconductor Capacitors are presented to illustrate giant electron and hole trapping capacitances at many simultaneously present two-charge-state and one-trapped-carrier, or one-energy-level impurity species. Models described include a donor electron trap and an acceptor hole trap, both donors, both acceptors, both shallow energy levels, both deep, one shallow and one deep, and the identical donor and acceptor. Device and material parameters are selected to simulate chemically and physically realizable capacitors for fundamental trapping parameter characterizations and for electrical and optical signal processing applications. (invited papers)

Limitations of threshold voltage engineering of AlGaN/GaN heterostructures by dielectric interface charge density and manipulation by oxygen plasma surface treatments

Science.gov (United States)

Lükens, G.; Yacoub, H.; Kalisch, H.; Vescan, A.

2016-05-01

The interface charge density between the gate dielectric and an AlGaN/GaN heterostructure has a significant impact on the absolute value and stability of the threshold voltage Vth of metal-insulator-semiconductor (MIS) heterostructure field effect transistor. It is shown that a dry-etching step (as typically necessary for normally off devices engineered by gate-recessing) before the Al2O3 gate dielectric deposition introduces a high positive interface charge density. Its origin is most likely donor-type trap states shifting Vth to large negative values, which is detrimental for normally off devices. We investigate the influence of oxygen plasma annealing techniques of the dry-etched AlGaN/GaN surface by capacitance-voltage measurements and demonstrate that the positive interface charge density can be effectively compensated. Furthermore, only a low Vth hysteresis is observable making this approach suitable for threshold voltage engineering. Analysis of the electrostatics in the investigated MIS structures reveals that the maximum Vth shift to positive voltages achievable is fundamentally limited by the onset of accumulation of holes at the dielectric/barrier interface. In the case of the Al2O3/Al0.26Ga0.74N/GaN material system, this maximum threshold voltage shift is limited to 2.3 V.

Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

International Nuclear Information System (INIS)

Barchi, R.L.; Tanaka, J.C.

1984-01-01

In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

Estimation of Transformer Parameters and Loss Analysis for High Voltage Capacitor Charging Application

DEFF Research Database (Denmark)

Thummala, Prasanth; Schneider, Henrik; Ouyang, Ziwei

2013-01-01

In a bi-directional DC-DC converter for capacitive charging application, the losses associated with the transformer makes it a critical component. In order to calculate the transformer losses, its parameters such as AC resistance, leakage inductance and self capacitance of the high voltage (HV......) winding has to be estimated accurately. This paper analyzes the following losses of bi-directional flyback converter namely switching loss, conduction loss, gate drive loss, transformer core loss, and snubber loss, etc. Iterative analysis of transformer parameters viz., AC resistance, leakage inductance...

Time-dependent deformation of polymer network in polymer-stabilized cholesteric liquid crystals (Conference Presentation)

Science.gov (United States)

Lee, Kyung Min; Tondiglia, Vincent P.; Bunning, Timothy J.; White, Timothy J.

2017-02-01

Recently, we reported direct current (DC) field controllable electro-optic (EO) responses of negative dielectric anisotropy polymer stabilized cholesteric liquid crystals (PSCLCs). A potential mechanism is: Ions in the liquid crystal mixtures are trapped in/on the polymer network during the fast photopolymerization process, and the movement of ions by the application of the DC field distorts polymer network toward the negative electrode, inducing pitch variation through the cell thickness, i.e., pitch compression on the negative electrode side and pitch expansion on positive electrode side. As the DC voltage is directly applied to a target voltage, charged polymer network is deformed and the reflection band is tuned. Interestingly, the polymer network deforms further (red shift of reflection band) with time when constantly applied DC voltage, illustrating DC field induced time dependent deformation of polymer network (creep-like behavior). This time dependent reflection band changes in PSCLCs are investigated by varying the several factors, such as type and concentration of photoinitiators, liquid crystal monomer content, and curing condition (UV intensity and curing time). In addition, simple linear viscoelastic spring-dashpot models, such as 2-parameter Kelvin and 3-parameter linear models, are used to investigate the time-dependent viscoelastic behaviors of polymer networks in PSCLC.

Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

Directory of Open Access Journals (Sweden)

Kota Kasahara

Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

Behaviour of total surface charge in SiO2-Si system under short-pulsed ultraviolet irradiation cycles characterised by surface photo voltage technique

International Nuclear Information System (INIS)

Kang, Ban-Hong; Lee, Wah-Pheng; Yow, Ho-Kwang; Tou, Teck-Yong

2009-01-01

Effects of time-accumulated ultraviolet (UV) irradiation and surface treatment on thermally oxidized p-type silicon wafers were investigated by using the surface photo voltage (SPV) technique via the direct measurement of the total surface charge, Q SC . The rise and fall times of Q sc curves, as a function of accumulated UV irradiation, depended on the thermal oxide thickness. A simple model was proposed to explain the time-varying characteristics of Q sc based on the UV-induced bond breaking of SiOH and SiH, and photoemission of bulk electrons to wafer surface where O 2 - charges were formed. While these mechanisms resulted in charge variations and hence in Q sc , these could be removed by rinsing the silicon wafers in de-ionized water followed by spin-dry or blow-dry by an ionizer fan. Empirical parameters were used in the model simulations and curve-fitting of Q SC . The simulated results suggested that initial changes in the characteristic behaviour of Q sc were mainly due to the net changes in the positive and negative charges, but subsequently were dominated by the accumulation of O 2 - during the UV irradiation.

Thickness dependent charge transport in ferroelectric BaTiO3 heterojunctions

Science.gov (United States)

Singh, Pooja; Rout, P. K.; Singh, Manju; Rakshit, R. K.; Dogra, Anjana

2015-09-01

We have investigated the effect of ferroelectric barium titanate (BaTiO3) film thickness on the charge transport mechanism in pulsed laser deposited epitaxial metal-ferroelectric semiconductor junctions. The current (I)-voltage (V) measurements across the junctions comprising of 20-500 nm thick BaTiO3 and conducting bottom electrode (Nb: SrTiO3 substrate or La2/3Ca1/3MnO3 buffer layer) demonstrate the space charge limited conduction. Further analysis indicates a reduction in the ratio of free to trapped carriers with increasing thickness in spite of decreasing trap density. Such behaviour arises the deepening of the shallow trap levels (I-V curves implies a bipolar resistive switching behaviour, which can be explained in terms of charge trapping and de-trapping process.

KCNQ1 channel modulation by KCNE proteins via the voltage-sensing domain.

Science.gov (United States)

Nakajo, Koichi; Kubo, Yoshihiro

2015-06-15

The gating of the KCNQ1 potassium channel is drastically regulated by auxiliary subunit KCNE proteins. KCNE1, for example, slows the activation kinetics of KCNQ1 by two orders of magnitude. Like other voltage-gated ion channels, the opening of KCNQ1 is regulated by the voltage-sensing domain (VSD; S1-S4 segments). Although it has been known that KCNE proteins interact with KCNQ1 via the pore domain, some recent reports suggest that the VSD movement may be altered by KCNE. The altered VSD movement of KCNQ1 by KCNE proteins has been examined by site-directed mutagenesis, the scanning cysteine accessibility method (SCAM), voltage clamp fluorometry (VCF) and gating charge measurements. These accumulated data support the idea that KCNE proteins interact with the VSDs of KCNQ1 and modulate the gating of the KCNQ1 channel. In this review, we will summarize recent findings and current views of the KCNQ1 modulation by KCNE via the VSD. In this context, we discuss our recent findings that KCNE1 may alter physical interactions between the S4 segment (VSD) and the S5 segment (pore domain) of KCNQ1. Based on these findings from ourselves and others, we propose a hypothetical mechanism for how KCNE1 binding alters the VSD movement and the gating of the channel. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

Science.gov (United States)

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

International Nuclear Information System (INIS)

Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

2012-01-01

Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

Condition-dependent movement and dispersal in experimental metacommunities

Czech Academy of Sciences Publication Activity Database

Fronhofer, E. A.; Klečka, Jan; Melián, C. J.; Altermatt, F.

2015-01-01

Roč. 18, č. 9 (2015), s. 954-963 ISSN 1461-023X Grant - others:Sciex fellowship(CZ) 12.327 Institutional support: RVO:60077344 Keywords : allee effect * density-dependent dispersal * density-dependent movement Subject RIV: EH - Ecology, Behaviour Impact factor: 10.772, year: 2015 http://onlinelibrary.wiley.com/doi/10.1111/ele.12475/epdf

Dependence of the carrier mobility and trapped charge limited conduction on silver nanoparticles embedment in doped polypyrrole nanostructures

Science.gov (United States)

Biswas, Swarup; Dutta, Bula; Bhattacharya, Subhratanu

2013-10-01

The present article demonstrates an intensive study upon the temperature dependent current density (J)-voltage (V) characteristics of moderately doped polypyrrole nanostructure and its silver nanoparticles incorporated nanocomposites. Analysis of the measured J-V characteristics of different synthesized nano-structured samples within a wide temperature range revealed that the electrical conduction behavior followed a trapped charge-limited conduction and a transition of charge transport mechanism from deep exponential trap limited conduction to shallow traps limited conduction had been occurred due to the incorporation of silver nanoparticles within the polypyrrole matrix. A direct evaluation of carrier mobility as a function of electric field and temperature from the measured J-V characteristics illustrates that the incorporation of silver nanoparticles within the polypyrrole matrix enhances the carrier mobility at a large extent by reducing the concentration of traps within the polypyrrole matrix. The calculated mobility is consistent with the Poole-Frenkel form for the electrical field up to a certain temperature range. The nonlinear low temperature dependency of mobility of all the nanostructured samples was explained by Mott variable range hopping conduction mechanisms. Quantitative information regarding the charge transport parameters obtained from the above study would help to extend optimization strategies for the fabrication of new organic semiconducting nano-structured devices.

Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

NARCIS (Netherlands)

Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

2002-01-01

Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

Influence of different open circuit voltage tests on state of charge online estimation for lithium-ion batteries

International Nuclear Information System (INIS)

Zheng, Fangdan; Xing, Yinjiao; Jiang, Jiuchun; Sun, Bingxiang; Kim, Jonghoon; Pecht, Michael

2016-01-01

Highlights: • Two common tests for observing battery open circuit voltage performance are compared. • The temperature dependency of the OCV-SOC relationship is investigated. • Two estimators are evaluated in terms of accuracy and robustness for estimating battery SOC. • The incremental OCV test is better to predetermine the OCV-SOCs for SOC online estimation. - Abstract: Battery state of charge (SOC) estimation is a crucial function of battery management systems (BMSs), since accurate estimated SOC is critical to ensure the safety and reliability of electric vehicles. A widely used technique for SOC estimation is based on online inference of battery open circuit voltage (OCV). Low-current OCV and incremental OCV tests are two common methods to observe the OCV-SOC relationship, which is an important element of the SOC estimation technique. In this paper, two OCV tests are run at three different temperatures and based on which, two SOC estimators are compared and evaluated in terms of tracking accuracy, convergence time, and robustness for online estimating battery SOC. The temperature dependency of the OCV-SOC relationship is investigated and its influence on SOC estimation results is discussed. In addition, four dynamic tests are presented, one for estimator parameter identification and the other three for estimator performance evaluation. The comparison results show that estimator 2 (based on the incremental OCV test) has higher tracking accuracy and is more robust against varied loading conditions and different initial values of SOC than estimator 1 (based on the low-current OCV test) with regard to ambient temperature. Therefore, the incremental OCV test is recommended for predetermining the OCV-SOCs for battery SOC online estimation in BMSs.

Hyperpolarization moves S4 sensors inward to open MVP, a methanococcal voltage-gated potassium channel.

Science.gov (United States)

Sesti, Federico; Rajan, Sindhu; Gonzalez-Colaso, Rosana; Nikolaeva, Natalia; Goldstein, Steve A N

2003-04-01

MVP, a Methanococcus jannaschii voltage-gated potassium channel, was cloned and shown to operate in eukaryotic and prokaryotic cells. Like pacemaker channels, MVP opens on hyperpolarization using S4 voltage sensors like those in classical channels activated by depolarization. The MVP S4 span resembles classical sensors in sequence, charge, topology and movement, traveling inward on hyperpolarization and outward on depolarization (via canaliculi in the protein that bring the extracellular and internal solutions into proximity across a short barrier). Thus, MVP opens with sensors inward indicating a reversal of S4 position and pore state compared to classical channels. Homologous channels in mammals and plants are expected to function similarly.

Energy distribution extraction of negative charges responsible for positive bias temperature instability

International Nuclear Information System (INIS)

Ren Shang-Qing; Yang Hong; Wang Wen-Wu; Tang Bo; Tang Zhao-Yun; Wang Xiao-Lei; Xu Hao; Luo Wei-Chun; Zhao Chao; Yan Jiang; Chen Da-Peng; Ye Tian-Chun

2015-01-01

A new method is proposed to extract the energy distribution of negative charges, which results from electron trapping by traps in the gate stack of nMOSFET during positive bias temperature instability (PBTI) stress based on the recovery measurement. In our case, the extracted energy distribution of negative charges shows an obvious dependence on energy, and the energy level of the largest energy density of negative charges is 0.01 eV above the conduction band of silicon. The charge energy distribution below that energy level shows strong dependence on the stress voltage. (paper)

Study of the degradation of the breakdown voltage of a super-junction power MOSFET due to charge imbalance

International Nuclear Information System (INIS)

Kondekar, Pravin N.; Oh, Hwan-Sool; Kim, Young-Beom

2006-01-01

In this research, we analytically designed a super-junction (SJ) structure and used a simulation tool to study its off-state charge imbalance behavior. In the case of a SJ MOSFET (CoolMOS TM ), designed for the lowest specific on- resistance R on , the MOS part of the transistor (channel region) affected the symmetry, creating a charge imbalance; in addition to this, the imbalance in the SJ drift layer, which was inherently due to limitations in the fabrication process was simulated by varying the doping density of the pillars up to 10 %. The underlying physical mechanisms responsible for the reduction of the breakdown voltage (BV) were investigated in detail by using the electric field profiles and potential contours. The effect of varying the junction depth of a p-body/well and the cell pitch on the breakdown voltage was also analyzed. The trade off between BV sensitivity and specific R on was also investigated.

Charge Transport in Spiro-OMeTAD Investigated through Space-Charge-Limited Current Measurements

Science.gov (United States)

Röhr, Jason A.; Shi, Xingyuan; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny

2018-04-01

Extracting charge-carrier mobilities for organic semiconductors from space-charge-limited conduction measurements is complicated in practice by nonideal factors such as trapping in defects and injection barriers. Here, we show that by allowing the bandlike charge-carrier mobility, trap characteristics, injection barrier heights, and the shunt resistance to vary in a multiple-trapping drift-diffusion model, a numerical fit can be obtained to the entire current density-voltage curve from experimental space-charge-limited current measurements on both symmetric and asymmetric 2 ,2',7 ,7' -tetrakis(N ,N -di-4-methoxyphenylamine)-9 ,9' -spirobifluorene (spiro-OMeTAD) single-carrier devices. This approach yields a bandlike mobility that is more than an order of magnitude higher than the effective mobility obtained using analytical approximations, such as the Mott-Gurney law and the moving-electrode equation. It is also shown that where these analytical approximations require a temperature-dependent effective mobility to achieve fits, the numerical model can yield a temperature-, electric-field-, and charge-carrier-density-independent mobility. Finally, we present an analytical model describing trap-limited current flow through a semiconductor in a symmetric single-carrier device. We compare the obtained charge-carrier mobility and trap characteristics from this analytical model to the results from the numerical model, showing excellent agreement. This work shows the importance of accounting for traps and injection barriers explicitly when analyzing current density-voltage curves from space-charge-limited current measurements.

Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films.

Science.gov (United States)

Röhr, Jason A; Moia, Davide; Haque, Saif A; Kirchartz, Thomas; Nelson, Jenny

2018-03-14

Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films

Science.gov (United States)

Röhr, Jason A.; Moia, Davide; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny

2018-03-01

Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

Quasiparticle conductance-voltage characteristics for break junctions involving d-wave superconductors: charge-density-wave effects.

Science.gov (United States)

Ekino, T; Gabovich, A M; Suan Li, Mai; Szymczak, H; Voitenko, A I

2017-12-20

Quasiparticle tunnel conductance-voltage characteristics (CVCs), [Formula: see text], were calculated for break junctions (BJs) made up of layered d-wave superconductors partially gapped by charge-density waves (CDWs). The current is assumed to flow in the ab-plane of electrodes. The influence of CDWs is analyzed by comparing the resulting CVCs with CVCs calculated for BJs made up of pure d-wave superconductors with relevant parameters. The main CDW-effects were found to be the appearance of new CVC peculiarities and the loss of CVC symmetry with respect to the V-sign. Tunnel directionality was shown to be one of the key factors in the formation of [Formula: see text] dependences. In particular, the orientation of electrodes with respect to the current channel becomes very important. As a result, [Formula: see text] can acquire a large variety of forms similar to those for tunnel junctions between superconductors with s-wave, d-wave, and mixed symmetry of their order parameters. The diversity of peculiarities is especially striking at finite temperatures. In the case of BJs made up of pure d-wave superconductors, the resulting CVC can include a two-peak gap-driven structure. The results were compared with the experimental BJ data for a number of high-T c oxides. It was shown that the large variety of the observed current-voltage characteristics can be interpreted in the framework of our approach. Thus, quasiparticle tunnel currents in the ab-plane can be used as an additional mean to detect CDWs competing with superconductivity in cuprates or other layered superconductors.

Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

Energy Technology Data Exchange (ETDEWEB)

Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

2014-03-31

This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

Directory of Open Access Journals (Sweden)

RAMÓN LATORRE

2006-01-01

Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

A 190 mV start-up and 59.2% efficiency CMOS gate boosting voltage doubler charge pump in 0.18 µm standard CMOS process for energy harvesting

Science.gov (United States)

Yoshida, Minori; Miyaji, Kousuke

2018-04-01

A start-up charge pump circuit for an extremely low input voltage (V IN) is proposed and demonstrated. The proposed circuit uses an inverter level shifter to generate a 2V IN voltage swing to the gate of both main NMOS and PMOS power transistors in a charge pump to reduce the channel resistance. The proposed circuit is fully implemented in a standard 0.18 µm CMOS process, and the measurement result shows that a minimum input voltage of 190 mV is achieved and output power increases by 181% compared with the conventional forward-body-bias scheme at a 300 mV input voltage. The proposed scheme achieves a maximum efficiency of 59.2% when the input voltage is 390 mV and the output current is 320 nA. The proposed circuit is suitable as a start-up circuit in ultralow power energy harvesting power management applications to boost-up from below threshold voltage.

A new technique for the study of charge transfer in multiply charged ion-ion collisions

International Nuclear Information System (INIS)

Shinpaugh, J.L.; Meyer, F.W.; Datz, S.

1994-01-01

While large cross sections (>10 -16 cm 2 ) have been predicted for resonant charge transfer in ion-ion collisions, no experimental data exist for multiply charged systems. A novel technique is being developed at the ORNL ECR facility to allow study of symmetric charge exchange in multiply charged ion-ion collisions using a single ion source. Specific intra-beam charge transfer collisions occurring in a well-defined interaction region labeled by negative high voltage are identified and analyzed by electrostatic analysis in combination with ion time-of-flight coincidence detection of the collision products. Center-of-mass collision energies from 400 to 1000 eV are obtained by varying source and labeling-cell voltages. In addition, by the introduction of a target gas into the high-voltage cell, this labeling-voltage method allows measurement of electron-capture and -loss cross sections for ion-atom collisions. Consequently, higher collision energies can be investigated without the requirement of placing the ECR source on a high-voltage platform

Voltage-sensing phosphatase modulation by a C2 domain

Directory of Open Access Journals (Sweden)

Paul M. Castle

2015-04-01

Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

Josephson tunneling current in the presence of a time-dependent voltage

International Nuclear Information System (INIS)

Harris, R.E.

1975-01-01

The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

International Nuclear Information System (INIS)

Hahlbohm, H.D.; Luebbig, H.; Luther, H.

1975-01-01

Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

Branching in current-voltage characteristics of intrinsic Josephson junctions

International Nuclear Information System (INIS)

Shukrinov, Yu M; Mahfouzi, F

2007-01-01

We study branching in the current-voltage characteristics of the intrinsic Josephson junctions of high-temperature superconductors in the framework of the capacitively coupled Josephson junction model with diffusion current. A system of dynamical equations for the gauge-invariant phase differences between superconducting layers for a stack of ten intrinsic junctions has been numerically solved. We have obtained a total branch structure in the current-voltage characteristics. We demonstrate the existence of a 'breakpoint region' on the current-voltage characteristics and explain it as a result of resonance between Josephson and plasma oscillations. The effect of the boundary conditions is investigated. The existence of two outermost branches and correspondingly two breakpoint regions for the periodic boundary conditions is shown. One branch, which is observed only at periodic boundary conditions, corresponds to the propagating of the plasma mode. The second one corresponds to the situation when the charge oscillations on the superconducting layers are absent, excluding the breakpoint. A time dependence of the charge oscillations at breakpoints is presented

Interface charge trapping induced flatband voltage shift during plasma-enhanced atomic layer deposition in through silicon via

Science.gov (United States)

Li, Yunlong; Suhard, Samuel; Van Huylenbroeck, Stefaan; Meersschaut, Johan; Van Besien, Els; Stucchi, Michele; Croes, Kristof; Beyer, Gerald; Beyne, Eric

2017-12-01

A Through Silicon Via (TSV) is a key component for 3D integrated circuit stacking technology, and the diameter of a TSV keeps scaling down to reduce the footprint in silicon. The TSV aspect ratio, defined as the TSV depth/diameter, tends to increase consequently. Starting from the aspect ratio of 10, to improve the TSV sidewall coverage and reduce the process thermal budget, the TSV dielectric liner deposition process has evolved from sub-atmospheric chemical vapour deposition to plasma-enhanced atomic layer deposition (PE-ALD). However, with this change, a strong negative shift in the flatband voltage is observed in the capacitance-voltage characteristic of the vertical metal-oxide-semiconductor (MOS) parasitic capacitor formed between the TSV copper metal and the p-Si substrate. And, no shift is present in planar MOS capacitors manufactured with the same PE-ALD oxide. By comparing the integration process of these two MOS capacitor structures, and by using Elastic Recoil Detection to study the elemental composition of our films, it is found that the origin of the negative flatband voltage shift is the positive charge trapping at the Si/SiO2 interface, due to the positive PE-ALD reactants confined to the narrow cavity of high aspect ratio TSVs. This interface charge trapping effect can be effectively mitigated by high temperature annealing. However, this is limited in the real process due to the high thermal budget. Further investigation on liner oxide process optimization is needed.

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

Science.gov (United States)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.

Science.gov (United States)

Dharia, Sameera; Rabbitt, Richard D

2010-01-01

Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.

Benchmarking of 3D space charge codes using direct phase space measurements from photoemission high voltage dc gun

Directory of Open Access Journals (Sweden)

Ivan V. Bazarov

2008-10-01

Full Text Available We present a comparison between space charge calculations and direct measurements of the transverse phase space of space charge dominated electron bunches from a high voltage dc photoemission gun followed by an emittance compensation solenoid magnet. The measurements were performed using a double-slit emittance measurement system over a range of bunch charge and solenoid current values. The data are compared with detailed simulations using the 3D space charge codes GPT and Parmela3D. The initial particle distributions were generated from measured transverse and temporal laser beam profiles at the photocathode. The beam brightness as a function of beam fraction is calculated for the measured phase space maps and found to approach within a factor of 2 the theoretical maximum set by the thermal energy and the accelerating field at the photocathode.

Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.

Science.gov (United States)

Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J

2012-06-06

Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Regulation of KV channel voltage-dependent activation by transmembrane β subunits

Directory of Open Access Journals (Sweden)

Xiaohui eSun

2012-04-01

Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

Energy Technology Data Exchange (ETDEWEB)

Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

2016-11-01

In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

Charge transport properties of CdMnTe radiation detectors

Directory of Open Access Journals (Sweden)

Prokopovich D. A.

2012-10-01

Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings

Science.gov (United States)

Desrosiers, M. F.; Bandurski, R. S.

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

Charge transport properties of CdMnTe radiation detectors

Energy Technology Data Exchange (ETDEWEB)

Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

2012-04-11

Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

Development and Application of a Wireless Sensor for Space Charge Density Measurement in an Ultra-High-Voltage, Direct-Current Environment.

Science.gov (United States)

Xin, Encheng; Ju, Yong; Yuan, Haiwen

2016-10-20

A space charge density wireless measurement system based on the idea of distributed measurement is proposed for collecting and monitoring the space charge density in an ultra-high-voltage direct-current (UHVDC) environment. The proposed system architecture is composed of a number of wireless nodes connected with space charge density sensors and a base station. The space charge density sensor based on atmospheric ion counter method is elaborated and developed, and the ARM microprocessor and Zigbee radio frequency module are applied. The wireless network communication quality and the relationship between energy consumption and transmission distance in the complicated electromagnetic environment is tested. Based on the experimental results, the proposed measurement system demonstrates that it can adapt to the complex electromagnetic environment under the UHVDC transmission lines and can accurately measure the space charge density.

Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

Science.gov (United States)

Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

2017-08-01

This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

Science.gov (United States)

Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

2012-02-14

Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

Localization of pellicle-induced open contacts using Charge-Induced Voltage Alteration

Energy Technology Data Exchange (ETDEWEB)

Cole, E.I. Jr.; Soden, J.M.

1993-08-01

The recently developed Charge-Induced Voltage Alteration (CIVA) technique for localizing open metal conductors was used successfully to identify transistors with electrically open metal-1 contacts to silicon. The transistors were in the I/O port circuitry of a failing microcontroller and were completely covered by a metal-2 power bus. The root cause of the open contacts was a subtle scratch in the pellicle over the contact reticle. The scratch prevented full exposure of the photoresist, resulting in incomplete removal of the interlevel oxide in several contact windows. In addition to this powerful new application of CIVA, a number of failure analysis techniques utilizing both the electrical and physical properties of the failing microcontrollers were employed to identify and confirm the open contacts. These techniques are reviewed and recommendations are given for improved pellicle/reticle inspection.

Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

Science.gov (United States)

Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

2010-01-01

In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

Layer-dependent surface potential of phosphorene and anisotropic/layer-dependent charge transfer in phosphorene-gold hybrid systems.

Science.gov (United States)

Xu, Renjing; Yang, Jiong; Zhu, Yi; Yan, Han; Pei, Jiajie; Myint, Ye Win; Zhang, Shuang; Lu, Yuerui

2016-01-07

The surface potential and the efficiency of interfacial charge transfer are extremely important for designing future semiconductor devices based on the emerging two-dimensional (2D) phosphorene. Here, we directly measured the strong layer-dependent surface potential of mono- and few-layered phosphorene on gold, which is consistent with the reported theoretical prediction. At the same time, we used an optical way photoluminescence (PL) spectroscopy to probe charge transfer in the phosphorene-gold hybrid system. We firstly observed highly anisotropic and layer-dependent PL quenching in the phosphorene-gold hybrid system, which is attributed to the highly anisotropic/layer-dependent interfacial charge transfer.

KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

DEFF Research Database (Denmark)

Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

2002-01-01

The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

Directory of Open Access Journals (Sweden)

Mohamad Khairul Anuar

2017-01-01

Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

Influence of the polarity of the applied voltage on the reignition of a discharge below a dielectric layer in air at atmospheric pressure

International Nuclear Information System (INIS)

Pechereau, François; Bourdon, Anne

2014-01-01

The dynamics of an atmospheric pressure air discharge in a point-to-plane geometry with a dielectric layer obstacle on the discharge path is investigated numerically for different applied voltages. Whatever the polarity of the voltage applied, first, a streamer discharge of the same polarity ignites at the point and propagates towards the dielectric layer. After the impact on the dielectric surface, the streamer discharge spreads along the upper dielectric surface and charges it positively or negatively depending on its polarity. On the bottom surface of the dielectric layer, charges with an opposite polarity are deposited. Surface charges on both faces of the dielectric layer are shown to have a significant influence on the discharge reignition for a negative applied voltage, but not for a positive one. Furthermore, it is shown that the dynamics of the discharge reignition below the dielectric layer depends on the polarity of the applied voltage at the point electrode. For a positive applied voltage, the reignited discharge is a positive ionization wave propagating towards the grounded plane. For a negative applied voltage, a double headed discharge is observed with positive and negative fronts propagating in opposite directions. Finally, the minimal value of the ionization integral to have a discharge reignition below the dielectric obstacle is found to be less for a negative applied voltage than for a positive one. (paper)

The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

Science.gov (United States)

Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

2013-03-01

The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

Excitation contraction uncoupling by high intracellular [Ca2+] in frog skeletal muscle: a voltage clamp study.

Science.gov (United States)

Olivera, J Fernando; Pizarro, Gonzalo

2016-10-01

Raising the intracellular [Ca 2+ ] ([Ca 2+ ] i ) was previously found to produce uncoupling between the electrical depolarization of the transverse tubules and contraction in skinned muscle fibers. Here we study the effect of elevated [Ca 2+ ] i in voltage clamped cut fibers of frog skeletal muscle to establish how the charge movement, a measure of the activation of the dihydropyridine receptors (DHPR)-voltage sensors, and Ca 2+ release, a consequence of the opening of the ryanodine receptor (RyR)-release channels, were affected. [Ca 2+ ] i was raised by various procedures (pharmacological release from the sarcoplasmic reticulum, application of high [Ca 2+ ] i intracellular solution, permeabilization of the plasma membrane by a Ca 2+ ionophore) all of which produced impairment of excitation-contraction coupling. The charge movement was reduced from 20.2 ± 1.24 to 9.9 ± 0.94 nC/μF meanwhile the Ca 2+ release flux was reduced from 13.5 + 0.7 to 2.2 ± 0.3 μM/ms (n = 33). This suggests that a significant fraction of the DHPRs that remained functional, could not activate RyRs, and were therefore presumably disconnected. These results are broadly consistent with the original reports in skinned fibers. Uncoupling was prevented by the addition to the intracellular solution of the protease inhibitor leupeptin. In approximately 40 % of the uncoupled cells we observed that the [Ca 2+ ] i transient continued to rise after the voltage clamp pulse was turned off. This loss of control by membrane voltage suggests that the uncoupled release channels might have another mechanism of activation, likely by Ca 2+ .

Cloning and functional expression of a plant voltage-dependent chloride channel.

Science.gov (United States)

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

Space charge inhibition effect of nano-Fe{sub 3}O{sub 4} on improvement of impulse breakdown voltage of transformer oil based on improved Kerr optic measurements

Energy Technology Data Exchange (ETDEWEB)

Yang, Qing, E-mail: yangqing@cqu.edu.cn; Yu, Fei; Sima, Wenxia [State Key Laboratory of Power Transmission Equipment & System Security and New Technology, Chongqing University, Shapingba District, Chongqing, 400044 (China); Zahn, Markus [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)

2015-09-15

Transformer oil-based nanofluids (NFs) with 0.03 g/L Fe{sub 3}O{sub 4} nanoparticle content exhibit 11.2% higher positive impulse breakdown voltage levels than pure transformer oils. To study the effects of the Fe{sub 3}O{sub 4} nanoparticles on the space charge in transformer oil and to explain why the nano-modified transformer oil exhibits improved impulse breakdown voltage characteristics, the traditional Kerr electro-optic field mapping technique is improved by increasing the length of the parallel-plate electrodes and by using a photodetector array as a high light sensitivity device. The space charge distributions of pure transformer oil and of NFs containing Fe{sub 3}O{sub 4} nanoparticles can be measured using the improved Kerr electro-optic field mapping technique. Test results indicate a significant reduction in space charge density in the transformer oil-based NFs with the Fe{sub 3}O{sub 4} nanoparticles. The fast electrons are captured by the nanoparticles and are converted into slow-charged particles in the NFs, which then reduce the space charge density and result in a more uniform electric field distribution. Streamer propagation in the NFs is also obstructed, and the breakdown strengths of the NFs under impulse voltage conditions are also improved.

Charge dependence and charge asymmetry in the nucleon-nucleon interaction due to processes involving Δ's

International Nuclear Information System (INIS)

Wells, T.B.

1978-01-01

The charge dependence and charge asymmetry of the nucleon-nucleon force arising from the exchange of a pion and a photon with the excitation of a nucleon resonance [Δ(1236)] is calculated. This charge dependence and asymmetry is studied through its effects on the 1 S nucleon-nucleon scattering lengths. The complexity of the calculation forces the use of approximations. The calculation is performed first with a pole approximation for the resonance and a second time with a Chew-Low description of the resonance. Both calculations neglect nuclear recoil. Estimates of this effect are made. The changes in the scattering lengths are small ( +- / 2 = 1.0225 G/sub π 0 / 2 will explain the proton-neutron scattering length

The recombination correction and the dependence of the response of plane parallel chambers on the polarizing voltage in pulsed electron and photon beams

International Nuclear Information System (INIS)

Roos, M.; Derikum, K.

2000-01-01

Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)

Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

DEFF Research Database (Denmark)

Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

2001-01-01

The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

Battery Charge Equalizer with Transformer Array

Science.gov (United States)

Davies, Francis

2013-01-01

High-power batteries generally consist of a series connection of many cells or cell banks. In order to maintain high performance over battery life, it is desirable to keep the state of charge of all the cell banks equal. A method provides individual charging for battery cells in a large, high-voltage battery array with a minimum number of transformers while maintaining reasonable efficiency. This is designed to augment a simple highcurrent charger that supplies the main charge energy. The innovation will form part of a larger battery charge system. It consists of a transformer array connected to the battery array through rectification and filtering circuits. The transformer array is connected to a drive circuit and a timing and control circuit that allow individual battery cells or cell banks to be charged. The timing circuit and control circuit connect to a charge controller that uses battery instrumentation to determine which battery bank to charge. It is important to note that the innovation can charge an individual cell bank at the same time that the main battery charger is charging the high-voltage battery. The fact that the battery cell banks are at a non-zero voltage, and that they are all at similar voltages, can be used to allow charging of individual cell banks. A set of transformers can be connected with secondary windings in series to make weighted sums of the voltages on the primaries.

