Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing
2014-07-01
Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.
Cryptanalytic Performance Appraisal of Improved CCH2 Proxy Multisignature Scheme
Directory of Open Access Journals (Sweden)
Raman Kumar
2014-01-01
Full Text Available Many of the signature schemes are proposed in which the t out of n threshold schemes are deployed, but they still lack the property of security. In this paper, we have discussed implementation of improved CCH1 and improved CCH2 proxy multisignature scheme based on elliptic curve cryptosystem. We have represented time complexity, space complexity, and computational overhead of improved CCH1 and CCH2 proxy multisignature schemes. We have presented cryptanalysis of improved CCH2 proxy multisignature scheme and showed that improved CCH2 scheme suffered from various attacks, that is, forgery attack and framing attack.
Biswas, Biswajit; Singh, Prashant Chandra
2015-11-11
The effect of hydration on the fluorine free organo-noble gas compound HKrCCH and the role of krypton in the stabilization of the hydrated HKrCCH complexes have been investigated using the quantum chemical calculations on the HKrCCH-(H2O)n=1-6 clusters. Structure and energetics calculations show that water stabilizes HKrCCH through the π hydrogen bond in which the OH group of water interacts with the C[triple bond, length as m-dash]C group of HKrCCH. A maximum of four water molecules can directly interact with the C[triple bond, length as m-dash]C of HKrCCH and after that only inter-hydrogen bonding takes place between the water molecules indicating that the primary hydration shell contains four water molecules. Atom in molecule analysis depicts that π hydrogen bonded complexes of the hydrated HKrCCH are cyclic structures in which the OKr interaction cooperates in the formation of strong O-HC[triple bond, length as m-dash]C interaction. Structure, energetics and charge analysis clearly established that krypton plays an important role in the stabilization as well as the formation of the primary hydration shell of hydrated HKrCCH complexes.
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
Energy Technology Data Exchange (ETDEWEB)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.
DEFF Research Database (Denmark)
Sperlich, Peter
Ice core records of δ13C-CH4 reflect the variability of CH4 biogeochemistry in response to climate change and show this system is far more complex than expected. The first part of this work is concerned with the development of analytical techniques that allow 1) precise referencing and 2) measure......Ice core records of δ13C-CH4 reflect the variability of CH4 biogeochemistry in response to climate change and show this system is far more complex than expected. The first part of this work is concerned with the development of analytical techniques that allow 1) precise referencing and 2......) measurements of δ13C-CH4 in ice core samples as is required when δ13C-CH4 records that are measured in several laboratories are merged for analysis. Both the referencing and measurement techniques have been compared to further laboratories which proofed the accuracy of the analytical systems. The second part...
Sun, M; Halfen, D T; Min, J; Harris, B; Clouthier, D J; Ziurys, L M
2010-11-07
The pure rotational spectrum of CuCCH in its ground electronic state (X̃ (1)Σ(+)) has been measured in the frequency range of 7-305 GHz using Fourier transform microwave (FTMW) and direct absorption millimeter/submillimeter methods. This work is the first spectroscopic study of CuCCH, a model system for copper acetylides. The molecule was synthesized using a new technique, discharge assisted laser ablation spectroscopy (DALAS). Four to five rotational transitions were measured for this species in six isotopologues ((63)CuCCH, (65)CuCCH, (63)Cu(13)CCH, (63)CuC(13)CH, (63)Cu(13)C(13)CH, and (63)CuCCD); hyperfine interactions arising from the copper nucleus were resolved, as well as smaller splittings in CuCCD due to deuterium quadrupole coupling. Five rotational transitions were also recorded in the millimeter region for (63)CuCCH and (65)CuCCH, using a Broida oven source. The combined FTMW and millimeter spectra were analyzed with an effective Hamiltonian, and rotational, electric quadrupole (Cu and D) and copper nuclear spin-rotation constants were determined. From the rotational constants, an r(m)(2) structure for CuCCH was established, with r(Cu-C) = 1.8177(6) Å, r(C-C) = 1.2174(6) Å, and r(C-H) = 1.046(2) Å. The geometry suggests that CuCCH is primarily a covalent species with the copper atom singly bonded to the C≡C-H moiety. The copper quadrupole constant indicates that the bonding orbital of this atom may be sp hybridized. The DALAS technique promises to be fruitful in the study of other small, metal-containing molecules of chemical interest.
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current
DEFF Research Database (Denmark)
Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten
2002-01-01
The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....
On the theory of non-self-maintained low voltage arc discharge
International Nuclear Information System (INIS)
Shcherbinin, P.P.; Cherednichenko, Yu.G.
1980-01-01
In the approximation of constant temperature of plasma electrons for two emitter temperatures 1440 and 1830 K calculated are the volt-ampere characteristics and components of the voltage internal drop in a thermionic converter in the cases of self-maintained discharge in cesium and with an external source of atom ionization and electron heating. It is obtained, that using an external ionization source the decrease of voltage drop in the interelectrode gap with account of ionization energy constitutes about 0.1 V. Electron heating is not effective. For further reduction of voltage losses it is necessary to search for ways for decreasing electron Coulomb scattering on ions
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes
DEFF Research Database (Denmark)
Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R
2006-01-01
Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
LENUS (Irish Health Repository)
Donnellan, Fergal
2010-01-01
Neuroimmune agonists induce epithelial Cl(-) secretion through elevations in intracellular Ca2+ or cAMP. Previously, we demonstrated that epidermal growth factor receptor (EGFR) transactivation and subsequent ERK MAPK activation limits secretory responses to Ca2+-dependent, but not cAMP-dependent, agonists. Although JNK MAPKs are also expressed in epithelial cells, their role in regulating transport function is unknown. Here, we investigated the potential role for JNK in regulating Cl(-) secretion in T(84) colonic epithelial cells. Western blot analysis revealed that a prototypical Ca2+-dependent secretagogue, carbachol (CCh; 100 microM), induced phosphorylation of both the 46-kDa and 54-kDa isoforms of JNK. This effect was mimicked by thapsigargin (TG), which specifically elevates intracellular Ca2+, but not by forskolin (FSK; 10 microM), which elevates cAMP. CCh-induced JNK phosphorylation was attenuated by the EGFR inhibitor, tyrphostin-AG1478 (1 microM). Pretreatment of voltage-clamped T(84) cells with SP600125 (2 microM), a specific JNK inhibitor, potentiated secretory responses to both CCh and TG but not to FSK. The effects of SP600125 on CCh-induced secretion were not additive with those of the ERK inhibitor, PD98059. Finally, in apically permeabilized T(84) cell monolayers, SP600125 potentiated CCh-induced K+ conductances but not Na+\\/K+ATPase activity. These data demonstrate a novel role for JNK MAPK in regulating Ca2+ but not cAMP-dependent epithelial Cl(-) secretion. JNK activation is mediated by EGFR transactivation and exerts its antisecretory effects through inhibition of basolateral K+ channels. These data further our understanding of mechanisms regulating epithelial secretion and underscore the potential for exploitation of MAPK-dependent signaling in treatment of intestinal transport disorders.
New Identifications of the CCH Radical in Planetary Nebulae: A Connection to C60?
Schmidt, D. R.; Ziurys, L. M.
2017-12-01
New detections of CCH have been made toward nine planetary nebulae (PNe), including K4-47, K3-58, K3-17, M3-28, and M4-14. Measurements of the N = 1 → 0 and N = 3 → 2 transitions of this radical near 87 and 262 GHz were carried out using the new 12 m and the Sub-Millimeter Telescope (SMT) of the Arizona Radio Observatory (ARO). The presence of fine and/or hyperfine structure in the spectra aided in the identification. CCH was not observed in two PNe which are sources of C60. The planetary nebulae with positive detections represent a wide range of ages and morphologies, and all had previously been observed in HCN and HNC. Column densities for CCH in the PNe, determined from radiative transfer modeling, were N tot(CCH) ˜ 0.2-3.3 × 1015 cm-2, corresponding to fractional abundances with respect to H2 of f ˜ 0.2-47 × 10-7. The abundance of CCH was found to not vary significantly with kinematic age across a time span of ˜10,000 years, in contrast to predictions of chemical models. CCH appears to be a fairly common constituent of PNe that are carbon-rich, and its distribution may anti-correlate with that of C60. These results suggest that CCH may be a product of C60 photodestruction, which is known to create C2 units. The molecule may subsequently survive the PN stage and populate diffuse clouds. The distinct, double-horned line profiles for CCH observed in K3-45 and M3-28 indicate the possible presence of a bipolar flow oriented at least partially toward the line of sight.
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.
Directory of Open Access Journals (Sweden)
Ting-Feng Lin
Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.
International Nuclear Information System (INIS)
Kniess, Torsten; Rode, Katrin; Wuest, Frank
2008-01-01
The results of [ 11 C]CH 3 I synthesis through hydrogen gas reduction of [ 11 C]CO 2 on different nickel catalysts (HARSHAW-nickel, SHIMALITE-nickel, nickel on silica/alumina, nickel nanosize 99.99%) followed by gas phase iodination using a TRACERlab FX C synthesis unit are reported. Further reaction parameters such as furnace temperatures, flow rate of hydrogen gas and reduction time were optimized. It was found that reduction of [ 11 C]CO 2 proceeded in 28-83% yield depending on the nickel catalyst and temperature. The gas phase iodination (methane conversion) gave 31-62% of [ 11 C]CH 3 I depending on temperature and amount of iodine in the iodine furnace. [ 11 C]CH 3 I was used for heteroatom methylation reactions exemplified by a piperazine and a phenol (1 and 3). The specific activity of the 11 C-labelled products 2 and 4 was determined after HPLC purification and solid-phase extraction. Compounds 2 and 4 were obtained in 8-14% radiochemical yield (decay-corrected, based upon trapped [ 11 C]CH 4 ) within 30 min. The specific activity was determined to be in the range of 20-30 GBq/μmol at the end-of-synthesis. Nickel catalyst nanosize was found to be superior compared with other Ni catalysts tested. The relatively low specific activity may be mainly due to carbon contaminations originating from the long copper tubing (500 m) between the cyclotron and the radiochemistry facility
Directory of Open Access Journals (Sweden)
Rajeev Gupta
2017-06-01
Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Directory of Open Access Journals (Sweden)
Marianna F Tomasello
Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.
The microwave and millimeter spectrum of ZnCCH (X̃2Σ+): a new zinc-containing free radical.
Min, J; Halfen, D T; Sun, M; Harris, B; Ziurys, L M
2012-06-28
The pure rotational spectrum of the ZnCCH (X̃(2)Σ(+)) radical has been measured using Fourier transform microwave (FTMW) and millimeter direct-absorption methods in the frequency range of 7-260 GHz. This work is the first study of ZnCCH by any type of spectroscopic technique. In the FTMW system, the radical was synthesized in a mixture of zinc vapor and 0.05% acetylene in argon, using a discharge assisted laser ablation source. In the millimeter-wave spectrometer, the molecule was created from the reaction of zinc vapor, produced in a Broida-type oven, with pure acetylene in a dc discharge. Thirteen rotational transitions were recorded for the main species, (64)ZnCCH, and between 4 and 10 for the (66)ZnCCH, (68)ZnCCH, (64)ZnCCD, and (64)Zn(13)C(13)CH isotopologues. The fine structure doublets were observed in all the data, and in the FTMW spectra, hydrogen, deuterium, and carbon-13 hyperfine splittings were resolved. The data have been analyzed with a (2)Σ Hamiltonian, and rotational, spin-rotation, and H, D, and (13)C hyperfine parameters have been established for this radical. From the rotational constants, an r(m) ((1)) structure was determined with r(Zn-C) = 1.9083 Å, r(C-C) = 1.2313 Å, and r(C-H) = 1.0508 Å. The geometry suggests that ZnCCH is primarily a covalent species with the zinc atom singly bonded to the C≡C-H moiety. This result is consistent with the hyperfine parameters, which suggest that the unpaired electron is localized on the zinc nucleus. The spin-rotation constant indicates that an excited (2)Π state may exist ∼19,000 cm(-1) in energy above the ground state.
Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik
2018-05-01
Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.
Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy
2004-10-01
We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.
Regulation of KV channel voltage-dependent activation by transmembrane β subunits
Directory of Open Access Journals (Sweden)
Xiaohui eSun
2012-04-01
Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.
Induced voltage due to time-dependent magnetisation textures
International Nuclear Information System (INIS)
Kudtarkar, Santosh Kumar; Dhadwal, Renu
2010-01-01
We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.
Ashok, Anushruti; Rai, Nagendra Kumar; Raza, Waseem; Pandey, Rukmani; Bandyopadhyay, Sanghamitra
2016-11-01
Chronic cerebral hypoperfusion (CCH) manifests Alzheimer's Disease (AD) neuropathology, marked by increased amyloid beta (Aβ). Besides, hypoxia stimulates Heparin-binding EGF-like growth factor (HB-EGF) mRNA expression in the hippocampus. However, involvement of HB-EGF in CCH-induced Aβ pathology remains unidentified. Here, using Bilateral Common Carotid Artery Occlusion mouse model, we explored the mechanism of HB-EGF regulated Aβ induction in CCH. We found that HB-EGF inhibition suppressed, while exogenous-HB-EGF triggered hippocampal Aβ, proving HB-EGF-dependent Aβ increase. We also detected that HB-EGF affected the expression of primary Aβ transporters, receptor for advanced glycation end-products (RAGE) and lipoprotein receptor-related protein-1 (LRP-1), indicating impaired Aβ clearance across the blood-brain barrier (BBB). An HB-EGF-dependent loss in BBB integrity supported impaired Aβ clearance. The effect of HB-EGF on Amyloid Precursor Protein pathway was relatively insignificant, suggesting a lesser effect on Aβ generation. Delving into BBB disruption mechanism demonstrated HB-EGF-mediated stimulation of Matrix metalloprotease-9 (MMP9), which affected BBB via HB-EGF-ectodomain shedding and epidermal growth factor receptor activation. Examining the intersection of HB-EGF-regulated pathway and hypoxia revealed HB-EGF-dependent increase in transcription factor, Hypoxia-inducible factor-1alpha (HIF1α). Further, via binding to hypoxia-responsive elements in MMP9 gene, HIF1α stimulated MMP9 expression, and therefore appeared as a prominent intermediary in HB-EGF-induced BBB damage. Overall, our study reveals the essential role of HB-EGF in triggering CCH-mediated Aβ accumulation. The proposed mechanism involves an HB-EGF-dependent HIF1α increase, generating MMP9 that stimulates soluble-HB-EGF/EGFR-induced BBB disintegration. Consequently, CCH-mediated hippocampal RAGE and LRP-1 deregulation together with BBB damage impair Aβ transport and clearance
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms
DEFF Research Database (Denmark)
Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta
2008-01-01
The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...
Cantrell, A R; Scheuer, T; Catterall, W A
1999-07-01
Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.
Min, J; Ziurys, L M
2016-05-14
Pure rotational spectroscopy of the CrC (X(3)Σ(-)) and CrCCH (X̃ (6)Σ(+)) radicals has been conducted using millimeter/sub-millimeter direct absorption methods in the frequency range 225-585 GHz. These species were created in an AC discharge of Cr(CO)6 and either methane or acetylene, diluted in argon. Spectra of the CrCCD were also recorded for the first time using deuterated acetylene as the carbon precursor. Seven rotational transitions of CrC were measured, each consisting of three widely spaced, fine structure components, arising from spin-spin and spin-rotation interactions. Eleven rotational transitions were recorded for CrCCH and five for CrCCD; each transition in these cases was composed of a distinct fine structure sextet. These measurements confirm the respective (3)Σ(-) and (6)Σ(+) ground electronic states of these radicals, as indicated from optical studies. The data were analyzed using a Hund's case (b) Hamiltonian, and rotational, spin-spin, and spin-rotation constants have been accurately determined for all three species. The spectroscopic parameters for CrC were significantly revised from previous optical work, while those for CrCCH are in excellent agreement; completely new constants were established for CrCCD. The chromium-carbon bond length for CrC was calculated to be 1.631 Å, while that in CrCCH was found to be rCr-C = 1.993 Å - significantly longer. This result suggests that a single Cr-C bond is present in CrCCH, preserving the acetylenic structure of the ligand, while a triple bond exists in CrC. Analysis of the spin constants suggests that CrC has a nearby excited (1)Σ(+) state lying ∼16 900 cm(-1) higher in energy, and CrCCH has a (6)Π excited state with E ∼ 4800 cm(-1).
Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells
International Nuclear Information System (INIS)
Diserbo, M.; Barbier, M.; Quignard, J.F.
1998-01-01
Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-01-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Choix, Francisco J; Snell-Castro, Raúl; Arreola-Vargas, Jorge; Carbajal-López, Alberto; Méndez-Acosta, Hugo O
2017-12-01
In the present study, the capacity of the cyanobacterium Leptolyngbya sp. CChF1 to remove CO 2 from real and synthetic biogas was evaluated. The identification of the cyanobacterium, isolated from the lake Chapala, was carried out by means of morphological and molecular analyses, while its potential for CO 2 removal from biogas streams was evaluated by kinetic experiments and optimized by a central composite design coupled to a response surface methodology. Results demonstrated that Leptolyngbya sp. CChF1 is able to remove CO 2 and grow indistinctly in real or synthetic biogas streams, showing tolerance to high concentrations of CO 2 and CH 4 , 25 and 75%, respectively. The characterization of the biomass composition at the end of the kinetic assays revealed that the main accumulated by-products under both biogas streams were lipids, followed by proteins and carbohydrates. Regarding the optimization experiments, light intensity and temperature were the studied variables, while synthetic biogas was the carbon source. Results showed that light intensity was significant for CO 2 capture efficiency (p = 0.0290), while temperature was significant for biomass production (p = 0.0024). The predicted CO 2 capture efficiency under optimal conditions (27.1 °C and 920 lx) was 93.48%. Overall, the results of the present study suggest that Leptolyngbya sp. CChF1 is a suitable candidate for biogas upgrading.
Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel
International Nuclear Information System (INIS)
Barchi, R.L.; Tanaka, J.C.
1984-01-01
In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab
C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.
Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer
2013-09-01
Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.
Photofragment imaging study of the CH2CCH2OH radical intermediate of the OH+allene reaction
International Nuclear Information System (INIS)
Raman, Arjun S.; Justine Bell, M.; Lau, K.-C.; Butler, Laurie J.
2007-01-01
These velocity map imaging experiments characterize the photolytic generation of one of the two radical intermediates formed when OH reacts via an addition mechanism with allene. The CH 2 CCH 2 OH radical intermediate is generated photolytically from the photodissociation of 2-chloro-2-propen-1-ol at 193 nm. Detecting the Cl atoms using [2+1] resonance-enhanced multiphoton ionization evidences an isotropic angular distribution for the Cl+CH 2 CCH 2 OH photofragments, a spin-orbit branching ratio for Cl( 2 P 1/2 ):Cl( 2 P 3/2 ) of 0.28, and a bimodal recoil kinetic energy distribution. Conservation of momentum and energy allows us to determine from this data the internal energy distribution of the nascent CH 2 CCH 2 OH radical cofragment. To assess the possible subsequent decomposition pathways of this highly vibrationally excited radical intermediate, we include electronic structure calculations at the G3//B3LYP level of theory. They predict the isomerization and dissociation transition states en route from the initial CH 2 CCH 2 OH radical intermediate to the three most important product channels for the OH+allene reaction expected from this radical intermediate: formaldehyde+C 2 H 3 , H+acrolein, and ethene+CHO. We also calculate the intermediates and transition states en route from the other radical adduct, formed by addition of the OH to the center carbon of allene, to the ketene+CH 3 product channel. We compare our results to a previous theoretical study of the O+allyl reaction conducted at the CBS-QB3 level of theory, as the two reactions include several common intermediates
Photofragment imaging study of the CH2CCH2OH radical intermediate of the OH +allene reaction
Raman, Arjun S.; Justine Bell, M.; Lau, Kai-Chung; Butler, Laurie J.
2007-10-01
These velocity map imaging experiments characterize the photolytic generation of one of the two radical intermediates formed when OH reacts via an addition mechanism with allene. The CH2CCH2OH radical intermediate is generated photolytically from the photodissociation of 2-chloro-2-propen-1-ol at 193nm. Detecting the Cl atoms using [2+1] resonance-enhanced multiphoton ionization evidences an isotropic angular distribution for the Cl +CH2CCH2OH photofragments, a spin-orbit branching ratio for Cl(P1/22):Cl(P3/22) of 0.28, and a bimodal recoil kinetic energy distribution. Conservation of momentum and energy allows us to determine from this data the internal energy distribution of the nascent CH2CCH2OH radical cofragment. To assess the possible subsequent decomposition pathways of this highly vibrationally excited radical intermediate, we include electronic structure calculations at the G3//B3LYP level of theory. They predict the isomerization and dissociation transition states en route from the initial CH2CCH2OH radical intermediate to the three most important product channels for the OH +allene reaction expected from this radical intermediate: formaldehyde+C2H3, H +acrolein, and ethene+CHO. We also calculate the intermediates and transition states en route from the other radical adduct, formed by addition of the OH to the center carbon of allene, to the ketene+CH3 product channel. We compare our results to a previous theoretical study of the O +allyl reaction conducted at the CBS-QB3 level of theory, as the two reactions include several common intermediates.
DEFF Research Database (Denmark)
Garau, Gianpiero; Magotti, Paola; Heine, Martin
2015-01-01
Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...
Voltage-dependent amplification of synaptic inputs in respiratory motoneurones
Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A
2012-01-01
The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Marinho, Maria Vanda; Yoshida, Maria Irene; Guedes, Kassilio J; Krambrock, Klaus; Bortoluzzi, Adailton J; Hörner, Manfredo; Machado, Flávia C; Teles, Wagner M
2004-02-23
From the reaction between a dinuclear paddle-wheel carboxylate, namely [Cu2mu-(O2CCH2C4H3S)4] (1), and the flexible ligand 1,3-bis(4-pyridyl)propane (BPP) a neutral 2-D coordination polymer [[Cu2(O2CCH2C4H3S)4mu-(BPP)2
Vector spin modeling for magnetic tunnel junctions with voltage dependent effects
International Nuclear Information System (INIS)
Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.
2014-01-01
Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects
Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.
Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio
2016-11-17
Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating
Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar
2012-01-01
The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342
Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.
Held, Katharina; Voets, Thomas; Vriens, Joris
2016-01-01
Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.
Cloning and functional expression of a plant voltage-dependent chloride channel.
Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C
1996-01-01
Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442
International Nuclear Information System (INIS)
Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika
2006-01-01
An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)
Chewing Maintains Hippocampus-Dependent Cognitive Function.
Chen, Huayue; Iinuma, Mitsuo; Onozuka, Minoru; Kubo, Kin-Ya
2015-01-01
Mastication (chewing) is important not only for food intake, but also for preserving and promoting the general health. Recent studies have showed that mastication helps to maintain cognitive functions in the hippocampus, a central nervous system region vital for spatial memory and learning. The purpose of this paper is to review the recent progress of the association between mastication and the hippocampus-dependent cognitive function. There are multiple neural circuits connecting the masticatory organs and the hippocampus. Both animal and human studies indicated that cognitive functioning is influenced by mastication. Masticatory dysfunction is associated with the hippocampal morphological impairments and the hippocampus-dependent spatial memory deficits, especially in elderly. Mastication is an effective behavior for maintaining the hippocampus-dependent cognitive performance, which deteriorates with aging. Therefore, chewing may represent a useful approach in preserving and promoting the hippocampus-dependent cognitive function in older people. We also discussed several possible mechanisms involved in the interaction between mastication and the hippocampal neurogenesis and the future directions for this unique fascinating research.
Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process
Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.
1988-08-01
Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.
Directory of Open Access Journals (Sweden)
Seok-Yong Lee
2009-03-01
Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A
2017-05-01
Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
Wind Power Plant Voltage Stability Evaluation: Preprint
Energy Technology Data Exchange (ETDEWEB)
Muljadi, E.; Zhang, Y. C.
2014-09-01
Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.
Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi
2017-11-01
A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Directory of Open Access Journals (Sweden)
Mohamad Khairul Anuar
2017-01-01
Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification
Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo
2013-01-01
In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...
Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M
1993-01-01
A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from
Monitoring operating temperature and supply voltage in achieving high system dependability
Khan, M.A.; Kerkhoff, Hans G.
2013-01-01
System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability
Directory of Open Access Journals (Sweden)
Wei Xia
2015-01-01
Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter
Directory of Open Access Journals (Sweden)
Padalko D.A.
2017-12-01
Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.
Single-InN-Nanowire Nanogenerator with Upto 1 V Output Voltage
Huang, Chi-Te
2010-07-30
Piezoelectric potential of a InN nanowire (NW) growing along [011̄0] can be positive, negative, and zero depending on the direction of the applied transverse force. By measuring the output voltage of a InN-NW-based nanogenerator, about 40% to 55% of output voltages are within the range of ?1 and ?20 mV, and 25% to 30% of output voltages would exceed ?100 mV. Some output voltages could reach the magnitude of ?1000 mV, showing its great potential for fabricating high-output nanogenerators. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Identification of an HV 1 voltage-gated proton channel in insects.
Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris
2016-04-01
The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.
Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.
2018-04-01
Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.
Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.
Freites, J Alfredo; Tobias, Douglas J
2015-06-01
Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.
Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites
Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.
2000-01-01
We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...
Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R
2003-03-01
The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.
International Nuclear Information System (INIS)
Yamacli, Serhan; Avci, Mutlu
2009-01-01
In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.
Directory of Open Access Journals (Sweden)
Jessica A Hennessey
Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of
Petit, C.; Zander, D.
2007-10-01
It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).
International Nuclear Information System (INIS)
Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A
2010-01-01
Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway
Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A
2018-02-21
Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.
Arancibia, Sergio; Del Campo, Miguel; Nova, Esteban; Salazar, Fabián; Becker, María Inés
2012-03-01
Hemocyanins, which boost the immune system of mammals, have been used as carrier-adjuvants to promote Ab production against haptens and peptides, as immunostimulants during therapy for bladder carcinoma and as a component in therapeutic vaccines for cancer. These biomedical applications have led to growing interest in obtaining hemocyanins with high immunogenicity. Here, we study the immunological properties of a modified oxidized Concholepas concholepas hemocyanin (Ox-CCH) obtained by the oxidation of its carbohydrates using sodium periodate. We assessed the internalization of Ox-CCH into DCs and its immunogenicity and antitumor effects. Transmission electron microscopy showed no changes in Ox-CCH quaternary structure with respect to native CCH, although proteolytic treatment followed by SDS-PAGE analysis demonstrated that Schiff bases were formed. Interestingly, DCs internalized Ox-CCH faster than CCH, mainly through macropinocytosis. During this process, Ox-CCH remained inside endosome-like structures for a longer period. Mouse immunization experiments demonstrated that Ox-CCH is more immunogenic and a better carrier than CCH. Moreover, Ox-CCH showed a significant antitumor effect in the B16F10 melanoma model similar to that produced by CCH, inducing IFN-γ secretion. Together, these data demonstrate that the aldehydes formed by the periodate oxidation of sugar moieties stabilizes the CCH structure, increasing its adjuvant/immunostimulatory carrier effects. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Fukin, Georgy K.; Samsonov, Maxim A.; Arapova, Alla V.; Mazur, Anton S.; Artamonova, Tatiana O.; Khodorkovskiy, Mikhail A.; Vasilyev, Aleksander V.