Free-energy relationships in ion channels activated by voltage and ligand

Science.gov (United States)

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

Science.gov (United States)

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP

DEFF Research Database (Denmark)

Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

2010-01-01

A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane...... as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy....... Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing...

Context-dependence of Aimed Arm Movements: A Transitory or A Stable Phenomenon?

Directory of Open Access Journals (Sweden)

Benjamin Baak

2014-10-01

Full Text Available Previous work documented that grasping movements in a typical laboratory context differ widely from those in a more natural context. We evaluate whether this context-dependence changes with experience. Data from 48 subjects (24 female; 24.9 ± 2.7 years of age were (reanalyzed. They had participated in experimental blocks with externally triggered, purposeless and repetitive movements (context L, laboratory-like, and a block with self-initiated, ecologically valid movements embedded in a complex task (context E, everyday-like. Mechanical constraints on grasping were identical in both blocks. A global metric, representing context-dependence across multiple kinematic parameters, did not change appreciably across the 20 trials of a block. Furthermore, the metric was not affected by prior participation in the other block. We conclude that context-dependence of grasping is robust, i.e., it shows little influence of prior experience. This opens the avenue for within-subject designs on context-dependence, e.g., for clinical investigations. Keywords: Motor control, Prehension, Context-dependence, Serial order, Attunement

Analysis of charge-dependent azimuthal correlations with HADES

Energy Technology Data Exchange (ETDEWEB)

Kornas, Frederic [TU Darmstadt (Germany); Selyuzhenkov, Ilya [GSI (Germany); Galatyuk, Tetyana [TU Darmstadt (Germany); GSI (Germany); Collaboration: HADES-Collaboration

2016-07-01

Charge-dependent azimuthal correlations relative to the reaction plane have been proposed as a probe in the search for the chiral magnetic effect in relativistic heavy-ion collisions. These type of correlations have been measured at the RHIC BES by STAR and at the LHC by ALICE. This contribution discusses two charged particle correlations with respect to the reaction plane measured with high statistic sample of Au+Au collisions at 1.23 AGeV collected by HADES. The Forward wall detector allows to reconstruct the reaction plane using the spectator fragments. The status of the analysis with protons and charged pions will be presented.

Simulation of forward dark current voltage characteristics of tandem solar cells

International Nuclear Information System (INIS)

Rubinelli, F.A.

2012-01-01

The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

Charging system and method for multicell storage batteries

Science.gov (United States)

Cox, Jay A.

1978-01-01

A battery-charging system includes a first charging circuit connected in series with a plurality of battery cells for controlled current charging. A second charging circuit applies a controlled voltage across each individual cell for equalization of the cells to the fully charged condition. This controlled voltage is determined at a level above the fully charged open-circuit voltage but at a sufficiently low level to prevent corrosion of cell components by electrochemical reaction. In this second circuit for cell equalization, a transformer primary receives closely regulated, square-wave voltage which is coupled to a plurality of equal secondary coil windings. Each secondary winding is connected in parallel to each cell of a series-connected pair of cells through half-wave rectifiers and a shared, intermediate conductor.

On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

Energy Technology Data Exchange (ETDEWEB)

Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

2007-04-30

The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

Ultra Low-Voltage Energy Harvesting

Science.gov (United States)

2013-09-01

if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

OpenAIRE

Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

2013-01-01

In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

Science.gov (United States)

Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

2004-10-01

We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

Single-Step Electrophoretic Deposition of Non-noble Metal Catalyst Layer with Low Onset Voltage for Ethanol Electro-oxidation.

Science.gov (United States)

Ahmadi Daryakenari, Ahmad; Hosseini, Davood; Ho, Ya-Lun; Saito, Takumi; Apostoluk, Aleksandra; Müller, Christoph R; Delaunay, Jean-Jacques

2016-06-29

A single-step electrophoretic deposition (EPD) process is used to fabricate catalyst layers which consist of nickel oxide nanoparticles attached on the surface of nanographitic flakes. Magnesium ions present in the colloid charge positively the flake's surface as they attach on it and are also used to bind nanographitic flakes together. The fabricated catalyst layers showed a very low onset voltage (-0.2 V vs Ag/AgCl) in the electro-oxidation of ethanol. To clarify the occurring catalytic mechanism, we performed annealing treatment to produce samples having a different electrochemical behavior with a large onset voltage. Temperature dependence measurements of the layer conductivity pointed toward a charge transport mechanism based on hopping for the nonannealed layers, while the drift transport is observed in the annealed layers. The hopping charge transport is responsible for the appearance of the low onset voltage in ethanol electro-oxidation.

Generation of charge imbalance in a superconductor by a temperature gradient

International Nuclear Information System (INIS)

Entin-Wohlman, O.; Orbach, R.

1980-01-01

The charge-imbalance voltage in a superconductor carrying a current in the presence of a temperature gradient is calculated from the Boltzmann equation in the clean limit. We demonstrate why the Green's-function approach in the dirty limit, first performed by Schmid and Schoem, generates the same Boltzmann-like equation for the distribution function. In addition, the charge-imbalance voltage in the absence of an impressed current is calculated. It is shown to depend on del 2 T+(delT) 2 /T, and not solely on (delT) 2 . The calculations are limited to the temperature regime near T/sub c/, such that Δ<< T

Charging equipment for several batteries. Ladegeraet fuer mehrere Akkumulatoren

Energy Technology Data Exchange (ETDEWEB)

Unruh, H

1980-11-27

The charging equipment for several batteries according to the invention, each of which is connected in series with a transistor controlling the charging current and where the battery voltage is divided by a voltage divider and taken to a controller, which controls the series transistor, is characterised by the fact that all the batteries are connected to a circuit to form the mean value of the battery voltages, which consists of a resistance star circuit, whose star point is connected to the voltage divider and whose end points are connected to the batteries, and that all the series transistors are connected to a common controller, which is controlled by the pick-off voltage of the voltage divider. In the charging equipment of the invention, the series transistors of all batteries are controlled synchronously by a single controller. If the batteries are in different states of charge, then the charging currents will be distributed differently according to their inside resistances, so that the battery with the lowest state of charge will receive the highest charging current.

The topogenic function of S4 promotes membrane insertion of the voltage-sensor domain in the KvAP channel.

Science.gov (United States)

Mishima, Eriko; Sato, Yoko; Nanatani, Kei; Hoshi, Naomi; Lee, Jong-Kook; Schiller, Nina; von Heijne, Gunnar; Sakaguchi, Masao; Uozumi, Nobuyuki

2016-12-01

Voltage-dependent K + (K V ) channels control K + permeability in response to shifts in the membrane potential. Voltage sensing in K V channels is mediated by the positively charged transmembrane domain S4. The best-characterized K V channel, KvAP, lacks the distinct hydrophilic region corresponding to the S3-S4 extracellular loop that is found in other K + channels. In the present study, we evaluated the topogenic properties of the transmembrane regions within the voltage-sensing domain in KvAP. S3 had low membrane insertion activity, whereas S4 possessed a unique type-I signal anchor (SA-I) function, which enabled it to insert into the membrane by itself. S4 was also found to function as a stop-transfer signal for retention in the membrane. The length and structural nature of the extracellular S3-S4 loop affected the membrane insertion of S3 and S4, suggesting that S3 membrane insertion was dependent on S4. Replacement of charged residues within the transmembrane regions with residues of opposite charge revealed that Asp 72 in S2 and Glu 93 in S3 contributed to membrane insertion of S3 and S4, and increased the stability of S4 in the membrane. These results indicate that the SA-I function of S4, unique among K + channels studied to date, promotes the insertion of S3 into the membrane, and that the charged residues essential for voltage sensing contribute to the membrane-insertion of the voltage sensor domain in KvAP. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Charge-transfer properties in the gas electron multiplier

International Nuclear Information System (INIS)

Han, Sanghyo; Kim, Yongkyun; Cho, Hyosung

2004-01-01

The charge transfer properties of a gas electron multiplier (GEM) were systematically investigated over a broad range of electric field configurations. The electron collection efficiency and the charge sharing were found to depend on the external fields, as well as on the GEM voltage. The electron collection efficiency increased with the collection field up to 90%, but was essentially independent of the drift field strength. A double conical GEM has a 10% gain increase with time due to surface charging by avalanche ions whereas this effect was eliminated with the cylindrical GEM. The positive-ion feedback is also estimated. (author)

Charge states of fast heavy ions in solids; target atomic number dependence

International Nuclear Information System (INIS)

Shima, Kunihiro

1985-01-01

Discussions were carried out on the origin of Z 2 (atomic number) dependent charge states with respect to projectile electron loss and capture process, and on relationship between the Z 2 dependence and that of mean charge states for heavy ions of 1 MeV/u energy region. Present and previously reported results were examined on the equilibrium charge distributions, 9-bar, of 120 MeV 63 Cu, 25 and 40 MeV 35 Cl, 109 MeV Si and 59 MeV F ions. It was clarified that 9-bar became generally higher for lower Z 2 depending on increasing energy, and osillatory behavior with energy-depending amplitude was seen in 9-bar vs Z 2 . Discussions were carrid out on these phenomena and related matters. Z 2 oscillations of 9-bar of fast heavy ions might be due to those of electron capture cross section into projectile K and L vacancies for high and intermediate charge states, respectively. A quantitative interpretation of the Z 2 -dependent 9-bar values is in progress based on collision process and observation of projectile x-ray. The 9-bar value dependency on Z 2 in ion passing foils and decrease of Z 2 oscillation amplitude with increasing collision energy were quite similar to the Z 2 dependence in stopping powers or in effective charge states estimated from stopping powers. But there was some discrepancies in the Z 2 oscillation of 9-bar and that of stopping powers. (Takagi, S.)

Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions.

Science.gov (United States)

Kang, Bok Eum; Baker, Bradley J

2016-04-04

An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response.

Justifying threshold voltage definition for undoped body transistors through 'crossover point' concept

International Nuclear Information System (INIS)

Baruah, Ratul Kumar; Mahapatra, Santanu

2009-01-01

Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.

Alternator control for battery charging

Energy Technology Data Exchange (ETDEWEB)

Brunstetter, Craig A.; Jaye, John R.; Tallarek, Glen E.; Adams, Joseph B.

2015-07-14

In accordance with an aspect of the present disclosure, an electrical system for an automotive vehicle has an electrical generating machine and a battery. A set point voltage, which sets an output voltage of the electrical generating machine, is set by an electronic control unit (ECU). The ECU selects one of a plurality of control modes for controlling the alternator based on an operating state of the vehicle as determined from vehicle operating parameters. The ECU selects a range for the set point voltage based on the selected control mode and then sets the set point voltage within the range based on feedback parameters for that control mode. In an aspect, the control modes include a trickle charge mode and battery charge current is the feedback parameter and the ECU controls the set point voltage within the range to maintain a predetermined battery charge current.

Discrimination of Li-ion batteries based on Hamming network using discharging-charging voltage pattern recognition for improved state-of-charge estimation

Energy Technology Data Exchange (ETDEWEB)

Kim, Jonghoon; Lee, Seongjun; Cho, B.H. [Power Electronics System Laboratory, School of Electrical Engineering and Computer Science, Seoul National University, Seoul 151-744 (Korea, Republic of)

2011-02-15

Differences in electrochemical characteristics among Li-ion batteries and factors such as temperature and ageing result in erroneous state-of-charge (SoC) estimation when using the existing extended Kalman filter (EKF) algorithm. This study presents an application of the Hamming neural network to the identification of suitable battery model parameters for improved SoC estimation. The discharging-charging voltage (DCV) patterns of ten fresh Li-ion batteries are measured, together with the battery parameters, as representative patterns. Through statistical analysis, the Hamming network is applied for identification of the representative DCV pattern that matches most closely of the pattern of the arbitrary battery to be measured. Model parameters of the representative battery are then applied to estimate the SoC of the arbitrary battery using the EKF. This avoids the need for repeated parameter measurement. Using model parameters selected by the proposed method, all SoC estimates (off-line and on-line) based on the EKF are within {+-}5% of the values estimated by ampere-hour counting. (author)

Analysis of the effect of interface state charges on threshold voltage and transconductance of 6H-SiC N-channel MOSFET

International Nuclear Information System (INIS)

Tang Xiaoyan; Zhang Yimen; Zhang Yuming

2002-01-01

The effect of interface state charges on the threshold voltage and transconductance of 6H-SiC N-channel metal-oxide semiconductor field-effect transistor (MOSFET) is analyzed based on the non-uniformly distributed interface state density in the band gap and incomplete impurity ionization in silicon carbide. The results show that the nonuniform distribution of interface state density cause not only the increment of the threshold voltage but also the degradation of the transconductance of MOSFET so that it is one of the important factors to influence the characteristics of SiC MOSFET

A Charge Controller Design For Solar Power System

OpenAIRE

Nandar Oo; Kyaw Soe Lwin; Hla Myo Tun

2015-01-01

This paper presents the solar charge controller circuit for controlling the overcharging and discharging from solar panel. This circuit regulates the charging of the battery in a solar system by monitoring battery voltage and switching the solar or other power source off when the battery reaches a preset voltage. This circuit is low voltages disconnect circuit. A charge controller circuit can increase battery life by preventing over-charging which can cause loss of electrolyte. The flow chart...

Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility

OpenAIRE

STORK, Milan

2014-01-01

Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...

A thermoelectric voltage effect in polyethylene oxide

CERN Document Server

Martin, B; Kliem, H

2003-01-01

The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

Science.gov (United States)

Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

2018-02-21

Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

Diagram representations of charge pumping processes in CMOS transistors

International Nuclear Information System (INIS)

Huang Xinyun; Jiao Guangfan; Cao Wei; Huang Darning; Li Mingfu; Shen Chen

2010-01-01

A diagram representation method is proposed to interpret the complicated charge pumping (CP) processes. The fast and slow traps in CP measurement are defined. Some phenomena such as CP pulse rise/fall time dependence, frequency dependence, the voltage dependence for the fast and slow traps, and the geometric CP component are clearly illustrated at a glance by the diagram representation. For the slow trap CP measurement, there is a transition stage and a steady stage due to the asymmetry of the electron and hole capture, and the CP current is determined by the lower capturing electron or hole component. The method is used to discuss the legitimacy of the newly developed modified charge pumping method. (semiconductor devices)

Properties of a radiation-induced charge multiplication region in epitaxial silicon diodes

CERN Document Server

Lange, Jörn; Fretwurst, Eckhart; Klanner, Robert; Lindström, Gunnar

2010-01-01

Charge multiplication (CM) in p$^+$n epitaxial silicon pad diodes of 75, 100 and 150 $\\upmu$m thickness at high voltages after proton irradiation with 1 MeV neutron equivalent fluences in the order of $10^{16}$ cm$^{-2}$ was studied as an option to overcome the strong trapping of charge carriers in the innermost tracking region of future Super-LHC detectors. Charge collection efficiency (CCE) measurements using the Transient Current Technique (TCT) with radiation of different penetration (670, 830, 1060 nm laser light and $\\alpha$-particles with optional absorbers) were used to locate the CM region close to the p$^+$-implantation. The dependence of CM on material, thickness of the epitaxial layer, annealing and temperature was studied. The collected charge in the CM regime was found to be proportional to the deposited charge, uniform over the diode area and stable over a period of several days. Randomly occurring micro discharges at high voltages turned out to be the largest challenge for operation of the dio...

Memory effects in MIS structures based on silicon and polymethylmethacrylate with nanoparticle charge-storage elements

Energy Technology Data Exchange (ETDEWEB)

Mabrook, M.F. [School of Engineering and Centre for Molecular and Nanoscale Electronics, Durham University, South Road, Durham DH1 3LE (United Kingdom)], E-mail: m.f.mabrook@durham.ac.uk; Jombert, A.S. [School of Engineering and Centre for Molecular and Nanoscale Electronics, Durham University, South Road, Durham DH1 3LE (United Kingdom); Department of Chemistry, Durham University, South Road, Durham DH1 3LE (United Kingdom); Machin, S.E.; Pearson, C.; Kolb, D. [School of Engineering and Centre for Molecular and Nanoscale Electronics, Durham University, South Road, Durham DH1 3LE (United Kingdom); Coleman, K.S. [Department of Chemistry, Durham University, South Road, Durham DH1 3LE (United Kingdom); Zeze, D.A.; Petty, M.C. [School of Engineering and Centre for Molecular and Nanoscale Electronics, Durham University, South Road, Durham DH1 3LE (United Kingdom)

2009-03-15

We report on the electrical behaviour of metal-insulator-semiconductor (MIS) structures fabricated on p-type silicon substrates and using polymethylmethacrylate (PMMA) as the dielectric. Gold nanoparticles, single-wall carbon nanotubes and C{sub 60}, deposited at room temperature, were used as charge-storage elements. In all cases, the MIS devices containing the nanoparticles exhibited hysteresis in their capacitance versus voltage characteristics, with a memory window depending on the range of the voltage sweep. This hysteresis was attributed to the charging and discharging of the nanoparticles from the gate electrode. A relatively large memory window of about 2.2 V was achieved by scanning the applied voltage of an Al/PMMA/C{sub 60}/SiO{sub 2}/Si structure between 4 and -4 V. Gold nanoparticle-based memory devices produced the best charge retention behaviour compared to the other MIS structures investigated.

Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

DEFF Research Database (Denmark)

Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

2001-01-01

The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

A Charge Controller Design For Solar Power System

Directory of Open Access Journals (Sweden)

Nandar Oo

2015-08-01

Full Text Available This paper presents the solar charge controller circuit for controlling the overcharging and discharging from solar panel. This circuit regulates the charging of the battery in a solar system by monitoring battery voltage and switching the solar or other power source off when the battery reaches a preset voltage. This circuit is low voltages disconnect circuit. A charge controller circuit can increase battery life by preventing over-charging which can cause loss of electrolyte. The flow chart is also provided.

X-ray irradiation effects of interface traps and trapped-oxide charge at the Si-SiO{sub 2} interface of segmented silicon sensors

Energy Technology Data Exchange (ETDEWEB)

Kopsalis, Ioannis; Fretwurst, Eckhart; Garutti, Erika; Klanner, Robert; Schwandt, Joern [Institute for Experimental Physics, Hamburg University, Luruper Chaussee 149, D-22761 Hamburg (Germany)

2016-07-01

The surface radiation damage of SiO{sub 2} grown on high-ohmic Si, as used for the fabrication of segmented silicon sensors, has been investigated. Circular p- and n-MOSFETs, biased in accumulation and inversion at a field in the SiO{sub 2} of about 500 kV/cm, have been irradiated by X-rays up to a dose of about 17 kGy(SiO{sub 2}) in different irradiation steps. Before and after each irradiation, the gate voltage has been cycled from inversion to accumulation conditions and back, and from the dependence of the drain-source current, on gate voltage, the threshold voltage of the MOSFET and the hole and electron mobility at the Si-SiO{sub 2} interface determined. From the threshold voltage, the effective oxide-charge density is calculated. Using the subthreshold-current technique the contribution of interface traps, in the lower and the upper part of the energy Si bandgap, and of fixed oxide-charge to the effective oxide-charge density has been estimated. Results on the dose dependence of the above quantities, the charging-up and discharging of border traps when changing the gate voltage, and the hole and electron mobilities at the Si-SiO{sub 2} interface are presented.

Combining Market-Based Control with Distribution Grid Constraints when Coordinating Electric Vehicle Charging

Directory of Open Access Journals (Sweden)

Geert Deconinck

2015-12-01

Full Text Available The charging of electric vehicles (EVs impacts the distribution grid, and its cost depends on the price of electricity when charging. An aggregator that is responsible for a large fleet of EVs can use a market-based control algorithm to coordinate the charging of these vehicles, in order to minimize the costs. In such an optimization, the operational parameters of the distribution grid, to which the EVs are connected, are not considered. This can lead to violations of the technical constraints of the grid (e.g., under-voltage, phase unbalances; for example, because many vehicles start charging simultaneously when the price is low. An optimization that simultaneously takes the economic and technical aspects into account is complex, because it has to combine time-driven control at the market level with event-driven control at the operational level. Different case studies investigate under which circumstances the market-based control, which coordinates EV charging, conflicts with the operational constraints of the distribution grid. Especially in weak grids, phase unbalance and voltage issues arise with a high share of EVs. A low-level voltage droop controller at the charging point of the EV can be used to avoid many grid constraint violations, by reducing the charge power if the local voltage is too low. While this action implies a deviation from the cost-optimal operating point, it is shown that this has a very limited impact on the business case of an aggregator, and is able to comply with the technical distribution grid constraints, even in weak distribution grids with many EVs.

Nanoparticle electrostatic loss within corona needle charger during particle-charging process

International Nuclear Information System (INIS)

Huang Chenghsiung; Alonso, Manuel

2011-01-01

A numerical investigation has been carried out to examine the electrostatic loss of nanoparticles in a corona needle charger. Two-dimensional flow field, electric field, particle charge, and particle trajectory were simulated to obtain the electrostatic deposition loss at different conditions. Simulation of particle trajectories shows that the number of charges per particle during the charging process depends on the particle diameter, radial position from the symmetry axis, applied voltage, Reynolds number, and axial distance along the charger. The numerical results of nanoparticle electrostatic loss agreed fairly well with available experimental data. The results reveal that the electrostatic loss of nanoparticles increases with increasing applied voltage and electrical mobility of particles; and with decreasing particle diameter and Reynolds number. A regression equation closely fitted the obtained numerical results for different conditions. The equation is useful for directly calculating the electrostatic loss of nanoparticles in the corona needle charger during particle-charging process.

Time dependent charging of layer clouds in the global electric circuit

Science.gov (United States)

Zhou, Limin; Tinsley, Brian A.

2012-09-01

There is much observational data consistent with the hypothesis that the ionosphere-earth current density (Jz) in the global electric circuit, which is modulated by both solar activity and thunderstorm activity, affects atmospheric dynamics and cloud cover. One candidate mechanism involves Jz causing the accumulation of space charge on droplets and aerosol particles, that affects the rate of scavenging of the latter, notably those of Cloud Condensation Nuclei (CCN) and Ice Forming Nuclei (IFN) (Tinsley, 2008, 2010). Space charge is the difference, per unit volume, between total positive and total negative electrical charge that is on droplets, aerosol particles (including the CCN and IFN) and air ions. The cumulative effects of the scavenging in stratiform clouds and aerosol layers in an air mass over the lifetime of the aerosol particles of 1-10 days affects the concentration and size distribution of the CCN, so that in subsequent episodes of cloud formation (including deep convective clouds) there can be effects on droplet size distribution, coagulation, precipitation processes, and even storm dynamics.Because the time scales for charging for some clouds can be long compared to cloud lifetimes, the amount of charge at a given time, and its effect on scavenging, depend more on the charging rate than on the equilibrium charge that would eventually be attained. To evaluate this, a new time-dependent charging model has been developed. The results show that for typical altostratus clouds with typical droplet radii 10 μm and aerosol particles of radius of 0.04 μm, the time constant for charging in response to a change in Jz is about 800 s, which is comparable to cloud formation and dissipation timescales for some cloud situations. The charging timescale is found to be strong functions of altitude and aerosol concentration, with the time constant for droplet charging at 2 km in air with a high concentration of aerosols being about an hour, and for clouds at 10 km in

Diffuse-charge effects on the transient response of electrochemical cells

NARCIS (Netherlands)

Soestbergen, M.; Biesheuvel, P.M.; Bazant, M.Z.

2010-01-01

We present theoretical models for the time-dependent voltage of an electrochemical cell in response to a current step, including effects of diffuse charge (or “space charge”) near the electrodes on Faradaic reaction kinetics. The full model is based on the classical Poisson-Nernst-Planck equations

A Bidirectional Multi-Port DC-DC Converter Integrating Voltage Equalizer

DEFF Research Database (Denmark)

Chen, Jianfei; Hou, Shiying; Deng, Fujin

2015-01-01

A novel bidirectional multi-port dc-dc converter integrating voltage equalizer based on switched-capacitor voltage accumulator (SCVA) is proposed. It has two operating modes of charging and discharging for battery modules. All battery modules are connected in series indirectly and can be equalize...... battery modules with different voltages. Simulation results has shown the feasibility of the proposed converter.......A novel bidirectional multi-port dc-dc converter integrating voltage equalizer based on switched-capacitor voltage accumulator (SCVA) is proposed. It has two operating modes of charging and discharging for battery modules. All battery modules are connected in series indirectly and can be equalized...

Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

International Nuclear Information System (INIS)

Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

2009-01-01

Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

Contributions of counter-charge in a potassium channel voltage-sensor domain

DEFF Research Database (Denmark)

Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P

2011-01-01

Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

Effect of trap states and microstructure on charge carrier conduction mechanism through semicrystalline poly(vinyl alcohol) granular film

Science.gov (United States)

Das, A. K.; Bhowmik, R. N.; Meikap, A. K.

2018-05-01

We report a comprehensive study on hysteresis behaviour of current-voltage characteristic and impedance spectroscopy of granular semicrystalline poly(vinyl alcohol) (PVA) film. The charge carrier conduction mechanism and charge traps of granular PVA film by measuring and analyzing the temperature dependent current-voltage characteristic indicate a bi-stable electronic state in the film. A sharp transformation of charge carrier conduction mechanism from Poole-Frenkel emission to space charge limited current mechanism has been observed. An anomalous oscillatory behaviour of current has been observed due to electric pulse effect on the molecular chain of the polymer. Effect of microstructure on charge transport mechanism has been investigated from impedance spectroscopy analysis. An equivalent circuit model has been proposed to explain the result.

DEPTH-CHARGE static and time-dependent perturbation/sensitivity system for nuclear reactor core analysis. Revision I. [DEPTH-CHARGE code

Energy Technology Data Exchange (ETDEWEB)

White, J.R.

1985-04-01

This report provides the background theory, user input, and sample problems required for the efficient application of the DEPTH-CHARGE system - a code black for both static and time-dependent perturbation theory and data sensitivity analyses. The DEPTH-CHARGE system is of modular construction and has been implemented within the VENTURE-BURNER computational system at Oak Ridge National Laboratory. The DEPTH module (coupled with VENTURE) solves for the three adjoint functions of Depletion Perturbation Theory and calculates the desired time-dependent derivatives of the response with respect to the nuclide concentrations and nuclear data utilized in the reference model. The CHARGE code is a collection of utility routines for general data manipulation and input preparation and considerably extends the usefulness of the system through the automatic generation of adjoint sources, estimated perturbed responses, and relative data sensitivity coefficients. Combined, the DEPTH-CHARGE system provides, for the first time, a complete generalized first-order perturbation/sensitivity theory capability for both static and time-dependent analyses of realistic multidimensional reactor models. This current documentation incorporates minor revisions to the original DEPTH-CHARGE documentation (ORNL/CSD-78) to reflect some new capabilities within the individual codes.

High Voltage Homemade Capacitor Charger for Plasma Focus System

International Nuclear Information System (INIS)

Abdul Halim Baijan; Azaman Ahmad; Rokiah Mohd Sabri; Siti Aiasah Hashim; Mohd Rizal Md Chulan; Wah, L.K.; Azhar Ahmad; Rosli Che Ros; Mohd Faiz Mohd Zin

2015-01-01

A high voltage capacitor charger has been designed and built to replace a high voltage charger type General Atomics CCDs Power Supply which was damaged. The fabrication design was using materials which were easily available in the local market. Among the main components of the high-voltage charger is a transformer for neon lights, variable transformer rated 0 - 240 V 1 KVA, and 240 V transformer isolator. The results of experiments that have been conducted shows that a homemade capacitor charger was able to charge high voltage capacitors up to the required voltage of which was 12 kV. However the time taken for charging is quite long, up to more than 6 minutes. (author)

High speed auto-charging system for condenser bank

International Nuclear Information System (INIS)

Mizuno, Yasunori; Bito, Fumio; Fujita, Kazuhiko; Sometani, Taro

1987-01-01

A current-control type high-speed charging system, which is intended for auto-charging of the condenser bank, is developed. Moreover, the system can also serve to compensate the current leakage from the condenser bank so that the charged voltage can be kept constant. The system consists of a sequence circuit, a charging current control circuit (or auto-charging circuit) and a charging circuit. The auto-charging circuit is characterized by the use of a triac to control the current. The current, controlled by the circuit, is supplied to the condenser bank through a step-up transformer and voltage doubler rectifier circuit. It is demonstrated that the use of the high-speed auto-charging circuit can largely decrease the required charging time, compared to constant voltage charging. In addition, the compensation function is shown to serve effectively for maintaining a constant voltage after the completion of charging. The required charging time is decreases as the charging current increases. The maximum charging current is decided by the rating of the traic and the current rating of the rectifier diode in the secondary circuit. Major components of these circuits have decreased impedances to minimize the effect of noise, so that the possibility of an accident can be eliminated. Other various improvements are made in the grounding circuit and the charging protection circuit in order to ensure safety. (Nogami, K.)

Nonlinear charge transport in bipolar semiconductors due to electron heating

International Nuclear Information System (INIS)

Molina-Valdovinos, S.; Gurevich, Yu.G.

2016-01-01

It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

Nonlinear charge transport in bipolar semiconductors due to electron heating

Energy Technology Data Exchange (ETDEWEB)

Molina-Valdovinos, S., E-mail: sergiom@fisica.uaz.edu.mx [Universidad Autónoma de Zacatecas, Unidad Académica de Física, Calzada Solidaridad esq. Paseo, La Bufa s/n, CP 98060, Zacatecas, Zac, México (Mexico); Gurevich, Yu.G. [Centro de Investigación y de Estudios Avanzados del IPN, Departamento de Física, Av. IPN 2508, México D.F., CP 07360, México (Mexico)

2016-05-27

It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

Directory of Open Access Journals (Sweden)

Wei Xia

2015-01-01

Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

Controllability of the Coulomb charging energy in close-packed nanoparticle arrays.

Science.gov (United States)

Duan, Chao; Wang, Ying; Sun, Jinling; Guan, Changrong; Grunder, Sergio; Mayor, Marcel; Peng, Lianmao; Liao, Jianhui

2013-11-07

We studied the electronic transport properties of metal nanoparticle arrays, particularly focused on the Coulomb charging energy. By comparison, we confirmed that it is more reasonable to estimate the Coulomb charging energy using the activation energy from the temperature-dependent zero-voltage conductance. Based on this, we systematically and comprehensively investigated the parameters that could be used to tune the Coulomb charging energy in nanoparticle arrays. We found that four parameters, including the particle core size, the inter-particle distance, the nearest neighboring number, and the dielectric constant of ligand molecules, could significantly tune the Coulomb charging energy.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Directory of Open Access Journals (Sweden)

R. N. Bhowmik

2015-06-01

Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Science.gov (United States)

Bhowmik, R. N.; Vijayasri, G.

2015-06-01

We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

A cascaded three-phase symmetrical multistage voltage multiplier

International Nuclear Information System (INIS)

Iqbal, Shahid; Singh, G K; Besar, R; Muhammad, G

2006-01-01

A cascaded three-phase symmetrical multistage Cockcroft-Walton voltage multiplier (CW-VM) is proposed in this report. It consists of three single-phase symmetrical voltage multipliers, which are connected in series at their smoothing columns like string of batteries and are driven by three-phase ac power source. The smoothing column of each voltage multiplier is charged twice every cycle independently by respective oscillating columns and discharged in series through load. The charging discharging process completes six times a cycle and therefore the output voltage ripple's frequency is of sixth order of the drive signal frequency. Thus the proposed approach eliminates the first five harmonic components of load generated voltage ripples and sixth harmonic is the major ripple component. The proposed cascaded three-phase symmetrical voltage multiplier has less than half the voltage ripple, and three times larger output voltage and output power than the conventional single-phase symmetrical CW-VM. Experimental and simulation results of the laboratory prototype are given to show the feasibility of proposed cascaded three-phase symmetrical CW-VM

Context-dependent adaptation of visually-guided arm movements and vestibular eye movements: role of the cerebellum

Science.gov (United States)

Lewis, Richard F.

2003-01-01

Accurate motor control requires adaptive processes that correct for gradual and rapid perturbations in the properties of the controlled object. The ability to quickly switch between different movement synergies using sensory cues, referred to as context-dependent adaptation, is a subject of considerable interest at present. The potential function of the cerebellum in context-dependent adaptation remains uncertain, but the data reviewed below suggest that it may play a fundamental role in this process.

NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

Science.gov (United States)

Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

2018-01-01

Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Charge-dependent azimuthal correlations in pPb collisions with CMS experiment

Science.gov (United States)

Tu, Zhoudunming; CMS Collaboration

2017-11-01

Charge-dependent azimuthal correlations relative to the event plane in AA collisions have been suggested as providing evidence for the chiral magnetic effect (CME) caused by local strong parity violation. However, the observation of the CME remains inconclusive because of several possible sources of background correlations that may account for part or all of the observed signals. This talk will present the first application of three-particle, charge-dependent azimuthal correlation analysis in proton-nucleus collisions, using pPb data collected with the CMS experiment at the LHC at √{sNN} = 5.02 TeV. The differences found in comparing same and opposite sign correlations are studied as a function of event multiplicity and the pseudorapidity gap between two of the particles detected in the CMS tracker detector. After selecting events with comparable charge-particle multiplicities, the results for pPb collisions are found to be similar to those for PbPb collisions collected at the same collision energy. With a reduced magnetic field strength and a random field orientation in high multiplicity pPb events, the CME contribution to any charge separation signal is expected to be much smaller than found in peripheral PbPb events. These results pose a challenge for the interpretation of charge-dependent azimuthal correlations in heavy ion collisions in terms of the chiral magnetic effect.

Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

Science.gov (United States)

Vaccaro, S. R.

2011-09-01

The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

Microparticles in high-voltage accelerator tubes

International Nuclear Information System (INIS)

Griffith, G.L.; Eastham, D.A.

1979-01-01

Microparticles with radii greater than 2 μm have been observed in a high voltage vacuum accelerator tube. The charge acquired by most of the particles is similar to the contact charging of a conducting sphere on a plane. (author)

Dosimeter charging apparatus

International Nuclear Information System (INIS)

Reuter, F.A.; Moorman, Ch.J.