2017-10-01
In this paper we present the results of a high-resolution single crystal X-ray diffraction experiment of a triphenylantimony diacrylate (Ph3Sb(O2CCH=CH2)2 (1)) and a subsequent charge density study based on a topological analysis according to quantum theory of atoms in molecules (QTAIM) together with density functional theory (DFT) calculation of isolated molecule. The QTAIM was used to investigate nature of the chemical bonds and molecular graph of Ph3Sb(O2CCH=CH2)2 complex. The molecular graph shows that only in one acrylate group there is an evidence of bonding between antimony and carbonyl oxygen atom in terms of the presence of a bond path. Thus the molecular graph for this class of compounds does not provide a definitive picture of the chemical bonding and should be complemented with other descriptors, such as and a source function (SF), noncovalent interaction (NCI) index and delocalization index (DI). Moreover the realization of π…π interactions between double bonds of acrylate groups in adjacent molecules allowed us to carry out a thermopolimerization reaction in crystals of Ph3Sb(O2CCH=CH2)2 complex and to determine a probable structure of polymer by solid state CP/MAS 13C NMR.
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-01
Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.
2002-01-01
Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Energy Technology Data Exchange (ETDEWEB)
Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)
2014-03-31
This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.
Directory of Open Access Journals (Sweden)
Ying Yang
2017-01-01
Full Text Available Hypoxia inducible factor 1α (HIF-1α, a pivotal regulator of gene expression in response to hypoxia and ischemia, is now considered to regulate both pro-survival and pro-death responses depending on the duration and severity of the stress. We previously showed that chronic global cerebral hypoperfusion (CCH triggered long-lasting accumulation of HIF-1α protein in the hippocampus of rats. However, the role of the stabilized HIF-1α in CCH is obscure. Here, we knock down endogenous HIF-1α to determine whether and how HIF-1α affects the disease processes and phenotypes of CCH. Lentivirus expressing HIF-1α small hairpin RNA was injected into the bilateral hippocampus and bilateral ventricles to knock down HIF-1α gene expression in the hippocampus and other brain areas. Permanent bilateral common carotid artery occlusions, known as 2-vessel occlusions (2VOs, were used to induce CCH in rats. Angiogenesis, oxidative stress, histopathological changes of the brain, and cognitive function were tested. Knockdown of HIF-1α prior to 2VO significantly exacerbates the impairment of learning and memory after four weeks of CCH. Mechanically, reduced cerebral angiogenesis, increased oxidative damage, and increased density of astrocytes and microglia in the cortex and some subregions of hippocampus are also shown after four weeks of CCH. Furthermore, HIF-1α knockdown also disrupts upregulation of regulated downstream genes. Our findings suggest that HIF-1α-protects the brain from oxidative stress and inflammation response in the disease process of CCH. Accumulated HIF-1α during CCH mediates endogenous adaptive processes to defend against more severe hypoperfusion injury of the brain, which may provide a therapeutic benefit.
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Hahlbohm, H.D.; Luebbig, H.; Luther, H.
1975-01-01
Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)
Maintainability analysis considering time-dependent and time-independent covariates
International Nuclear Information System (INIS)
Barabadi, Abbas; Barabady, Javad; Markeset, Tore
2011-01-01
Traditional parametric methods for assessing maintainability most often only consider time to repair (TTR) as a single explanatory variable. However, to predict availability more precisely for high availability systems, a better model is needed to quantify the effect of operational environment on maintainability. The proportional repair model (PRM), which is developed based on proportional hazard model (PHM), may be used to analyze maintainability in the present of covariates. In the PRM, the effect of covariates is considered to be time independent. However this assumption may not be valid for some situations. The aim of this paper is to develop the Cox regression model and its extension in the presence of time-dependent covariates for determining maintainability. A simple case study is used to demonstrate how the model can be applied in a real case.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP
Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.
2010-01-01
In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128
Directory of Open Access Journals (Sweden)
Alicia Lundby
2008-06-01
Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.
Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S
2016-03-01
Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2001-01-01
The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...
Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram
DEFF Research Database (Denmark)
Nielsen, S.K.; Noat, Y.; Brandbyge, Mads
2003-01-01
The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...
DEFF Research Database (Denmark)
Bennekou, P.; Barksmann, T. L.; Christophersen, P.
2006-01-01
The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...
Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid
Directory of Open Access Journals (Sweden)
Galyna Maleeva
2017-05-01
Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.
Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C
2016-01-01
The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.
International Nuclear Information System (INIS)
Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.
1988-01-01
The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns
Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg
2014-04-01
Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages
Directory of Open Access Journals (Sweden)
Zhi-Yong Li
2013-01-01
Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.
Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah
2012-01-01
The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
DEFF Research Database (Denmark)
Timmermann, D B; Lund, Trine Meldgaard; Belhage, B
2001-01-01
The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...
Directory of Open Access Journals (Sweden)
Laura Mejía-Teniente
2015-11-01
Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G
2015-11-25
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio
2010-09-15
Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.
Kangasaho, V. E.; Tsuruta, A.; Aalto, T.; Backman, L. B.; Houweling, S.; Krol, M. C.; Peters, W.; van der Laan-Luijkx, I. T.; Lienert, S.; Joos, F.; Dlugokencky, E. J.; Michael, S.; White, J. W. C.
2017-12-01
The atmospheric burden of CH4 has more than doubled since preindustrial time. Evaluating the contribution from anthropogenic and natural emissions to the global methane budget is of great importance to better understand the significance of different sources at the global scale, and their contribution to changes in growth rate of atmospheric CH4 before and after 2006. In addition, observations of δ13C-CH4 suggest an increase in natural sources after 2006, which matches the observed increase and variation of CH4 abudance. Methane emission sources can be identified using δ13C-CH4, because different sources produce methane with process-specific isotopic signatures. This study focuses on inversion model based estimates of global anthropogenic and natural methane emission rates to evaluate the existing methane emission estimates with a new δ13C-CH4 inversion system. In situ measurements of atmospheric methane and δ13C-CH4 isotopic signature, provided by the NOAA Global Monitoring Division and the Institute of Arctic and Alpine Research, will be assimilated into the CTDAS-13C-CH4. The system uses the TM5 atmospheric transport model as an observation operator, constrained by ECMWF ERA Interim meteorological fields, and off-line TM5 chemistry fields to account for the atmospheric methane sink. LPX-Bern DYPTOP ecosystem model is used for prior natural methane emissions from wetlands, peatlands and mineral soils, GFED v4 for prior fire emissions and EDGAR v4.2 FT2010 inventory for prior anthropogenic emissions. The EDGAR antropogenic emissions are re-divided into enteric fermentation and manure management, landfills and waste water, rice, coal, oil and gas, and residential emissions, and the trend of total emissions is scaled to match optimized anthropogenic emissions from CTE-CH4. In addition to these categories, emissions from termites and oceans are included. Process specific δ13C-CH4 isotopic signatures are assigned to each emission source to estimate 13CH4 fraction
Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo
2017-08-29
Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.
Directory of Open Access Journals (Sweden)
Mesbahus Saleheen
2016-05-01
Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.
International Nuclear Information System (INIS)
Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi
2009-01-01
Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms
Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.
Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf
2006-03-01
We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.
30 CFR 77.704-1 - Work on high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Work on high-voltage lines. 77.704-1 Section 77... MINES Grounding § 77.704-1 Work on high-voltage lines. (a) No high-voltage line shall be regarded as... provided in § 77.103) that such high-voltage line has been deenergized and grounded. Such qualified person...
Osteen, Jeremiah D; Sampson, Kevin; Iyer, Vivek; Julius, David; Bosmans, Frank
2017-06-27
The Na v 1.1 voltage-gated sodium channel is a critical contributor to excitability in the brain, where pathological loss of function leads to such disorders as epilepsy, Alzheimer's disease, and autism. This voltage-gated sodium (Na v ) channel subtype also plays an important role in mechanical pain signaling by primary afferent somatosensory neurons. Therefore, pharmacologic modulation of Na v 1.1 represents a potential strategy for treating excitability disorders of the brain and periphery. Inactivation is a complex aspect of Na v channel gating and consists of fast and slow components, each of which may involve a contribution from one or more voltage-sensing domains. Here, we exploit the Hm1a spider toxin, a Na v 1.1-selective modulator, to better understand the relationship between these temporally distinct modes of inactivation and ask whether they can be distinguished pharmacologically. We show that Hm1a inhibits the gating movement of the domain IV voltage sensor (VSDIV), hindering both fast and slow inactivation and leading to an increase in Na v 1.1 availability during high-frequency stimulation. In contrast, ICA-121431, a small-molecule Na v 1.1 inhibitor, accelerates a subsequent VSDIV gating transition to accelerate entry into the slow inactivated state, resulting in use-dependent block. Further evidence for functional coupling between fast and slow inactivation is provided by a Na v 1.1 mutant in which fast inactivation removal has complex effects on slow inactivation. Taken together, our data substantiate the key role of VSDIV in Na v channel fast and slow inactivation and demonstrate that these gating processes are sequential and coupled through VSDIV. These findings provide insight into a pharmacophore on VSDIV through which modulation of inactivation gating can inhibit or facilitate Na v 1.1 function.
Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.
Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin
2013-08-06
Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.
Control of total voltage in the large distributed RF system of LEP
Ciapala, Edmond
1995-01-01
The LEP RF system is made up of a large number of independent RF units situated around the ring near the interaction points. These have different available RF voltages depending on their type and they may be inactive or unable to provide full voltage for certain periods. The original RF voltage control system was based on local RF unit voltage function generators pre-loaded with individual tables for energy ramping. This was replaced this year by a more flexible global RF voltage control system. A central controller in the main control room has direct access to the units over the LEP TDM system via multiplexers and local serial links. It continuously checks the state of all the units and adjusts their voltages to maintain the desired total voltage under all conditions. This voltage is distributed among the individual units to reduce the adverse effects of RF voltage asymmetry around the machine as far as possible. The central controller is a VME system with 68040 CPU and real time multitasking operating syste...
Vaccaro, S. R.
2011-09-01
The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.
Grafting voltage and pharmacological sensitivity in potassium channels.
Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing
2016-08-01
A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.
DEFF Research Database (Denmark)
Anand, Sandeep; G. Fernandes, Baylon; Guerrero, Josep M.
2013-01-01
DC microgrids are gaining popularity due to high efficiency, high reliability, and easy interconnection of renewable sources as compared to the ac system. Control objectives of dc microgrid are: 1) to ensure equal load sharing (in per unit) among sources; and 2) to maintain low-voltage regulation...
Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli
2016-01-01
Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007
International Nuclear Information System (INIS)
Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu
2015-01-01
Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)
Low voltage electron beam accelerators
International Nuclear Information System (INIS)
Ochi, Masafumi
2003-01-01
Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)
Low voltage electron beam accelerators
Energy Technology Data Exchange (ETDEWEB)
Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)
2003-02-01
Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)
Calcium dependence of eugenol tolerance and toxicity in Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Stephen K Roberts
Full Text Available Eugenol is a plant-derived phenolic compound which has recognised therapeutical potential as an antifungal agent. However little is known of either its fungicidal activity or the mechanisms employed by fungi to tolerate eugenol toxicity. A better exploitation of eugenol as a therapeutic agent will therefore depend on addressing this knowledge gap. Eugenol initiates increases in cytosolic Ca2+ in Saccharomyces cerevisiae which is partly dependent on the plasma membrane calcium channel, Cch1p. However, it is unclear whether a toxic cytosolic Ca2+elevation mediates the fungicidal activity of eugenol. In the present study, no significant difference in yeast survival was observed following transient eugenol treatment in the presence or absence of extracellular Ca2+. Furthermore, using yeast expressing apoaequorin to report cytosolic Ca2+ and a range of eugenol derivatives, antifungal activity did not appear to be coupled to Ca2+ influx or cytosolic Ca2+ elevation. Taken together, these results suggest that eugenol toxicity is not dependent on a toxic influx of Ca2+. In contrast, careful control of extracellular Ca2+ (using EGTA or BAPTA revealed that tolerance of yeast to eugenol depended on Ca2+ influx via Cch1p. These findings expose significant differences between the antifungal activity of eugenol and that of azoles, amiodarone and carvacrol. This study highlights the potential to use eugenol in combination with other antifungal agents that exhibit differing modes of action as antifungal agents to combat drug resistant infections.
Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S
2017-06-02
Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Yeh, Chi-Wei; Hsu, Li-Sung
2016-12-01
The small GTPase Ras superfamily regulates several neuronal functions including neurite outgrowth and neuron proliferation. In this study, zebrafish diras1a and diras1b were identified and were found to be mainly expressed in the central nervous system and dorsal neuron ganglion. Overexpression of green fluorescent protein (GFP)-diras1a or GFP-diras1b triggered neurite outgrowth of Neuro-2a cells. The wild types, but not the C terminus truncated forms, of diras1a and diras1b elevated the protein level of Ras-related C3 botulinum toxin substrate 1 (Rac1) and downregulated Ras homologous member A (RhoA) expression. Glutathione S-transferase (GST) pull-down assay also revealed that diras1a and diras1b enhanced Rac1 activity. Interfering with Rac1, Pak1, or cyclin-dependent kinase 5 (CDK5) activity or with the Arp2/3 inhibitor prevented diras1a and diras1b from mediating the neurite outgrowth effects. In the zebrafish model, knockdown of diras1a and/or diras1b by morpholino antisense oligonucleotides not only reduced axon guidance but also caused the loss of trigeminal ganglion without affecting the precursor markers, such as ngn1 and neuroD. Co-injection with messenger RNA (mRNA) derived from mouse diras1 or constitutively active human Rac1 restored the population of trigeminal ganglion. In conclusion, we provided preliminary evidence that diras1 is involved in neurite outgrowth and maintains the number of trigeminal ganglions through the Rac1-dependent pathway.
30 CFR 75.705-1 - Work on high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Work on high-voltage lines. 75.705-1 Section 75... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Grounding § 75.705-1 Work on high-voltage lines. (a) Section 75.705 specifically prohibits work on energized high-voltage lines underground; (b...
Gabapentin Modulates HCN4 Channel Voltage-Dependence
Directory of Open Access Journals (Sweden)
Han-Shen Tae
2017-08-01
Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.
Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing
Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.
2013-01-01
Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the
Energy Technology Data Exchange (ETDEWEB)
Arora, N D
1987-05-01
A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.
Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal
Kim, Younggy
2011-01-01
Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.
Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors
International Nuclear Information System (INIS)
Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.
1993-01-01
The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature
Dual Regulation of Voltage-Sensitive Ion Channels by PIP2
Directory of Open Access Journals (Sweden)
Aldo A Rodríguez Menchaca
2012-09-01
Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.
Film size-dependent voltage-modulated magnetism in multiferroic heterostructures
Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.
2014-01-01
The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375
Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors
Directory of Open Access Journals (Sweden)
Salmela Iikka
2012-08-01
Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.
DEFF Research Database (Denmark)
Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia
2016-01-01
This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
30 CFR 77.902-1 - Fail safe ground check circuits; maximum voltage.
2010-07-01
... voltage. 77.902-1 Section 77.902-1 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... OF UNDERGROUND COAL MINES Low- and Medium-Voltage Alternating Current Circuits § 77.902-1 Fail safe ground check circuits; maximum voltage. The maximum voltage used for ground check circuits under § 77.902...
30 CFR 77.803-1 - Fail safe ground check circuits; maximum voltage.
2010-07-01
... voltage. 77.803-1 Section 77.803-1 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.803-1 Fail safe ground check circuits; maximum voltage. The maximum voltage used for ground check circuits under § 77.803 shall not...
International Nuclear Information System (INIS)
Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.
2008-01-01
Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field
International Nuclear Information System (INIS)
Miah, M. Idrish
2008-01-01
The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed
Dharia, Sameera; Rabbitt, Richard D.
2011-01-01
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Directory of Open Access Journals (Sweden)
Kao HSR
2018-01-01
Full Text Available Henry SR Kao,1 Stewart PW Lam,2 Tin Tin Kao3,4 1Calligraphy Therapy Laboratory, Shenzhen Institute of Neuroscience, Shenzhen, China; 2Research and Development Division, Calli-Health Society, 3Department of Geography, 4Department of Psychology, University of Hong Kong, Hong Kong Introduction: This study investigated the efficacy of Chinese calligraphy handwriting (CCH for the awakening of patients under a vegetative state after stroke. The theories, the instrument, and the treatment protocols were reported. A single case of a severe stroke patient who was in a coma state for 2 years is presented in this study. The objectives were to apply finger writing as a new method to awaken a stroke patient in a coma state and to test the effect of this method in improving the patient’s vegetative states over time. Case presentation: A 55-year-old man suffered a severe stroke in 2004 which left him in a coma for 2 years without any systematic rehabilitation. A culture-based finger-writing method of visual-spatial intervention was then applied to improve his condition. The writing tasks involved aided viewing and finger tracing of sets of innovative characters with enriched visual-spatial and movement characteristics. Following regular treatment protocols involving diverse movement and sensory feedback, the patient was awakened after 12 months. As a consequence, the patient showed significant behavioral changes favoring enhanced focusing, alertness, visual scan, visual span, and quickened visual and motor responses. The treatment continued for another 12 months. As the treatment progressed, we gradually observed improvements in his attention span and mental concentration. His eye ball movements – the left eye in particular – were quickened and showed wider visual angularity in his focal vision. Currently, the patient can now watch television, engage in improved visual sighting, and focus on visual-spatial and cognitive-linguistic materials. Conclusion
30 CFR 77.807-1 - High-voltage powerlines; clearances above ground.
2010-07-01
... OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.807-1 High-voltage powerlines; clearances above ground. High-voltage powerlines located above driveways, haulageways, and railroad tracks...
rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays
International Nuclear Information System (INIS)
Hebboul, S.E.; Garland, J.C.
1993-01-01
We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations
Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field
Energy Technology Data Exchange (ETDEWEB)
Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au
2008-10-15
The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.
Terachi, Momomi; Hirono, Chikara; Kitagawa, Michinori; Sugita, Makoto
2018-06-01
Cholinergic agonists evoke elevations of the cytoplasmic free-calcium concentration ([Ca 2+ ] i ) to stimulate fluid secretion in salivary glands. Salivary flow rates are significantly reduced in diabetic patients. However, it remains elusive how salivary secretion is impaired in diabetes. Here, we used an ex vivo submandibular gland perfusion technique to characterize the dependency of salivary flow rates on extracellular glucose concentration and activities of glucose transporters expressed in the glands. The cholinergic agonist carbachol (CCh) induced sustained fluid secretion, the rates of which were modulated by the extracellular glucose concentration in a biphasic manner. Both lowering the extracellular glucose concentration to less than 2.5 mM and elevating it to higher than 5 mM resulted in decreased CCh-induced fluid secretion. The CCh-induced salivary flow was suppressed by phlorizin, an inhibitor of the sodium-glucose cotransporter 1 (SGLT1) located basolaterally in submandibular acinar cells, which is altered at the protein expression level in diabetic animal models. Our data suggest that SGLT1-mediated glucose uptake in acinar cells is required to maintain the fluid secretion by sustaining Cl - secretion in real-time. High extracellular glucose levels may suppress the CCh-induced secretion of salivary fluid by altering the activities of ion channels and transporters downstream of [Ca 2+ ] i signals. © 2018 Eur J Oral Sci.
Energy Technology Data Exchange (ETDEWEB)
Lee, Nam Woo [Fuel Cell Technology Development Team, Eco-Technology Center, Hyundai-Kia Motors, Yongin (Korea, Republic of); Kim, Young Sang; Kim, Min Soo [Dept. of Mechanical and Aerospace Engineering, Seoul National University, Seoul (Korea, Republic of); Kim, Min Sung [School of Energy Systems Engineering, Chung-Ang University, Seoul (Korea, Republic of)
2016-09-15
Decreasing the voltage of a fuel cell through hydrogen mixing or using low-air stoichiometry ratio is beneficial to remove condensed water inside GDL under flooding condition. In this study, the effect of voltage level of a fuel cell on water distribution in GDL under flooding condition was numerically analyzed. Water content in GDL was dependent on the voltage level of a fuel cell, that is, the water content was low when the cell voltage was maintained low. The effect of voltage change under flooding condition was also simulated. The flow rate of condensed water inside GDL considerably increased immediately after decreasing the cell voltage. The oxygen concentration in the catalyst layer was increased by decreasing the voltage of the fuel cell. Consequently, the cell voltage was recovered. Therefore, decreasing cell voltage under flooding condition can facilitate removal of condensed water in GDL.
Current–voltage characteristics of manganite–titanite perovskite junctions
Directory of Open Access Journals (Sweden)
Benedikt Ifland
2015-07-01
Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.
Directory of Open Access Journals (Sweden)
Zhixin Lin
Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.
Thermal voltage noise in layered superconductors
International Nuclear Information System (INIS)
Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.
1995-01-01
Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields
Potentiation of glycine-gated NR1/NR3A NMDA receptors relieves Ca2+-dependent outward rectification
Directory of Open Access Journals (Sweden)
Christian Madry
2010-03-01
Full Text Available Glycine has diverse functions within the mammalian central nervous system. It inhibits postsynaptic neurons via strychnine-sensitive glycine receptors (GlyRs and enhances neuronal excitation through co-activation of N-methyl-D-aspartate (NMDA receptors. Classical Ca2+-permeable NMDA receptors are composed of glycine-binding NR1 and glutamate-binding NR2 subunits, and hence require both glutamate and glycine for efficient activation. In contrast, recombinant receptors composed of NR1 and the glycine binding NR3A and/or NR3B subunits lack glutamate binding sites and can be activated by glycine alone. Therefore these receptors are also named excitatory glycine receptors. Co-application of antagonists of the NR1 glycine-binding site or of the divalent cation Zn2+ markedly enhances the glycine responses of these receptors. To gain further insight into the properties of these glycine-gated NMDA receptors, we investigated their current-voltage (I-V dependence. Whole-cell current-voltage relations of glycine currents recorded from NR1/NR3B and NR1/NR3A/NR3B expressing oocytes were found to be linear under our recording conditions. In contrast, NR1/NR3A receptors displayed a strong outwardly rectifying I-V relation. Interestingly, the voltage-dependent inward current block was abolished in the presence of NR1 antagonists, Zn2+ or a combination of both. Further analysis revealed that Ca2+ (1.8 mM present in our recording solutions was responsible for the voltage-dependent inhibition of ion flux through NR1/NR3A receptors. Since physiological concentrations of the divalent cation Mg2+ did not affect the I-V dependence, our data suggest that relief of the voltage-dependent Ca2+ block of NR1/NR3A receptors by Zn2+ may be important for the regulation of excitatory glycinergic transmission, according to the Mg2+-block of conventional NR1/NR2 NMDA receptors.
International Nuclear Information System (INIS)
Georgakopoulos, D; Budovsky, I; Hagen, T; Sasaki, H; Yamamori, H
2012-01-01
We have developed a programmable Josephson voltage standard that can produce voltages up to 20 V with a resolution of better than 0.1 µV over the whole voltage range and better than 1 nV for voltages up to 10 mV. The standard has two superconductor–normal metal–superconductor junction arrays connected in series and driven by two radiofrequency oscillators. The cryogenic part of the standard is based on a cryocooler. The new standard agrees with the primary quantum voltage standard maintained at the National Measurement Institute, Australia, within 10 nV and forms the basis of an automated calibration system for digital multimeters and voltage references. (paper)
Directory of Open Access Journals (Sweden)
P. Sperlich
2013-08-01
Full Text Available Air bubbles in ice core samples represent the only opportunity to study the mixing ratio and isotopic variability of palaeoatmospheric CH4 and N2O. The highest possible precision in isotope measurements is required to maximize the resolving power for CH4 and N2O sink and source reconstructions. We present a new setup to measure δ13C-CH4, δ15N-N2O and δ18O-N2O isotope ratios in one ice core sample and with one single IRMS instrument, with a precision of 0.09, 0.6 and 0.7‰, respectively, as determined on 0.6–1.6 nmol CH4 and 0.25–0.6 nmol N2O. The isotope ratios are referenced to the VPDB scale (δ13C-CH4, the N2-air scale (δ15N-N2O and the VSMOW scale (δ18O-N2O. Ice core samples of 200–500 g are melted while the air is constantly extracted to minimize gas dissolution. A helium carrier gas flow transports the sample through the analytical system. We introduce a new gold catalyst to oxidize CO to CO2 in the air sample. CH4 and N2O are then separated from N2, O2, Ar and CO2 before they get pre-concentrated and separated by gas chromatography. A combustion unit is required for δ13C-CH4 analysis, which is equipped with a constant oxygen supply as well as a post-combustion trap and a post-combustion GC column (GC-C-GC-IRMS. The post-combustion trap and the second GC column in the GC-C-GC-IRMS combination prevent Kr and N2O interferences during the isotopic analysis of CH4-derived CO2. These steps increase the time for δ13C-CH4 measurements, which is used to measure δ15N-N2O and δ18O-N2O first and then δ13C-CH4. The analytical time is adjusted to ensure stable conditions in the ion source before each sample gas enters the IRMS, thereby improving the precision achieved for measurements of CH4 and N2O on the same IRMS. The precision of our measurements is comparable to or better than that of recently published systems. Our setup is calibrated by analysing multiple reference gases that were injected over bubble-free ice samples. We show
Lemtiri-Chlieh, Fouad
2013-09-03
The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.
Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha
2013-01-01
The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.
International Nuclear Information System (INIS)
Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.
2005-01-01
The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning
International Nuclear Information System (INIS)
Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.
1986-01-01
Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel
International Nuclear Information System (INIS)
Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei
2015-01-01
The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)
Voltage Controlled Dynamic Demand Response
DEFF Research Database (Denmark)
Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...
Multi-objective optimization of distributed generation with voltage ...
African Journals Online (AJOL)
DR OKE
1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...
Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda
2015-12-25
The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W
2016-02-01
Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2000-01-01
In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....
Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.
Directory of Open Access Journals (Sweden)
Paula L Diaz-Sylvester
Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.
A real time multi-server multi-client coherent database for a new high voltage system
International Nuclear Information System (INIS)
Gorbics, M.; Green, M.
1995-01-01
A high voltage system has been designed to allow multiple users (clients) access to the database of measured values and settings. This database is actively maintained in real time for a given mainframe containing multiple modules each having their own database. With limited CPU nd memory resources the mainframe system provides a data coherency scheme for multiple clients which (1) allows the client to determine when and what values need to be updated, (2) allows for changes from one client to be detected by another client, and (3) does not depend on the mainframe system tracking client accesses
Voltage-gated lipid ion channels
DEFF Research Database (Denmark)
Blicher, Andreas; Heimburg, Thomas Rainer
2013-01-01
Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...
E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.
Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej
2018-04-17
E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.
A 1.8 GHz Voltage-Controlled Oscillator using CMOS Technology
Maisurah, M. H. Siti; Emran, F. Nazif; Norman Fadhil, Idham M.; Rahim, A. I. Abdul; Razman, Y. Mohamed
2011-05-01
A Voltage-Controlled Oscillator (VCO) for 1.8 GHz application has been designed using a combination of both 0.13 μm and 0.35 μm CMOS technology. The VCO has a large tuning range, which is from 1.39 GHz to 1.91 GHz, using a control voltage from 0 to 3V. The VCO exhibits a low phase-noise at 1.8 GHz which is around -119.8dBc/Hz at a frequency offset of 1 MHz.
Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R
2016-09-01
The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.
International Nuclear Information System (INIS)
Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming
2013-01-01
Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)
Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana
Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing
2015-01-01
Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363
Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco
2013-01-23
Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.
Persistent pain after spinal cord injury is maintained by primary afferent activity.