1985-01-01

An apparatus for charging a dosimeter which has a capacitor connected between first and second electrodes and a movable electrode in a chamber electrically connected to the first electrode. The movable electrode deflects varying amounts depending upon the charge present on said capacitor. The charger apparatus includes first and second charger electrodes couplable to the first and second dosimeter electrodes. To charge the dosimeter, it is urged downwardly into a charging socket on the charger apparatus. The second dosimeter electrode, which is the dosimeter housing, is electrically coupled to the second charger electrode through a conductive ring which is urged upwardly by a spring. As the dosimeter is urged into the socket, the ring moves downwardly, in contact with the second charger electrode. As the dosimeter is further urged downwardly, the first dosimeter electrode and first charger electrode contact one another, and an insulator post carrying the first and second charger electrodes is urged downwardly. Downward movement of the post effects the application of a charging potential between the first and second charger electrodes. After the charging potential has been applied, the dosimeter is moved further into the charging socket against the force of a relatively heavy biasing spring until the dosimeter reaches a mechanical stop in the charging socket

The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

Science.gov (United States)

Campbell, I. H.; Davids, P. S.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.

1998-04-01

We present device model calculations of the current-voltage (I-V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I-V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I-V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited.

A Temperature Dependent Lumped-charge Model for Trench FS-IGBT

DEFF Research Database (Denmark)

Duan, Yaoqiang; Kang, Yong; Iannuzzo, Francesco

2018-01-01

Abstract: This paper proposes a temperature dependent lumped-charge model for FS-IGBT. Due to the evolution of the IGBT structure, the existing lumped-charge IGBT model established for NPT-IGBT is not suitable for the simulation of FS-IGBT. This paper extends the lumped-charge IGBT model including...... the field-stop (FS) structure and temperature characteristics. The temperature characteristics of the model are considered for both the bipolar part and unipolar part. In addition, a new PN junction model which can distinguish the collector structure is presented and validated by TCAD simulation. Finally...

Phenomenological charge-dependent forces in nuclei

International Nuclear Information System (INIS)

Kasymbalinov, R.N.; Sapershtein, E.E.

1984-01-01

The Nolen-Schiffer anomaly and the double Coulomb differences, i.e., mass differences of mirror nuclei differing by two nucleons, are considered together. It is shown that in the calculation of these differences one must take into account a renormalization of the Coulomb amplitude because of the polarization of the core and also include the ''tail effect,'' i.e., the difference of the single-particle wave functions of the protons and neutrons. These two effects have been ignored in earlier work on this subject. It has turned out that the latter effect is particularly important, and its sign depends on the character of the density dependence of the amplitude GAMMA/sup xi/ responsible for pairing. The phenomenological non-Coulomb charge-dependent forces, the introduction of which permits elimination of the Nolen--Schiffer anomaly, make it possible to reproduce also the double Coulomb differences only if one assumes that the amplitude GAMMA/sup xi/ corresponds to the surface pairing

The behaviour of the charging system of the Vivitron for the first voltage tests

International Nuclear Information System (INIS)

Helleboid, J.M.

1992-06-01

The charging system used for the initial commissioning of the Vivitron generator is a simplified temporary version of the final one. As the belt runs in a largely open structure performances could be possibly limited compared with the final design. The observed behaviour for the first high voltage tests was quite satisfying apart from the excessive parasitic currents at the rollers. That led us to study and test many solutions up to the point that a humidity level much higher than thought was discovered as the most probable cause of the problem. The further tests brought the confirmation as the parasitic currents at the supporting rollers not exceeded tens of microA under dry conditions as it had first been expected from the experimental design studies

The electric strength of high-voltage transformers insulation at effect of partial dischargers

International Nuclear Information System (INIS)

Khoshravan, E.; Zeraatparvar, A.; Gashimov, A.M.; Mehdizadeh, R.N.

2001-01-01

Full text : In paper the change of electric strength of high-voltage transformers insulation at the effect of partial discharges with space charge accumulation was investigated. It is revealed that the effect of partial discharges of insulation materials results the reduction of their pulsing electric strength which can restore the own initial value at releasing of saved charge the volume of a material under condition of absence the ineversible structural changes in it. Researches of high-voltage transformers insulation's non-failure operation conditions show, that at increasing of insulation work time in a strong electrical field the reduction of average breakdown voltages with simultaneous increasing of spread in discharge voltage values takes place. It authentically testifies to reduction of short-time discharge voltage of insulation materials during their electrical aging. As the basic reason of insulation electrical aging the partial discharges occurring in gas cavities inside insulation were considered. It is known that the space charges will be formed in insulation elements of high-voltage devices which effects in dielectrical property of these elements including the electric strength and the space charge formation can occur also at partial discharges in an alternating voltage while the service of high-voltage transformers. In the given work the experiments in revealing separate influence partial discharges in pulsing electric strength of insulation materials at presence and at absence inside them the space charge were spent

Coupling between the voltage-sensing and phosphatase domains of Ci-VSP.

Science.gov (United States)

Villalba-Galea, Carlos A; Miceli, Francesco; Taglialatela, Maurizio; Bezanilla, Francisco

2009-07-01

The Ciona intestinalis voltage sensor-containing phosphatase (Ci-VSP) shares high homology with the phosphatidylinositol phosphatase enzyme known as PTEN (phosphatase and tensin homologue deleted on chromosome 10). We have taken advantage of the similarity between these proteins to inquire about the coupling between the voltage sensing and the phosphatase domains in Ci-VSP. Recently, it was shown that four basic residues (R11, K13, R14, and R15) in PTEN are critical for its binding onto the membrane, required for its catalytic activity. Ci-VSP has three of the basic residues of PTEN. Here, we show that when R253 and R254 (which are the homologues of R14 and R15 in PTEN) are mutated to alanines in Ci-VSP, phosphatase activity is disrupted, as revealed by a lack of effect on the ionic currents of KCNQ2/3, where current decrease is a measure of phosphatase activity. The enzymatic activity was not rescued by the introduction of lysines, indicating that the binding is an arginine-specific interaction between the phosphatase binding domain and the membrane, presumably through the phosphate groups of the phospholipids. We also found that the kinetics and steady-state voltage dependence of the S4 segment movement are affected when the arginines are not present, indicating that the interaction of R253 and R254 with the membrane, required for the catalytic action of the phosphatase, restricts the movement of the voltage sensor.

Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

Science.gov (United States)

Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

2011-05-06

Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

Electric generation and ratcheted transport of contact-charged drops

Science.gov (United States)

Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.

2017-10-01

We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

Functional interactions at the interface between voltage-sensing and pore domains in the Shaker K(v) channel.

Science.gov (United States)

Soler-Llavina, Gilberto J; Chang, Tsg-Hui; Swartz, Kenton J

2006-11-22

Voltage-activated potassium (K(v)) channels contain a central pore domain that is partially surrounded by four voltage-sensing domains. Recent X-ray structures suggest that the two domains lack extensive protein-protein contacts within presumed transmembrane regions, but whether this is the case for functional channels embedded in lipid membranes remains to be tested. We investigated domain interactions in the Shaker K(v) channel by systematically mutating the pore domain and assessing tolerance by examining channel maturation, S4 gating charge movement, and channel opening. When mapped onto the X-ray structure of the K(v)1.2 channel the large number of permissive mutations support the notion of relatively independent domains, consistent with crystallographic studies. Inspection of the maps also identifies portions of the interface where residues are sensitive to mutation, an external cluster where mutations hinder voltage sensor activation, and an internal cluster where domain interactions between S4 and S5 helices from adjacent subunits appear crucial for the concerted opening transition.

Online model-based estimation of state-of-charge and open-circuit voltage of lithium-ion batteries in electric vehicles

International Nuclear Information System (INIS)

He, Hongwen; Zhang, Xiaowei; Xiong, Rui; Xu, Yongli; Guo, Hongqiang

2012-01-01

This paper presents a method to estimate the state-of-charge (SOC) of a lithium-ion battery, based on an online identification of its open-circuit voltage (OCV), according to the battery’s intrinsic relationship between the SOC and the OCV for application in electric vehicles. Firstly an equivalent circuit model with n RC networks is employed modeling the polarization characteristic and the dynamic behavior of the lithium-ion battery, the corresponding equations are built to describe its electric behavior and a recursive function is deduced for the online identification of the OCV, which is implemented by a recursive least squares (RLS) algorithm with an optimal forgetting factor. The models with different RC networks are evaluated based on the terminal voltage comparisons between the model-based simulation and the experiment. Then the OCV-SOC lookup table is built based on the experimental data performed by a linear interpolation of the battery voltages at the same SOC during two consecutive discharge and charge cycles. Finally a verifying experiment is carried out based on nine Urban Dynamometer Driving Schedules. It indicates that the proposed method can ensure an acceptable accuracy of SOC estimation for online application with a maximum error being less than 5.0%. -- Highlights: ► An equivalent circuit model with n RC networks is built for lithium-ion batteries. ► A recursive function is deduced for the online estimation of the model parameters like OCV and R O . ► The relationship between SOC and OCV is built with a linear interpolation method by experiments. ► The experiments show the online model-based SOC estimation is reasonable with enough accuracy.

A charge-dependent mechanism is responsible for the dynamic accumulation of proteins inside nucleoli.

Science.gov (United States)

Musinova, Yana R; Kananykhina, Eugenia Y; Potashnikova, Daria M; Lisitsyna, Olga M; Sheval, Eugene V

2015-01-01

The majority of known nucleolar proteins are freely exchanged between the nucleolus and the surrounding nucleoplasm. One way proteins are retained in the nucleoli is by the presence of specific amino acid sequences, namely nucleolar localization signals (NoLSs). The mechanism by which NoLSs retain proteins inside the nucleoli is still unclear. Here, we present data showing that the charge-dependent (electrostatic) interactions of NoLSs with nucleolar components lead to nucleolar accumulation as follows: (i) known NoLSs are enriched in positively charged amino acids, but the NoLS structure is highly heterogeneous, and it is not possible to identify a consensus sequence for this type of signal; (ii) in two analyzed proteins (NF-κB-inducing kinase and HIV-1 Tat), the NoLS corresponds to a region that is enriched for positively charged amino acid residues; substituting charged amino acids with non-charged ones reduced the nucleolar accumulation in proportion to the charge reduction, and nucleolar accumulation efficiency was strongly correlated with the predicted charge of the tested sequences; and (iii) sequences containing only lysine or arginine residues (which were referred to as imitative NoLSs, or iNoLSs) are accumulated in the nucleoli in a charge-dependent manner. The results of experiments with iNoLSs suggested that charge-dependent accumulation inside the nucleoli was dependent on interactions with nucleolar RNAs. The results of this work are consistent with the hypothesis that nucleolar protein accumulation by NoLSs can be determined by the electrostatic interaction of positively charged regions with nucleolar RNAs rather than by any sequence-specific mechanism. Copyright © 2014 Elsevier B.V. All rights reserved.

Extraction of sub-gap density of states via capacitance-voltage measurement for the erasing process in a TFT charge-trapping memory

Science.gov (United States)

Chiang, Yen-Chang; Hsiao, Yang-Hsuan; Li, Jeng-Ting; Chen, Jen-Sue

2018-02-01

Charge-trapping memories (CTMs) based on zinc tin oxide (ZTO) semiconductor thin-film transistors (TFTs) can be programmed by a positive gate voltage and erased by a negative gate voltage in conjunction with light illumination. To understand the mechanism involved, the sub-gap density of states associated with ionized oxygen vacancies in the ZTO active layer is extracted from optical response capacitance-voltage (C-V) measurements. The corresponding energy states of ionized oxygen vacancies are observed below the conduction band minimum at approximately 0.5-1.0 eV. From a comparison of the fitted oxygen vacancy concentration in the CTM-TFT after the light-bias erasing operation, it is found that the pristine-erased device contains more oxygen vacancies than the program-erased device because the trapped electrons in the programmed device are pulled into the active layer and neutralized by the oxygen vacancies that are present there.

Cell voltage versus electrode potential range in aqueous supercapacitors

Science.gov (United States)

Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

2015-01-01

Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

Summary of transient high-voltage calculations for the FRX-C experiment

International Nuclear Information System (INIS)

Kewish, R.W. Jr.; Rej, D.J.

1982-06-01

Calculations of the electrical circuit equations are performed over a wide range of parameters corresponding to the FRX-C field-reversed THETA-pinch experiment at Los Alamos. Without any plasma or external damping, serious voltage doubling and quadrupling of the main capacitor bank charge voltage are observed. These oscillating high voltages are found to be adequately suppressed by the strategic placement of external snubber circuitry. On the other hand, no doubling of the THETA-pinch preionization bank charge voltage is found. Calculations of the equations for the z-pinch preionization circuit are also performed

Charge collection efficiency of irradiated silicon detector operated at cryogenic temperatures

International Nuclear Information System (INIS)

Borer, K.; Janos, S.; Palmieri, V.G.; Dezillie, B.; Li, Z.; Collins, P.; Niinikoski, T.O.; Lourenco, C.; Sonderegger, P.; Borchi, E.; Bruzzi, M.; Pirollo, S.; Granata, V.; Pagano, S.; Chapuy, S.; Dimcovski, Z.; Grigoriev, E.; Bell, W.; Devine, S.R.H.; O'Shea, V.; Smith, K.; Berglund, P.; Boer, W. de; Hauler, F.; Heising, S.; Jungermann, L.; Casagrande, L.; Cindro, V.; Mikuz, M.; Zavartanik, M.; Via, C. da; Esposito, A.; Konorov, I.; Paul, S.; Schmitt, L.; Buontempo, S.; D'Ambrosio, N.; Pagano, S.; Ruggiero, G.; Eremin, V.; Verbitskaya, E.

2000-01-01

The charge collection efficiency (CCE) of heavily irradiated silicon diode detectors was investigated at temperatures between 77 and 200 K. The CCE was found to depend on the radiation dose, bias voltage value and history, temperature, and bias current generated by light. The detector irradiated to the highest fluence 2x10 15 n/cm 2 yields a MIP signal of at least 15000 e - both at 250 V forward bias voltage, and at 250 V reverse bias voltage in the presence of a light-generated current. The 'Lazarus effect' was thus shown to extend to fluences at least ten times higher than was previously studied

Structural basis of lipid-driven conformational transitions in the KvAP voltage-sensing domain.

Science.gov (United States)

Li, Qufei; Wanderling, Sherry; Sompornpisut, Pornthep; Perozo, Eduardo

2014-02-01

Voltage-gated ion channels respond to transmembrane electric fields through reorientations of the positively charged S4 helix within the voltage-sensing domain (VSD). Despite a wealth of structural and functional data, the details of this conformational change remain controversial. Recent electrophysiological evidence showed that equilibrium between the resting ('down') and activated ('up') conformations of the KvAP VSD from Aeropyrum pernix can be biased through reconstitution in lipids with or without phosphate groups. We investigated the structural transition between these functional states, using site-directed spin-labeling and EPR spectroscopic methods. Solvent accessibility and interhelical distance determinations suggest that KvAP gates through S4 movements involving an ∼3-Å upward tilt and simultaneous ∼2-Å axial shift. This motion leads to large accessibly changes in the intracellular water-filled crevice and supports a new model of gating that combines structural rearrangements and electric-field remodeling.

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

Science.gov (United States)

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

Gate-bias and temperature dependence of charge transport in dinaphtho[2,3-b:2‧,3‧-d]thiophene thin-film transistors with MoO3/Au electrodes

Science.gov (United States)

Shaari, Safizan; Naka, Shigeki; Okada, Hiroyuki

2018-04-01

We investigated the gate-bias and temperature dependence of the voltage-current (V-I) characteristics of dinaphtho[2,3-b:2‧,3‧-d]thiophene with MoO3/Au electrodes. The insertion of the MoO3 layer significantly improved the device performance. The temperature dependent V-I characteristics were evaluated and could be well fitted by the Schottky thermionic emission model with barrier height under forward- and reverse-biased regimes in the ranges of 33-57 and 49-73 meV, respectively. However, at a gate voltage of 0 V, at which a small activation energy was obtained, we needed to consider another conduction mechanism at the grain boundary. From the obtained results, we concluded that two possible conduction mechanisms governed the charge injection at the metal electrode-organic semiconductor interface: the Schottky thermionic emission model and the conduction model in the organic thin-film layer and grain boundary.

The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

Energy Technology Data Exchange (ETDEWEB)

Campbell, I.H.; Davids, P.S.; Smith, D.L. [Los Alamos National Laboratory, Los Alamos, New Mexico87545 (United States); Barashkov, N.N.; Ferraris, J.P. [The University of Texas at Dallas, Richardson, Texas75083 (United States)

1998-04-01

We present device model calculations of the current{endash}voltage (I{endash}V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I{endash}V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I{endash}V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited. {copyright} {ital 1998 American Institute of Physics.}

Voltage control of ferromagnetic resonance

Directory of Open Access Journals (Sweden)

Ziyao Zhou

2016-06-01

Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

Plant virus cell-to-cell movement is not dependent on the transmembrane disposition of its movement protein.

Science.gov (United States)

Martínez-Gil, Luis; Sánchez-Navarro, Jesús A; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael

2009-06-01

The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement.

Should I stay or should I go? A habitat-dependent dispersal kernel improves prediction of movement.