Yang, Qing; Wu, Zizhen; Hadden, Julia K; Odem, Max A; Zuo, Yan; Crook, Robyn J; Frost, Jeffrey A; Walters, Edgar T
2014-08-06
Chronic pain caused by insults to the CNS (central neuropathic pain) is widely assumed to be maintained exclusively by central mechanisms. However, chronic hyperexcitablility occurs in primary nociceptors after spinal cord injury (SCI), suggesting that SCI pain also depends upon continuing activity of peripheral sensory neurons. The present study in rats (Rattus norvegicus) found persistent upregulation after SCI of protein, but not mRNA, for a voltage-gated Na(+) channel, Nav1.8, that is expressed almost exclusively in primary afferent neurons. Selectively knocking down Nav1.8 after SCI suppressed spontaneous activity in dissociated dorsal root ganglion neurons, reversed hypersensitivity of hindlimb withdrawal reflexes, and reduced ongoing pain assessed by a conditioned place preference test. These results show that activity in primary afferent neurons contributes to ongoing SCI pain. Copyright © 2014 the authors 0270-6474/14/3410765-05$15.00/0.
Intermediate state trapping of a voltage sensor
DEFF Research Database (Denmark)
Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca
2012-01-01
Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...
Current-voltage-temperature characteristics of DNA origami
Energy Technology Data Exchange (ETDEWEB)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)
2009-04-29
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Current-voltage-temperature characteristics of DNA origami
International Nuclear Information System (INIS)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander
2009-01-01
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-23
Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.
Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi
2009-01-01
Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...
Voltage scheduling for low power/energy
Manzak, Ali
2001-07-01
Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned
Amin, Atefeh Y; Reuter, Knud; Meyer-Friedrichsen, Timo; Halik, Marcus
2011-12-20
We investigated two different (2,7-dialkyl-[1]benzothieno[3,2-b][1]benzothiophenes; C(n)-BTBT-C(n), where n = 12 or 13) semiconductors in low-voltage operating thin-film transistors. By choosing functional molecules in nanoscaled hybrid dielectric layers, we were able to tune the surface energy and improve device characteristics, such as leakage current and hysteresis. The dipolar nature of the self-assembled molecules led to a shift in the threshold voltage. All devices exhibited high charge carrier mobilities of 0.6-7.0 cm(2) V(-1) s(-1). The thin-film morphology of BTBT was studied by means of atomic force microscopy (AFM), presented a dependency upon the surface energy of the self-assembled monolayer (SAM) hybrid dielectrics but not upon the device performance. The use of C(13)-BTBT-C(13) on hybrid dielectrics of AlO(x) and a F(15)C(18)-phosphonic acid monolayer led to devices with a hole mobility of 1.9 cm(2) V(-1) s(-1) at 3 V, on/off ratio of 10(5), small device-device variation of mobility, and a threshold voltage of only -0.9 V, thus providing excellent characteristics for further integration. © 2011 American Chemical Society
Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin
2013-09-01
We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped
Directory of Open Access Journals (Sweden)
Kota Kasahara
Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
Mechanism of voltage-gated channel formation in lipid membranes.
Guidelli, Rolando; Becucci, Lucia
2016-04-01
Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.
First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment
Energy Technology Data Exchange (ETDEWEB)
König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)
2017-11-15
Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.
Low voltage arc formation in railguns
Hawke, R.S.
1985-08-05
A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.
Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.
2017-01-01
E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267
Directory of Open Access Journals (Sweden)
Colin H Peters
Full Text Available E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.
International Nuclear Information System (INIS)
Mohamadou, Youssoufa; Oh, Tong In; Wi, Hun; Sohal, Harsh; Farooq, Adnan; Woo, Eung Je; McEwan, Alistair Lee
2012-01-01
Current sources are widely used in bio-impedance spectroscopy (BIS) measurement systems to maximize current injection for increased signal to noise while keeping within medical safety specifications. High-performance current sources based on the Howland current pump with optimized impedance converters are able to minimize stray capacitance of the cables and setup. This approach is limited at high frequencies primarily due to the deteriorated output impedance of the constant current source when situated in a real measurement system. For this reason, voltage sources have been suggested, but they require a current sensing resistor, and the SNR reduces at low impedance loads due to the lower current required to maintain constant voltage. In this paper, we compare the performance of a current source-based BIS and a voltage source-based BIS, which use common components. The current source BIS is based on a Howland current pump and generalized impedance converters to maintain a high output impedance of more than 1 MΩ at 2 MHz. The voltage source BIS is based on voltage division between an internal current sensing resistor (R s ) and an external sample. To maintain high SNR, R s is varied so that the source voltage is divided more or less equally. In order to calibrate the systems, we measured the transfer function of the BIS systems with several known resistor and capacitor loads. From this we may estimate the resistance and capacitance of biological tissues using the least-squares method to minimize error between the measured transimpedance excluding the system transfer function and that from an impedance model. When tested on realistic loads including discrete resistors and capacitors, and saline and agar phantoms, the voltage source-based BIS system had a wider bandwidth of 10 Hz to 2.2 MHz with less than 1% deviation from the expected spectra compared to more than 10% with the current source. The voltage source also showed an SNR of at least 60 dB up to 2.2 MHz
Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.
2011-01-01
In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494
New method for determining avalanche breakdown voltage of silicon photomultipliers
International Nuclear Information System (INIS)
Chirikov-Zorin, I.
2017-01-01
The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru
Experimental validation of prototype high voltage bushing
Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.
2017-08-01
Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.
Robot-performed synthesis of [11C]CH3-methionine with isolation by means of solid-phase extraction
International Nuclear Information System (INIS)
Vasil'ev, D.A.; Kiselev, M.Yu.; Korsakov, M.V.; Khorti, A.G.
1992-01-01
Robot-performed technology of synthesizing radiopharmaceutical preparation 11 CH 3 -methionine, used in positron-emission tomography of brain to evaluate the rate of protein biosynthesis was developed. The technology is based on the synthesis of 11 CH 3 -methionine from[ 11 C]-CH I and DL-homocysteinethiolactone with subsequent isolation of the preparation by the method of solid-phase extraction. Activity of the preparation synthesized is 0.13-0.17 Ci, specific activity -325-850 Ci/mmol, total duration of the synthesis from the moment of irradiation end is 16-19 min, radiochemical yield, as regards 11 CH 3 I corrected for carbon-11 decay, is 60 %
Muscarinic activation of Ca2+-activated Cl- current in interstitial cells of Cajal.
Zhu, Mei Hong; Sung, In Kyung; Zheng, Haifeng; Sung, Tae Sik; Britton, Fiona C; O'Driscoll, Kate; Koh, Sang Don; Sanders, Kenton M
2011-09-15
Interstitial cells of Cajal (ICC) provide pacemaker activity and functional bridges between enteric motor nerve terminals and gastrointestinal smooth muscle cells. The ionic conductance(s) in ICC that are activated by excitatory neural inputs are unknown. Transgenic mice (Kit(copGFP/+)) with constitutive expression of a bright green fluorescent protein were used to investigate cellular responses of ICC to cholinergic stimulation. ICC displayed spontaneous transient inward currents (STICs) under voltage clamp that corresponded to spontaneous transient depolarizations (STDs) under current clamp. STICs reversed at 0 mV when E(Cl) = 0 mV and at -40 mV when E(Cl) was -40 mV, suggesting the STICs were due to a chloride conductance. Carbachol (CCh, 100 nm and 1 μm) induced a sustained inward current (depolarization in current clamp) and increased the amplitude and frequency of STICs and STDs. CCh responses were blocked by atropine (10 μm) or 4-DAMP (100 nm), an M(3) receptor antagonist. STDs were blocked by niflumic acid and 5-nitro-2-(3-phenylpropylamino)-benzoic acid (both 100 μm), and CCh had no effect in the presence of these drugs. The responses of intact circular muscles to CCh and stimulation of intrinsic excitatory nerves by electrical field stimulation (EFS) were also compared. CCh (1 μm) caused atropine-sensitive depolarization and increased the maximum depolarization of slow waves. Similar atropine-sensitive responses were elicited by stimulation of intrinsic excitatory neurons. Niflumic acid (100 μm) blocked responses to EFS but had minor effect on responses to exogenous CCh. These data suggest that different ionic conductances are responsible for electrical responses elicited by bath-applied CCh and cholinergic nerve stimulation.
Directory of Open Access Journals (Sweden)
Arnautović Dušan
2014-01-01
Full Text Available The paper, discusses the possibility to use coordinated Q-V controller (CQVC to perform secondary voltage control at the power plant level. The CQVC performs the coordination of the synchronous generators' (SG reactive power outputs in order to maintain the same total reactive power delivered by the steam power plant (SPP, while at the same time maintaining a constant voltage with programmed reactive droop characteristic at the SPP HV busbar. This busbar is the natural pilot node for secondary voltage control at HV level as the node with maximum power production and maximum power consumption. In addition to voltage control, the CQVC maintains the uniform allocation of reactive power reserves at all SGs in the power plant. This is accomplished by setting the reactive power of each SG at given operating point in accordance to the available reactive power of the same SG at that point. Different limitations imposed by unit's and plant equipment are superimposed on original SG operating chart (provided by the manufacturer in order to establish realistic limits of SG operation at given operating point. The CQVC facilitates: i practical implementation of secondary voltage control in power system, as it is capable of ensuring delivery of reactive power as requested by regional/voltage control while maintaining voltage at system pilot node, ii the full deployment of available reactive power of SGs which in turn contributes to system stability, iii assessment of the reactive power impact/contribution of each generator in providing voltage control as ancillary service. Furthermore, it is also possible to use CQVC to pricing reactive power production cost at each SG involved and to design reactive power bidding structure for transmission network devices by using recorded data. Practical exploitation experience acquired during CQVC continuous operation for over two years enabled implementation of the optimal setting of reference voltage and droop on daily
Chen, Sun-Yang; Lee, Yuan-Pern
2010-03-01
A step-scan Fourier-transform infrared spectrometer coupled with a multipass absorption cell was utilized to monitor the transient species produced in gaseous reactions of CH3CO and O2; IR absorption spectra of CH3C(O)OO and α-lactone were observed. Absorption bands with origins at 1851±1, 1372±2, 1169±6, and 1102±3 cm-1 are attributed to t-CH3C(O)OO, and those at 1862±3, 1142±4, and 1078±6 cm-1 are assigned to c-CH3C(O)OO. A weak band near 1960 cm-1 is assigned to α-lactone, cyc-CH2C(O)O, a coproduct of OH. These observed rotational contours agree satisfactorily with simulated bands based on predicted rotational parameters and dipole derivatives, and observed vibrational wavenumbers agree with harmonic vibrational wavenumbers predicted with B3LYP/aug-cc-pVDZ density-functional theory. The observed relative intensities indicate that t-CH3C(O)OO is more stable than c-CH3C(O)OO by 3±2 kJ mol-1. Based on these observations, the branching ratio for the OH+α-lactone channel of the CH3CO+O2 reaction is estimated to be 0.04±0.01 under 100 Torr of O2 at 298 K. A simple kinetic model is employed to account for the decay of CH3C(O)OO.
Chen, Sun-Yang; Lee, Yuan-Pern
2010-03-21
A step-scan Fourier-transform infrared spectrometer coupled with a multipass absorption cell was utilized to monitor the transient species produced in gaseous reactions of CH(3)CO and O(2); IR absorption spectra of CH(3)C(O)OO and alpha-lactone were observed. Absorption bands with origins at 1851+/-1, 1372+/-2, 1169+/-6, and 1102+/-3 cm(-1) are attributed to t-CH(3)C(O)OO, and those at 1862+/-3, 1142+/-4, and 1078+/-6 cm(-1) are assigned to c-CH(3)C(O)OO. A weak band near 1960 cm(-1) is assigned to alpha-lactone, cyc-CH(2)C(=O)O, a coproduct of OH. These observed rotational contours agree satisfactorily with simulated bands based on predicted rotational parameters and dipole derivatives, and observed vibrational wavenumbers agree with harmonic vibrational wavenumbers predicted with B3LYP/aug-cc-pVDZ density-functional theory. The observed relative intensities indicate that t-CH(3)C(O)OO is more stable than c-CH(3)C(O)OO by 3+/-2 kJ mol(-1). Based on these observations, the branching ratio for the OH+alpha-lactone channel of the CH(3)CO+O(2) reaction is estimated to be 0.04+/-0.01 under 100 Torr of O(2) at 298 K. A simple kinetic model is employed to account for the decay of CH(3)C(O)OO.
Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.
Carvalho-de-Souza, Joao L; Bezanilla, Francisco
2018-02-05
Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018
Bias dependent charge trapping in MOSFETs during 1 and 6 MeV electron irradiation
Energy Technology Data Exchange (ETDEWEB)
Shinde, N.S. [Department of Chemical Engineering, Mie University, 5148507 (Japan); Kulkarni, V.R.; Mathakari, N.L.; Bhoraskar, V.N. [Department of Physics, Univeristy of Pune, Pune 411007 (India); Dhole, S.D. [Department of Physics, Univeristy of Pune, Pune 411007 (India)], E-mail: sanjay@physics.unipune.ernet.in
2008-06-15
To study irradiation-induced charge trapping in SiO{sub 2} and around the SiO{sub 2}-Si interface, depletion n-MOSFETs (metal-oxide-semiconductor field effect transistor) were used. The devices were gate biased during 1 and 6 MeV pulsed electron irradiation. The I{sub D}-V{sub DS} (drain current versus drain voltage) and I{sub D}-V{sub GS} (drain current versus gate voltage) characteristics were measured before and after irradiation. The shift in threshold voltage {delta}V{sub T} (difference in threshold voltage V{sub T} before and after irradiation) exhibited trends depending on the applied gate bias during 1 MeV electron irradiation. This behavior can be associated to the contribution of irradiation-induced negative charge {delta}N{sub IT} buildup around the SiO{sub 2}-Si interface to {delta}V{sub T}, which is sensitive to the electron tunneling from the substrates. However, only weak gate bias dependence was observed in 6 MeV electron irradiated devices. Independent of the energy loss and applied bias, the positive oxide trapped charge {delta}N{sub OT} is marginal and can be associated to thin and good quality of SiO{sub 2}. These results are explained using screening of free and acceptor states by the applied bias during irradiation, thereby reducing the total irradiation-induced charges.
Multi-Period Optimization for Voltage Control System in Transmission Grids
DEFF Research Database (Denmark)
Qin, Nan; Chen, Si; Liu, Chengxi
2015-01-01
Automatic Voltage Control (AVC) systems maintain the voltage in an acceptable range and minimize the power loss of the grid by coordinately regulating the controllable components. Switchable shunts and tap-able transformers are expected to be operated as few times as possible. This paper proposes...
Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam
Andreev, Andrey
2005-10-01
The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.
Voltage stability in low voltage microgrids in aspects of active and reactive power demand
Directory of Open Access Journals (Sweden)
Parol Mirosław
2016-03-01
Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.
Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne
2010-10-01
The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Salvador Valle-Reyes
2018-05-01
Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.
International Nuclear Information System (INIS)
Pe, T.; McDonald, J.; Clem, J.R.
1995-01-01
The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section
An analog RF gap voltage regulation system for the Advanced Photon Source storage ring
International Nuclear Information System (INIS)
Horan, D.
1999-01-01
An analog rf gap voltage regulation system has been designed and built at Argonne National Laboratory to maintain constant total storage ring rf gap voltage, independent of beam loading and cavity tuning effects. The design uses feedback control of the klystron mod-anode voltage to vary the amount of rf power fed to the storage ring cavities. The system consists of two independent feedback loops, each regulating the combined rf gap voltages of eight storage ring cavities by varying the output power of either one or two rf stations, depending on the mode of operation. It provides full operator control and permissive logic to permit feedback control of the rf system output power only if proper conditions are met. The feedback system uses envelope-detected cavity field probe outputs as the feedback signal. Two different methods of combining the individual field probe signals were used to generate a relative DC level representing one-half of the total storage ring rf voltage, an envelope-detected vector sum of the field probe rf signals, and the DC sum of individual field probe envelope detector outputs. The merits of both methods are discussed. The klystron high-voltage power supply (HVPS) units are fitted with an analog interface for external control of the mod-anode voltage level, using a four-quadrant analog multiplier to modulate the HVPS mod-anode voltage regulator set-point in response to feedback system commands
Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks
Teverovsky, Alexander A.
2016-01-01
Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.
Simple programmable voltage reference for low frequency noise measurements
Ivanov, V. E.; Chye, En Un
2018-05-01
The paper presents a circuit design of a low-noise voltage reference based on an electric double-layer capacitor, a microcontroller and a general purpose DAC. A large capacitance value (1F and more) makes it possible to create low-pass filter with a large time constant, effectively reducing low-frequency noise beyond its bandwidth. Choosing the optimum value of the resistor in the RC filter, one can achieve the best ratio between the transient time, the deviation of the output voltage from the set point and the minimum noise cut-off frequency. As experiments have shown, the spectral density of the voltage at a frequency of 1 kHz does not exceed 1.2 nV/√Hz the maximum deviation of the output voltage from the predetermined does not exceed 1.4 % and depends on the holding time of the previous value. Subsequently, this error is reduced to a constant value and can be compensated.
DEFF Research Database (Denmark)
Chakraborty, Debojyoti; Paszkowski-Rogacz, Maciej; Berger, Nicolas
2017-01-01
-chromosome-encoded protein A830080D01Rik, hereafter referred to as transient octamer binding factor 1 (TOBF1), to genomic sites resembling the canonical Oct-Sox motif. TOBF1 physically interacts with Panct1 and exhibits a cell-cycle-specific punctate localization in ESCs. At the chromatin level, this correlates with its......-cycle-dependent manner and suggest that lncRNAs might function as barcodes for identifying genomic addresses for maintaining cellular states....
Czech Academy of Sciences Publication Activity Database
Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav
2006-01-01
Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Sequential circuit design for radiation hardened multiple voltage integrated circuits
Clark, Lawrence T [Phoenix, AZ; McIver, III, John K.
2009-11-24
The present invention includes a radiation hardened sequential circuit, such as a bistable circuit, flip-flop or other suitable design that presents substantial immunity to ionizing radiation while simultaneously maintaining a low operating voltage. In one embodiment, the circuit includes a plurality of logic elements that operate on relatively low voltage, and a master and slave latches each having storage elements that operate on a relatively high voltage.
Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.
2016-03-01
Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.
International Nuclear Information System (INIS)
Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L
2016-01-01
Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)
International Nuclear Information System (INIS)
Beck, H.G.E.
1979-01-01
A model is presented for the 1/f noise in ion-implanted resistors. The resistance was changed by a reverse bias voltage. The model explains the experimentally found square dependence between the relative 1/f noise intensity C/C 0 and the relative change in resistance R/R 0 . (author)
International Nuclear Information System (INIS)
Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.
1994-01-01
In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna
2013-03-01
The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.
Secondary Frequency and Voltage Control of Islanded Microgrids via Distributed Averaging
DEFF Research Database (Denmark)
W. Simpson-Porco, John; Shafiee, Qobad; Dorfler, Florian
2015-01-01
actions. The frequency controller rapidly regulates the microgrid frequency to its nominal value while maintaining active power sharing among the distributed generators. Tuning of the voltage controller provides a simple and intuitive trade-off between the conflicting goals of voltage regulation...
International Nuclear Information System (INIS)
Wang, Long; Ma, Yulin; Li, Qin; Cui, Yingzhi; Wang, Panpan; Cheng, Xinqun; Zuo, Pengjian; Du, Chunyu; Gao, Yunzhi
2017-01-01
Tris(2,2,2-trifluoroethyl) phosphite (TTFEP) is investigated as an electrolyte additive to improve the electrochemical performance of LiNi 1/3 Co 1/3 Mn 1/3 O 2 cathode at high operating voltage (4.6 V). Charge/discharge measurements demonstrate that TTFEP is effective to improve the cycling stability and rate capability of LiNi 1/3 Co 1/3 Mn 1/3 O 2 cathode. The capacity retention of LiNi 1/3 Co 1/3 Mn 1/3 O 2 /Li cell with 1% TTFEP-containing electrolyte reaches up to 85.4% after 100 cycles at 0.5C (1C = 160 mA g −1 ), while that of the cell with the baseline electrolyte (1 M LiPF 6 in EC/DMC electrolyte) only remains 74.2%. Moreover, the discharge capacity of the cathode with 1% TTFEP-containing electrolyte could maintain around 112.0 mAh g −1 at 4C. Based on the characterization of electrochemical impedance spectroscopy (EIS), scanning electron microscopy (SEM), X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS), a protective interphase film formed on the cathode surface can be found due to the preferential oxidation of TTFEP, which inhibits the electrolyte decomposition and mitigates the cathode structural destruction, leading to the improved electrochemical performance of LiNi 1/3 Co 1/3 Mn 1/3 O 2 cathode at high voltage.
The allosteric site regulates the voltage sensitivity of muscarinic receptors.
Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas
2018-01-01
Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.
Planning aspects of ac extra high voltage lines
Energy Technology Data Exchange (ETDEWEB)
Engelhardt, H
1964-01-01
The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.
Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement
International Nuclear Information System (INIS)
Boudjella, Aissa
2011-01-01
The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.
Energy Technology Data Exchange (ETDEWEB)
Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)
2017-01-01
Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.
McCoy, Portia; Norton, Thomas T; McMahon, Lori L
2008-07-01
Acetylcholine is an important modulator of synaptic efficacy and is required for learning and memory tasks involving the visual cortex. In rodent visual cortex, activation of muscarinic acetylcholine receptors (mAChRs) induces a persistent long-term depression (LTD) of transmission at synapses recorded in layer 2/3 of acute slices. Although the rodent studies expand our knowledge of how the cholinergic system modulates synaptic function underlying learning and memory, they are not easily extrapolated to more complex visual systems. Here we used tree shrews for their similarities to primates, including a visual cortex with separate, defined regions of monocular and binocular innervation, to determine whether mAChR activation induces long-term plasticity. We find that the cholinergic agonist carbachol (CCh) not only induces long-term plasticity, but the direction of the plasticity depends on the subregion. In the monocular region, CCh application induces LTD of the postsynaptic potential recorded in layer 2/3 that requires activation of m3 mAChRs and a signaling cascade that includes activation of extracellular signal-regulated kinase (ERK) 1/2. In contrast, layer 2/3 postsynaptic potentials recorded in the binocular region express long-term potentiation (LTP) following CCh application that requires activation of m1 mAChRs and phospholipase C. Our results show that activation of mAChRs induces long-term plasticity at excitatory synapses in tree shrew visual cortex. However, depending on the ocular inputs to that region, variation exists as to the direction of plasticity, as well as to the specific mAChR and signaling mechanisms that are required.
International Nuclear Information System (INIS)
Onufriyev, Valery V.
2001-01-01
It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient--γ i with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure p cs ) and cathode temperature T k is constant too (U b =constant with T k =constant and p cs =constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-p cs and cathode temperature-T k and is independent on IEG length--Δ ieg . On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly--the region of excited atoms--''Aston glow.''
Onufriyev, Valery. V.
2001-02-01
It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient-γi with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure pcs) and cathode temperature Tk is constant too (Ub=constant with Tk=constant and pcs=constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-pcs and cathode temperature-Tk and is independent on IEG length-Δieg. On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly-the region of excited atoms-``Aston glow.'' .
A new linear induction voltage adder approach to radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.
1992-01-01
At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap
International Nuclear Information System (INIS)
Chang Yongbin; Dolliver, D. D.; Ordonez, C. A.
1999-01-01
In the work reported, time-dependent effects are considered which affect the prospect of getting two oppositely signed plasmas to overlap the same region while trapped within a solenoidal magnetic field. Parameters that are relevant to future experimental attempts at producing cold antihydrogen atoms using nested-well plasma traps are considered. It is found that the timescale over which an overlap remains, without changing the electrode voltages, can be much larger than the timescale over which the overlap plasma recombines. Hence, it does not appear necessary to use time-dependent electrode voltages to maintain the overlap while antihydrogen atoms are being produced
Directory of Open Access Journals (Sweden)
S. Demirezen
Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase
Voltage fluctuations in granular superconductors in the perpendicular configuration
International Nuclear Information System (INIS)
Gerashchenko, O V
2003-01-01
The spectral density of voltage fluctuations in granular YBa 2 Cu 3 O 7-δ superconductors in the perpendicular configuration has been studied in the flux flow mode. It has been found that, in this case, the 1/f-voltage noise observed depends weakly on temperature and is associated with motion of a magnetic flux in the superconductor. A comparison of the data obtained with the results of previous measurements in parallel configuration has shown that voltage noise is produced by a single common source, which is presumably associated with self-organization of the critical state in granular superconductors
Leipold, Enrico; Borges, Adolfo
2012-01-01
Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487
Muscarinic activation of Ca2+-activated Cl− current in interstitial cells of Cajal
Zhu, Mei Hong; Sung, In Kyung; Zheng, Haifeng; Sung, Tae Sik; Britton, Fiona C; O'Driscoll, Kate; Koh, Sang Don; Sanders, Kenton M
2011-01-01
Abstract Interstitial cells of Cajal (ICC) provide pacemaker activity and functional bridges between enteric motor nerve terminals and gastrointestinal smooth muscle cells. The ionic conductance(s) in ICC that are activated by excitatory neural inputs are unknown. Transgenic mice (KitcopGFP/+) with constitutive expression of a bright green fluorescent protein were used to investigate cellular responses of ICC to cholinergic stimulation. ICC displayed spontaneous transient inward currents (STICs) under voltage clamp that corresponded to spontaneous transient depolarizations (STDs) under current clamp. STICs reversed at 0 mV when ECl = 0 mV and at –40 mV when ECl was –40 mV, suggesting the STICs were due to a chloride conductance. Carbachol (CCh, 100 nm and 1 μm) induced a sustained inward current (depolarization in current clamp) and increased the amplitude and frequency of STICs and STDs. CCh responses were blocked by atropine (10 μm) or 4-DAMP (100 nm), an M3 receptor antagonist. STDs were blocked by niflumic acid and 5-nitro-2-(3-phenylpropylamino)-benzoic acid (both 100 μm), and CCh had no effect in the presence of these drugs. The responses of intact circular muscles to CCh and stimulation of intrinsic excitatory nerves by electrical field stimulation (EFS) were also compared. CCh (1 μm) caused atropine-sensitive depolarization and increased the maximum depolarization of slow waves. Similar atropine-sensitive responses were elicited by stimulation of intrinsic excitatory neurons. Niflumic acid (100 μm) blocked responses to EFS but had minor effect on responses to exogenous CCh. These data suggest that different ionic conductances are responsible for electrical responses elicited by bath-applied CCh and cholinergic nerve stimulation. PMID:21768263
Reduction of Voltage Harmonics for Parallel-operated Inverters
DEFF Research Database (Denmark)
Zhong, Qing-Chang; Blaabjerg, Frede; Guerrero, Josep M.
2011-01-01
The inherent limitations of the conventional droop control scheme have recently been revealed and a robust droop controller to achieve exact proportional load sharing has been proposed. This paper continues the work with a strategy to improve the voltage quality so that the total harmonic...... distortion of the output voltage can be maintained small even when nonlinear loads are connected. Experimental results are provided to verify the analysis and design....
Poisson simulation for high voltage terminal of test stand for 1MV electrostatic accelerator
Energy Technology Data Exchange (ETDEWEB)
Park, Sae-Hoon; Kim, Jeong-Tae; Kwon, Hyeok-Jung; Cho, Yong-Sub [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kim, Yu-Seok [Dongguk Univ.., Gyeongju (Korea, Republic of)
2014-10-15
KOMAC provide ion beam to user which energy range need to expand to MeV range and develop 1 MV electrostatic accelerator. The specifications of the electrostatic accelerator are 1MV acceleration voltage, 10 mA peak current and variable gas ion. We are developing test stand before set up 1 MV electrostatic accelerator. The test stand voltage is 300 kV and operating time is 8 hours. The test stand is consist of 300 kV high voltage terminal, DC-AC-DC inverter, power supply device inside terminal, 200MHz RF power, 5 kV extraction power supply, 300 kV accelerating tube and vacuum system.. The beam measurement system and beam dump will be installed next to accelerating tube. Poisson code simulation results of the high voltage terminal are presented in this paper. Poisson code has been used to calculate the electric field for high voltage terminal. The results of simulation were verified with reasonable results. The poisson code structure could be apply to the high voltage terminal of the test stand.
Poisson simulation for high voltage terminal of test stand for 1MV electrostatic accelerator
International Nuclear Information System (INIS)
Park, Sae-Hoon; Kim, Jeong-Tae; Kwon, Hyeok-Jung; Cho, Yong-Sub; Kim, Yu-Seok
2014-01-01
KOMAC provide ion beam to user which energy range need to expand to MeV range and develop 1 MV electrostatic accelerator. The specifications of the electrostatic accelerator are 1MV acceleration voltage, 10 mA peak current and variable gas ion. We are developing test stand before set up 1 MV electrostatic accelerator. The test stand voltage is 300 kV and operating time is 8 hours. The test stand is consist of 300 kV high voltage terminal, DC-AC-DC inverter, power supply device inside terminal, 200MHz RF power, 5 kV extraction power supply, 300 kV accelerating tube and vacuum system.. The beam measurement system and beam dump will be installed next to accelerating tube. Poisson code simulation results of the high voltage terminal are presented in this paper. Poisson code has been used to calculate the electric field for high voltage terminal. The results of simulation were verified with reasonable results. The poisson code structure could be apply to the high voltage terminal of the test stand
Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.
Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C
2018-05-07
Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.
Energy Technology Data Exchange (ETDEWEB)
Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)
2015-01-15
In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.
Ionization smoke detectors - the high-voltage issues
International Nuclear Information System (INIS)
Anon.
1992-01-01
Production of high-voltage ionization smoke detectors ceased in 1978 following the development of lower voltage models which used much smaller amounts of radioactive material. Despite this fact, thousands of high-voltage detectors are still in use today in many large UK companies. The major users argue that there is no reason to stop using their detectors if they are still fit for their purpose - many could last for another 15 to 20 years if properly maintained. But pressure has been mounting on businesses to replace all their high-voltage detectors with new low-voltage models within the next couple of years. This could place a huge financial burden on the companies concerned, with costs possibly running into millions of pounds. Traditionally, the major detector installers offered cleaning and maintenance services for high-voltage detectors to their customers but these have now been withdrawn. The installers give no clear reasons for this decision except that the detectors are outmoded and should be disposed of as soon as possible. Most users would agree that conversion to low-voltage types is inevitable but their main worry is the financial strain of replacing all their detectors - and associated equipment - in one go. They would prefer to phase out their high-voltage detectors in stages over a number of years to spread the costs of conversion. The problems of maintenance is discussed. A dual voltage fire alarm panel which allows the high-voltage detectors to be phased out is mentioned. (Author)
Yang, G.; Stark, B. H.; Burrow, S. G.; Hollis, S. J.
2014-11-01
This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up.
International Nuclear Information System (INIS)
Yang, G; Stark, B H; Burrow, S G; Hollis, S J
2014-01-01
This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
ПАНЧЕНКО, В В
2015-01-01
The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...
Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.
2013-11-01
As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.
International Nuclear Information System (INIS)
Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing
2010-01-01
The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)
The development of long pulse high voltage power supply for MNI-1U neutral beam injector
International Nuclear Information System (INIS)
Detai Wang
1989-01-01
A high power long pulse high voltage power supply (HVPS) for MNI- 1 U neutral beam injector (NBI) is described. This HVPS is used as a switching regulator with a duty cycle of 1/100, the specifications of circuit are as follows, output pulse voltage 50kv, pulse current 30A, pulse width 50ms, rise-time and fall-time of the voltage are less than 25 μs, stability of the pulse flat is better than 0.5%, regulation response time of the pulse voltage less than 30 μs can be attained. It is also used as a stable DC HVPS, output voltage is 1 to 100kv, current is 1 to 5A. If regulation tube is shunted with high power resistor in parallel, the current can be extended to 10 A, stability of the output voltage or current is better than 0.1%. Now, the HVPS has been put into operation for MNI- 1 U NBI and PIG ion source made in French. 3 refs., 5 figs
Energy Technology Data Exchange (ETDEWEB)
Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)
2015-06-15
We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.
A Grid Voltage Measurement Method for Wind Power Systems during Grid Fault Conditions
Directory of Open Access Journals (Sweden)
Cheol-Hee Yoo
2014-11-01
Full Text Available Grid codes in many countries require low-voltage ride-through (LVRT capability to maintain power system stability and reliability during grid fault conditions. To meet the LVRT requirement, wind power systems must stay connected to the grid and also supply reactive currents to the grid to support the recovery from fault voltages. This paper presents a new fault detection method and inverter control scheme to improve the LVRT capability for full-scale permanent magnet synchronous generator (PMSG wind power systems. Fast fault detection can help the wind power systems maintain the DC-link voltage in a safe region. The proposed fault detection method is based on on-line adaptive parameter estimation. The performance of the proposed method is verified in comparison to the conventional voltage measurement method defined in the IEC 61400-21 standard.
KCNE1 constrains the voltage sensor of Kv7.1 K+ channels.
Directory of Open Access Journals (Sweden)
Liora Shamgar
Full Text Available Kv7 potassium channels whose mutations cause cardiovascular and neurological disorders are members of the superfamily of voltage-gated K(+ channels, comprising a central pore enclosed by four voltage-sensing domains (VSDs and sharing a homologous S4 sensor sequence. The Kv7.1 pore-forming subunit can interact with various KCNE auxiliary subunits to form K(+ channels with very different gating behaviors. In an attempt to characterize the nature of the promiscuous gating of Kv7.1 channels, we performed a tryptophan-scanning mutagenesis of the S4 sensor and analyzed the mutation-induced perturbations in gating free energy. Perturbing the gating energetics of Kv7.1 bias most of the mutant channels towards the closed state, while fewer mutations stabilize the open state or the inactivated state. In the absence of auxiliary subunits, mutations of specific S4 residues mimic the gating phenotypes produced by co-assembly of Kv7.1 with either KCNE1 or KCNE3. Many S4 perturbations compromise the ability of KCNE1 to properly regulate Kv7.1 channel gating. The tryptophan-induced packing perturbations and cysteine engineering studies in S4 suggest that KCNE1 lodges at the inter-VSD S4-S1 interface between two adjacent subunits, a strategic location to exert its striking action on Kv7.1 gating functions.
Directory of Open Access Journals (Sweden)
Jader Santos Cruz
2012-10-01
Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.
Voltage Unbalance Compensation with Smart Three-phase Loads
DEFF Research Database (Denmark)
Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig
2016-01-01
unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....
Structural interactions between lipids, water and S1-S4 voltage-sensing domains.
Krepkiy, Dmitriy; Gawrisch, Klaus; Swartz, Kenton J
2012-11-02
Membrane proteins serve crucial signaling and transport functions, yet relatively little is known about their structures in membrane environments or how lipids interact with these proteins. For voltage-activated ion channels, X-ray structures suggest that the mobile voltage-sensing S4 helix would be exposed to the membrane, and functional studies reveal that lipid modification can profoundly alter channel activity. Here, we use solid-state NMR to investigate structural interactions of lipids and water with S1-S4 voltage-sensing domains and to explore whether lipids influence the structure of the protein. Our results demonstrate that S1-S4 domains exhibit extensive interactions with lipids and that these domains are heavily hydrated when embedded in a membrane. We also find evidence for preferential interactions of anionic lipids with S1-S4 domains and that these interactions have lifetimes on the timescale of ≤ 10(-3)s. Arg residues within S1-S4 domains are well hydrated and are positioned in close proximity to lipids, exhibiting local interactions with both lipid headgroups and acyl chains. Comparative studies with a positively charged lipid lacking a phosphodiester group reveal that this lipid modification has only modest effects on the structure and hydration of S1-S4 domains. Taken together, our results demonstrate that Arg residues in S1-S4 voltage-sensing domains reside in close proximity to the hydrophobic interior of the membrane yet are well hydrated, a requirement for carrying charge and driving protein motions in response to changes in membrane voltage. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
John J. Lemasters
2017-12-01
Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.
Automatic Voltage Control (AVC) System under Uncertainty from Wind Power
DEFF Research Database (Denmark)
Qin, Nan; Abildgaard, Hans; Flynn, Damian
2016-01-01
An automatic voltage control (AVC) system maintains the voltage profile of a power system in an acceptable range and minimizes the operational cost by coordinating the regulation of controllable components. Typically, all of the parameters in the optimization problem are assumed to be certain...... and constant in the decision making process. However, for high shares of wind power, uncertainty in the decision process due to wind power variability may result in an infeasible AVC solution. This paper proposes a voltage control approach which considers the voltage uncertainty from wind power productions....... The proposed method improves the performance and the robustness of a scenario based approach by estimating the potential voltage variations due to fluctuating wind power production, and introduces a voltage margin to protect the decision against uncertainty for each scenario. The effectiveness of the proposed...
Directory of Open Access Journals (Sweden)
M. R. Aghamohammadi
2011-06-01
Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.
VKCDB: Voltage-gated potassium channel database
Directory of Open Access Journals (Sweden)
Gallin Warren J
2004-01-01
Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain
Directory of Open Access Journals (Sweden)
Yukiko eMishina
2014-09-01
Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Temperature Dependences of Torque Generation and Membrane Voltage in the Bacterial Flagellar Motor
Inoue, Yuichi; Baker, Matthew A.B.; Fukuoka, Hajime; Takahashi, Hiroto; Berry, Richard M.; Ishijima, Akihiko
2013-01-01
In their natural habitats bacteria are frequently exposed to sudden changes in temperature that have been shown to affect their swimming. With our believed to be new methods of rapid temperature control for single-molecule microscopy, we measured here the thermal response of the Na+-driven chimeric motor expressed in Escherichia coli cells. Motor torque at low load (0.35 μm bead) increased linearly with temperature, twofold between 15°C and 40°C, and torque at high load (1.0 μm bead) was independent of temperature, as reported for the H+-driven motor. Single cell membrane voltages were measured by fluorescence imaging and these were almost constant (∼120 mV) over the same temperature range. When the motor was heated above 40°C for 1–2 min the torque at high load dropped reversibly, recovering upon cooling below 40°C. This response was repeatable over as many as 10 heating cycles. Both increases and decreases in torque showed stepwise torque changes with unitary size ∼150 pN nm, close to the torque of a single stator at room temperature (∼180 pN nm), indicating that dynamic stator dissociation occurs at high temperature, with rebinding upon cooling. Our results suggest that the temperature-dependent assembly of stators is a general feature of flagellar motors. PMID:24359752
Phase noise cancellation in polarisation-maintaining fibre links
Rauf, B.; Vélez López, M. C.; Thoumany, P.; Pizzocaro, M.; Calonico, D.
2018-03-01
The distribution of ultra-narrow linewidth laser radiation is an integral part of many challenging metrological applications. Changes in the optical pathlength induced by environmental disturbances compromise the stability and accuracy of optical fibre networks distributing the laser light and call for active phase noise cancellation. Here we present a laboratory scale optical (at 578 nm) fibre network featuring all polarisation maintaining fibres in a setup with low optical powers available and tracking voltage-controlled oscillators implemented. The stability and accuracy of this system reach performance levels below 1 × 10-19 after 10 000 s of averaging.
Directory of Open Access Journals (Sweden)
V. N. Radkevich
2014-01-01
Full Text Available This paper describes an estimation method of decreasing losses of active power in power transformers with voltage 10(6/0,4 kV after installation of devices of reactive power compensation on output side depending on voltage level, connected to capacity devices, taking into account dielectric loss in capacitors. Analysis of functional dependences was carried out. Investigation of function with a help of derivations was carried out. Points of function extremum and also its intervals of rise and fall rates were founded. This paper describes graphic investigation of obtained functional dependence, which is introduced by quartic polynominal. It is established that decreasing of losses of active power depends on technical parameters and load factor of transformer, coefficient of loading power of electricity consumers, voltage value connected to capacitor unit.Using obtained functional dependences, calculations for the main size-types of power transformers with voltage 10(6/0,4 kV serie ТМГ 11 and ТМГ12 were done. It is established that depending on technical characteristics of certain transformer, coefficient of its loading and power, there is a definite value of deviation of real voltage value from working voltage of capacitor installation when it will be observed positive technical and economical effect from installed capacitor battery unit. For taken value of loading coefficient and transformer’s power the maximum decrease of losses of active power takes place under voltage directed to capacitor unit, which is lower then nominal value. For all taken size-types of power transformers the argument of investigating function for its maximal value is out of standard permissible of voltage deviations from nominal value.These functional dependents can be used for preliminary calculations, which are needed for making decision on compensation of reactive power in electric power supply systems of industrial objects. Their consideration allows more
Baran, D.; Kirchartz, T.; Wheeler, S.; Dimitrov, S.; Abdelsamie, Maged; Gorman, J.; Ashraf, Raja; Holliday, S.; Wadsworth, A.; Gasparini, N.; Kaienburg, P.; Yan, H.; Amassian, Aram; Brabec, C. J.; Durrant, J. R.; McCulloch, Iain
2016-01-01
of high recombination losses, which empirically limit the open-circuit voltage (Voc) to typically less than 1 V. Here we show that this empirical limit can be overcome using non-fullerene acceptors blended with the low band gap polymer PffBT4T-2DT leading
Rini Ann Jerin, A; Kaliannan, Palanisamy; Subramaniam, Umashankar
2017-09-01
Fault ride through (FRT) capability in wind turbines to maintain the grid stability during faults has become mandatory with the increasing grid penetration of wind energy. Doubly fed induction generator based wind turbine (DFIG-WT) is the most popularly utilized type of generator but highly susceptible to the voltage disturbances in grid. Dynamic voltage restorer (DVR) based external FRT capability improvement is considered. Since DVR is capable of providing fast voltage sag mitigation during faults and can maintain the nominal operating conditions for DFIG-WT. The effectiveness of the DVR using Synchronous reference frame (SRF) control is investigated for FRT capability in DFIG-WT during both balanced and unbalanced fault conditions. The operation of DVR is confirmed using time-domain simulation in MATLAB/Simulink using 1.5MW DFIG-WT. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.
Directory of Open Access Journals (Sweden)
Yoni Haitin
Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.
DEFF Research Database (Denmark)
Fuchs, W; Larsen, Erik Hviid; Lindemann, B
1977-01-01
1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...
76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop
2011-11-15
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...
Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H
2012-10-01
A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.
Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer
DEFF Research Database (Denmark)
Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev
1999-01-01
bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...
Energy Technology Data Exchange (ETDEWEB)
Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)
2010-12-15
We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)
Energy Technology Data Exchange (ETDEWEB)
Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)
2016-03-07
We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.
International Nuclear Information System (INIS)
Roos, M.; Derikum, K.
2000-01-01
Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)
Origin of the transition voltage in gold–vacuum–gold atomic junctions
International Nuclear Information System (INIS)
Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano
2013-01-01
The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)
Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage
Directory of Open Access Journals (Sweden)
RAMÓN LATORRE
2006-01-01
Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.
Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.
Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco
2013-11-01
Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.
Macroeconomic Assessment of Voltage Sags
Directory of Open Access Journals (Sweden)
Sinan Küfeoğlu
2016-12-01
Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.
Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers
Directory of Open Access Journals (Sweden)
J. Koton
2011-04-01
Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.
Voltage control on a train system
Gordon, Susanna P.; Evans, John A.
2004-01-20
The present invention provides methods for preventing low train voltages and managing interference, thereby improving the efficiency, reliability, and passenger comfort associated with commuter trains. An algorithm implementing neural network technology is used to predict low voltages before they occur. Once voltages are predicted, then multiple trains can be controlled to prevent low voltage events. Further, algorithms for managing inference are presented in the present invention. Different types of interference problems are addressed in the present invention such as "Interference During Acceleration", "Interference Near Station Stops", and "Interference During Delay Recovery." Managing such interference avoids unnecessary brake/acceleration cycles during acceleration, immediately before station stops, and after substantial delays. Algorithms are demonstrated to avoid oscillatory brake/acceleration cycles due to interference and to smooth the trajectories of closely following trains. This is achieved by maintaining sufficient following distances to avoid unnecessary braking/accelerating. These methods generate smooth train trajectories, making for a more comfortable ride, and improve train motor reliability by avoiding unnecessary mode-changes between propulsion and braking. These algorithms can also have a favorable impact on traction power system requirements and energy consumption.
Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.
Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho
2017-08-16
Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.
DNMT1 Maintains Progenitor Function in Self-Renewing Somatic Tissue
Sen, George L.; Reuter, Jason A.; Webster, Daniel E.; Zhu, Lilly; Khavari, Paul A.
2010-01-01
Progenitor cells maintain self-renewing tissues throughout life by sustaining their capacity for proliferation while suppressing cell cycle exit and terminal differentiation1,2. DNA methylation3,4,5 provides a potential epigenetic mechanism for the cellular memory needed to preserve the somatic progenitor state through repeated cell divisions. DNA methyltransferase 1 (DNMT1)6,7 maintains DNA methylation patterns after cellular replication. Although dispensable for embryonic stem cell maintena...
A High Voltage Swing 1.9 GHz PA in Standard CMOS
Aartsen, W.A.J.; Annema, Anne J.; Nauta, Bram
2002-01-01
A circuit technique for RF power amplifiers that reliably handle voltage peaks well above the nominal supply voltage is presented. To achieve this high-voltage tolerance the circuit implements switched-cascode transistors that yield reliable operation for voltages up to 7V at RF frequencies in a
Directory of Open Access Journals (Sweden)
R. N. Bhowmik
2015-06-01
Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Bhowmik, R. N.; Vijayasri, G.
2015-06-01
We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Ye, Bo; Luo, Haiping; Lu, Yaobin; Liu, Guangli; Zhang, Renduo; Li, Xiao
2017-11-01
The aim of this study was to improve performance of the microbial electrolysis desalination and chemical-production cell (MEDCC) using enlarged anode and high applied voltages. MEDCCs with anode lengths of 9 and 48cm (i.e., the 9cm-anode MEDCC and 48cm-anode MEDCC, respectively) were tested under different voltages (1.2-3.0V). Our results demonstrated for the first time that the MEDCC could maintain high performance even under the applied voltage higher than that for water dissociation (i.e., 1.8V). Under the applied voltage of 2.5V, the maximum current density in the 48cm-anode MEDCC reached 32.8±2.6A/m 2 , which is one of the highest current densities reported so far in the bioelectrochemical system (BES). The relative abundance of Geobacter was changed along the anode length. Our results show the great potential of the BES with enlarged anode and high applied voltages. Copyright © 2017 Elsevier Ltd. All rights reserved.
SGK3 Sensitivity of Voltage Gated K+ Channel Kv1.5 (KCNA5
Directory of Open Access Journals (Sweden)
Musaab Ahmed
2016-01-01
Full Text Available Background: The serum & glucocorticoid inducible kinase isoform SGK3 is a powerful regulator of several transporters, ion channels and the Na+/K+ ATPase. Targets of SGK3 include the ubiquitin ligase Nedd4-2, which is in turn a known regulator of the voltage gated K+ channel Kv1.5 (KCNA5. The present study thus explored whether SGK3 modifies the activity of the voltage gated K+ channel KCNA5, which participates in the regulation of diverse functions including atrial cardiac action potential, activity of vascular smooth muscle cells, insulin release and tumour cell proliferation. Methods: cRNA encoding KCNA5 was injected into Xenopus oocytes with and without additional injection of cRNA encoding wild-type SGK3, constitutively active S419DSGK3, inactive K191NSGK3 and/or wild type Nedd4-2. Voltage gated K+ channel activity was quantified utilizing dual electrode voltage clamp. Results: Voltage gated current in KCNA5 expressing Xenopus oocytes was significantly enhanced by wild-type SGK3 and S419DSGK3, but not by K191NSGK3. SGK3 was effective in the presence of ouabain (1 mM and thus did not require Na+/K+ ATPase activity. Coexpression of Nedd4-2 decreased the voltage gated current in KCNA5 expressing Xenopus oocytes, an effect largely reversed by additional coexpression of SGK3. Conclusion: SGK3 is a positive regulator of KCNA5, which is at least partially effective by abrogating the effect of Nedd4-2.
Directory of Open Access Journals (Sweden)
Lei Zhu
Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.
High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC
Lizcano, M.
2017-01-01
High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.
Directory of Open Access Journals (Sweden)
I Made Ginarsa
2013-11-01
Full Text Available Chaos and voltage collapse occurred in critical power systems due to disturbing of energy. PID-SVC layered reccurrent neural network-based (LRN-based PID-SVC was proposed to solve this problem. A PID was used to control chaos and voltage collapse. Then, an SVC LRN-based to maintan the load voltage. By using the proposed controller, chaos and voltage collapse were able to suppress and maintain the load voltage around the setting value. Furthemore, the proposed controller gives better response than PI-SVC controller.
KCNQ1 channel modulation by KCNE proteins via the voltage-sensing domain.
Nakajo, Koichi; Kubo, Yoshihiro
2015-06-15
The gating of the KCNQ1 potassium channel is drastically regulated by auxiliary subunit KCNE proteins. KCNE1, for example, slows the activation kinetics of KCNQ1 by two orders of magnitude. Like other voltage-gated ion channels, the opening of KCNQ1 is regulated by the voltage-sensing domain (VSD; S1-S4 segments). Although it has been known that KCNE proteins interact with KCNQ1 via the pore domain, some recent reports suggest that the VSD movement may be altered by KCNE. The altered VSD movement of KCNQ1 by KCNE proteins has been examined by site-directed mutagenesis, the scanning cysteine accessibility method (SCAM), voltage clamp fluorometry (VCF) and gating charge measurements. These accumulated data support the idea that KCNE proteins interact with the VSDs of KCNQ1 and modulate the gating of the KCNQ1 channel. In this review, we will summarize recent findings and current views of the KCNQ1 modulation by KCNE via the VSD. In this context, we discuss our recent findings that KCNE1 may alter physical interactions between the S4 segment (VSD) and the S5 segment (pore domain) of KCNQ1. Based on these findings from ourselves and others, we propose a hypothetical mechanism for how KCNE1 binding alters the VSD movement and the gating of the channel. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.
International Nuclear Information System (INIS)
Shukrinov, Yu.M.; Mahfouzi, F.
2006-01-01
We study the current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors by numerical calculations and in framework of capacitively coupled Josephson junctions model we obtain the total number of branches. The influence of the coupling parameter α on the current-voltage characteristics at fixed parameter β (β 2 1/β c , where β c is McCumber parameter) and the influence of α on β-dependence of the current-voltage characteristics are investigated. We obtain the α-dependence of the branch's slopes and branch's endpoints. The presented results show new features of the coupling effect on the scheme of hysteresis jumps in current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors
Induced Voltage in an Open Wire
Morawetz, K.; Gilbert, M.; Trupp, A.
2017-07-01
A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.
The high voltage system for the novel MPGD-based photon detectors of COMPASS RICH-1
Dalla Torre, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Chatterjee, C.; Ciliberti, P.; Dasgupta, S.; Gobbo, B.; Gregori, M.; Hamar, G.; Levorato, S.; Martin, A.; Menon, G.; Tessarotto, F.; Zhao, Y.
2018-01-01
The architecture of the novel MPGD-based photon detectors of COMPASS RICH-1 consists in a large-size hybrid MPGD multilayer layout combining two layers of Thick-GEMs and a bulk resistive MICROMEGAS. Concerning biasing voltage, the Thick-GEMs are segmented in order to reduce the energy released in case of occasional discharges, while the MICROMEGAS anode is segmented in pads individually biased at positive voltage, while the micromesh is grounded. In total, there are ten different electrode types and more than 20000 electrodes supplied by more than 100 HV channels. Commercial power supply units are used. The original elements of the power supply system are the architecture of the voltage distribution net, the compensation, by voltage adjustment, of the effects of pressure and temperature variation affecting the detector gain and a sophisticated control software, which allows to protect the detectors against errors by the operator, to monitor and log voltages and current at 1 Hz rate and to automatically react ...
A Smart Load Interface and Voltage Regulator for Electrostatic Vibration Energy Harvester
Bedier, Mohammed; Basset, Philippe; Galayko, Dimitri
2016-11-01
This paper presents a new implementation in ams 0.35μm HV technology of a complete energy management system for an electrostatic vibrational energy harvester (e-VEH). It is based on the Bennet's doubler architecture and includes a load voltage regulator (LVR) and a smart Load Interface (LI) that are self-controlled with internal voltages for maximum power point tracking (MMPT). The CMOS implementation makes use of an energy harvester that is capable of producing up to 1.8μW at harmonic excitation, given its internal voltage is kept within its optimum. An intermediate LI stage and its controller makes use of a high side switch with zero static power level shifter, and a low power hysteresis comparator. A full circuit level simulation with a VHDL-AMS model of the e-VEH presented was successfully achieved, indicating that the proposed load interface controller consumes less than 100nW average power. Moreover, a LVR regulates the buffer and discharge the harvested energy into a generic resistive load maintaining the voltage within a nominal value of 2 Volts.
Bhattacharya, T
2002-01-01
Our high-pressure Raman scattering experiments on pentaerythritol (C(CH sub 2 OH) sub 4) show that this compound undergoes at least three phase transformations up to 25 GPa. Splitting of various modes at approx 6.3, approx 8.2 and 10 GPa suggests that these phase transformations result in lowering of crystalline symmetry. A very small discontinuous change in slope of most of the Raman-active modes is observed at 0.3 GPa. However, no other signature of a phase transition was observed at this pressure. The observed correlation of the pressures for the onset of the two phase transformations with the limiting values of the distances between various non-bonded atoms in the parent phase suggests that the molecular rearrangements across the phase transformations are not very drastic. In addition, our earlier Fourier transform infrared and present Raman investigations indicate that high-pressure compression leads to increase in strength of the hydrogen bond present in this compound.
Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.
Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J
2012-07-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.
Desipramine in opioid-dependent cocaine abusers maintained on buprenorphine vs methadone.
Oliveto, A H; Feingold, A; Schottenfeld, R; Jatlow, P; Kosten, T R
1999-09-01
Cocaine abuse occurs in 40% to 60% of patients entering opioid maintenance treatment, and effective pharmacotherapies are needed for this combined dependence. This 13-week, randomized, double-blind, placebo-controlled trial evaluated the efficacy of desipramine hydrochloride (0 or 150 mg/d) plus buprenorphine hydrochloride (12 mg/d) or methadone hydrochloride (65 mg/d) in 180 opioid-dependent cocaine abusers (124 men, 56 women). Supervised urine samples were obtained thrice weekly, and self-reported cocaine and heroin use was reported once weekly. Desipramine plasma levels were determined at weeks 4 and 10. In men, opioid abstinence was increased more rapidly over time when treated with methadone than with buprenorphine, whereas cocaine abstinence was increased more with buprenorphine than with methadone. In women, opioid abstinence was increased the least rapidly when treated with buprenorphine plus placebo, while cocaine abstinence was increased more rapidly over time when treated with methadone than with buprenorphine. Regardless of sex or opioid medication, desipramine increased opioid and cocaine abstinence more rapidly over time than placebo. Self-reported opioid use confirmed these findings. Desipramine plasma levels were higher in women than in men, particularly those on buprenorphine maintenance. Higher desipramine plasma levels were associated with greater opioid, but not cocaine, abstinence. Desipramine may be a useful adjunctive medication in facilitating opioid and cocaine abstinence in opioid-maintained patients. The efficacy of opioid medications to treat opioid or cocaine dependence may differ by sex. These findings highlight the importance of including sex as a factor when examining treatment outcome in these types of trials.