Directory of Open Access Journals (Sweden)

Fabrice Vinatier

Full Text Available The analysis of animal movement within different landscapes may increase our understanding of how landscape features affect the perceptual range of animals. Perceptual range is linked to movement probability of an animal via a dispersal kernel, the latter being generally considered as spatially invariant but could be spatially affected. We hypothesize that spatial plasticity of an animal's dispersal kernel could greatly modify its distribution in time and space. After radio tracking the movements of walking insects (Cosmopolites sordidus in banana plantations, we considered the movements of individuals as states of a Markov chain whose transition probabilities depended on the habitat characteristics of current and target locations. Combining a likelihood procedure and pattern-oriented modelling, we tested the hypothesis that dispersal kernel depended on habitat features. Our results were consistent with the concept that animal dispersal kernel depends on habitat features. Recognizing the plasticity of animal movement probabilities will provide insight into landscape-level ecological processes.

Should I stay or should I go? A habitat-dependent dispersal kernel improves prediction of movement.

Science.gov (United States)

Vinatier, Fabrice; Lescourret, Françoise; Duyck, Pierre-François; Martin, Olivier; Senoussi, Rachid; Tixier, Philippe

2011-01-01

The analysis of animal movement within different landscapes may increase our understanding of how landscape features affect the perceptual range of animals. Perceptual range is linked to movement probability of an animal via a dispersal kernel, the latter being generally considered as spatially invariant but could be spatially affected. We hypothesize that spatial plasticity of an animal's dispersal kernel could greatly modify its distribution in time and space. After radio tracking the movements of walking insects (Cosmopolites sordidus) in banana plantations, we considered the movements of individuals as states of a Markov chain whose transition probabilities depended on the habitat characteristics of current and target locations. Combining a likelihood procedure and pattern-oriented modelling, we tested the hypothesis that dispersal kernel depended on habitat features. Our results were consistent with the concept that animal dispersal kernel depends on habitat features. Recognizing the plasticity of animal movement probabilities will provide insight into landscape-level ecological processes.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

Science.gov (United States)

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-03-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

Voltage and capacity stability of the Hubble telescope nickel-hydrogen battery

Energy Technology Data Exchange (ETDEWEB)

Vaidyanathan, H. [Communications Satellite Corp., Clarksburg, MD (United States). COMSAT Labs.; Wajsgras, H. [NASA Goddard Space Flight Center, Greenbelt, MD (United States); Rao, G.M. [NASA Goddard Space Flight Center, Greenbelt, MD (United States)

1996-01-01

The power system of the Ubble Space Telescope includes two orbital replacement units, each containing three nickel-hydrogen (Ni-H{sub 2}) batteries of 88 Ah capacity. Since launch in April 1990, the batteries have completed 23 000 charge and discharge cycles and continue to meet the power demands of the satellite. The voltage, capacity, and pressure characteristics of all six batteries were analyzed to determine the state of health of the battery and to identify any signs of performance degradation. The battery pressures have changed to varying degrees. The end-of-charge pressure for battery 4 increased by 96 psi, while that for battery 3 decreased by 37 psi. The voltages of the individual cells show a decay rate of 0.69 mV per 1000 cycles, and the capacity of the batteries has apparently decreased, possibly due to the system being operated at a lower stage of charge. Autonomous battery operation involving charge termination at a preselected voltage continues to restore the energy dissipated during each orbit. The accumulated data on voltages and recharge ratios can be used to design new temperature-compensated voltage levels for similar missions that employ Ni-H{sub 2} batteries. (orig.)

Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

Energy Technology Data Exchange (ETDEWEB)

Arora, N D

1987-05-01

A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

Investigation of surface charge density on solid–liquid interfaces by modulating the electrical double layer

International Nuclear Information System (INIS)

Moon, Jong Kyun; Song, Myung Won; Pak, Hyuk Kyu

2015-01-01

A solid surface in contact with water or aqueous solution usually carries specific electric charges. These surface charges attract counter ions from the liquid side. Since the geometry of opposite charge distribution parallel to the solid–liquid interface is similar to that of a capacitor, it is called an electrical double layer capacitor (EDLC). Therefore, there is an electrical potential difference across an EDLC in equilibrium. When a liquid bridge is formed between two conducting plates, the system behaves as two serially connected EDLCs. In this work, we propose a new method for investigating the surface charge density on solid–liquid interfaces. By mechanically modulating the electrical double layers and simultaneously applying a dc bias voltage across the plates, an ac electric current can be generated. By measuring the voltage drop across a load resistor as a function of bias voltage, we can study the surface charge density on solid–liquid interfaces. Our experimental results agree very well with the simple equivalent electrical circuit model proposed here. Furthermore, using this method, one can determine the polarity of the adsorbed state on the solid surface depending on the material used. We expect this method to aid in the study of electrical phenomena on solid–liquid interfaces. (paper)

Reducing burn-in voltage loss in polymer solar cells by increasing the polymer crystallinity

KAUST Repository

Heumueller, Thomas

2014-08-01

In order to commercialize polymer solar cells, the fast initial performance losses present in many high efficiency materials will have to be managed. This burn-in degradation is caused by light-induced traps and its characteristics depend on which polymer is used. We show that the light-induced traps are in the bulk of the active layer and we find a direct correlation between their presence and the open-circuit voltage loss in devices made with amorphous polymers. Solar cells made with crystalline polymers do not show characteristic open circuit voltage losses, even though light-induced traps are also present in these devices. This indicates that crystalline materials are more resistant against the influence of traps on device performance. Recent work on crystalline materials has shown there is an energetic driving force for charge carriers to leave amorphous, mixed regions of bulk heterojunctions, and charges are dominantly transported in pure, ordered phases. This energetic landscape allows efficient charge generation as well as extraction and also may benefit the stability against light-induced traps. This journal is © the Partner Organisations 2014.

Simulations of induced-charge electro-osmosis in microfluidic devices

Science.gov (United States)

Ben, Yuxing

2005-03-01

Theories of nonlinear electrokinetic phenomena generally assume a uniform, neutral bulk electroylte in contact with a polarizable thin double layer near a metal or dielectric surface, which acts as a "capacitor skin". Induced-charge electro-osmosis (ICEO) is the general effect of nonlinear electro-osmotic slip, when an applied electric field acts on its own induced (diffuse) double-layer charge. In most theoretical and experimental work, ICEO has been studied in very simple geometries, such as colloidal spheres and planar, periodic micro-electrode arrays. Here we use finite-element simulations to predict how more complicated geometries of polarizable surfaces and/or electrodes yield flow profiles with subtle dependence on the amplitude and frequency of the applied voltage. We also consider how the simple model equations break down, due to surface conduction, bulk diffusion, and concentration polarization, for large applied voltages (as in most experiments).

Simple DCM or CRM analog peak current controller for HV capacitor charge-discharge applications

DEFF Research Database (Denmark)

Trintis, Ionut; Dimopoulos, Emmanouil; Munk-Nielsen, Stig

2013-01-01

This paper presents a simple analog current controller suitable for buck and boost converter topologies. The controller operates in DCM or CRM, depending on the setup. The experimental results are presented to validate the proposed controller functionality for a high voltage capacitor charge...

Simulation of HPIB propagation in biased charge collector

International Nuclear Information System (INIS)

Li Hongyu; Qiu Aici

2004-01-01

A 2.5D PIC simulation using KARAT code for inner charge propagation within biased charge collector for measuring HPIB is presented. The simulation results indicate that the charges were neutralized but the current non-neutralized in the biased charge collector. The influence of ions collected vs biased voltage of the collector was also simulated. -800 V biased voltage can meet the measurement of 500 keV HPIB, and this is consistent with the experimental results

Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

Directory of Open Access Journals (Sweden)

Salmela Iikka

2012-08-01

Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

Symmetry dependence of rms charge radii

International Nuclear Information System (INIS)

Angeli, I.

2000-01-01

Complete text of publication follows. The nucleon number dependence of rms charge radii is often approximated by some simple formula containing the mass number A only, R(A) = r(A) x A 1/3 where r(A) is a slowly varying function of A e.g. r(A) = r 0 + r 1 A -2/3 + r 2 A -4/3 ; r 0 , r 1 and r 2 are determined from a fit to experimental data. These simple mass-dependent formulae R(A) may be useful for nuclei along the valley of stability. However, for nuclei of the stability line, the mass number A = N + Z in itself is not enough to characterise the dependence of the R(Z,N) radius surface of the nucleon numbers Z and N. Changing a neutron to a proton a change in the charge radius can be expected, although A remains constant. In the present work, to extend the traditional radius formula, an additional term has been included, depending on the symmetry parameter I = (N-Z)/A. Several parametrisations were tried, using weighted least-squares (minimum χ 2 ) procedures for the fit to present-day data base (1). The best fit (with χ 2 /n'∼16) was found for R b (A,I) = r(A) x A 1/3 + b(I-I st ), where I st = (N st -Z st )/A is the value of the symmetry parameter of the stable isobar with the given mass number A, and b = -0.83. The alternative formula R a (A,I) = [r(A) + a(I-I st ) x A 1/3 is only slightly inferior to the previous one; here a = -0.20 and χ 2 /n'∼18. These results are practically independent of the ways of minimum search: fixing the parameters r 0 , r 1 and r 2 and varying teh parameter b (a) or varying the radius parameters r 0 , r 1 and r 2 and b (a) simultaneously. The main difficulty in determining the right parametrisation is caused by the fact that the experimental surface R exp (A,I) is not smooth. On the contrary, there are significant shell- and deformation effects (2,3) and isolated irregular points that may strongly affect the result of the fit. In order to avoid the effect of these strong deviations on the smooth symmetry dependence, more than

Charging device for an electrostatic accelerator

International Nuclear Information System (INIS)

Pivovar, L.I.; Khurgin, K.M.

1983-01-01

The invention relates to electrostatic accelerators operating in compressed gases and charged by a charge-carrying belt transport device with driving and driven shafts. The aim of the invention is the increase of service life of the device by decreasing deflection of the charge-carrying belt in high-voltage conductor operation at high voltages. Increase of survice life of the device is provided due to the fact that the belt as a whole is more stable and it runs true without slacking shielding rods

The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

Directory of Open Access Journals (Sweden)

Ting-Feng Lin

Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

One-dimensional Brownian motion of charged nanoparticles along microtubules: a model system for weak binding interactions.

Science.gov (United States)

Minoura, Itsushi; Katayama, Eisaku; Sekimoto, Ken; Muto, Etsuko

2010-04-21

Various proteins are known to exhibit one-dimensional Brownian motion along charged rodlike polymers, such as microtubules (MTs), actin, and DNA. The electrostatic interaction between the proteins and the rodlike polymers appears to be crucial for one-dimensional Brownian motion, although the underlying mechanism has not been fully clarified. We examined the interactions of positively-charged nanoparticles composed of polyacrylamide gels with MTs. These hydrophilic nanoparticles bound to MTs and displayed one-dimensional Brownian motion in a charge-dependent manner, which indicates that nonspecific electrostatic interaction is sufficient for one-dimensional Brownian motion. The diffusion coefficient decreased exponentially with an increasing particle charge (with the exponent being 0.10 kBT per charge), whereas the duration of the interaction increased exponentially (exponent of 0.22 kBT per charge). These results can be explained semiquantitatively if one assumes that a particle repeats a cycle of binding to and movement along an MT until it finally dissociates from the MT. During the movement, a particle is still electrostatically constrained in the potential valley surrounding the MT. This entire process can be described by a three-state model analogous to the Michaelis-Menten scheme, in which the two parameters of the equilibrium constant between binding and movement, and the rate of dissociation from the MT, are derived as a function of the particle charge density. This study highlights the possibility that the weak binding interactions between proteins and rodlike polymers, e.g., MTs, are mediated by a similar, nonspecific charge-dependent mechanism. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Frequency dependent magneto-transport in charge transfer Co(II) complex

Energy Technology Data Exchange (ETDEWEB)

Shaw, Bikash Kumar; Saha, Shyamal K., E-mail: cnssks@iacs.res.in

2014-09-01

A charge transfer chelated system containing ferromagnetic metal centers is the ideal system to investigate the magneto-transport and magneto-dielectric effects due to the presence of both electronic as well as magnetic properties and their coupling. Magneto-transport properties in materials are usually studied through dc charge transport under magnetic field. As frequency dependent conductivity is an essential tool to understand the nature of carrier wave, its spatial extension and their mutual interaction, in the present work, we have investigated frequency dependent magneto-transport along with magnetization behavior in [Co{sub 2}(II)-(5-(4-PhMe)-1,3,4-oxadiazole-H{sup +}-2-thiolate){sub 5}](OAc){sub 4} metal complex to elucidate the nature of above quantities and their response under magnetic field in the transport property. We have used the existing model for ac conduction incorporating the field dependence to explain the frequency dependent magneto-transport. It is seen that the frequency dependent magneto-transport could be well explained using the existing model for ac conduction. -Highlights: • Chelated Co(II) complex is synthesized for magneto-transport applications. • Frequency dependent magneto-transport and magnetization behavior are studied. • Nature of carrier wave, its spatial extension is investigated under magnetic field. • Existing model for ac conduction is used with magnetic field dependence.

Double input converters for different voltage sources with isolated charger

Directory of Open Access Journals (Sweden)

Chalash Sattayarak

2014-09-01

Full Text Available This paper presents the double input converters for different voltage input sources with isolated charger coils. This research aims to increase the performance of the battery charger circuit. In the circuit, there are the different voltage levels of input source. The operating modes of the switch in the circuit use the microcontroller to control the battery charge and to control discharge mode automatically when the input voltage sources are lost from the system. The experimental result of this research shows better performance for charging at any time period of the switch, while the voltage input sources work together. Therefore, this research can use and develop to battery charger for present or future.

Charge-collection efficiency of GaAs field effect transistors fabricated with a low temperature grown buffer layer: dependence on charge deposition profile

International Nuclear Information System (INIS)

McMorrow, D.; Knudson, A.R.; Melinger, J.S.; Buchner, S.

1999-01-01

The results presented here reveal a surprising dependence of the charge-collection efficiency of LT GaAs FETs (field effect transistors) on the depth profile of the deposited charge. Investigation of the temporal dependence of the signal amplitude, carrier density contours, and potential contours reveals different mechanisms for charge collection arising from carriers deposited above and below the LT GaAs buffer layer, respectively. In particular, carriers deposited below the LT GaAs buffer layer dissipate slowly and give rise to a persistent charge collection that is associated with a bipolar-like gain process. These results may be of significance in understanding the occurrence of single-event upsets from protons, neutrons, and large-angle, glancing heavy-ion strikes. (authors)

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

Energy Technology Data Exchange (ETDEWEB)

Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

2015-06-15

We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Effect of voltage waveform on dielectric barrier discharge ozone production efficiency

Science.gov (United States)

Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.

2012-03-01

Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.

Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

International Nuclear Information System (INIS)

Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

2008-01-01

Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Does consolidation of visuospatial sequence knowledge depend on eye movements?

Directory of Open Access Journals (Sweden)

Daphné Coomans

Full Text Available In the current study, we assessed whether visuospatial sequence knowledge is retained over 24 hours and whether this retention is dependent on the occurrence of eye movements. Participants performed two sessions of a serial reaction time (SRT task in which they had to manually react to the identity of a target letter pair presented in one of four locations around a fixation cross. When the letter pair 'XO' was presented, a left response had to be given, when the letter pair 'OX' was presented, a right response was required. In the Eye Movements (EM condition, eye movements were necessary to perform the task since the fixation cross and the target were separated by at least 9° visual angle. In the No Eye Movements (NEM condition, on the other hand, eye movements were minimized by keeping the distance from the fixation cross to the target below 1° visual angle and by limiting the stimulus presentation to 100 ms. Since the target identity changed randomly in both conditions, no manual response sequence was present in the task. However, target location was structured according to a deterministic sequence in both the EM and NEM condition. Learning of the target location sequence was determined at the end of the first session and 24 hours after initial learning. Results indicated that the sequence learning effect in the SRT task diminished, yet remained significant, over the 24 hour interval in both conditions. Importantly, the difference in eye movements had no impact on the transfer of sequence knowledge. These results suggest that the retention of visuospatial sequence knowledge occurs alike, irrespective of whether this knowledge is supported by eye movements or not.

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

International Nuclear Information System (INIS)

Miah, M. Idrish

2008-01-01

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

Plant Virus Cell-to-Cell Movement Is Not Dependent on the Transmembrane Disposition of Its Movement Protein▿ †

Science.gov (United States)

Martínez-Gil, Luis; Sánchez-Navarro, Jesús A.; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael

2009-01-01

The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement. PMID:19321624

Chaos in Time-Dependent Space-Charge Potentials

CERN Document Server

Betzel, Gregory T; Sideris, Ioannis V

2005-01-01

We consider a spherically symmetric, homologously breathing, space-charge-dominated beam bunch in the spirit of the particle-core model. The question we ask is: How does the time dependence influence the population of chaotic orbits? The static beam has zero chaotic orbits; the equation of particle motion is integrable up to quadrature. This is generally not true once the bunch is set into oscillation. We quantify the population of chaotic orbits as a function of space charge and oscillation amplitude (mismatch). We also apply a newly developed measure of chaos, one that distinguishes between regular, sticky, and wildly chaotic orbits, to characterize the phase space in detail. We then introduce colored noise into the system and show how its presence modifies the dynamics. One finding is that, despite the presence of a sizeable population of chaotic orbits, halo formation in the homologously breathing beam is much less prevalent than in an envelope-matched counterpart wherein an internal collective mode is ex...