Origin of the transition voltage in gold–vacuum–gold atomic junctions
Wu, Kunlin
2012-12-13
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.
Czech Academy of Sciences Publication Activity Database
Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav
2007-01-01
Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Directory of Open Access Journals (Sweden)
H. Schaefer
2012-09-01
Full Text Available Isotope records of atmospheric CH4 can be used to infer changes in the biogeochemistry of CH4. One factor currently limiting the quantitative interpretation of such changes are uncertainties in the isotope measurements stemming from the lack of a unique isotope reference gas, certified for δ13C-CH4 or δ2H-CH4. We present a method to produce isotope reference gases for CH4 in synthetic air that are precisely anchored to the VPDB and VSMOW scales and have δ13C-CH4 values typical for the modern and glacial atmosphere. We quantitatively combusted two pure CH4 gases from fossil and biogenic sources and determined the δ13C and δ2H values of the produced CO2 and H2O relative to the VPDB and VSMOW scales within a very small analytical uncertainty of 0.04‰ and 0.7‰, respectively. We found isotope ratios of −39.56‰ and −56.37‰ for δ13C and −170.1‰ and −317.4‰ for δ2H in the fossil and biogenic CH4, respectively. We used both CH4 types as parental gases from which we mixed two filial CH4 gases. Their δ13C was determined to be −42.21‰ and −47.25‰ representing glacial and present atmospheric δ13C-CH4. The δ2H isotope ratios of the filial CH4 gases were found to be −193.1‰ and −237.1‰, respectively. Next, we mixed aliquots of the filial CH4 gases with ultrapure N2/O2 (CH4 ≤ 2 ppb producing two isotope reference gases of synthetic air with CH4 mixing ratios near atmospheric values. We show that our method is reproducible and does not introduce isotopic fractionation for δ13C within the uncertainties of our detection limit (we cannot conclude this for δ2H because our system is currently not prepared for δ2H-CH4 measurements in air samples. The general principle of our method can be applied to produce synthetic isotope reference gases targeting δ2H-CH4 or other gas species.
Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B
2017-09-20
Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In
Simulation of forward dark current voltage characteristics of tandem solar cells
International Nuclear Information System (INIS)
Rubinelli, F.A.
2012-01-01
The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the
Energy Technology Data Exchange (ETDEWEB)
Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)
2007-04-30
The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.
Practical experience in the determination of the tube voltage using the Ardran-Crooks cassette
International Nuclear Information System (INIS)
Ewen, K.; Roesner, W.
1984-01-01
Within the framework of quality control measures in X-ray diagnostics and therapy, it is desirable to employ for the determination of tube voltage (e.g. in diagnostic X-ray equipment) methods which are as economical as possible while saving time and being simple to apply in spite of the fact that they are as highly accurate as ever possible. The absorber method described here, represented by the Ardran-Crooks cassette, possesses the advantage of low price and easy application. However, if it is operated in such a way that time is saved (assessment by the eye), it is not so accurate, whereas in accurate operation (assessment via luxmeter) it does require a relatively large amount of time. After the film has been exposed, it is necessary to estimate or measure the agreement of blackenings on one and the same film in order to determine the tube voltage. This voltage is then read off by means of a calibration curve. The error in the determination of the tube voltage via the Ardran-Crooks cassette depends on the accuracy of the calibration curve, which, in turn, depends on the number of measurements performed when producing the curve, and on the correct voltage of the standard X-ray equipment used in producing the calibration curve. In addition, assessment by eye adds a total error of 2.3% to 8%, depending on the amount of tube voltage. If the luxmeter is used instead of the eye, this additional error is less than 1% in relation to the magnitude of the tube voltage. (orig./BWU) [de
A Study on Energy Saving of Single Phase Induction Motor By Voltage Control
Energy Technology Data Exchange (ETDEWEB)
Bae, Jong Moon [Pusan College of Information Technolgy, Pusan (Korea); Kim, Joon Hong [Dong Myong College, Pusan (Korea)
2001-06-01
This paper describes a simple effective method for energy saving of AC motors having a widely variable load. The proposed method is based on an optimal efficiency control which is operated by voltage-current pattern such as to maintain the maximum efficiency on the efficiency-output characteristics of the motor, TRIAC voltage control characteristics. The parameters of simplified voltage-current pattern can be determined approximately and reliably from the rated voltage and current of the motor. Experiments are focused on a single phase capacitor motor, the optimal energy saving are proved by proposed method. (author). 8 refs., 15 figs.
Developing Fast Fluorescent Protein Voltage Sensors by Optimizing FRET Interactions.
Directory of Open Access Journals (Sweden)
Uhna Sung
Full Text Available FRET (Förster Resonance Energy Transfer-based protein voltage sensors can be useful for monitoring neuronal activity in vivo because the ratio of signals between the donor and acceptor pair reduces common sources of noise such as heart beat artifacts. We improved the performance of FRET based genetically encoded Fluorescent Protein (FP voltage sensors by optimizing the location of donor and acceptor FPs flanking the voltage sensitive domain of the Ciona intestinalis voltage sensitive phosphatase. First, we created 39 different "Nabi1" constructs by positioning the donor FP, UKG, at 8 different locations downstream of the voltage-sensing domain and the acceptor FP, mKO, at 6 positions upstream. Several of these combinations resulted in large voltage dependent signals and relatively fast kinetics. Nabi1 probes responded with signal size up to 11% ΔF/F for a 100 mV depolarization and fast response time constants both for signal activation (~2 ms and signal decay (~3 ms. We improved expression in neuronal cells by replacing the mKO and UKG FRET pair with Clover (donor FP and mRuby2 (acceptor FP to create Nabi2 probes. Nabi2 probes also had large signals and relatively fast time constants in HEK293 cells. In primary neuronal culture, a Nabi2 probe was able to differentiate individual action potentials at 45 Hz.
Pulakazhi Venu, Vivek Krishna; Adijiang, Ayinuer; Seibert, Tara; Chen, Yong-Xiang; Shi, Chunhua; Batulan, Zarah; O'Brien, Edward R
2017-06-01
Recently, we demonstrated that heat shock protein (HSP)-27 is protective against the development of experimental atherosclerosis, reducing plaque cholesterol content by more than 30%. Moreover, elevated HSP-27 levels are predictive of relative freedom from clinical cardiovascular events. HSP-27 signaling occurs via the activation of NF-κB, which induces a marked up-regulation in expression of granulocyte-monocyte colony-stimulating factor (GM-CSF), a cytokine that is known to alter ABC transporters involved in reverse cholesterol transport (RCT). Therefore, we hypothesized that HSP-27-derived GM-CSF has a potent role in impeding plaque formation by promoting macrophage RCT and sought to better characterize this pathway. Treatment of THP-1 cells, RAW-Blue cells, and primary macrophages with recombinant HSP-27 resulted in NF-κB activation via TLR-4 and was inhibited by various pharmacologic blockers of this pathway. Moreover, HSP-27-induced upregulation of GM-CSF expression was dependent on TLR-4 signaling. Recombinant (r)HSP-27 treatment of ApoE -/- female (but not male) mice for 4 wk yielded reductions in plaque area and cholesterol clefts of 33 and 47%, respectively, with no effect on GM-CSF -/- ApoE -/- mice. With 12 wk of rHSP-27 treatment, both female and male mice showed reductions in plaque burden (55 and 42%, respectively) and a 60% reduction in necrotic core area but no treatment effect in GM-CSF -/- ApoE -/- mice. In vitro functional studies revealed that HSP-27 enhanced the expression of ABCA1 and ABCG1, as well as facilitated cholesterol efflux in vitro by ∼10%. These novel findings establish a paradigm for HSP-27-mediated RCT and set the stage for the development of HSP-27 atheroprotective therapeutics.-Pulakazhi Venu, V. K., Adijiang, A., Seibert, T., Chen, Y.-X., Shi, C., Batulan, Z., O'Brien, E. R. Heat shock protein 27-derived atheroprotection involves reverse cholesterol transport that is dependent on GM-CSF to maintain ABCA1 and ABCG1
Nonlinear electrokinetics at large voltages
Energy Technology Data Exchange (ETDEWEB)
Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu
2009-07-15
The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.
Luo, Pan; Lu, Yun; Li, Changjun; Zhou, Mei; Chen, Cheng; Lu, Qing; Xu, Xulin; He, Zhi; Guo, Lianjun
2015-09-01
Chronic cerebral hypoperfusion (CCH) causes learning and memory impairments and increases the risk of Alzheimer disease (AD) and vascular dementia (VD) through several biologically plausible pathways, yet the mechanisms underlying the disease process remained unclear particularly in a temporal manner. We performed permanent bilateral occlusion of the common carotid arteries (two-vessel occlusion, 2VO) to induce CCH. To determine whether hyperpolarization-activated cyclic nucleotide-gated (HCN) channels are altered at different stages of cognitive impairment caused by CCH, adult male SD rats were randomly distributed into sham-operated 4, 8 and 12weeks group, 2VO 4, 8 and 12weeks group. Learning and memory performance were evaluated with Morris water maze (MWM) and long-term potentiation (LTP) was used to address the underlying synaptic mechanisms. Expression of NeuN, HCN1 and HCN2 in hippocampal CA1, DG and CA3 areas was quantified by immunohistochemistry and western blotting. Our data showed that CCH induced a remarkable spatial learning and memory deficits in rats of 2VO 4, 8, and 12weeks group although neuronal loss only occurred after 4weeks of 2VO surgery in CA1. In addition, a significant reduction of HCN1 surface expression in CA1 was observed in the group that suffered 4weeks ischemia but neither 8 nor 12weeks. However, HCN2 surface expression in CA1 increased throughout the ischemia time-scales (4, 8 and 12w). Our findings indicate spatial learning and memory deficits in the CCH model are associated with disturbed HCN1 and HCN2 surface expression in hippocampal CA1. The altered patterns of both HCN1 and HCN2 surface expression may be implicated in the early stage (4w) of spatial learning and memory impairments; and the stable and long-lasting impairments of spatial learning and memory may partially attribute to the up-regulated HCN2 surface expression. Copyright © 2015 Elsevier Inc. All rights reserved.
An optical fiber Bragg grating and piezoelectric ceramic voltage sensor
Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui
2017-10-01
Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.
An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.
Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui
2017-10-01
Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.
Directory of Open Access Journals (Sweden)
Hyewon Lee
2015-04-01
Full Text Available This paper describes the design, evaluation, and implementation of a compensation scheme for a measurement voltage transformer (VT using the hysteresis characteristics of the core. The error of a VT is caused by the primary winding voltage and secondary winding voltage. The latter depends on the secondary current, whereas the former depends on the primary current, which is an aggregate of the exciting and secondary currents. The secondary current is obtained directly from the secondary voltage and is used to obtain the voltage across the secondary winding. For the primary current, the exciting current is decomposed into two components: core-loss and magnetizing currents. The magnetizing current is obtained by the flux-magnetizing current curve instead of the hysteresis loop to minimize the required loops for compensation. The core-loss current is obtained by dividing the primary induced voltage by the core-loss resistance. Finally, the estimated voltages across the primary and secondary windings are added to the measured secondary voltage for compensation. The scheme can significantly improve the accuracy of a VT. The results of the performance of compensator are shown in the experimental test. The accuracy of the measurement VT improves from 1.0C class to 0.1C class. The scheme can help to significantly reduce the required core cross section of a measurement VT in an electrical energy system.
Synchro-betatron resonance due to gap voltage asymmetry
Energy Technology Data Exchange (ETDEWEB)
Baartman, R
1992-11-01
RF cavities for synchrotrons are not in general axially symmetric. This can be due, for example, to the location of the input power coupling loop. It can cause the voltage on one side of the accelerating gap to be different from that on the other side. Associated with this asymmetry is an rf magnetic field which deflects a beam particle by an amount depending upon its rf phase. The deflection can accumulate if the betatron tune is situated on a synchrotron sideband of the integer resonance. We develop the theory for this resonance and apply it to the KAON Factory Booster and to the SSC LEB. We find that the upper limit on allowable voltage asymmetry across the beam pipe is 0.1% in both cases. (author) 5 refs., 1 tab.
Heat-pump performance: voltage dip/sag, under-voltage and over-voltage
Directory of Open Access Journals (Sweden)
William J.B. Heffernan
2014-12-01
Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.
Increased oxidative metabolism and myoglobin expression in zebrafish muscle during chronic hypoxia
Directory of Open Access Journals (Sweden)
Richard T. Jaspers
2014-07-01
Full Text Available Fish may be extremely hypoxia resistant. We investigated how muscle fibre size and oxidative capacity in zebrafish (Danio rerio adapt during severe chronic hypoxia. Zebrafish were kept for either 3 or 6 weeks under chronic constant hypoxia (CCH (10% air/90%N2 saturated water. We analyzed cross-sectional area (CSA, succinate dehydrogenase (SDH activity, capillarization, myonuclear density, myoglobin (Mb concentration and Mb mRNA expression of high and low oxidative muscle fibres. After 3 weeks of CCH, CSA, SDH activity, Mb concentration, capillary and myonuclear density of both muscle fibre types were similar as under normoxia. In contrast, staining intensity for Mb mRNA of hypoxic high oxidative muscle fibres was 94% higher than that of normoxic controls (P<0.001. Between 3 and 6 weeks of CCH, CSA of high and low oxidative muscle fibres increased by 25 and 30%, respectively. This was similar to normoxic controls. Capillary and myonuclear density were not changed by CCH. However, in high oxidative muscle fibres of fish maintained under CCH, SDH activity, Mb concentration as well as Mb mRNA content were higher by 86%, 138% and 90%, respectively, than in muscle fibres of fish kept under normoxia (P<0.001. In low oxidative muscle fibres, SDH activity, Mb and Mb mRNA content were not significantly changed. Under normoxia, the calculated interstitial oxygen tension required to prevent anoxic cores in muscle fibres (PO2crit of high oxidative muscle fibres was between 1.0 and 1.7 mmHg. These values were similar at 3 and 6 weeks CCH. We conclude that high oxidative skeletal muscle fibres of zebrafish continue to grow and increase oxidative capacity during CCH. Oxygen supply to mitochondria in these fibres may be facilitated by an increased Mb concentration, which is regulated by an increase in Mb mRNA content per myonucleus.
PMU-Aided Voltage Security Assessment for a Wind Power Plant: Preprint
Energy Technology Data Exchange (ETDEWEB)
Jiang, H.; Zhang, Y. C.; Zhang, J. J.; Muljadi, E.
2015-04-08
Because wind power penetration levels in electric power systems are continuously increasing, voltage stability is a critical issue for maintaining power system security and operation. The traditional methods to analyze voltage stability can be classified into two categories: dynamic and steady-state. Dynamic analysis relies on time-domain simulations of faults at different locations; however, this method needs to exhaust faults at all locations to find the security region for voltage at a single bus. With the widely located phasor measurement units (PMUs), the Thevenin equivalent matrix can be calculated by the voltage and current information collected by the PMUs. This paper proposes a method based on a Thevenin equivalent matrix to identify system locations that will have the greatest impact on the voltage at the wind power plant’s point of interconnection. The number of dynamic voltage stability analysis runs is greatly reduced by using the proposed method. The numerical results demonstrate the feasibility, effectiveness, and robustness of the proposed approach for voltage security assessment for a wind power plant.
Low-Voltage Switched-Capacitor Circuits
DEFF Research Database (Denmark)
Bidari, E.; Keskin, M.; Maloberti, F.
1999-01-01
Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....
The effect of external visible light on the breakdown voltage of a long discharge tube
Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.
2016-06-01
The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.
Determination of maintainability for Dacia 1304, 1,9 D utility vehicle
Budiul Berghian, A.; Vasiu, T.; Birtok Baneasa, C.
2018-01-01
The study analyses the ability to be maintained or rehabilitation of Dacia 1304, 1,9D utility vehicle. The paper comprises the determination of its maintainability using the Weibull++8 specialized software.
Functional diversity of voltage-sensing phosphatases in two urodele amphibians.
Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi
2014-07-16
Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...
Energy Technology Data Exchange (ETDEWEB)
He, Bingjun [College of Life Sciences, Nankai University, Tianjin 300071 (China); Soderlund, David M., E-mail: dms6@cornell.edu [Department of Entomology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456 (United States)
2011-12-15
We expressed rat Na{sub v}1.6 sodium channels in combination with the rat {beta}1 and {beta}2 auxiliary subunits in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on expressed sodium currents using the whole-cell patch clamp technique. Both pyrethroids produced concentration-dependent, resting modification of Na{sub v}1.6 channels, prolonging the kinetics of channel inactivation and deactivation to produce persistent 'late' currents during depolarization and tail currents following repolarization. Both pyrethroids also produced concentration dependent hyperpolarizing shifts in the voltage dependence of channel activation and steady-state inactivation. Maximal shifts in activation, determined from the voltage dependence of the pyrethroid-induced late and tail currents, were {approx} 25 mV for tefluthrin and {approx} 20 mV for deltamethrin. The highest attainable concentrations of these compounds also caused shifts of {approx} 5-10 mV in the voltage dependence of steady-state inactivation. In addition to their effects on the voltage dependence of inactivation, both compounds caused concentration-dependent increases in the fraction of sodium current that was resistant to inactivation following strong depolarizing prepulses. We assessed the use-dependent effects of tefluthrin and deltamethrin on Na{sub v}1.6 channels by determining the effect of trains of 1 to 100 5-ms depolarizing prepulses at frequencies of 20 or 66.7 Hz on the extent of channel modification. Repetitive depolarization at either frequency increased modification by deltamethrin by {approx} 2.3-fold but had no effect on modification by tefluthrin. Tefluthrin and deltamethrin were equally potent as modifiers of Na{sub v}1.6 channels in HEK293 cells using the conditions producing maximal modification as the basis for comparison. These findings show that the actions of tefluthrin and deltamethrin of Na{sub v}1.6 channels
Hoke, Eric T.
2012-09-14
Polymer:fullerene solar cells are demonstrated with power conversion efficiencies over 7% with blends of PBDTTPD and PC 61 BM. These devices achieve open-circuit voltages ( V oc ) of 0.945 V and internal quantum efficiencies of 88%, making them an ideal candidate for the large bandgap junction in tandem solar cells. V oc \\'s above 1.0 V are obtained when the polymer is blended with multiadduct fullerenes; however, the photocurrent and fill factor are greatly reduced. In PBDTTPD blends with multiadduct fullerene ICBA, fullerene emission is observed in the photoluminescence and electroluminescence spectra, indicating that excitons are recombining on ICBA. Voltage-dependent, steady state and time-resolved photoluminescence measurements indicate that energy transfer occurs from PBDTTPD to ICBA and that back hole transfer from ICBA to PBDTTPD is inefficient. By analyzing the absorption and emission spectra from fullerene and charge transfer excitons, we estimate a driving free energy of -0.14 ± 0.06 eV is required for efficient hole transfer. These results suggest that the driving force for hole transfer may be too small for efficient current generation in polymer:fullerene solar cells with V oc values above 1.0 V and that non-fullerene acceptor materials with large optical gaps ( > 1.7 eV) may be required to achieve both near unity internal quantum efficiencies and values of V oc exceeding 1.0 V. © 2013 WILEY-VCH Verlag GmbH and Co.
Hoke, Eric T.; Vandewal, Koen; Bartelt, Jonathan A.; Mateker, William R.; Douglas, Jessica D.; Noriega, Rodrigo; Graham, Kenneth; Frechet, Jean; Salleo, Alberto; McGehee, Michael D.
2012-01-01
Polymer:fullerene solar cells are demonstrated with power conversion efficiencies over 7% with blends of PBDTTPD and PC 61 BM. These devices achieve open-circuit voltages ( V oc ) of 0.945 V and internal quantum efficiencies of 88%, making them an ideal candidate for the large bandgap junction in tandem solar cells. V oc 's above 1.0 V are obtained when the polymer is blended with multiadduct fullerenes; however, the photocurrent and fill factor are greatly reduced. In PBDTTPD blends with multiadduct fullerene ICBA, fullerene emission is observed in the photoluminescence and electroluminescence spectra, indicating that excitons are recombining on ICBA. Voltage-dependent, steady state and time-resolved photoluminescence measurements indicate that energy transfer occurs from PBDTTPD to ICBA and that back hole transfer from ICBA to PBDTTPD is inefficient. By analyzing the absorption and emission spectra from fullerene and charge transfer excitons, we estimate a driving free energy of -0.14 ± 0.06 eV is required for efficient hole transfer. These results suggest that the driving force for hole transfer may be too small for efficient current generation in polymer:fullerene solar cells with V oc values above 1.0 V and that non-fullerene acceptor materials with large optical gaps ( > 1.7 eV) may be required to achieve both near unity internal quantum efficiencies and values of V oc exceeding 1.0 V. © 2013 WILEY-VCH Verlag GmbH and Co.
A common pathway for charge transport through voltage-sensing domains.
Chanda, Baron; Bezanilla, Francisco
2008-02-07
Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.
Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong
2017-08-01
This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.
Voltage Control of Antiferromagnetic Phases at Near-Terahertz Frequencies
Barra, Anthony; Domann, John; Kim, Ki Wook; Carman, Greg
2018-03-01
A method to control antiferromagnetism using voltage-induced strain is proposed and theoretically examined. Voltage-induced magnetoelastic anisotropy is shown to provide sufficient torque to switch an antiferromagnetic domain 90° either from out of plane to in plane or between in-plane axes. Numerical results indicate that strain-mediated antiferromagnetic switching can occur in an 80-nm nanopatterned disk at frequencies approaching 1 THz but that the switching speed heavily depends on the system's mechanical design. Furthermore, the energy cost to induce magnetic switching is only 450 aJ, indicating that magnetoelastic control of antiferromagnetism is substantially more energy efficient than other approaches.
Kant, Surya; Peng, Mingsheng; Rothstein, Steven J
2011-03-01
Plants need abundant nitrogen and phosphorus for higher yield. Improving plant genetics for higher nitrogen and phosphorus use efficiency would save potentially billions of dollars annually on fertilizers and reduce global environmental pollution. This will require knowledge of molecular regulators for maintaining homeostasis of these nutrients in plants. Previously, we reported that the NITROGEN LIMITATION ADAPTATION (NLA) gene is involved in adaptive responses to low-nitrogen conditions in Arabidopsis, where nla mutant plants display abrupt early senescence. To understand the molecular mechanisms underlying NLA function, two suppressors of the nla mutation were isolated that recover the nla mutant phenotype to wild type. Map-based cloning identified these suppressors as the phosphate (Pi) transport-related genes PHF1 and PHT1.1. In addition, NLA expression is shown to be regulated by the low-Pi induced microRNA miR827. Pi analysis revealed that the early senescence in nla mutant plants was due to Pi toxicity. These plants accumulated over five times the normal Pi content in shoots specifically under low nitrate and high Pi but not under high nitrate conditions. Also the Pi overaccumulator pho2 mutant shows Pi toxicity in a nitrate-dependent manner similar to the nla mutant. Further, the nitrate and Pi levels are shown to have an antagonistic crosstalk as displayed by their differential effects on flowering time. The results demonstrate that NLA and miR827 have pivotal roles in regulating Pi homeostasis in plants in a nitrate-dependent fashion.
Equilibrium fluctuation relations for voltage coupling in membrane proteins.
Kim, Ilsoo; Warshel, Arieh
2015-11-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free
International Nuclear Information System (INIS)
Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.
2014-01-01
Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can
Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon
2014-01-01
Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597
Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie
2018-05-01
Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.
Dharia, Sameera; Rabbitt, Richard D
2010-01-01
Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.
Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching
Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest
2017-09-01
A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k = 2) at 1 MHz and 0.5 part in 106 (k = 2) at 100 kHz is within reach.
International Nuclear Information System (INIS)
Rivera, V.A.G.; Stari, C.; Sergeenkov, S.; Marega, E.; Araujo-Moreira, F.M.
2008-01-01
We present our recent results on the temperature dependence of current-voltage characteristics for polycrystalline Y 1-x Pr x Ba 2 Cu 3 O 7-δ superconductors with x=0.0, 0.1 and 0.3. The experimental results are found to be reasonably well fitted for all samples by a power like law of the form V=R(I-I c ) a(T) . Here, we assume that a(T)=1+Φ 0 I C (T)/2πk B T and I C (T)=I C (0)(1-T/T C ) 3/2 for the temperature dependences of the power exponent and critical current, respectively. According to the theoretical interpretation of the obtained results, nonlinear deviation of our current-voltage characteristics curves from Ohmic behavior (with a(T C )=1) below T C is attributed to the manifestation of dissipation processes. They have a characteristic temperature T p defined via the power exponent as a(T p )=2 and are related to the current induced depinning of Abrikosov vortices. Both T C (x) and T p (x) are found to decrease with an increase of Pr concentration x reflecting deterioration of the superconducting properties of the doped samples
Williams, Steven E; Linton, Nick; O'Neill, Louisa; Harrison, James; Whitaker, John; Mukherjee, Rahul; Rinaldi, Christopher A; Gill, Jaswinder; Niederer, Steven; Wright, Matthew; O'Neill, Mark
2017-09-01
Bipolar voltage is used during electroanatomic mapping to define abnormal myocardium, but the effect of activation rate on bipolar voltage is not known. We hypothesized that bipolar voltage may change in response to activation rate. By examining corresponding unipolar signals we sought to determine the mechanisms of such changes. LA extrastimulus mapping was performed during CS pacing in 10 patients undergoing first time paroxysmal atrial fibrillation ablation. Bipolar and unipolar electrograms were recorded using a PentaRay catheter (4-4-4 spacing) and indifferent IVC electrode, respectively. An S1S2 pacing protocol was delivered with extrastimulus coupling interval reducing from 350 to 200 milliseconds. At each recording site (119 ± 37 per LA), bipolar peak-to-peak voltage, unipolar peak to peak voltage and activation delay between unipole pairs was measured. Four patterns of bipolar voltage/extrastimulus coupling interval curves were seen: voltage attenuation with plateau voltage >1 mV (48 ± 15%) or voltage unaffected by coupling interval with plateau voltage >1 mV (17 ± 10%) or voltage attenuation were associated with significantly greater unipolar voltage attenuation at low (25 ± 28 mV/s vs. 9 ± 11 mV/s) and high (23 ± 29 mV/s vs. 6 ± 12 mV/s) plateau voltage sites (P voltage attenuation (P = 0.026). Bipolar electrogram voltage is dependent on activation rate at a significant proportion of sites. Changes in unipolar voltage and timing underlie these effects. These observations have important implications for use of voltage mapping to delineate abnormal atrial substrate. © 2017 The Authors. Journal of Cardiovascular Electrophysiology published by Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Filip Touska
2017-08-01
Full Text Available Ciguatoxins (CTXs are marine toxins that cause ciguatera fish poisoning, a debilitating disease dominated by sensory and neurological disturbances that include cold allodynia and various painful symptoms as well as long-lasting pruritus. Although CTXs are known as the most potent mammalian sodium channel activator toxins, the etiology of many of its neurosensory symptoms remains unresolved. We recently described that local application of 1 nM Pacific Ciguatoxin-1 (P-CTX-1 into the skin of human subjects induces a long-lasting, painful axon reflex flare and that CTXs are particularly effective in releasing calcitonin-gene related peptide (CGRP from nerve terminals. In this study, we used mouse and rat skin preparations and enzyme-linked immunosorbent assays (ELISA to study the molecular mechanism by which P-CTX-1 induces CGRP release. We show that P-CTX-1 induces CGRP release more effectively in mouse as compared to rat skin, exhibiting EC50 concentrations in the low nanomolar range. P-CTX-1-induced CGRP release from skin is dependent on extracellular calcium and sodium, but independent from the activation of various thermosensory transient receptor potential (TRP ion channels. In contrast, lidocaine and tetrodotoxin (TTX reduce CGRP release by 53–75%, with the remaining fraction involving L-type and T-type voltage-gated calcium channels (VGCC. Using transgenic mice, we revealed that the TTX-resistant voltage-gated sodium channel (VGSC NaV1.9, but not NaV1.8 or NaV1.7 alone and the combined activation of the TTX-sensitive VGSC subtypes NaV1.7 and NaV1.1 carry the largest part of the P-CTX-1-caused CGRP release of 42% and 34%, respectively. Given the contribution of CGRP to nociceptive and itch sensing pathways, our findings contribute to a better understanding of sensory symptoms of acute and chronic ciguatera that may help in the identification of potential therapeutics.
Touska, Filip; Sattler, Simon; Malsch, Philipp; Lewis, Richard J.; Zimmermann, Katharina
2017-01-01
Ciguatoxins (CTXs) are marine toxins that cause ciguatera fish poisoning, a debilitating disease dominated by sensory and neurological disturbances that include cold allodynia and various painful symptoms as well as long-lasting pruritus. Although CTXs are known as the most potent mammalian sodium channel activator toxins, the etiology of many of its neurosensory symptoms remains unresolved. We recently described that local application of 1 nM Pacific Ciguatoxin-1 (P-CTX-1) into the skin of human subjects induces a long-lasting, painful axon reflex flare and that CTXs are particularly effective in releasing calcitonin-gene related peptide (CGRP) from nerve terminals. In this study, we used mouse and rat skin preparations and enzyme-linked immunosorbent assays (ELISA) to study the molecular mechanism by which P-CTX-1 induces CGRP release. We show that P-CTX-1 induces CGRP release more effectively in mouse as compared to rat skin, exhibiting EC50 concentrations in the low nanomolar range. P-CTX-1-induced CGRP release from skin is dependent on extracellular calcium and sodium, but independent from the activation of various thermosensory transient receptor potential (TRP) ion channels. In contrast, lidocaine and tetrodotoxin (TTX) reduce CGRP release by 53–75%, with the remaining fraction involving L-type and T-type voltage-gated calcium channels (VGCC). Using transgenic mice, we revealed that the TTX-resistant voltage-gated sodium channel (VGSC) NaV1.9, but not NaV1.8 or NaV1.7 alone and the combined activation of the TTX-sensitive VGSC subtypes NaV1.7 and NaV1.1 carry the largest part of the P-CTX-1-caused CGRP release of 42% and 34%, respectively. Given the contribution of CGRP to nociceptive and itch sensing pathways, our findings contribute to a better understanding of sensory symptoms of acute and chronic ciguatera that may help in the identification of potential therapeutics. PMID:28867800
Recording membrane potential changes through photoacoustic voltage sensitive dye
DEFF Research Database (Denmark)
Zhang, Haichong K.; Kang, Jeeun; Yan, Ping
2017-01-01
Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...
Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma
International Nuclear Information System (INIS)
Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup
2002-01-01
The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate
Substrate bias voltage and deposition temperature dependence on ...
Indian Academy of Sciences (India)
Thin films or a coating of any sort prior to its application into real world has to be studied for the dependence of ..... For line focusing, incident beam mask was employed with ..... org/content/avs/journal/jvst/11/4/10.1116/1.1312732. Thornton J A ...
High Voltage Installation of PS Linac 1 Preinjector
CERN PhotoLab
1974-01-01
The high-voltage installation of the linac 1 preinjector in its house-sized Faraday cage. Originally driven by a 520 kV Cockcroft-Walton generator, at the time of this picture the HV came from a 520 kV SAMES generator. The column in the front carries a capacitor. The cubicle in the right background is the electronics platform (see 7403120). The round structure at left houses the ion source, from where the protons (and sometimes other ions), electrostatically accelerated to 520 keV, enter the Alvarez structure of linac 1, to be accelerated to 50 MeV. Jean-Luc Vallet is busy with servicing the installation. See also 7403064X, 7403066X.
A low voltage programmable unipolar inverter with a gold nanoparticle monolayer on plastic.
Zhou, Ye; Han, Su-Ting; Huang, Long-Biao; Huang, Jing; Yan, Yan; Zhou, Li; Roy, V A L
2013-05-24
A programmable low voltage unipolar inverter with saturated-load configuration has been demonstrated on a plastic substrate. A self-assembled monolayer of gold (Au) nanoparticles was inserted into the dielectric layer acting as a charge trapping layer. The inverter operated well with supply voltages of inverter. Furthermore, the programmable behavior was maintained well at various bending states, demonstrating the adequate flexibility of our devices.
Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel
DEFF Research Database (Denmark)
Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle
2012-01-01
The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
Bootstrapped Low-Voltage Analog Switches
DEFF Research Database (Denmark)
Steensgaard-Madsen, Jesper
1999-01-01
Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...
DEFF Research Database (Denmark)
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar
2008-01-01
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...
Berthier, Christine; Kutchukian, Candice; Bouvard, Clément; Okamura, Yasushi; Jacquemond, Vincent
2015-04-01
Phosphoinositides act as signaling molecules in numerous cellular transduction processes, and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) regulates the function of several types of plasma membrane ion channels. We investigated the potential role of PtdIns(4,5)P2 in Ca(2+) homeostasis and excitation-contraction (E-C) coupling of mouse muscle fibers using in vivo expression of the voltage-sensing phosphatases (VSPs) Ciona intestinalis VSP (Ci-VSP) or Danio rerio VSP (Dr-VSP). Confocal images of enhanced green fluorescent protein-tagged Dr-VSP revealed a banded pattern consistent with VSP localization within the transverse tubule membrane. Rhod-2 Ca(2+) transients generated by 0.5-s-long voltage-clamp depolarizing pulses sufficient to elicit Ca(2+) release from the sarcoplasmic reticulum (SR) but below the range at which VSPs are activated were unaffected by the presence of the VSPs. However, in Ci-VSP-expressing fibers challenged by 5-s-long depolarizing pulses, the Ca(2+) level late in the pulse (3 s after initiation) was significantly lower at 120 mV than at 20 mV. Furthermore, Ci-VSP-expressing fibers showed a reversible depression of Ca(2+) release during trains, with the peak Ca(2+) transient being reduced by ∼30% after the application of 10 200-ms-long pulses to 100 mV. A similar depression was observed in Dr-VSP-expressing fibers. Cav1.1 Ca(2+) channel-mediated current was unaffected by Ci-VSP activation. In fibers expressing Ci-VSP and a pleckstrin homology domain fused with monomeric red fluorescent protein (PLCδ1PH-mRFP), depolarizing pulses elicited transient changes in mRFP fluorescence consistent with release of transverse tubule-bound PLCδ1PH domain into the cytosol; the voltage sensitivity of these changes was consistent with that of Ci-VSP activation, and recovery occurred with a time constant in the 10-s range. Our results indicate that the PtdIns(4,5)P2 level is tightly maintained in the transverse tubule membrane of the muscle fibers
MOTOR ACCELERATION TIME OPTIMIZATION BY THE CHANGE OF THE SUPPLY VOLTAGE VALUE
Directory of Open Access Journals (Sweden)
G. K. Aslanov
2016-01-01
Full Text Available Abstract. It is proved that the deviation of the voltage from the nominal values, often leads to overheating of the motor windings, which reduces the insulation life to a great extent.The task of determining the change in the acceleration time of the motor depending on the switching time of its supply voltage is set. The modeling of DC motor 2ПН132М operation in the short- run changes in starting voltage from 380 V to 220 V - which is its nominal value-is carried out. By sweep method is determined the optimum time for switching the supply voltage of the motor. Mathematical dependencies and simulation results are presented.
Directory of Open Access Journals (Sweden)
Surya Kant
2011-03-01
Full Text Available Plants need abundant nitrogen and phosphorus for higher yield. Improving plant genetics for higher nitrogen and phosphorus use efficiency would save potentially billions of dollars annually on fertilizers and reduce global environmental pollution. This will require knowledge of molecular regulators for maintaining homeostasis of these nutrients in plants. Previously, we reported that the NITROGEN LIMITATION ADAPTATION (NLA gene is involved in adaptive responses to low-nitrogen conditions in Arabidopsis, where nla mutant plants display abrupt early senescence. To understand the molecular mechanisms underlying NLA function, two suppressors of the nla mutation were isolated that recover the nla mutant phenotype to wild type. Map-based cloning identified these suppressors as the phosphate (Pi transport-related genes PHF1 and PHT1.1. In addition, NLA expression is shown to be regulated by the low-Pi induced microRNA miR827. Pi analysis revealed that the early senescence in nla mutant plants was due to Pi toxicity. These plants accumulated over five times the normal Pi content in shoots specifically under low nitrate and high Pi but not under high nitrate conditions. Also the Pi overaccumulator pho2 mutant shows Pi toxicity in a nitrate-dependent manner similar to the nla mutant. Further, the nitrate and Pi levels are shown to have an antagonistic crosstalk as displayed by their differential effects on flowering time. The results demonstrate that NLA and miR827 have pivotal roles in regulating Pi homeostasis in plants in a nitrate-dependent fashion.
Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks
Teverovsky, Alexander
2016-01-01
Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.
Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L
2013-09-09
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Noninvasive method for the calibration of the peak voltage (kVp) meters
International Nuclear Information System (INIS)
Macedo, E.M.; Navarro, M.V.T.; Pereira, L.; Garcia, I.F.M.; Navarro, V.C.C.
2015-01-01
Quality control in diagnostic radiology is one of the mechanisms that minimize radiation exposure, and the measurement of tube voltage is one of the main test in these procedures. So, the calibration of non-invasive tube voltage meters is essential to maintain the metrological reliability of quality control tests. Thus, this work describes the implementation of the calibration methodology of the quantity tube peak voltage by the substitution method, using non-invasive standard meter, at LABPROSAUD-IFBA. The results showed great performance and when compared with calibrations by invasive methods, showed maximum difference of 4%, contemplated in the uncertainty ranges of the calibrations. (author)
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.
Energy Technology Data Exchange (ETDEWEB)
Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)
2015-06-15
We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
DNMT1 maintains progenitor function in self-renewing somatic tissue.
Sen, George L; Reuter, Jason A; Webster, Daniel E; Zhu, Lilly; Khavari, Paul A
2010-01-28
Progenitor cells maintain self-renewing tissues throughout life by sustaining their capacity for proliferation while suppressing cell cycle exit and terminal differentiation. DNA methylation provides a potential epigenetic mechanism for the cellular memory needed to preserve the somatic progenitor state through repeated cell divisions. DNA methyltransferase 1 (DNMT1) maintains DNA methylation patterns after cellular replication. Although dispensable for embryonic stem cell maintenance, the role for DNMT1 in maintaining the progenitor state in constantly replenished somatic tissues, such as mammalian epidermis, is unclear. Here we show that DNMT1 is essential for epidermal progenitor cell function. DNMT1 protein was found enriched in undifferentiated cells, where it was required to retain proliferative stamina and suppress differentiation. In tissue, DNMT1 depletion led to exit from the progenitor cell compartment, premature differentiation and eventual tissue loss. Genome-wide analysis showed that a significant portion of epidermal differentiation gene promoters were methylated in self-renewing conditions but were subsequently demethylated during differentiation. Furthermore, UHRF1 (refs 9, 10), a component of the DNA methylation machinery that targets DNMT1 to hemi-methylated DNA, is also necessary to suppress premature differentiation and sustain proliferation. In contrast, Gadd45A and B, which promote active DNA demethylation, are required for full epidermal differentiation gene induction. These data demonstrate that proteins involved in the dynamic regulation of DNA methylation patterns are required for progenitor maintenance and self-renewal in mammalian somatic tissue.
Saeed Abazari; Ebrahim Haghjou; Ghazanfar Shahgholiyan
2009-01-01
This paper presents a study about of a fuzzy Controlled STATCOM, which can be applied for mitigation of the voltage flicker in a distribution system. The voltage flicker is produced by a large variable load absorbing continuously changing currents such as an arc furnace. The DSTATCOM includes a voltage-sourced PWM inverter and its control system. The control strategy of the DSTATCOM plays an important role in maintaining the voltage flicker. Here, the DSTATCOM controller is designed with two...
A Uniform Voltage Gain Control for Alignment Robustness in Wireless EV Charging
Directory of Open Access Journals (Sweden)
Yabiao Gao
2015-08-01
Full Text Available The efficiency of wireless power transfer is sensitive to the horizontal and vertical distances between the transmitter and receiver coils due to the magnetic coupling change. To address the output voltage variation and efficiency drop caused by misalignment, a uniform voltage gain frequency control is implemented to improve the power delivery and efficiency of wireless power transfer under misalignment. The frequency is tuned according to the amplitude and phase-frequency characteristics of coupling variations in order to maintain a uniform output voltage in the receiver coil. Experimental comparison of three control methods, including fixed frequency control, resonant frequency control, and the proposed uniform gain control was conducted and demonstrated that the uniform voltage gain control is the most robust method for managing misalignment in wireless charging applications.
Directory of Open Access Journals (Sweden)
Iris H Kim
Full Text Available The Hv1 channel and voltage-sensitive phosphatases share with voltage-gated sodium, potassium, and calcium channels the ability to detect changes in membrane potential through voltage-sensing domains (VSDs. However, they lack the pore domain typical of these other channels. NaV, KV, and CaV proteins can be found in neurons and muscles, where they play important roles in electrical excitability. In contrast, VSD-containing proteins lacking a pore domain are found in non-excitable cells and are not involved in neuronal signaling. Here, we report the identification of HVRP1, a protein related to the Hv1 channel (from which the name Hv1 Related Protein 1 is derived, which we find to be expressed primarily in the central nervous system, and particularly in the cerebellum. Within the cerebellar tissue, HVRP1 is specifically expressed in granule neurons, as determined by in situ hybridization and immunohistochemistry. Analysis of subcellular distribution via electron microscopy and immunogold labeling reveals that the protein localizes on the post-synaptic side of contacts between glutamatergic mossy fibers and the granule cells. We also find that, despite the similarities in amino acid sequence and structural organization between Hv1 and HVRP1, the two proteins have distinct functional properties. The high conservation of HVRP1 in vertebrates and its cellular and subcellular localizations suggest an important function in the nervous system.
The direct l-type resonance spectrum of CF3CCH in the vibrational state ν 10 = 2
International Nuclear Information System (INIS)
Woetzel, Ulf; Maeder, Heinrich; Harder, Hauke; Pracna, Petr; Sarka, Kamil
2005-01-01
The direct l-type resonance spectrum of CF 3 CCH in the vibrational state ν 10 = 2 has been measured by means of waveguide microwave Fourier transform spectroscopy in the range 8-26 GHz. Two types of direct l-type resonance transitions induced by the (Δk = ±2, Δl = ±2) interaction could be observed: 262 transitions following the ΔJ = 0, Δk = Δl = 2 selection rule covering values of J = 17-64 and G vertical bar k - l vertical bar from 2 to 15, and 75 transitions following the ΔJ = 0, Δk = Δl = 4 selection rule covering values of J = 44-70 and G up to 3. The strong (2, 2) resonance furthermore allowed the observation of A 1 -A 2 splittings of the k = l = ±2 states from J = 63-70. The transitions with G = 3 showed splittings due to the (4, -2) and (0, 6) interactions. The corresponding energy level systems and part of the Hamiltonian matrix are discussed. Strong perturbations due to Δ(k - l) = 3 interactions coupling the states k = ±1, l = ±2 and k = ±4, l ±2 made possible the observation of perturbation-allowed transitions with selection rule k = ±1, l =± 2 ↔ k = 0, l = ±2. Additionally, the J = 2-1 and 3-2 rotational transitions have been measured. A multiple fitting analysis has been performed in which the experimental data have been fitted using five reduced forms of the effective Hamiltonian as proposed by Sarka and Harder [J. Mol. Spectrosc. 197 (1999) 254]. Parameters up to sixth order have been determined including the axial rotational constant A for both values of vertical bar l vertical bar and the unitary equivalence of the determined parameter sets has been demonstrated
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
LED Current Balance Using a Variable Voltage Regulator with Low Dropout vDS Control
Directory of Open Access Journals (Sweden)
Hung-I Hsieh
2017-02-01
Full Text Available A cost-effective light-emitting diode (LED current balance strategy using a variable voltage regulator (VVR with low dropout vDS control is proposed. This can regulate the multiple metal-oxide-semiconductor field-effect transistors (MOSFETs of the linear current regulators (LCR, maintaining low dropout vDS on the flat vGS-characteristic curves and making all drain currents almost the same. Simple group LCRs respectively loaded with a string LED are employed to implement the theme. The voltage VVdc from a VVR is synthesized by a string LED voltage NvD, source voltage vR, and a specified low dropout vDS = VQ. The VVdc updates instantly, through the control loop of the master LCR, which means that all slave MOSFETs have almost the same biases on their flat vGS-characteristic curves. This leads to all of the string LED currents being equal to each other, producing an almost even luminance. An experimental setup with microchip control is built to verify the estimations. Experimental results show that the luminance of all of the string LEDs are almost equal to one another, with a maximum deviation below 1% during a wide dimming range, while keeping all vDS of the MOSFETs at a low dropout voltage, as expected.
Na(+) /H(+) exchanger 1 (NHE1) function is necessary for maintaining mammary tissue architecture.
Jenkins, Edmund C; Debnath, Shawon; Varriano, Sophia; Gundry, Stephen; Fata, Jimmie E
2014-02-01
The mammary gland is an ideal model to study the link between form and function in normal tissue. Perhaps as interesting as the cues necessary to generate this structure are the signals required to maintain its branched architecture over the lifetime of the organism, since likely these pathways are de-regulated in malignancies. Previously, we have shown that the Na(+) /H(+) exchanger 1 (NHE1), a critical regulator of intracellular pH, was necessary for mammary branching morphogenesis. Here we provide strong evidence that NHE1 function is also necessary for maintaining mammary branched architecture. Inhibition of NHE1 with 5-N-Methy-N-isobutyl amiloride (MIA) on branched structures resulted in a rapid (within 24 hr) and reversible loss of branched architecture that was not accompanied by any overt changes in cell proliferation or cell death. NHE1 inhibition led to a significant acidification of intracellular pH in the branched end buds that preceded a number of events, including altered tissue polarity of myoepithelial cells, loss of NHE1 basal polarity, F-actin rearrangements, and decreased E-cadherin expression. Our results implicate NHE1 function and intracellular pH homeostasis as key factors that maintain mammary tissue architecture, thus, indirectly allowing for mammary function as a milk-providing (form) and -producing (function) gland. Copyright © 2013 Wiley Periodicals, Inc.
ATP binding cassette G1-dependent cholesterol efflux during inflammation.
de Beer, Maria C; Ji, Ailing; Jahangiri, Anisa; Vaughan, Ashley M; de Beer, Frederick C; van der Westhuyzen, Deneys R; Webb, Nancy R
2011-02-01
ATP binding cassette transporter G1 (ABCG1) mediates the transport of cellular cholesterol to HDL, and it plays a key role in maintaining macrophage cholesterol homeostasis. During inflammation, HDL undergoes substantial remodeling, acquiring lipid changes and serum amyloid A (SAA) as a major apolipoprotein. In the current study, we investigated whether remodeling of HDL that occurs during acute inflammation impacts ABCG1-dependent efflux. Our data indicate that lipid free SAA acts similarly to apolipoprotein A-I (apoA-I) in mediating sequential efflux from ABCA1 and ABCG1. Compared with normal mouse HDL, acute phase (AP) mouse HDL containing SAA exhibited a modest but significant 17% increase in ABCG1-dependent efflux. Interestingly, AP HDL isolated from mice lacking SAA (SAAKO mice) was even more effective in promoting ABCG1 efflux. Hydrolysis with Group IIA secretory phospholipase A(2) (sPLA(2)-IIA) significantly reduced the ability of AP HDL from SAAKO mice to serve as a substrate for ABCG1-mediated cholesterol transfer, indicating that phospholipid (PL) enrichment, and not the presence of SAA, is responsible for alterations in efflux. AP human HDL, which is not PL-enriched, was somewhat less effective in mediating ABCG1-dependent efflux compared with normal human HDL. Our data indicate that inflammatory remodeling of HDL impacts ABCG1-dependent efflux independent of SAA.
Voltage-sensing phosphatase modulation by a C2 domain.
Castle, Paul M; Zolman, Kevin D; Kohout, Susy C
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x
International Nuclear Information System (INIS)
Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O
2006-01-01
We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results
A 1.8 V LDO voltage regulator with foldback current limit and thermal protection
International Nuclear Information System (INIS)
Liu Zhiming; Fu Zhongqian; Huang Lu; Xi Tianzuo
2009-01-01
This paper introduces the design of a l.8 V low dropout voltage regulator (LDO) and a foldback current limit circuit which limits the output current to 3 mA when load over-current occurs. The LDO was implemented in a 0.18 μm CMOS technology. The measured result reveals that the LDO's power supply rejection (PSR) is about -58 dB and -54 dB at 20 Hz and 1 kHz respectively, the response time is 4 μs and the quiescent current is 20 μA. The designed LDO regulator can work with a supply voltage down to 2.0 V with a drop-out voltage of 200 mV at a maximum load current of 240 mA. (semiconductor integrated circuits)
Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter
Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.;
2012-01-01
At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Delta E(sub FWHM) = 3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterized the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.
31 CFR 1.30 - Application to system of records maintained by Government contractors.
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Application to system of records maintained by Government contractors. 1.30 Section 1.30 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act § 1.30 Application to system of records maintained...
Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique
2010-03-01
Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Seong-Ho Ok
2013-01-01
Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.
Directory of Open Access Journals (Sweden)
Jan Chodkiewicz
2014-12-01
Full Text Available Background The results of numerous studies indicate strong associations of personality with the occurrence, and also with the treatment, of alcohol dependence. However, there is no agreement regarding the role of particular dimensions of temperament and character in the course of, and for the results of, alcohol rehabilitation therapy. The objective of the present research was to investigate the relationships between the dimensions of temperament and character as they are presented by Robert Cloninger and motivation for maintaining abstinence in the case of male alcohol-dependent individuals concluding the therapy. Participants and procedure Eighty-nine male alcohol-dependent individuals, concluding alcohol rehabilitation therapy in an outpatient setting, were studied. The following research tools were applied: the Temperament and Character Inventory (TCI of R. Cloninger in the Polish adaptation of E. Hornowska (2003, and the Motivation for Maintaining Abstinence Inventory, the author of which is M. Ziółkowski. Results Two clusters, differing in the aspect of motivation for maintaining abstinence after the conclusion of the treatment, were distinguished: of individuals manifesting weaker motivation (n = 39 and those manifesting stronger motivation (n = 50. The patients with stronger motivation manifested the following major features: a lower level of harm avoidance, a higher level of reward dependence, and a higher level of cooperativeness. Conclusions Personality as it is presented by Cloninger manifests connections with motivation for maintaining abstinence. The research confirms the need for diagnosing addicted patients in the scope of temperament and character traits.
Radiation effects on residual voltage of polyethylene films
International Nuclear Information System (INIS)
Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.
1986-01-01
It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)
Nguyen, Diep M N; Schut, Gerrit J; Zadvornyy, Oleg A; Tokmina-Lukaszewska, Monika; Poudel, Saroj; Lipscomb, Gina L; Adams, Leslie A; Dinsmore, Jessica T; Nixon, William J; Boyd, Eric S; Bothner, Brian; Peters, John W; Adams, Michael W W
2017-09-01
Electron bifurcation has recently gained acceptance as the third mechanism of energy conservation in which energy is conserved through the coupling of exergonic and endergonic reactions. A structure-based mechanism of bifurcation has been elucidated recently for the flavin-based enzyme NADH-dependent ferredoxin NADP + oxidoreductase I (NfnI) from the hyperthermophillic archaeon Pyrococcus furiosus. NfnI is thought to be involved in maintaining the cellular redox balance, producing NADPH for biosynthesis by recycling the two other primary redox carriers, NADH and ferredoxin. The P. furiosus genome encodes an NfnI paralog termed NfnII, and the two are differentially expressed, depending on the growth conditions. In this study, we show that deletion of the genes encoding either NfnI or NfnII affects the cellular concentrations of NAD(P)H and particularly NADPH. This results in a moderate to severe growth phenotype in deletion mutants, demonstrating a key role for each enzyme in maintaining redox homeostasis. Despite their similarity in primary sequence and cofactor content, crystallographic, kinetic, and mass spectrometry analyses reveal that there are fundamental structural differences between the two enzymes, and NfnII does not catalyze the NfnI bifurcating reaction. Instead, it exhibits non-bifurcating ferredoxin NADP oxidoreductase-type activity. NfnII is therefore proposed to be a bifunctional enzyme and also to catalyze a bifurcating reaction, although its third substrate, in addition to ferredoxin and NADP(H), is as yet unknown. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Sensing voltage across lipid membranes
Swartz, Kenton J.
2009-01-01
The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925
Directory of Open Access Journals (Sweden)
Margo P
2009-11-01
Full Text Available Dynamic Voltage Restorer (DVR is a power electronics device to protect sensitive load when voltage sag occurs. Commonly, sensitive loads are electronic-based devices which generate harmonics. The magnitude and phase of compensated voltage in DVR depend on grounding system and type of fault. If the system is floating, the zero sequence components do not appear on the load side. Meanwhile, in a neutral grounded system, voltage sag is extremely affected by zero sequence components. A blocking transformer is commonly installed in series with DVR to reduce the effect of zero sequence components. This paper proposes a new DVR control scheme that is capable of eliminating the blocking transformer and reducing harmonic distortion. The system uses fuzzy polar controller to replace the conventional PI or FL controller that is commonly used. By taking into account the zero sequence components in the controller design, the effects of zero sequence components can be compensated. Simulated results show the effectiveness of the proposed DVR controller
Directory of Open Access Journals (Sweden)
E.F. Schwartz
2003-09-01
Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.
LRRK2 regulates voltage-gated calcium channel function.
Directory of Open Access Journals (Sweden)
Cade eBedford
2016-05-01
Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.
2008-01-01
External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J
2008-11-01
External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.
Findeisen, Felix; Minor, Daniel L
2009-03-01
Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.
Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...
Wolf, M.; Noel, G. T.; Stirn, R. J.
1977-01-01
Difficulties in relating observed current-voltage characteristics of individual silicon solar cells to their physical and material parameters were underscored by the unexpected large changes in the current-voltage characteristics telemetered back from solar cells on the ATS-1 spacecraft during their first year in synchronous orbit. Depletion region recombination was studied in cells exhibiting a clear double-exponential dark characteristic by subjecting the cells to proton irradiation. A significant change in the saturation current, an effect included in the Sah, Noyce, Shockley formulation of diode current resulting from recombination in the depletion region, was caused by the introduction of shallow levels in the depletion region by the proton irradiation. This saturation current is not attributable only to diffusion current from outside the depletion region and only its temperature dependence can clarify its origin. The current associated with the introduction of deep-lying levels did not change significantly in these experiments.
Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie
2014-01-01
Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Development of a New Cascade Voltage-Doubler for Voltage Multiplication
Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri
2014-01-01
For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.
DEFF Research Database (Denmark)
Zhao, Xin; Firoozabadi, Mehdi Savaghebi; Quintero, Juan Carlos Vasquez
2015-01-01
. In this paper, a voltage support strategy based on negative sequence droop control, which regulate the positive/negative sequence active and reactive power flow by means of sending proper voltage reference to the inner control loop, is proposed for the grid connected MGs to ride through voltage sags under...... complex line impedance conditions. In this case, the MGs should inject a certain amount of positive and negative sequence power to the grid so that the voltage quality at load side can be maintained at a satisfied level. A two layer hierarchical control strategy is proposed in this paper. The primary...... control loop consists of voltage and current inner loops, conventional droop control and virtual impedance loop while the secondary control loop is based on positive/negative sequence droop control which can achieve power injection under voltage sags. Experimental results with asymmetrical voltage sags...