Charge-dependent azimuthal correlations in pPb collisions with CMS experiment

CERN Document Server

Tu, Zhoudunming

2017-01-01

Charge-dependent azimuthal correlations relative to the event plane in AA collisions have been suggested as providing evidence for the chiral magnetic effect (CME) caused by local strong parity violation. However, the observation of the CME remains inconclusive because of several possible sources of background correlations that may account for part or all of the observed signals. This talk will present the first application of three-particle, charge-dependent azimuthal correlation analysis in proton-nucleus collisions, using pPb data collected with the CMS experiment at the LHC at $\\sqrt{s_{NN}}$ = 5.02 TeV. The differences found in comparing same and opposite sign correlations are studied as a function of event multiplicity and the pseudorapidity gap between two of the particles detected in the CMS tracker detector. After selecting events with comparable charge-particle multiplicities, the results for pPb collisions are found to be similar to those for PbPb collisions collected at the same collision energy. ...

Movement reveals scale dependence in habitat selection of a large ungulate

Science.gov (United States)

Northrup, Joseph; Anderson, Charles R.; Hooten, Mevin B.; Wittemyer, George

2016-01-01

Ecological processes operate across temporal and spatial scales. Anthropogenic disturbances impact these processes, but examinations of scale dependence in impacts are infrequent. Such examinations can provide important insight to wildlife–human interactions and guide management efforts to reduce impacts. We assessed spatiotemporal scale dependence in habitat selection of mule deer (Odocoileus hemionus) in the Piceance Basin of Colorado, USA, an area of ongoing natural gas development. We employed a newly developed animal movement method to assess habitat selection across scales defined using animal-centric spatiotemporal definitions ranging from the local (defined from five hour movements) to the broad (defined from weekly movements). We extended our analysis to examine variation in scale dependence between night and day and assess functional responses in habitat selection patterns relative to the density of anthropogenic features. Mule deer displayed scale invariance in the direction of their response to energy development features, avoiding well pads and the areas closest to roads at all scales, though with increasing strength of avoidance at coarser scales. Deer displayed scale-dependent responses to most other habitat features, including land cover type and habitat edges. Selection differed between night and day at the finest scales, but homogenized as scale increased. Deer displayed functional responses to development, with deer inhabiting the least developed ranges more strongly avoiding development relative to those with more development in their ranges. Energy development was a primary driver of habitat selection patterns in mule deer, structuring their behaviors across all scales examined. Stronger avoidance at coarser scales suggests that deer behaviorally mediated their interaction with development, but only to a degree. At higher development densities than seen in this area, such mediation may not be possible and thus maintenance of sufficient

Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2

Science.gov (United States)

Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi

2018-04-01

Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.

Conservation of Charge and Conservation of Current

OpenAIRE

Eisenberg, Bob

2016-01-01

Conservation of current and conservation of charge are nearly the same thing: when enough is known about charge movement, conservation of current can be derived from conservation of charge, in ideal dielectrics, for example. Conservation of current is enforced implicitly in ideal dielectrics by theories that conserve charge. But charge movement in real materials like semiconductors or ionic solutions is never ideal. We present an apparently universal derivation of conservation of current and ...

A compact, all solid-state LC high voltage generator.

Science.gov (United States)

Fan, Xuliang; Liu, Jinliang

2013-06-01

LC generator is widely applied in the field of high voltage generation technology. A compact and all solid-state LC high voltage generator based on saturable pulse transformer is proposed in this paper. First, working principle of the generator is presented. Theoretical analysis and circuit simulation are used to verify the design of the generator. Experimental studies of the proposed LC generator with two-stage main energy storage capacitors are carried out. And the results show that the proposed LC generator operates as expected. When the isolation inductance is 27 μH, the output voltage is 1.9 times larger than the charging voltage on single capacitor. The multiplication of voltages is achieved. On the condition that the primary energy storage capacitor is charged to 857 V, the output voltage of the generator can reach to 59.5 kV. The step-up ratio is nearly 69. When self breakdown gas gap switch is used as main switch, the rise time of the voltage pulse on load resistor is 8.7 ns. It means that the series-wound inductance in the discharging circuit is very small in this system. This generator can be employed in two different applications.

Light sensitive memristor with bi-directional and wavelength-dependent conductance control

Energy Technology Data Exchange (ETDEWEB)

Maier, P.; Hartmann, F., E-mail: fabian.hartmann@physik.uni-wuerzburg.de; Emmerling, M.; Schneider, C.; Kamp, M.; Worschech, L. [Technische Physik and Wilhelm Conrad Röntgen Research Center for Complex Material Systems, Physikalisches Institut, Universität Würzburg, Am Hubland, D-97074 Würzburg (Germany); Rebello Sousa Dias, M. [Departamento de Fisica, Universidade Federal de São Carlos, 13565-905 São Carlos, São Paulo (Brazil); Institute for Research in Electronics and Applied Physics, University of Maryland, College Park, Maryland 20742 (United States); Castelano, L. K.; Marques, G. E.; Lopez-Richard, V. [Departamento de Fisica, Universidade Federal de São Carlos, 13565-905 São Carlos, São Paulo (Brazil); Höfling, S. [Technische Physik and Wilhelm Conrad Röntgen Research Center for Complex Material Systems, Physikalisches Institut, Universität Würzburg, Am Hubland, D-97074 Würzburg (Germany); SUPA, School of Physics and Astronomy, University of St. Andrews, St. Andrews KY16 9SS (United Kingdom)

2016-07-11

We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.

Light sensitive memristor with bi-directional and wavelength-dependent conductance control

International Nuclear Information System (INIS)

Maier, P.; Hartmann, F.; Emmerling, M.; Schneider, C.; Kamp, M.; Worschech, L.; Rebello Sousa Dias, M.; Castelano, L. K.; Marques, G. E.; Lopez-Richard, V.; Höfling, S.

2016-01-01

We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.

Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

DEFF Research Database (Denmark)

Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

2006-01-01

Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

Charge injection and transport properties of an organic light-emitting diode

Directory of Open Access Journals (Sweden)

Peter Juhasz

2016-01-01

Full Text Available The charge behavior of organic light emitting diode (OLED is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport.

Gate-dependent asymmetric transport characteristics in pentacene barristors with graphene electrodes.

Science.gov (United States)

Hwang, Wang-Taek; Min, Misook; Jeong, Hyunhak; Kim, Dongku; Jang, Jingon; Yoo, Daekyung; Jang, Yeonsik; Kim, Jun-Woo; Yoon, Jiyoung; Chung, Seungjun; Yi, Gyu-Chul; Lee, Hyoyoung; Wang, Gunuk; Lee, Takhee

2016-11-25

We investigated the electrical characteristics and the charge transport mechanism of pentacene vertical hetero-structures with graphene electrodes. The devices are composed of vertical stacks of silicon, silicon dioxide, graphene, pentacene, and gold. These vertical heterojunctions exhibited distinct transport characteristics depending on the applied bias direction, which originates from different electrode contacts (graphene and gold contacts) to the pentacene layer. These asymmetric contacts cause a current rectification and current modulation induced by the gate field-dependent bias direction. We observed a change in the charge injection barrier during variable-temperature current-voltage characterization, and we also observed that two distinct charge transport channels (thermionic emission and Poole-Frenkel effect) worked in the junctions, which was dependent on the bias magnitude.

An Integrated Chip High-Voltage Power Receiver for Wireless Biomedical Implants

Directory of Open Access Journals (Sweden)

Vijith Vijayakumaran Nair

2015-06-01

Full Text Available In near-field wireless-powered biomedical implants, the receiver voltage largely overrides the compliance of low-voltage power receiver systems. To limit the induced voltage, generally, low-voltage topologies utilize limiter circuits, voltage clippers or shunt regulators, which are power-inefficient methods. In order to overcome the voltage limitation and improve power efficiency, we propose an integrated chip high-voltage power receiver based on the step down approach. The topology accommodates voltages as high as 30 V and comprises a high-voltage semi-active rectifier, a voltage reference generator and a series regulator. Further, a battery management circuit that enables safe and reliable implant battery charging based on analog control is proposed and realized. The power receiver is fabricated in 0.35-μm high-voltage Bipolar-CMOS-DMOStechnology based on the LOCOS0.35-μm CMOS process. Measurement results indicate 83.5% power conversion efficiency for a rectifier at 2.1 mA load current. The low drop-out regulator based on the current buffer compensation and buffer impedance attenuation scheme operates with low quiescent current, reduces the power consumption and provides good stability. The topology also provides good power supply rejection, which is adequate for the design application. Measurement results indicate regulator output of 4 ± 0.03 V for input from 5 to 30 V and 10 ± 0.05 V output for input from 11 to 30 V with load current 0.01–100 mA. The charger circuit manages the charging of the Li-ion battery through all if the typical stages of the Li-ion battery charging profile.

Charge-dependent effects in double photoionization of He-like ions

Energy Technology Data Exchange (ETDEWEB)

Foster, M; Colgan, J [Theoretical Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2006-12-28

A study is made of triple differential cross sections (TDCS) resulting from the double photoionization (DPI) of He-like ions. The angular correlations between the outgoing electrons are examined as a function of the nuclear target charge. Time-dependent close-coupling theory (TDCC) is used to solve the time-dependent Schroedinger equation for both outgoing electrons. Previous theoretical models that have calculated the TDCS for He-like ions have only included the electron-electron interaction through approximate perturbative methods. We have analysed the effects of the electron correlation and the dependence relative to the nuclear charge. We find that the differing TDCS shapes for unequal electron energy sharings observed by Otranto and Garibotti (2003 Eur. Phys. J. D 27 215, 2005 Phys. Rev. A 71 034703-1, 2003 Phys. Rev. A 67 064701) for He-like ions are not due to the decreasing relative strength of the electron-electron correlation, but rather due to the different energy regions in which each calculation is carried out. Our calculations are compared with previous experimental and theoretical work, where available.

Doping dependence of charge order in electron-doped cuprate superconductors

Science.gov (United States)

Mou, Yingping; Feng, Shiping

2017-12-01

In the recent studies of the unconventional physics in cuprate superconductors, one of the central issues is the interplay between charge order and superconductivity. Here the mechanism of the charge-order formation in the electron-doped cuprate superconductors is investigated based on the t-J model. The experimentally observed momentum dependence of the electron quasiparticle scattering rate is qualitatively reproduced, where the scattering rate is highly anisotropic in momentum space, and is intriguingly related to the charge-order gap. Although the scattering strength appears to be weakest at the hot spots, the scattering in the antinodal region is stronger than that in the nodal region, which leads to the original electron Fermi surface is broken up into the Fermi pockets and their coexistence with the Fermi arcs located around the nodal region. In particular, this electron Fermi surface instability drives the charge-order correlation, with the charge-order wave vector that matches well with the wave vector connecting the hot spots, as the charge-order correlation in the hole-doped counterparts. However, in a striking contrast to the hole-doped case, the charge-order wave vector in the electron-doped side increases in magnitude with the electron doping. The theory also shows the existence of a quantitative link between the single-electron fermiology and the collective response of the electron density.

Meson theory of charge-dependent nuclear forces. Chapter 10

International Nuclear Information System (INIS)

Henley, E.M.; Miller, G.A.

1979-01-01

Although the charge dependence is a small effect it is a useful probe for nuclear structure and forces details. The authors are primarily concerned with the short-range meson-theoretic origin of these forces. They discuss recent experimental and theoretical advances and give applications and possible tests of the theory. (D.H.)

Nickel-Hydrogen Battery Fault Clearing at Low State of Charge

Science.gov (United States)

Lurie, C.

1997-01-01

Fault clearing currents were achieved and maintained at discharge rates from C/2 to C/3 at high and low states of charge. The fault clearing plateau voltage is strong function of: discharge current, and voltage-prior-to-the-fault-clearing-event and a weak function of state of charge. Voltage performance, for the range of conditions reported, is summarized.

Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices

Science.gov (United States)

K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.

2017-10-01

The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

Energy Technology Data Exchange (ETDEWEB)

Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

2008-10-15

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

Floating liquid bridge charge dynamics

Science.gov (United States)

Teschke, Omar; Soares, David Mendez; Gomes, Whyllerson Evaristo; Valente Filho, Juracyr Ferraz

2016-01-01

The interaction of liquid with electric fields is investigated in a configuration where up to 13 kV are applied between electrodes resulting in a 106 V/m electric field in the capillaries and where there is the formation of a free-standing fluid bridge in the interelectrode gap. The Mott-Gurney equation was fitted to the measured ionization current vs applied voltage curve which indicates that the ionization rate at the high-voltage anode electrode dimethylsulfoxide (DMSO) interface and space charging in the interelectrode gap determine the floating liquid bridge current for a given cathode-to-anode voltage. Space charge effects were measured in the cathode becker and also at the liquid bridge since the ionized charges at the anode migrate to the bridge outer surface and decrease the interfacial tension from 43 mJ/m2 to 29 mJ/m2. Two distinct structural regions then form the bridge, a charged plastic (bulk modulus ˜100 MPa) conducting outer layer with a surface conductivity of ˜10-9 Ω-1, which shapes and supports the floating fluid structure, and an inner liquid cylinder, where DMSO molecules flow.

Temperature-dependent built-in potential in organic semiconductor devices

NARCIS (Netherlands)

Kemerink, M.; Kramer, J.M.; Gommans, H.H.P.; Janssen, R.A.J.

2006-01-01

The temperature dependence of the built-in voltage of organic semiconductor devices is studied. The results are interpreted using a simple analytical model for the band bending at the electrodes. It is based on the notion that, even at zero current, diffusion may cause a significant charge density

Wideband Electrostatic Vibration Energy Harvester (e-VEH) Having a Low Start-Up Voltage Employing a High-Voltage Integrated Interface

International Nuclear Information System (INIS)

Dudka, A; Galayko, D; Basset, P; Cottone, F; Blokhina, E

2013-01-01

This paper reports on an electrostatic Vibration Energy Harvester (e-VEH) system, for which the energy conversion process is initiated with a low bias voltage and is compatible with wideband stochastic external vibrations. The system employs the auto-synchronous conditioning circuit topology with the use of a novel dedicated integrated low-power high-voltage switch that is needed to connect the charge pump and flyback – two main parts of the used conditioning circuit. The proposed switch is designed and implemented in AMS035HV CMOS technology. Thanks to the proposed switch device, which is driven with a low-voltage ground-referenced logic, the e-VEH system may operate within a large voltage range, from a pre-charge low voltage up to several tens volts. With such a high-voltage e-VEH operation, it is possible to obtain a strong mechanical coupling and a high rate of vibration energy conversion. The used transducer/resonator device is fabricated with a batch-processed MEMS technology. When excited with stochastic vibrations having an acceleration level of 0.8 g rms distributed in the band 110–170 Hz, up to 0.75 μW of net electrical power has been harvested with our system. This work presents an important milestone in the challenge of designing a fully integrated smart conditioning interface for the capacitive e-VEHs

Innovation of High Voltage Supply Adjustment Device on Diagnostic X-Ray Machine

International Nuclear Information System (INIS)

Sujatno; Wiranto Budi Santoso

2010-01-01

Innovation of high voltage supply adjustment device on diagnostic x-ray machine has been carried out. The innovation is conducted by utilizing an electronic circuit as a high voltage adjustment device. Usually a diagnostic x-ray machine utilizes a transformer or an auto-transformer as a high voltage supply adjustment device. A high power diagnostic x-ray machine needs a high power transformer which has big physical dimension. Therefore a box control where the transformer is located has to have big physical dimension. Besides, the price of the transformer is expensive and hardly found in local markets. In this innovation, the transformer is replaced by an electronic circuit. The main component of the electronic circuit is Triac BTA-40. As adjustment device, the triac is controlled by a variable resistor which is coupled by a stepper motor. A step movement of stepper motor varies a value of resistor. The resistor value determines the triac gate voltage. Furthermore the triac will open according to the value of electrical current flowing to the gate. When the gate is open, electrical voltage and current will flow from cathode to anode of the triac. The value of these electrical voltage and current depend on gate open condition. Then this triac output voltage is feed to diagnostic x-ray machine high voltage supply. Therefore the high voltage value of diagnostic x-ray machine is adjusted by the output voltage of the electronic circuit. By using this electronic circuit, the physical dimension of diagnostic x-ray machine box control and the price of the equipment can be reduced. (author)

Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

Science.gov (United States)

Shirokov, Roman E.