Hsieh, Ming-Chun; Ho, Yu-Cheng; Lai, Cheng-Yuan; Wang, Hsueh-Hsiao; Lee, An-Sheng; Cheng, Jen-Kun; Chau, Yat-Pang; Peng, Hsien-Yu
2017-11-01
Bromodomain-containing protein 4 binds acetylated promoter histones and promotes transcription; however, the role of bromodomain-containing protein 4 in inflammatory hyperalgesia remains unclear. Male Sprague-Dawley rats received hind paw injections of complete Freund's adjuvant to induce hyperalgesia. The dorsal root ganglia were examined to detect changes in bromodomain-containing protein 4 expression and the activation of genes involved in the expression of voltage-gated sodium channel 1.7, which is a key pain-related ion channel. The intraplantar complete Freund's adjuvant injections resulted in thermal hyperalgesia (4.0 ± 1.5 s; n = 7). The immunohistochemistry and immunoblotting results demonstrated an increase in the bromodomain-containing protein 4-expressing dorsal root ganglia neurons (3.78 ± 0.38 fold; n = 7) and bromodomain-containing protein 4 protein levels (2.62 ± 0.39 fold; n = 6). After the complete Freund's adjuvant injection, histone H3 protein acetylation was enhanced in the voltage-gated sodium channel 1.7 promoter, and cyclin-dependent kinase 9 and phosphorylation of RNA polymerase II were recruited to this area. Furthermore, the voltage-gated sodium channel 1.7-mediated currents were enhanced in neurons of the complete Freund's adjuvant rats (55 ± 11 vs. 19 ± 9 pA/pF; n = 4 to 6 neurons). Using bromodomain-containing protein 4-targeted antisense small interfering RNA to the complete Freund's adjuvant-treated rats, the authors demonstrated a reduction in the expression of bromodomain-containing protein 4 (0.68 ± 0.16 fold; n = 7), a reduction in thermal hyperalgesia (7.5 ± 1.5 s; n = 7), and a reduction in the increased voltage-gated sodium channel 1.7 currents (21 ± 4 pA/pF; n = 4 to 6 neurons). Complete Freund's adjuvant triggers enhanced bromodomain-containing protein 4 expression, ultimately leading to the enhanced excitability of nociceptive neurons and thermal hyperalgesia. This effect is
A 1.8 V LDO voltage regulator with foldback current limit and thermal protection
Energy Technology Data Exchange (ETDEWEB)
Liu Zhiming; Fu Zhongqian; Huang Lu; Xi Tianzuo, E-mail: zml1985@mail.ustc.edu.c [Department of Electronic Science and Technology, University of Science and Technology of China, Hefei 230027 (China)
2009-08-15
This paper introduces the design of a l.8 V low dropout voltage regulator (LDO) and a foldback current limit circuit which limits the output current to 3 mA when load over-current occurs. The LDO was implemented in a 0.18 {mu}m CMOS technology. The measured result reveals that the LDO's power supply rejection (PSR) is about -58 dB and -54 dB at 20 Hz and 1 kHz respectively, the response time is 4 {mu}s and the quiescent current is 20 {mu}A. The designed LDO regulator can work with a supply voltage down to 2.0 V with a drop-out voltage of 200 mV at a maximum load current of 240 mA. (semiconductor integrated circuits)
Modulation of voltage-gated channel currents by harmaline and harmane.
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2005-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.
Suppressing voltage transients in high voltage power supplies
International Nuclear Information System (INIS)
Lickel, K.F.; Stonebank, R.
1979-01-01
A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)
Successful application of Low Voltage Electron Microscopy to practical materials problems
International Nuclear Information System (INIS)
Bell, David C.; Mankin, Max; Day, Robert W.; Erdman, Natasha
2014-01-01
Low-voltage High-Resolution Electron Microscopy (LVHREM) has several advantages, including increased cross-sections for inelastic and elastic scattering, increased contrast per electron, decreased delocalization effects and reduced knock-on damage. Imaging at differing voltages has shown advantages for imaging materials that are knock-on damage sensitive. We show experimentally that different materials systems benefit from low voltage high-resolution microscopy. There are advantages for imaging single layer materials such as graphene at below the knock-on threshold; we present an example of imaging a graphene sheet at 40 kV. We have also examined mesoporous silica decorated with Pd nanoparticles and carbon black functionalized with Pd/Pt nanoparticles. In these cases we show that the lower voltage imaging maintains the structure of the surrounding matrix during imaging, whereas aberration correction provides the higher resolution for imaging the nanoparticle lattice. Perhaps surprisingly we show that zeolites damage preferentially by ionization effects (radiolysis). The current literature suggests that below incident energies of 40 kV the damage is mainly radiolitic, whereas at incident energies above 200 kV the knock-on damage and material sputtering will be the dominant effect. Our experimental observations support this conclusion and the effects we have observed at 40 kV are not indicative of knock-on damage. Other nanoscale materials such as thin silicon nanowires also benefit from lower voltage imaging. LVHREM imaging provides an excellent option to avoid beam damage to nanowires; our results suggest that LVHREM is suitable for nanowire-biological composites. Our experimental observations serve as a clear demonstration that even at 40 keV accelerating voltage, LVHREM can be used without inducing beam damage to locate dislocations and other crystalline defects, which may have adverse effects on nanowire device performance. Low voltage operation will likely
Directory of Open Access Journals (Sweden)
Pui-Sun Lei
2015-01-01
Full Text Available This Letter presents a low start-up voltage dc–dc converter for low-power thermoelectric systems which uses a native n-type MOS transistor as the start-up switch. The start-up voltage of the proposed converter is 300 mV and the converter does not need batteries to start up. The negative voltage control is proposed to reduce the leakage current caused by native n-type transistor and increase the efficiency. The proposed converter was designed using standard 0.18 µm CMOS process with chip size of 0.388 mm^2. The peak efficiency is 63% at load current of 1.5 mA. The proposed converter provides output voltage >1 V at maximum load current of 3.2 mA.
The voltage-gated potassium channel subunit, Kv1.3, is expressed in epithelia
DEFF Research Database (Denmark)
Grunnet, Morten; Rasmussen, Hanne B; Hay-Schmidt, Anders
2003-01-01
The Shaker-type voltage-gated potassium channel, Kv1.3, is believed to be restricted in distribution to lymphocytes and neurons. In lymphocytes, this channel has gained intense attention since it has been proven that inhibition of Kv1.3 channels compromise T lymphocyte activation. To investigate...
A Grid Voltage Measurement Method for Wind Power Systems during Grid Fault Conditions
Yoo, Cheol-Hee; Chung, Il-Yop; Yoo, Hyun-Jae; Hong, Sung-Soo
2014-01-01
Grid codes in many countries require low-voltage ride-through (LVRT) capability to maintain power system stability and reliability during grid fault conditions. To meet the LVRT requirement, wind power systems must stay connected to the grid and also supply reactive currents to the grid to support the recovery from fault voltages. This paper presents a new fault detection method and inverter control scheme to improve the LVRT capability for full-scale permanent magnet synchronous generator (P...
A High-Voltage Level Tolerant Transistor Circuit
Annema, Anne J.; Geelen, Godefridus Johannes Gertrudis Maria
2001-01-01
A high-voltage level tolerant transistor circuit, comprising a plurality of cascoded transistors, including a first transistor (T1) operatively connected to a high-voltage level node (3) and a second transistor (T2) operatively connected to a low-voltage level node (2). The first transistor (T1)
Light emitting diode driver with differential voltage supply
2015-01-01
The current invention relates to a driver for driving one or a plurality of LEDs (D1, D2), comprising at least one driving unit (201, 202) adapted to be supplied with a differential voltage, between one first bias voltage (VB1) and one second bias voltage (VB2), the differential voltage being
Apo calmodulin binding to the L-type voltage-gated calcium channel Cav1.2 IQ peptide
International Nuclear Information System (INIS)
Lian Luyun; Myatt, Daniel; Kitmitto, Ashraf
2007-01-01
The influx of calcium through the L-type voltage-gated calcium channels (LTCCs) is the trigger for the process of calcium-induced calcium release (CICR) from the sarcoplasmic recticulum, an essential step for cardiac contraction. There are two feedback mechanisms that regulate LTCC activity: calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF), both of which are mediated by calmodulin (CaM) binding. The IQ domain (aa 1645-1668) housed within the cytoplasmic domain of the LTCC Ca v 1.2 subunit has been shown to bind both calcium-loaded (Ca 2+ CaM ) and calcium-free CaM (apoCaM). Here, we provide new data for the structural basis for the interaction of apoCaM with the IQ peptide using NMR, revealing that the apoCaM C-lobe residues are most significantly perturbed upon complex formation. In addition, we have employed transmission electron microscopy of purified LTCC complexes which shows that both apoCaM and Ca 2+ CaM can bind to the intact channel
Directory of Open Access Journals (Sweden)
Frank S Choveau
2012-07-01
Full Text Available Voltage-gated potassium (Kv channels are tetramers, each subunit presenting six transmembrane segments (S1-S6, with each S1-S4 segments forming a voltage-sensing domain (VSD and the four S5-S6 forming both the conduction pathway and its gate. S4 segments control the opening of the intracellular activation gate in response to changes in membrane potential. Crystal structures of several voltage-gated ion channels in combination with biophysical and mutagenesis studies highlighted the critical role of the S4-S5 linker (S4S5L and of the S6 C-terminal part (S6T in the coupling between the VSD and the activation gate. Several mechanisms have been proposed to describe the coupling at a molecular scale. This review summarizes the mechanisms suggested for various voltage-gated ion channels, including a mechanism that we described for KCNQ1, in which S4S5L is acting like a ligand binding to S6T to stabilize the channel in a closed state. As discussed in this review, this mechanism may explain the reverse response to depolarization in HCN-like channels. As opposed to S4S5L, the phosphoinositide, phosphatidylinositol 4,5-bisphosphate (PIP2, stabilizes KCNQ1 channel in an open state. Many other ion channels (not only voltage-gated require PIP2 to function properly, confirming its crucial importance as an ion channel co-factor. This is highlighted in cases in which an altered regulation of ion channels by PIP2 leads to channelopathies, as observed for KCNQ1. This review summarizes the state of the art on the two regulatory mechanisms that are critical for KCNQ1 and other voltage-gated channels function (PIP2 and S4-S5L, and assesses their potential physiological and pathophysiological roles.
Reactive power and voltage control strategy based on dynamic and adaptive segment for DG inverter
Zhai, Jianwei; Lin, Xiaoming; Zhang, Yongjun
2018-03-01
The inverter of distributed generation (DG) can support reactive power to help solve the problem of out-of-limit voltage in active distribution network (ADN). Therefore, a reactive voltage control strategy based on dynamic and adaptive segment for DG inverter is put forward to actively control voltage in this paper. The proposed strategy adjusts the segmented voltage threshold of Q(U) droop curve dynamically and adaptively according to the voltage of grid-connected point and the power direction of adjacent downstream line. And then the reactive power reference of DG inverter can be got through modified Q(U) control strategy. The reactive power of inverter is controlled to trace the reference value. The proposed control strategy can not only control the local voltage of grid-connected point but also help to maintain voltage within qualified range considering the terminal voltage of distribution feeder and the reactive support for adjacent downstream DG. The scheme using the proposed strategy is compared with the scheme without the reactive support of DG inverter and the scheme using the Q(U) control strategy with constant segmented voltage threshold. The simulation results suggest that the proposed method has a significant improvement on solving the problem of out-of-limit voltage, restraining voltage variation and improving voltage quality.
A 600kV 15mA Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage
International Nuclear Information System (INIS)
Su Tongling; Zhang Yimin; Chen Shangwen; Liu Yantong; Lv Huiyi; Liu Jiangtao
2006-01-01
A Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage has been developed. This power supply has been operated in a ns pulse neutron generator. The maximum non-load voltage is 600kV while the working voltage and load current are 550kV and 15mA, respectively. The tested results indicate that when the power supply is operated at 300kV, 6.7mA and the input voltage varies +/-10%, the long-term stability of the output voltage is S=(0.300-1.006)x10 -3 . The ripple voltage is δU P-P =6.2V at 300kV, 6.8-8.3mA and the ratio of δU P-P to the output voltage V H is δU P-P /V H =2.1x10 -5
Transient voltage sharing in series-coupled high voltage switches
Directory of Open Access Journals (Sweden)
Editorial Office
1992-07-01
Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analysis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus occurs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.
47 CFR 17.54 - Rated lamp voltage.
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Rated lamp voltage. 17.54 Section 17.54... voltage. To insure the necessary lumen output by obstruction lights, the rated voltage of incandescent lamps used shall correspond to be within 3 percent higher than the voltage across the lamp socket during...
Voltage-sensing phosphatase modulation by a C2 domain
Directory of Open Access Journals (Sweden)
Paul M. Castle
2015-04-01
Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
Control of Grid Interactive PV Inverters for High Penetration in Low Voltage Distribution Networks
Demirok, Erhan
2012-01-01
Regarding of high density deployment of PV installations in electricity grids, new technical challenges such as voltage rise, thermal loading of network components, voltage unbalance, harmonic interaction and fault current contributions are being added to tasks list of distribution system operators (DSOs) in order to maintain at least the same power quality as before PVs were not revealed. Potential problems caused by high amount of PV installations can be avoided with technical study of both...
International Nuclear Information System (INIS)
Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.
2013-01-01
For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).
Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor
International Nuclear Information System (INIS)
Kim, N.; Cheong, Y.; Song, W.
2010-01-01
We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.
Voltage quantization by ballistic vortices in two-dimensional superconductors
International Nuclear Information System (INIS)
Orlando, T.P.; Delin, K.A.
1991-01-01
The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions
Low-power operation using self-timed circuits and adaptive scaling of the supply voltage
DEFF Research Database (Denmark)
Nielsen, Lars Skovby; Niessen, C.; Sparsø, Jens
1994-01-01
Recent research has demonstrated that for certain types of applications like sampled audio systems, self-timed circuits can achieve very low power consumption, because unused circuit parts automatically turn into a stand-by mode. Additional savings may be obtained by combining the self......-timed circuits with a mechanism that adaptively adjusts the supply voltage to the smallest possible, while maintaining the performance requirements. This paper describes such a mechanism, analyzes the possible power savings, and presents a demonstrator chip that has been fabricated and tested. The idea...... of voltage scaling has been used previously in synchronous circuits, and the contributions of the present paper are: 1) the combination of supply scaling and self-timed circuitry which has some unique advantages, and 2) the thorough analysis of the power savings that are possible using this technique.>...
Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.
Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong
2017-10-23
The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.
Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.
Masetto, S; Weng, T; Valli, P; Correia, M J
1999-06-23
Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.
Directory of Open Access Journals (Sweden)
Dong-Hai Liu
Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Directory of Open Access Journals (Sweden)
José Joaquín Merino
Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Quantum phase slips and voltage fluctuations in superconducting nanowires
Energy Technology Data Exchange (ETDEWEB)
Semenov, Andrew G. [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physics Institute, Moscow (Russian Federation); National Research University Higher School of Economics, Moscow (Russian Federation); Zaikin, Andrei D. [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physics Institute, Moscow (Russian Federation); Institute of Nanotechnology, Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany)
2017-06-15
We argue that quantum phase slips (QPS) may generate non-equilibrium voltage fluctuations in superconducting nanowires. In the low frequency limit we evaluate all cumulants of the voltage operator which obey Poisson statistics and show a power law dependence on the external bias. We specifically address quantum shot noise which power spectrum S{sub Ω} may depend non-monotonously on temperature. In the long wire limit S{sub Ω} decreases with increasing frequency Ω and vanishes beyond a threshold value of Ω at T → 0. Our predictions can be directly tested in future experiments with superconducting nanowires. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Mitigation of voltage sags in the distribution system with dynamic voltage restorer
International Nuclear Information System (INIS)
Viglas, D.; Belan, A.
2012-01-01
Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)
Directory of Open Access Journals (Sweden)
Dolphin Annette C
2003-09-01
Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those
Energy Technology Data Exchange (ETDEWEB)
Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.
2016-01-01
Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.
2010-01-01
... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Suggested Instrumentation for Current Monitoring Device and High Voltage Facility 1 Figures 1 and 2 to Part 1204 Commercial Practices CONSUMER... Instrumentation for Current Monitoring Device and High Voltage Facility EC03OC91.008 ...
Zhang, Baihao; Chikuma, Shunsuke; Hori, Shohei; Fagarasan, Sidonia; Honjo, Tasuku
2016-07-26
PD-1 (programmed-death 1), an immune-inhibitory receptor required for immune self-tolerance whose deficiency causes autoimmunity with variable severity and tissue specificity depending on other genetic factors, is expressed on activated T cells, including the transcription factor FoxP3(+) Treg cells known to play critical roles in maintaining immune tolerance. However, whether PD-1 expression by the Treg cells is required for their immune regulatory function, especially in autoimmune settings, is still unclear. We found that mice with partial FoxP3 insufficiency developed early-onset lympho-proliferation and lethal autoimmune pancreatitis only when PD-1 is absent. The autoimmune phenotype was rescued by the transfer of FoxP3-sufficient T cells, regardless of whether they were derived from WT or PD-1-deficient mice, indicating that Treg cells dominantly protect against development of spontaneous autoimmunity without intrinsic expression of PD-1. The absence of PD-1 combined with partial FoxP3 insufficiency, however, led to generation of ex-FoxP3 T cells with proinflammatory properties and expansion of effector/memory T cells that contributed to the autoimmune destruction of target tissues. Altogether, the results suggest that PD-1 and FoxP3 work collaboratively in maintaining immune tolerance mostly through nonoverlapping pathways. Thus, PD-1 is modulating the activation threshold and maintaining the balance between regulatory and effector T cells, whereas FoxP3 is sufficient for dominant regulation through maintaining the integrity of the Treg function. We suggest that genetic or environmental factors that even moderately affect the expression of both PD-1 and FoxP3 can cause life-threatening autoimmune diseases by disrupting the T-cell homeostasis.
Voltage current characteristics of type III superconductors
International Nuclear Information System (INIS)
Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.
1980-01-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)
Voltage current characteristics of type III superconductors
Energy Technology Data Exchange (ETDEWEB)
Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii
1980-06-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.
2005-01-01
A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional
Teruya, Daisuke; Masukawa, Shigeo; Iida, Shoji
We propose a novel inverter that can be operated either as a Current Source Inverter (CSI) or as a Voltage Source Inverter (VSI) by changing only the control signals. It is proper to apply it to the interconnecting system with renewal energy, such as photovoltaic cells or wind generation systems, to a grid. This inverter is usually operated as the CSI connected to the grid. Even if the energy source has a lower voltage than the grid, the energy can be supplied to the grid through the proposed inverter. The power factor can be briefly maintained at almost unity. When power supply from the grid is interrupted, the proposed circuit should be operated as the VSI in the stand-alone operation mode. In this way, the circuit can maintain a constant output voltage to the loads. In this paper, the proposed circuit configuration and the control schemes for both the CSI and the VSI are described. Further, the circuit characteristics for both are discussed experimentally.
CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.
Directory of Open Access Journals (Sweden)
Samuel eGoodchild
2012-06-01
Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.
Microprocessor-controlled, programmable ramp voltage generator
International Nuclear Information System (INIS)
Hopwood, J.
1978-11-01
A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds
Directory of Open Access Journals (Sweden)
Natalia González
Full Text Available Skeletal muscle regeneration and long term maintenance is directly link to the balance between self-renewal and differentiation of resident adult stem cells known as satellite cells. In turn, satellite cell fate is influenced by a functional interaction between the transcription factor Pax7 and members of the MyoD family of muscle regulatory factors. Thus, changes in the Pax7-to-MyoD protein ratio may act as a molecular rheostat fine-tuning acquisition of lineage identity while preventing precocious terminal differentiation. Pax7 is expressed in quiescent and proliferating satellite cells, while its levels decrease sharply in differentiating progenitors Pax7 is maintained in cells (reacquiring quiescence. While the mechanisms regulating Pax7 levels based on differentiation status are not well understood, we have recently described that Pax7 levels are directly regulated by the ubiquitin-ligase Nedd4, thus promoting proteasome-dependent Pax7 degradation in differentiating satellite cells. Here we show that Pax7 levels are maintained in proliferating muscle progenitors by a mechanism involving casein kinase 2-dependent Pax7 phosphorylation at S201. Point mutations preventing S201 phosphorylation or casein kinase 2 inhibition result in decreased Pax7 protein in proliferating muscle progenitors. Accordingly, this correlates directly with increased Pax7 ubiquitination. Finally, Pax7 down regulation induced by casein kinase 2 inhibition results in precocious myogenic induction, indicating early commitment to terminal differentiation. These observations highlight the critical role of post translational regulation of Pax7 as a molecular switch controlling muscle progenitor fate.
PLZT light transmittance memory driven with an asymmetric voltage pulse
International Nuclear Information System (INIS)
Inoue, Kazuhiko; Morita, Takeshi
2010-01-01
PLZT is a ferroelectric electro-optic material, which has been operated with a constant voltage supply to keep a certain optical property. In this study, we propose an optical transmittance memory effect by controlling the domain conditions. The keypoint is to use an asymmetric voltage pulse. In the positive direction, a sufficiently-large voltage is applied to align the polarization directions. After this operation, a relatively small light transmittance is memorized even after removing the electric field. On the other hand, in the negative direction, the amplitude of the voltage is adjusted to the coercive electric field. In this condition, the domain structure is almost the same as the depolarization state. With this voltage supply, the maximum light transmittance can be kept after removing the electric field. Using these voltage operations, the PLZT can obtain two light transmittance states depending on the domain structure. This memory effect should be useful for innovative optical scanners or shutters in the future.
Oliva, Harold; Moltedo, Bruno; De Ioannes, Pablo; Faunes, Fernando; De Ioannes, Alfredo E; Becker, María Inés
2002-10-01
We studied the reactivity of mouse monoclonal antibodies (MAbs) against the hemocyanin from the Chilean marine gastropod Concholepas concholepas (CCH). This protein has been successfully used as a carrier to produce antibodies to haptens and peptides. All MAbs (13) belonging to IgG subclass exhibit dissociation constants (K(d)) from 1 x 10(-7) M to 1 x 10(-9) M. MAbs were characterized by enzyme-linked immunosorbant assay (ELISA) using CCH treated with different procedures, including dissociation into CCH-A and CCH-B subunits, Western blot, enzymatic digestion, chemical deglycosylation, and thermal denaturation. MAbs were classified into three categories, according to subunit specificity by ELISA. The epitope distribution shows that CCH subunits display common epitopes (group I, 5 MAbs, 1H5, 2A8, 3A5, 3B3, and 3E3), as well as specific epitopes for CCH-A subunits (group II, 3 MAbs, 1B8, 4D8, and 8E5) and for CCH-B subunits (group III, 5 MAbs, 1A4, 1E4, 2H10, 3B7, and 7B4). The results can be summarized as follows: (1). six antibodies react with thermal denatured CCH, suggesting that they recognize linear epitopes, whereas seven recognize conformational epitopes; (2). oxidation of carbohydrate moieties does not affect the binding of the MAbs; (3). enzymatic digestion of CCH decreases the reactivity of all antibodies irrespective of the protease used (elastase or trypsin); (4). bringing together the above data, in addition to epitopic complementarity analysis, we identified 12 different epitopes on the CCH molecule recognized by these MAbs. The anti-CCH MAbs presented here can be useful tools to understand the subunit organization of the CCH and its complex structure, which can explain its immunogenic and immunostimulating properties in mammals.
Artificial intelligence techniques for voltage control
Energy Technology Data Exchange (ETDEWEB)
Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.
1997-12-31
In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)
Gupta, Rajeev
2017-09-02
The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.
Influence of Voltage on Main Characteristics of Electric Lighting Lamps
Directory of Open Access Journals (Sweden)
V. B. Kozlovskaya
2009-01-01
Full Text Available An analysis and systemization of data on influence of voltage value on main lighting engineering, electric and economic characteristics of incandescent lamps, gaseous-discharge lamps of low and high pressure have been made in the paper.Analytical and graphical dependences have been obtained that ensure to evaluate quantitative changes of corresponding lamp characteristics at voltage deviation from nominal value.
Kishimoto, Tadashi; Ishihara, Tohru; Onodera, Hidetoshi
2018-04-01
In this paper, we propose a temperature monitor circuit that exhibits a small supply voltage sensitivity adopting a circuit topology of a reconfigurable ring oscillator. The circuit topology of the monitor is crafted such that the oscillation frequency is determined by the amount of subthreshold leakage current, which has an exponential dependence on temperature. Another important characteristic of the monitor is its small supply voltage sensitivity. The measured oscillation frequency of a test chip fabricated in a 65 nm CMOS process varies only 2.6% under a wide range of supply voltages from 0.4 to 1.0 V at room temperature. The temperature estimation error ranges from -0.3 to 0.4 °C over a temperature range of 10 to 100 °C.
Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava
2014-04-03
Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.
Voltage breakdown on niobium and copper surfaces
International Nuclear Information System (INIS)
Werner, G.R.; Padamsee, H.; Betzwieser, J.C.; Liu, Y.G.; Rubin, K.H.R.; Shipman, J.E.; Ying, L.T.
2003-01-01
Experiments have shown that voltage breakdown in superconducting niobium RF cavities is in many ways similar to voltage breakdown on niobium cathodes in DC voltage gaps; most striking are the distinctive starburst patterns and craters that mark the site of voltage breakdown in both superconducting cavities and DC vacuum gaps. Therefore, we can learn much about RF breakdown from simpler, faster DC experiments. We have direct evidence, in the form of before'' and ''after'' pictures, that breakdown events caused by high surface electric fields occur with high probability at contaminant particles on surfaces. Although the pre-breakdown behavior (field emission) seems to depend mostly on the contaminant particles present and little on the substrate, the breakdown event itself is greatly affected by the substrate-niobium, heavily oxidized niobium, electropolished copper, and diamond-machined copper cathodes lead to different kinds of breakdown events. By studying DC voltage breakdown we hope to learn more details about the processes involved in the transition from field emission to catastrophic arcing and the cratering of the surface; as well as learning how to prevent breakdown, we would like to learn how to cause breakdown, which could be important when ''processing'' cavities to reduce field emission. (author)
30 CFR 75.804 - Underground high-voltage cables.
2010-07-01
... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution § 75.804 Underground high-voltage cables. (a) Underground high-voltage cables used in resistance... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Underground high-voltage cables. 75.804 Section...
A method of accurate determination of voltage stability margin
Energy Technology Data Exchange (ETDEWEB)
Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology, Wroclaw (Poland); Klimek, A. [AREVA Transmission and Distribution, Stafford (United Kingdom)
2008-07-01
In the process of developing power system disturbance, voltage instability at the receiving substations often contributes to deteriorating system stability, which eventually may lead to severe blackouts. The voltage stability margin at receiving substations may be used to determine measures to prevent voltage collapse, primarily by operating or blocking the transformer tap changing device, or by load shedding. The best measure of the stability margin is the actual load to source impedance ratio and its critical value, which is unity. This paper presented an accurate method of calculating the load to source impedance ratio, derived from the Thevenin's equivalent circuit of the system, which led to calculation of the stability margin. The paper described the calculation of the load to source impedance ratio including the supporting equations. The calculation was based on the very definition of voltage stability, which says that system stability is maintained as long as the change of power, which follows the increase of admittance is positive. The testing of the stability margin assessment method was performed in a simulative way for a number of power network structures and simulation scenarios. Results of the simulations revealed that this method is accurate and stable for all possible events occurring downstream of the device location. 3 refs., 8 figs.
International Nuclear Information System (INIS)
Calnan, Sonya; Upadhyaya, Hari M.; Dann, Sandra E.; Thwaites, Mike J.; Tiwari, Ayodhya N.
2007-01-01
Indium tin oxide (ITO) films were deposited by reactive High Target Utilisation Sputtering (HiTUS) onto glass and polyimide substrates. The ion plasma was generated by an RF power source while the target bias voltage was varied from 300 V to 500 V using a separate DC power supply. The deposition rate, at constant target power, increased with DC target voltage due to increased ion energy reaching 34 nm/min at 500 V. All the films were polycrystalline and showed strong (400) and (222) reflections with the relative strength of latter increasing with target bias voltage. The resistivity was lowest at 500 V with values of 1.8 x 10 -4 Ω cm and 2.4 x 10 -4 Ω cm on glass and polyimide, respectively but was still less than 5 x 10 -4 Ω cm at 400 V. All films were highly transparent to visible light, (> 80%) but the NIR transmittance decreased with increasing target voltage due to higher free carrier absorption. Therefore, ITO films can be deposited onto semiconductor layers such as in solar cells, with minimal ion damage while maintaining low resistivity
Mohammad Moradi, Omid; Şen, Canhan; Sen, Canhan; Boni, A. G.; Pintilie, L.; Mısırlıoğlu, Burç; Misirlioglu, Burc
2018-01-01
In this work, we report on the variability of the Schottky effect in solution processed Ba1-xSrxTiO3 films (BST, x = 0, 0.5) grown on 0.5% Nb doped SrTiO3 substrates with top Pt electrodes (NSTO/BST/Pt). The films display leakage currents accompanied by varying degrees of hystereses in the current-voltage measurements. The magnitude of the leakage and hystereses depend on the Sr content. We focus on the current-voltage (I-V) behavior of our samples in the light of thermodynamic theory of ferr...
Coordinated control for low voltage ride-through of a PMSG-based wind power plant
Directory of Open Access Journals (Sweden)
Khagendra Thapa
2016-01-01
Full Text Available Wind turbine generators should be kept connected to a power grid, while supporting the voltage recovery in the case of a grid fault to meet low voltage ride-through requirement in some grid codes. This paper proposes a coordinated control scheme that prevents the increase in the DC-link voltage by reducing the active power in the machine side converter of permanent magnet synchronous generators (PMSGs in proportion to the voltage dip at the terminal of PMSGs. The proposed scheme changes the current priorities from the active current to the reactive current to inject more reactive power for a severe fault depending on the voltage dip. In addition, the grid-side converter operates in a voltage control mode with the slope, which is the ratio of reactive current capability to the voltage tolerance around a rated value. Moreover, during the fault, the slope is changed depending on the voltage dip to inject more reactive current. The performance of the proposed scheme is validated for a wind power plant consisting of 20 units of 5-MW PMSGs using an EMTP-RV simulator. The results demonstrate that the scheme enables the PMSGs not only to survive during the fault, but also to provide a dynamic reactive power support.
Design of shielded voltage divider for impulse voltage measurement
International Nuclear Information System (INIS)
Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.
1976-01-01
The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)
Current-voltage temperature characteristics of Au/n-Ge (1 0 0) Schottky diodes
Energy Technology Data Exchange (ETDEWEB)
Chawanda, Albert, E-mail: albert.chawanda@up.ac.za [Midlands State University, Bag 9055 Gweru (Zimbabwe); University of Pretoria, 0002 Pretoria (South Africa); Mtangi, Wilbert; Auret, Francois D; Nel, Jacqueline [University of Pretoria, 0002 Pretoria (South Africa); Nyamhere, Cloud [Nelson Mandela Metropolitan University, Port Elizabeth (South Africa); Diale, Mmantsae [University of Pretoria, 0002 Pretoria (South Africa)
2012-05-15
The variation in electrical characteristics of Au/n-Ge (1 0 0) Schottky contacts have been systematically investigated as a function of temperature using current-voltage (I-V) measurements in the temperature range 140-300 K. The I-V characteristics of the diodes indicate very strong temperature dependence. While the ideality factor n decreases, the zero-bias Schottky barrier height (SBH) ({Phi}{sub B}) increases with the increasing temperature. The I-V characteristics are analyzed using the thermionic emission (TE) model and the assumption of a Gaussian distribution of the barrier heights due to barrier inhomogeneities at the metal-semiconductor interface. The zero-bias barrier height {Phi}{sub B} vs. 1/2 kT plot has been used to show the evidence of a Gaussian distribution of barrier heights and values of {Phi}{sub B}=0.615 eV and standard deviation {sigma}{sub s0}=0.0858 eV for the mean barrier height and zero-bias standard deviation have been obtained from this plot, respectively. The Richardson constant and the mean barrier height from the modified Richardson plot were obtained as 1.37 A cm{sup -2} K{sup -2} and 0.639 eV, respectively. This Richardson constant is much smaller than the reported of 50 A cm{sup -2} K{sup -2}. This may be due to greater inhomogeneities at the interface.
DEFF Research Database (Denmark)
Guertin, Pierre A; Hounsgaard, Jørn
2006-01-01
cord of adult turtles maintainable for several weeks in culture conditions. N-methyl-D-aspartate (NMDA)-induced-tetrodotoxin (TTX)-resistant voltage oscillations in motoneurons were approximately 10 times faster in culture than in acute preparations. Oscillations in culture were abolished by NMDA...
Control Strategy of Three-Phase Photovoltaic Inverter under Low-Voltage Ride-Through Condition
Directory of Open Access Journals (Sweden)
Xianbo Wang
2015-01-01
Full Text Available The new energy promoting community has recently witnessed a surge of developments in photovoltaic power generation technologies. To fulfill the grid code requirement of photovoltaic inverter under low-voltage ride-through (LVRT condition, by utilizing the asymmetry feature of grid voltage, this paper aims to control both restraining negative sequence current and reactive power fluctuation on grid side to maintain balanced output of inverter. Two mathematical inverter models of grid-connected inverter containing LCL grid-side filter under both symmetrical and asymmetric grid are proposed. PR controller method is put forward based on inverter model under asymmetric grid. To ensure the stable operation of the inverter, grid voltage feedforward method is introduced to restrain current shock at the moment of voltage drop. Stable grid-connected operation and LVRT ability at grid drop have been achieved via a combination of rapid positive and negative sequence component extraction of accurate grid voltage synchronizing signals. Simulation and experimental results have verified the superior effectiveness of our proposed control strategy.
Voltage Stress on Y Capacitors from Indirect Lightning Pulses According to ED-14/DO-160
Meier, F.
2012-05-01
Transients due to lightning strikes on an aircraft's fuselage impose stress on the input filters of elec- tronic equipment. Permanent damage can occur when exceeding the voltage handling capacity of filter components causing a short circuit to ground. In ED-14/DO-160, section 22, a number of waveforms and levels are defined which are used to check the airworthiness of avionics equipment. Depending on pro- cedure and level, Y-capacitors are stressed by transient voltages which exceed their dielectric strength. The design engineer's task is a properly select the type and voltage rating of capacitors. With moderate simplifications, a LCR-series network is justified to calculate the peak voltage dependent on the capacitance.
Voltage-gated calcium flux mediates Escherichia coli mechanosensation.
Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M
2017-08-29
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.
Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.
Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R
2018-03-24
Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to
Chd1 remodelers maintain open chromatin and regulate the epigenetics of differentiation
Energy Technology Data Exchange (ETDEWEB)
Persson, Jenna [Department of Biosciences and Nutrition, Center for Biosciences, Karolinska Institutet (Sweden); Ekwall, Karl, E-mail: karl.ekwall@ki.se [Department of Biosciences and Nutrition, Center for Biosciences, Karolinska Institutet (Sweden); School of Life Sciences, University College Sodertorn, NOVUM, Huddinge (Sweden)
2010-05-01
Eukaryotic DNA is packaged around octamers of histone proteins into nucleosomes, the basic unit of chromatin. In addition to enabling meters of DNA to fit within the confines of a nucleus, the structure of chromatin has functional implications for cell identity. Covalent chemical modifications to the DNA and to histones, histone variants, ATP-dependent chromatin remodelers, small noncoding RNAs and the level of chromatin compaction all contribute to chromosomal structure and to the activity or silencing of genes. These chromatin-level alterations are defined as epigenetic when they are heritable from mother to daughter cell. The great diversity of epigenomes that can arise from a single genome permits a single, totipotent cell to generate the hundreds of distinct cell types found in humans. Two recent studies in mouse and in fly have highlighted the importance of Chd1 chromatin remodelers for maintaining an open, active chromatin state. Based on evidence from fission yeast as a model system, we speculate that Chd1 remodelers are involved in the disassembly of nucleosomes at promoter regions, thus promoting active transcription and open chromatin. It is likely that these nucleosomes are specifically marked for disassembly by the histone variant H2A.Z.
Chd1 remodelers maintain open chromatin and regulate the epigenetics of differentiation
International Nuclear Information System (INIS)
Persson, Jenna; Ekwall, Karl
2010-01-01
Eukaryotic DNA is packaged around octamers of histone proteins into nucleosomes, the basic unit of chromatin. In addition to enabling meters of DNA to fit within the confines of a nucleus, the structure of chromatin has functional implications for cell identity. Covalent chemical modifications to the DNA and to histones, histone variants, ATP-dependent chromatin remodelers, small noncoding RNAs and the level of chromatin compaction all contribute to chromosomal structure and to the activity or silencing of genes. These chromatin-level alterations are defined as epigenetic when they are heritable from mother to daughter cell. The great diversity of epigenomes that can arise from a single genome permits a single, totipotent cell to generate the hundreds of distinct cell types found in humans. Two recent studies in mouse and in fly have highlighted the importance of Chd1 chromatin remodelers for maintaining an open, active chromatin state. Based on evidence from fission yeast as a model system, we speculate that Chd1 remodelers are involved in the disassembly of nucleosomes at promoter regions, thus promoting active transcription and open chromatin. It is likely that these nucleosomes are specifically marked for disassembly by the histone variant H2A.Z.
30 CFR 75.813 - High-voltage longwalls; scope.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage longwalls; scope. 75.813 Section... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution High-Voltage Longwalls § 75.813 High-voltage longwalls; scope. Sections 75.814 through 75.822 of this...
Brink, van den A.; van der Heijden, M.A.J.; Swagten, H.J.M.; Koopmans, B.
2015-01-01
The coercivity and resistivity of a Pt/Co/AlOx/Pt junction are measured under sustained voltage application. High bias voltages of either polarity are determined to cause a strongly enhanced, reversible coercivity modification compared to low voltages. Time-resolved measurements show a logarithmic
Power Quality Improvement Using an Enhanced Network-Side-Shunt-Connected Dynamic Voltage Restorer
Fereidouni, Alireza; Masoum, Mohammad A. S.; Moghbel, Moayed
2015-10-01
Among the four basic dynamic voltage restorer (DVR) topologies, the network-side shunt-connected DVR (NSSC-DVR) has a relatively poor performance and is investigated in this paper. A new configuration is proposed and implemented for NSSC-DVR to enhance its performance in compensating (un)symmetrical deep and long voltage sags and mitigate voltage harmonics. The enhanced NSSC-DVR model includes a three-phase half-bridge semi-controlled network-side-shunt-connected rectifier and a three-phase full-bridge series-connected inverter implemented with a back-to-back configuration through a bidirectional buck-boost converter. The network-side-shunt-connected rectifier is employed to inject/draw the required energy by NSSC-DVR to restore the load voltage to its pre-fault value under sag/swell conditions. The buck-boost converter is responsible for maintaining the DC-link voltage of the series-connected inverter at its designated value in order to improve the NSSC-DVR capability in compensating deep and long voltage sags/swells. The full-bridge series-connected inverter permits to compensate unbalance voltage sags containing zero-sequence component. The harmonic compensation of the load voltage is achieved by extracting harmonics from the distorted network voltage using an artificial neural network (ANN) method called adaptive linear neuron (Adaline) strategy. Detailed simulations are performed by SIMULINK/MATLAB software for six case studies to verify the highly robustness of the proposed NSSC-DVR model under various conditions.
Energy Technology Data Exchange (ETDEWEB)
Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies
2008-04-09
This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.
A Study of Economical Incentives for Voltage Profile Control Method in Future Distribution Network
Tsuji, Takao; Sato, Noriyuki; Hashiguchi, Takuhei; Goda, Tadahiro; Tange, Seiji; Nomura, Toshio
In a future distribution network, it is difficult to maintain system voltage because a large number of distributed generators are introduced to the system. The authors have proposed “voltage profile control method” using power factor control of distributed generators in the previous work. However, the economical disbenefit is caused by the active power decrease when the power factor is controlled in order to increase the reactive power. Therefore, proper incentives must be given to the customers that corporate to the voltage profile control method. Thus, in this paper, we develop a new rules which can decide the economical incentives to the customers. The method is tested in one feeder distribution network model and its effectiveness is shown.
A voltage to frequency converter for astronomical photometry
Dunham, E.; Elliot, J. L.
1978-01-01
A voltage to frequency converter (VFC) for general use with photomultipliers is described. For high light levels, when the dead-time corrections for a photon counter would be excessive, the VFC maintains a linear response and allows the recording of data at high time resolution. Results of laboratory tests are given for the signal-to-noise characteristics, linearity, stability, and transient response of the VFC when used in conjunction with EMI 9658 and RCA C31034 photomultipliers.
Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.
2017-04-01
In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.
Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J
2017-04-20
Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.
International Nuclear Information System (INIS)
Oya, Yoko; Sakai, Nami; Watanabe, Yoshimasa; Yamamoto, Satoshi; Sakai, Takeshi; Hirota, Tomoya; Lindberg, Johan E.; Bisschop, Suzanne E.; Jørgensen, Jes K.; Van Dishoeck, Ewine F.
2014-01-01
Subarcsecond (0.''5) images of H 2 CO and CCH line emission have been obtained in the 0.8 mm band toward the low-mass protostar IRAS 15398–3359 in the Lupus 1 cloud as one of the Cycle 0 projects of the Atacama Large Millimeter/Submillimeter Array. We have detected a compact component concentrated in the vicinity of the protostar and a well-collimated outflow cavity extending along the northeast-southwest axis. The inclination angle of the outflow is found to be about 20°, or almost edge-on, based on the kinematic structure of the outflow cavity. This is in contrast to previous suggestions of a more pole-on geometry. The centrally concentrated component is interpreted by use of a model of the infalling rotating envelope with the estimated inclination angle and the mass of the protostar is estimated to be less than 0.09 M ☉ . Higher spatial resolution data are needed to infer the presence of a rotationally supported disk for this source, hinted at by a weak high-velocity H 2 CO emission associated with the protostar.
Directory of Open Access Journals (Sweden)
Abhishek Ghosh
2014-10-01
Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.
Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.
Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L
2016-02-25
Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.
Recording membrane potential changes through photoacoustic voltage sensitive dye
Zhang, Haichong K.; Kang, Jeeun; Yan, Ping; Abou, Diane S.; Le, Hanh N. D.; Thorek, Daniel L. J.; Kang, Jin U.; Gjedde, Albert; Rahmim, Arman; Wong, Dean F.; Loew, Leslie M.; Boctor, Emad M.
2017-03-01
Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. Based on this concept, we synthesized a novel near infrared photoacoustic VSD (PA-VSD) whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. With a 3-9 μM VSD concentration, we measured a PA signal increase in the range of 5.3 % to 18.1 %, and observed a corresponding signal reduction in fluorescence emission of 30.0 % to 48.7 %. A theoretical model successfully accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize the characteristics of improved photoacoustic probes. Together, our results demonstrate photoacoustic sensing as a potential new modality for sub-second recording and external imaging of electrophysiological and neurochemical events in the brain.
International Nuclear Information System (INIS)
Gear, A.R.L.; Hallam, T.J.
1986-01-01
Interest in phosphatidylinositol metabolism has been greatly stimulated by the findings that diglyceride and inositol phosphates may serve as second messengers in modulating cellular function. Formation of 1,4,5-inositol trisphosphate (IP 3 ), in particular, has been linked to mobilization of intracellular calcium in a number of cell types. The authors have examined the ability of IP 3 to mobilize calcium in human platelets permeabilized by either saponin or high-voltage discharge. Saponin at 15 μg/ml effectively permeabilized platelets to exogenous inositol 1,4,5-trisphosphate which released bound [ 45 Ca] within 1 min and with a Ka of 7.4 +/- 4.1 μM. A small (25%) azide-sensitive pool was also responsive to inositol trisphosphate. The calcium pools were completely discharged by A-23187 and the ATP-dependent uptake was prevented by dinitrophenol. In contrast to the result with saponin, platelets accessed by high-voltage discharge were insensitive to challenge by inositol 1,4,5-trisphosphate. The data suggest that while inositol 1,4,5-trisphosphate can rapidly mobilize platelet calcium, the ability to demonstrate this depends on the method of permeabilization
High voltage processing of the SLC polarized electron gun
International Nuclear Information System (INIS)
Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.
1993-04-01
The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described
International Nuclear Information System (INIS)
Karadeniz, S.; Selcuk, A. Birkan; Tugluoglu, N.; Ocak, S. Bilge
2007-01-01
We report the first investigation of the frequency dependent effects of gamma irradiation on interface state density and series resistance determined from capacitance-voltage (C-V) and conductance-voltage (G-V) characteristics in SnO 2 /n-Si structures prepared by spray deposition method. The samples were irradiated using a 60 Co γ-ray source at 500 kGy at room temperature. The C-V and G-V measurements of the samples were performed in the voltage range -6 V to 2 V and at 10 kHz, 100 kHz, 500 kHz and 1 MHz at room temperature before and after 500 kGy irradiation. The measurement capacitance and conductance are corrected for series resistance. It has been seen that the value of the series resistance R s of sample decreases from 204 Ω to 55.4 Ω with increasing the frequency before irradiation while it decreases from 248 Ω to 60 Ω with increasing frequency at 500 kGy irradiation. It has been found that and D it values of MOS structure increases up to 100 kHz and then decreases up to 1 MHz while the R s increases with increasing irradiation dose for our sample. The interface state density D it ranges from 1.83 x 10 13 cm -2 eV -1 for before irradiation to 1.54 x 10 13 cm -2 eV -1 for 500 kGy irradiation dose at 500 kHz and decreases with increasing frequency
Energy Technology Data Exchange (ETDEWEB)
Özerli, Halil; Karteri, İbrahim [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Karataş, Şükrü, E-mail: skaratas@ksu.edu.tr [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Department of Physics, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Altindal, Şemsettin [Department of Physics, Gazi University, 06100 Ankara (Turkey)
2014-05-01
Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I{sub 0}/T{sup 2}) versus (kT){sup −1} and ln(I{sub 0}/T{sup 2}) versus (nkT){sup −1} plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ{sub b0} versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ{sup ¯}{sub b0} = 1.071 eV and σ{sub 0} = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot.
International Nuclear Information System (INIS)
Özerli, Halil; Karteri, İbrahim; Karataş, Şükrü; Altindal, Şemsettin
2014-01-01
Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I 0 /T 2 ) versus (kT) −1 and ln(I 0 /T 2 ) versus (nkT) −1 plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ b0 versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ ¯ b0 = 1.071 eV and σ 0 = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot
Voltage gating of mechanosensitive PIEZO channels.
Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R
2018-03-15
Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.
Lin, Munan; Liu, Ming; Zhu, Guanghui; Wang, Yanpeng; Shi, Peiyun; Sun, Xuan
2017-08-01
A high voltage pulse generator based on a silicon-controlled rectifier has been designed and implemented for a field reversed configuration experiment. A critical damping circuit is used in the generator to produce the desired pulse waveform. Depending on the load, the rise time of the output trigger signal can be less than 1 μs, and the peak amplitudes of trigger voltage and current are up to 8 kV and 85 A in a single output. The output voltage can be easily adjusted by changing the voltage on a capacitor of the generator. In addition, the generator integrates an electrically floating heater circuit so it is capable of triggering either pseudosparks (TDI-type hydrogen thyratron) or ignitrons. Details of the circuits and their implementation are described in the paper. The trigger generator has successfully controlled the discharging sequence of the pulsed power supply for a field reversed configuration experiment.
Voltage-gated proton channel is expressed on phagosomes
International Nuclear Information System (INIS)
Okochi, Yoshifumi; Sasaki, Mari; Iwasaki, Hirohide; Okamura, Yasushi
2009-01-01
Voltage-gated proton channel has been suggested to help NADPH oxidase activity during respiratory burst of phagocytes through its activities of compensating charge imbalance and regulation of pH. In phagocytes, robust production of reactive oxygen species occurs in closed membrane compartments, which are called phagosomes. However, direct evidence for the presence of voltage-gated proton channels in phagosome has been lacking. In this study, the expression of voltage-gated proton channels was studied by Western blot with the antibody specific to the voltage-sensor domain protein, VSOP/Hv1, that has recently been identified as the molecular correlate for the voltage-gated proton channel. Phagosomal membranes of neutrophils contain VSOP/Hv1 in accordance with subunits of NADPH oxidases, gp91, p22, p47 and p67. Superoxide anion production upon PMA activation was significantly reduced in neutrophils from VSOP/Hv1 knockout mice. These are consistent with the idea that voltage-gated proton channels help NADPH oxidase in phagocytes to produce reactive oxygen species.
Directory of Open Access Journals (Sweden)
Perić Dragoslav M.
2015-01-01
Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.
Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM
2009-11-03
A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.
International Nuclear Information System (INIS)
Martin, M.
1991-01-01
Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance
International Nuclear Information System (INIS)
Povzner, A.A.; Volkov, A.G.
2017-01-01
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
Energy Technology Data Exchange (ETDEWEB)
Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru
2017-06-15
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
International Nuclear Information System (INIS)
Hanada, R.; Sugawara, H.; Aoki, Y.; Sato, H.; Shigeto, K.; Shinjo, T.; Ono, T.; Miyajima, H.
2002-01-01
We have simultaneously measured the field dependences of voltages at multiple pairs of resistance and transverse voltage probes in ferromagnetic wires (with either magnetic or non-magnetic voltage probes). Both the resistive (through the giant magnetoresistance and anisotropic magnetoresistance) and transverse voltages (through the planar Hall effect) exhibit abrupt jumps, reflecting discrete motion of domain walls or rotations of magnetization. Voltage probes, even if non-magnetic, are found to affect the jump fields depending on the sample conditions. We demonstrate that the specific information on the domain (wall) motion along a thin ferromagnetic wire could be obtained from the jump fields. (author)
Technical and economic aspects of the transmission of energy at extra high voltages
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1967-01-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke
2011-05-06
Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.
Robust Frequency and Voltage Stability Control Strategy for Standalone AC/DC Hybrid Microgrid
Directory of Open Access Journals (Sweden)
Furqan Asghar
2017-05-01
Full Text Available The microgrid (MG concept is attracting considerable attention as a solution to energy deficiencies, especially in remote areas, but the intermittent nature of renewable sources and varying loads cause many control problems and thereby affect the quality of power within a microgrid operating in standalone mode. This might cause large frequency and voltage deviations in the system due to unpredictable output power fluctuations. Furthermore, without any main grid support, it is more complex to control and manage the system. In past, droop control and various other coordination control strategies have been presented to stabilize the microgrid frequency and voltages, but in order to utilize the available resources up to their maximum capacity in a positive way, new and robust control mechanisms are required. In this paper, a standalone microgrid is presented, which integrates renewable energy-based distributed generations and local loads. A fuzzy logic-based intelligent control technique is proposed to maintain the frequency and DC (direct current-link voltage stability for sudden changes in load or generation power. Also from a frequency control perspective, a battery energy storage system (BESS is suggested as a replacement for a synchronous generator to stabilize the nominal system frequency as a synchronous generator is unable to operate at its maximum efficiency while being controlled for stabilization purposes. Likewise, a super capacitor (SC and BESS is used to stabilize DC bus voltages even though maximum possible energy is being extracted from renewable generated sources using maximum power point tracking. This newly proposed control method proves to be effective by reducing transient time, minimizing the frequency deviations, maintaining voltages even though maximum power point tracking is working and preventing generators from exceeding their power ratings during disturbances. However, due to the BESS limited capacity, load switching
Voltage current characteristics of type III superconductors
Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.
1980-06-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.
Study of current-voltage characteristics in PbTe(Ga) alloys at low temperatures
International Nuclear Information System (INIS)
Akimov, B.A.; Albul, A.V.; Bogdanov, E.V.
1992-01-01
Results of determining current-voltage characteristics in PbTe(Ga) monocrystals of n- and p-types of conductivity in strong electric fields E ≤ 2 x 10 3 V/Cm at 4.2-77 K are presented. It was established that at helium and nitrogen temperatures, the current-voltage characteristics of PbTe(Ga) alloys, high-ohmic state of which was realized in helium, differed qualitatively from ones, typical for unalloyed PbTe. The superlinear dependence, observed in the fields, beginning from E ≥ 1 V/cm, is explained in the framework of concepts of strong electric field effect on conductivity of impurity states
Findeisen, Felix; Minor, Daniel L.
2010-01-01
Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (CaVs) with unusual properties. CaBP1 inhibits CaV1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit CaV1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF-hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the CaV1.2 IQ domain at a site that overlaps with the Ca2+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates CaVs. PMID:21134641
Findeisen, Felix; Minor, Daniel L
2010-12-08
Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (Ca(V)s) with unusual properties. CaBP1 inhibits Ca(V)1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit Ca(V)1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the Ca(V)1.2 IQ domain at a site that overlaps with the Ca²+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates Ca(V)s. Copyright © 2010 Elsevier Ltd. All rights reserved.
Voltage Quench Dynamics of a Kondo System.
Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel
2016-01-22
We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.
Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki
2004-03-22
DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics
A complicated complex: Ion channels, voltage sensing, cell membranes and peptide inhibitors.
Zhang, Alan H; Sharma, Gagan; Undheim, Eivind A B; Jia, Xinying; Mobli, Mehdi
2018-04-21
Voltage-gated ion channels (VGICs) are specialised ion channels that have a voltage dependent mode of action, where ion conduction, or gating, is controlled by a voltage-sensing mechanism. VGICs are critical for electrical signalling and are therefore important pharmacological targets. Among these, voltage-gated sodium channels (Na V s) have attracted particular attention as potential analgesic targets. Na V s, however, comprise several structurally similar subtypes with unique localisations and distinct functions, ranging from amplification of action potentials in nociception (e.g. Na V 1.7) to controlling electrical signalling in cardiac function (Na V 1.5). Understanding the structural basis of Na V function is therefore of great significance, both to our knowledge of electrical signalling and in development of subtype and state selective drugs. An important tool in this pursuit has been the use of peptides from animal venoms as selective Na V modulators. In this review, we look at peptides, particularly from spider venoms, that inhibit Na V s by binding to the voltage sensing domain (VSD) of this channel, known as gating modifier toxins (GMT). In the first part of the review, we look at the structural determinants of voltage sensing in VGICs, the gating cycle and the conformational changes that accompany VSD movement. Next, the modulation of the analgesic target Na V 1.7 by GMTs is reviewed to develop bioinformatic tools that, based on sequence information alone, can identify toxins that are likely to inhibit this channel. The same approach is also used to define VSD sequences, other than that from Na V 1.7, which are likely to be sensitive to this class of toxins. The final section of the review focuses on the important role of the cellular membrane in channel modulation and also how the lipid composition affects measurements of peptide-channel interactions both in binding kinetics measurements in solution and in cell-based functional assays. Copyright © 2018
Robson, L; Hunter, M
1999-01-01
The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159
Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.
2005-03-01
Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.