2018-01-01

Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

Voltage-Driven Magnetization Switching and Spin Pumping in Weyl Semimetals

Science.gov (United States)

Kurebayashi, Daichi; Nomura, Kentaro

2016-10-01

We demonstrate electrical magnetization switching and spin pumping in magnetically doped Weyl semimetals. The Weyl semimetal is a three-dimensional gapless topological material, known to have nontrivial coupling between the charge and the magnetization due to the chiral anomaly. By solving the Landau-Lifshitz-Gilbert equation for a multilayer structure of a Weyl semimetal, an insulator and a metal while taking the charge-magnetization coupling into account, magnetization dynamics is analyzed. It is shown that the magnetization dynamics can be driven by the electric voltage. Consequently, switching of the magnetization with a pulsed electric voltage can be achieved, as well as precession motion with an applied oscillating electric voltage. The effect requires only a short voltage pulse and may therefore be energetically favorable for us in spintronics devices compared to conventional spin-transfer torque switching.

Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

Science.gov (United States)

Cantrell, A R; Scheuer, T; Catterall, W A

1999-07-01

Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

Combined effects of space charge and energetic disorder on photocurrent efficiency loss of field-dependent organic photovoltaic devices

International Nuclear Information System (INIS)

Yoon, Sangcheol; Hwang, Inchan; Park, Byoungchoo

2015-01-01

The loss of photocurrent efficiency by space-charge effects in organic solar cells with energetic disorder was investigated to account for how energetic disorder incorporates space-charge effects, utilizing a drift-diffusion model with field-dependent charge-pair dissociation and suppressed bimolecular recombination. Energetic disorder, which induces the Poole–Frenkel behavior of charge carrier mobility, is known to decrease the mobility of charge carriers and thus reduces photovoltaic performance. We found that even if the mobilities are the same in the absence of space-charge effects, the degree of energetic disorder can be an additional parameter affecting photocurrent efficiency when space-charge effects occur. Introducing the field-dependence parameter that reflects the energetic disorder, the behavior of efficiency loss with energetic disorder can differ depending on which charge carrier is subject to energetic disorder. While the energetic disorder that is applied to higher-mobility charge carriers decreases photocurrent efficiency further, the efficiency loss can be suppressed when energetic disorder is applied to lower-mobility charge carriers. (paper)

Identification of electric-field-dependent steps in the Na(+),K(+)-pump cycle.

Science.gov (United States)

Mares, Laura J; Garcia, Alvaro; Rasmussen, Helge H; Cornelius, Flemming; Mahmmoud, Yasser A; Berlin, Joshua R; Lev, Bogdan; Allen, Toby W; Clarke, Ronald J

2014-09-16

The charge-transporting activity of the Na(+),K(+)-ATPase depends on its surrounding electric field. To isolate which steps of the enzyme's reaction cycle involve charge movement, we have investigated the response of the voltage-sensitive fluorescent probe RH421 to interaction of the protein with BTEA (benzyltriethylammonium), which binds from the extracellular medium to the Na(+),K(+)-ATPase's transport sites in competition with Na(+) and K(+), but is not occluded within the protein. We find that only the occludable ions Na(+), K(+), Rb(+), and Cs(+) cause a drop in RH421 fluorescence. We conclude that RH421 detects intramembrane electric field strength changes arising from charge transport associated with conformational changes occluding the transported ions within the protein, not the electric fields of the bound ions themselves. This appears at first to conflict with electrophysiological studies suggesting extracellular Na(+) or K(+) binding in a high field access channel is a major electrogenic reaction of the Na(+),K(+)-ATPase. All results can be explained consistently if ion occlusion involves local deformations in the lipid membrane surrounding the protein occurring simultaneously with conformational changes necessary for ion occlusion. The most likely origin of the RH421 fluorescence response is a change in membrane dipole potential caused by membrane deformation. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Statistical Analysis of Partial Discharge Characteristics in Transformer Oil at the “Point-Plane” Electrode at Alternating Voltage

Directory of Open Access Journals (Sweden)

Korobeynikov S.M.

2017-08-01

Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.

Mitigation of Voltage Swells by Static Series Compensator

DEFF Research Database (Denmark)

Awad, Hilmy; Blaabjerg, Frede

2004-01-01

Swells and overvoltages can cause overheating, tripping or even destruction of industrial equipment such as motor drives and control relays. This paper investigates the possibility of employing the Static Series Compensator (SSC) to mitigate voltage swells/overvoltages. In the case of voltage...... is lower than a predetermined voltage level, the active power is employed to charge the ESC to this voltage level; 2) otherwise, the overvoltage protection of the SSC must operate. This paper also applies an overvoltage protection scheme based on a combination of a dc resistor with a chopper and the valves...

Resonance fluorescence revival in a voltage-controlled semiconductor quantum dot

Science.gov (United States)

Reigue, Antoine; Lemaître, Aristide; Gomez Carbonell, Carmen; Ulysse, Christian; Merghem, Kamel; Guilet, Stéphane; Hostein, Richard; Voliotis, Valia

2018-02-01

We demonstrate systematic resonance fluorescence recovery with near-unity emission efficiency in single quantum dots embedded in a charge-tunable device in a wave-guiding geometry. The quantum dot charge state is controlled by a gate voltage, through carrier tunneling from a close-lying Fermi sea, stabilizing the resonantly photocreated electron-hole pair. The electric field cancels out the charging/discharging mechanisms from nearby traps toward the quantum dots, responsible for the usually observed inhibition of the resonant fluorescence. Fourier transform spectroscopy as a function of the applied voltage shows a strong increase in the coherence time though not reaching the radiative limit. These charge controlled quantum dots can act as quasi-perfect deterministic single-photon emitters, with one laser pulse converted into one emitted single photon.

Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

KAUST Repository

Kim, Younggy; Hatzell, Marta C.; Hutchinson, Adam J.; Logan, Bruce E.

2011-01-01

to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses

Electrical bistability and charge-transport mechanisms in cuprous sulfide nanosphere-poly(N-vinylcarbazole) composite films

International Nuclear Information System (INIS)

Tang Aiwei; Teng Feng; Liu Jie; Wang Yichao; Peng Hongshang; Hou Yanbing; Wang Yongsheng

2011-01-01

In this study, electrically bistable devices were fabricated by incorporating cuprous sulfide (Cu 2 S) nanospheres with mean size less than 10 nm into a poly(N-vinylcarbazole) (PVK) matrix. A remarkable electrical bistability was clearly observed in the current–voltage curves of the devices due to an electric-field-induced charge transfer between the dodecanethiol-capped Cu 2 S nanospheres and PVK. The maximum ON/OFF current ratio reached up to value as large as 10 4 , which was dependent on the mass ratios of Cu 2 S nanospheres to PVK, the amplitude of the scanning voltages, and the film thickness. The charge-transport mechanisms of the electrically bistable devices were described on the basis of the experimental results using different theoretical models of organic electronics.

Net charge fluctuations and local charge compensation

International Nuclear Information System (INIS)

Fu Jinghua

2006-01-01

We propose net charge fluctuation as a measure of local charge correlation length. It is demonstrated that, in terms of a schematic multiperipheral model, net charge fluctuation satisfies the same Quigg-Thomas relation as satisfied by charge transfer fluctuation. Net charge fluctuations measured in finite rapidity windows depend on both the local charge correlation length and the size of the observation window. When the observation window is larger than the local charge correlation length, the net charge fluctuation only depends on the local charge correlation length, while forward-backward charge fluctuations always have strong dependence on the observation window size. Net charge fluctuations and forward-backward charge fluctuations measured in the present heavy ion experiments show characteristic features similar to those from multiperipheral models. But the data cannot all be understood within this simple model

Comment on 'Temperature dependence of the current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions'

Energy Technology Data Exchange (ETDEWEB)

Pipinys, P; Rimeika, A [Department of Physics, Vilnius Pedagogical University, Studentu 39, LT-08106 Vilnius (Lithuania)], E-mail: ftfdekanas@vpu.lt

2008-02-27

Current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions, measured in the temperature range 140-280 K by Kaya et al (2007 J. Phys.: Condens. Matter 19 406205), are reinterpreted in the framework of phonon-assisted tunnelling theory, as a free-charge-carrier generation mechanism in the strong electrical field. It is shown that phonon-assisted tunnelling more adequately describes the peculiarities of the variation of I-V data with temperature in PANI polymers. (comment)

Current voltage perspective of an organic electronic device

Science.gov (United States)

Mukherjee, Ayash K.; Kumari, Nikita

2018-05-01

Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.

Structure and hydration of membranes embedded with voltage-sensing domains.

Science.gov (United States)

Krepkiy, Dmitriy; Mihailescu, Mihaela; Freites, J Alfredo; Schow, Eric V; Worcester, David L; Gawrisch, Klaus; Tobias, Douglas J; White, Stephen H; Swartz, Kenton J

2009-11-26

Despite the growing number of atomic-resolution membrane protein structures, direct structural information about proteins in their native membrane environment is scarce. This problem is particularly relevant in the case of the highly charged S1-S4 voltage-sensing domains responsible for nerve impulses, where interactions with the lipid bilayer are critical for the function of voltage-activated ion channels. Here we use neutron diffraction, solid-state nuclear magnetic resonance (NMR) spectroscopy and molecular dynamics simulations to investigate the structure and hydration of bilayer membranes containing S1-S4 voltage-sensing domains. Our results show that voltage sensors adopt transmembrane orientations and cause a modest reshaping of the surrounding lipid bilayer, and that water molecules intimately interact with the protein within the membrane. These structural findings indicate that voltage sensors have evolved to interact with the lipid membrane while keeping energetic and structural perturbations to a minimum, and that water penetrates the membrane, to hydrate charged residues and shape the transmembrane electric field.

Development of a fast voltage control method for electrostatic accelerators

International Nuclear Information System (INIS)

Lobanov, Nikolai R.; Linardakis, Peter; Tsifakis, Dimitrios

2014-01-01

The concept of a novel fast voltage control loop for tandem electrostatic accelerators is described. This control loop utilises high-frequency components of the ion beam current intercepted by the image slits to generate a correction voltage that is applied to the first few gaps of the low- and high-energy acceleration tubes adjoining the high voltage terminal. New techniques for the direct measurement of the transfer function of an ultra-high impedance structure, such as an electrostatic accelerator, have been developed. For the first time, the transfer function for the fast feedback loop has been measured directly. Slow voltage variations are stabilised with common corona control loop and the relationship between transfer functions for the slow and new fast control loops required for optimum operation is discussed. The main source of terminal voltage instabilities, which are due to variation of the charging current caused by mechanical oscillations of charging chains, has been analysed

Circuit for Full Charging of Series Lithium-Ion Cells

Science.gov (United States)

Ott, William E.; Saunders, David L.

2007-01-01

An advanced charger has been proposed for a battery that comprises several lithium-ion cells in series. The proposal is directed toward charging the cells in as nearly an optimum manner as possible despite unit-to-unit differences among the nominally identical cells. The particular aspect of the charging problem that motivated the proposal can be summarized as follows: During bulk charging (charging all the cells in series at the same current), the voltages of individual cells increase at different rates. Once one of the cells reaches full charge, bulk charging must be stopped, leaving other cells less than fully charged. To make it possible to bring all cells up to full charge once bulk charging has been completed, the proposed charger would include a number of top-off chargers one for each cell. The top-off chargers would all be powered from the same DC source, but their outputs would be DC-isolated from each other and AC-coupled to their respective cells by means of transformers, as described below. Each top-off charger would include a flyback transformer, an electronic switch, and an output diode. For suppression of undesired electromagnetic emissions, each top-off charger would also include (1) a resistor and capacitor configured to act as a snubber and (2) an inductor and capacitor configured as a filter. The magnetic characteristics of the flyback transformer and the duration of its output pulses determine the energy delivered to the lithium-ion cell. It would be necessary to equip the cell with a precise voltage monitor to determine when the cell reaches full charge. In response to a full-charge reading by this voltage monitor, the electronic switch would be held in the off state. Other cells would continue to be charged similarly by their top-off chargers until their voltage monitors read full charge.

The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

DEFF Research Database (Denmark)

Bennekou, P.; Barksmann, T. L.; Christophersen, P.

2006-01-01

The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

Pressure and gap length dependence of gap breakdown voltage and discharge current of discharge-pumped KrF excimer laser. Hoden reiki KrF laser no zetsuen hakai den prime atsu to reiki denryu no atsuryoku, gap cho izon sei

Energy Technology Data Exchange (ETDEWEB)

Yukimura, K.; Kawakami, H. (Doshisha Univ., Tokyo (Japan)); Hitomi, K. (Kyoto Polytechnic College, Kyoto (Japan))

1991-04-20

On the gap destruction characteristics of UV-preionized discharge-pumped KrF excimer laser (charge transfer type) and the electric characteristics of the excited discharge, studies were made by changing the pressure (1.5-3 atm) and the discharge gap length (14-21 mm) of the discharge medium. (1) Gap breakdown voltage and the maximum current of the excited discharge give a similarity by a product of pressure and the gap length at the charge volatge. (2) Insulation breakdown of the gap occurs at the wave front of the applied voltage and the breakdown time gets delayed by the decreasing voltage applied. By setting the ionization index at constant value 20, the gap breakdown voltage is estimated at the error within 10%. (3) The relation between the maximum current, pressure and the gap length product changes the characteristics by the charge voltage of the primary condenser. With the result combined with the standardization of voltage/current of the excited discharge, the electric characteristics at the specific pressure and gap length can be readily known. 10 refs., 10 figs.

Time-dependent ion selectivity in capacitive charging of porous electrodes

NARCIS (Netherlands)

Zhao, R.; Soestbergen, M.; Rijnaarts, H.H.M.; Wal, van der A.F.; Bazant, M.Z.; Biesheuvel, P.M.

2012-01-01

In a combined experimental and theoretical study, we show that capacitive charging of porous electrodes in multicomponent electrolytes may lead to the phenomenon of time-dependent ion selectivity of the electrical double layers (EDLs) in the electrodes. This effect is found in experiments on

Effect of neutron irradiation on the breakdown voltage of power MOSFET's

International Nuclear Information System (INIS)

Hasan, S.M.Y.; Kosier, S.L.; Schrimpf, R.D.; Galloway, K.F.

1994-01-01

The effect of neutron irradiation on power metal-oxide-semiconductor field effect transistor (power MOSFET) breakdown voltage has been investigated. Transistors with various breakdown voltage ratings were irradiated in a TRIGA nuclear reactor with cumulative fluence levels up to 5 x 10 14 neutrons/cm 2 (1 MeV equivalent). Noticeable increases in the breakdown voltages are observed in n-type MOSFET's after 10 13 neutrons/cm 2 and in p-type MOSFETs after 10 12 neutrons/cm 2 . An increase in breakdown voltage of as much as 30% is observed after 5 x 10 14 neutrons/cm 2 . The increase in breakdown voltage is attributed to the neutron-irradiation-induced defects which decrease the mean free path and trap majority carriers in the space charge region. The effect of positive trapped oxide charge due to concomitant gamma radiation and the effect of the termination structure on the increase in breakdown voltage are considered. An empirical model is presented to predict the value of the breakdown voltage as a function of neutron fluence

Results of cycling with battery charging management; Resultats de cyclage avec gestion de charge au niveau batterie

Energy Technology Data Exchange (ETDEWEB)

Verniolle, J.; Fernandez, C. [European Space Research and Technology Centre, Noordwijk (Netherlands)

1996-12-31

In order to investigate the charging mode of an in-series assembly of lithium-carbon battery cells, a test has been performed on 5 commercial cells (18650) of 0.95 Ah nominal capacity. Results show that it is possible to cycle the cells at 80% of their output capacities during more than 2000 cycles. The management of the battery consists in maintaining a constant battery voltage as soon as a cell reaches its limit voltage during constant current charging. The initial dispersion of cells has been maintained practically constant during the cycling and the charge state of all cells has decreased progressively. (J.S.)

Results of cycling with battery charging management; Resultats de cyclage avec gestion de charge au niveau batterie

Energy Technology Data Exchange (ETDEWEB)

Verniolle, J; Fernandez, C [European Space Research and Technology Centre, Noordwijk (Netherlands)

1997-12-31

In order to investigate the charging mode of an in-series assembly of lithium-carbon battery cells, a test has been performed on 5 commercial cells (18650) of 0.95 Ah nominal capacity. Results show that it is possible to cycle the cells at 80% of their output capacities during more than 2000 cycles. The management of the battery consists in maintaining a constant battery voltage as soon as a cell reaches its limit voltage during constant current charging. The initial dispersion of cells has been maintained practically constant during the cycling and the charge state of all cells has decreased progressively. (J.S.)

Identification of an HV 1 voltage-gated proton channel in insects.

Science.gov (United States)

Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

2016-04-01

The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

Multistage charged particle accelerator, with high-vacuum insulation

International Nuclear Information System (INIS)

Holl, P.

1976-01-01

A multistage charged-particle accelerator for operating with accelerating voltages higher than 150 kV is described. The device consists essentially of a high-voltage insulator, a source for producing charged particles, a Wehnelt cylinder, an anode, and a post-accelerating tube containing stack-wise positioned post-accelerating electrodes. A high vacuum is used for insulating the parts carrying the high voltages, and at least one cylindrical screen surrounding these parts is interposed between them and the vacuum vessel, which can itself also function as a cylindrical screen

Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

Science.gov (United States)

Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

2013-11-01

This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride

International Nuclear Information System (INIS)

Yu Zhenrui; Aceves, Mariano; Carrillo, Jesus; Lopez-Estopier, Rosa

2006-01-01

The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V T . When the applied voltage is smaller than V T , the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V T , the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained