WorldWideScience

Sample records for voltage-dependent cation channels

  1. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  2. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  3. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  4. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

    2012-01-01

    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  5. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  6. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  7. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  8. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  9. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  10. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  11. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  12. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  13. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  14. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  15. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  16. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  17. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  18. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  19. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  20. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  1. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  2. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  3. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  4. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  5. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  6. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  7. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  8. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  9. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  10. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  11. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  12. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  13. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  14. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  15. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  16. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  17. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  18. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  19. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  20. Down-regulation of voltage-dependent sodium channels initiated by sodium influx in developing neurons

    International Nuclear Information System (INIS)

    Dargent, B.; Couraud, F.

    1990-01-01

    To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro

  1. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  2. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  3. Impaired control of L-type voltage-dependent calcium channels in experimental hypertension

    Czech Academy of Sciences Publication Activity Database

    Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef

    2009-01-01

    Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009

  4. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  5. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  6. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  7. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  8. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  9. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  10. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  13. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  15. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  16. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  17. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  18. Inversion of membrane surface charge by trivalent cations probed with a cation-selective channel.

    Science.gov (United States)

    Gurnev, Philip A; Bezrukov, Sergey M

    2012-11-13

    We demonstrate that the cation-selective channel formed by gramicidin A can be used as a reliable sensor for studying the multivalent ion accumulation at the surfaces of charged lipid membranes and the "charge inversion" phenomenon. In asymmetrically charged membranes with the individual leaflets formed from pure negative and positive lipids bathed by 0.1 M CsCl solutions the channel exhibits current rectification, which is comparable to that of a typical n/p semiconductor diode. We show that even at these highly asymmetrical conditions the channel conductance can be satisfactorily described by the electrodiffusion equation in the constant field approximation but, due to predictable limitations, only when the applied voltages do not exceed 50 mV. Analysis of the changes in the voltage-dependent channel conductance upon addition of trivalent cations allows us to gauge their interactions with the membrane surface. The inversion of the sign of the effective surface charge takes place at the concentrations, which correlate with the cation size. Specifically, these concentrations are close to 0.05 mM for lanthanum, 0.25 mM for hexaamminecobalt, and 4 mM for spermidine.

  19. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  20. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  1. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  2. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  3. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  4. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  5. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  6. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  7. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  8. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  9. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  10. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  11. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  12. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  13. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Heavy metal cations permeate the TRPV6 epithelial cation channel.

    Science.gov (United States)

    Kovacs, Gergely; Danko, Tamas; Bergeron, Marc J; Balazs, Bernadett; Suzuki, Yoshiro; Zsembery, Akos; Hediger, Matthias A

    2011-01-01

    TRPV6 belongs to the vanilloid family of the transient receptor potential channel (TRP) superfamily. This calcium-selective channel is highly expressed in the duodenum and the placenta, being responsible for calcium absorption in the body and fetus. Previous observations have suggested that TRPV6 is not only permeable to calcium but also to other divalent cations in epithelial tissues. In this study, we tested whether TRPV6 is indeed also permeable to cations such as zinc and cadmium. We found that the basal intracellular calcium concentration was higher in HEK293 cells transfected with hTRPV6 than in non-transfected cells, and that this difference almost disappeared in nominally calcium-free solution. Live cell imaging experiments with Fura-2 and NewPort Green DCF showed that overexpression of human TRPV6 increased the permeability for Ca(2+), Ba(2+), Sr(2+), Mn(2+), Zn(2+), Cd(2+), and interestingly also for La(3+) and Gd(3+). These results were confirmed using the patch clamp technique. (45)Ca uptake experiments showed that cadmium, lanthanum and gadolinium were also highly efficient inhibitors of TRPV6-mediated calcium influx at higher micromolar concentrations. Our results suggest that TRPV6 is not only involved in calcium transport but also in the transport of other divalent cations, including heavy metal ions, which may have toxicological implications. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Modulation of cardiac ryanodine receptor channels by alkaline earth cations.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available Cardiac ryanodine receptor (RyR2 function is modulated by Ca(2+ and Mg(2+. To better characterize Ca(2+ and Mg(2+ binding sites involved in RyR2 regulation, the effects of cytosolic and luminal earth alkaline divalent cations (M(2+: Mg(2+, Ca(2+, Sr(2+, Ba(2+ were studied on RyR2 from pig ventricle reconstituted in bilayers. RyR2 were activated by M(2+ binding to high affinity activating sites at the cytosolic channel surface, specific for Ca(2+ or Sr(2+. This activation was interfered by Mg(2+ and Ba(2+ acting at low affinity M(2+-unspecific binding sites. When testing the effects of luminal M(2+ as current carriers, all M(2+ increased maximal RyR2 open probability (compared to Cs(+, suggesting the existence of low affinity activating M(2+-unspecific sites at the luminal surface. Responses to M(2+ vary from channel to channel (heterogeneity. However, with luminal Ba(2+or Mg(2+, RyR2 were less sensitive to cytosolic Ca(2+ and caffeine-mediated activation, openings were shorter and voltage-dependence was more marked (compared to RyR2 with luminal Ca(2+or Sr(2+. Kinetics of RyR2 with mixtures of luminal Ba(2+/Ca(2+ and additive action of luminal plus cytosolic Ba(2+ or Mg(2+ suggest luminal M(2+ differentially act on luminal sites rather than accessing cytosolic sites through the pore. This suggests the presence of additional luminal activating Ca(2+/Sr(2+-specific sites, which stabilize high P(o mode (less voltage-dependent and increase RyR2 sensitivity to cytosolic Ca(2+ activation. In summary, RyR2 luminal and cytosolic surfaces have at least two sets of M(2+ binding sites (specific for Ca(2+ and unspecific for Ca(2+/Mg(2+ that dynamically modulate channel activity and gating status, depending on SR voltage.

  16. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  17. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  18. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  19. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  20. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  1. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó

    2016-03-01

    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  2. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  3. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  4. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  5. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  6. Membrane potential and cation channels in rat juxtaglomerular cells

    DEFF Research Database (Denmark)

    Friis, U G; Jørgensen, F; Andreasen, D

    2004-01-01

    The relationship between membrane potential and cation channels in juxtaglomerular (JG) cells is not well understood. Here we review electrophysiological and molecular studies of JG cells demonstrating the presence of large voltage-sensitive, calcium-activated potassium channels (BK(Ca)) of the Z......The relationship between membrane potential and cation channels in juxtaglomerular (JG) cells is not well understood. Here we review electrophysiological and molecular studies of JG cells demonstrating the presence of large voltage-sensitive, calcium-activated potassium channels (BK...

  7. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  8. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  9. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  10. Cationic Polymers Inhibit the Conductance of Lysenin Channels

    Directory of Open Access Journals (Sweden)

    Daniel Fologea

    2013-01-01

    Full Text Available The pore-forming toxin lysenin self-assembles large and stable conductance channels in natural and artificial lipid membranes. The lysenin channels exhibit unique regulation capabilities, which open unexplored possibilities to control the transport of ions and molecules through artificial and natural lipid membranes. Our investigations demonstrate that the positively charged polymers polyethyleneimine and chitosan inhibit the conducting properties of lysenin channels inserted into planar lipid membranes. The preservation of the inhibitory effect following addition of charged polymers on either side of the supporting membrane suggests the presence of multiple binding sites within the channel's structure and a multistep inhibition mechanism that involves binding and trapping. Complete blockage of the binding sites with divalent cations prevents further inhibition in conductance induced by the addition of cationic polymers and supports the hypothesis that the binding sites are identical for both multivalent metal cations and charged polymers. The investigation at the single-channel level has shown distinct complete blockages of each of the inserted channels. These findings reveal key structural characteristics which may provide insight into lysenin’s functionality while opening innovative approaches for the development of applications such as transient cell permeabilization and advanced drug delivery systems.

  11. Stretch-activated cation channel from larval bullfrog skin

    DEFF Research Database (Denmark)

    Hillyard, Stanley D; Willumsen, Niels J; Marrero, Mario B

    2010-01-01

    Cell-attached patches from isolated epithelial cells from larval bullfrog skin revealed a cation channel that was activated by applying suction (-1 kPa to -4.5 kPa) to the pipette. Activation was characterized by an initial large current spike that rapidly attenuated to a stable value and showed ...

  12. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  14. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  15. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain.

    Science.gov (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R

    2016-09-01

    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  16. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  17. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  18. Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels

    Directory of Open Access Journals (Sweden)

    Alice Kira Zelman

    2012-05-01

    Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.

  19. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.

    2012-05-29

    Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.

  20. Concerted action of two cation filters in the aquaporin water channel

    DEFF Research Database (Denmark)

    Wu, Binghua; Steinbronn, Christina; Alsterfjord, Magnus

    2009-01-01

    Aquaporin (AQP) facilitated water transport is common to virtually all cell membranes and is marked by almost perfect specificity and high flux rates. Simultaneously, protons and cations are strictly excluded to maintain ionic transmembrane gradients. Yet, the AQP cation filters have not been...... identified experimentally. We report that three point mutations turned the water-specific AQP1 into a proton/alkali cation channel with reduced water permeability and the permeability sequence: H(+) >>K(+) >Rb(+) >Na(+) >Cs(+) >Li(+). Contrary to theoretical models, we found that electrostatic repulsion...... at the central asn-pro-ala (NPA) region does not suffice to exclude protons. Full proton exclusion is reached only in conjunction with the aromatic/arginine (ar/R) constriction at the pore mouth. In contrast, alkali cations are blocked by the NPA region but leak through the ar/R constriction. Expression...

  1. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  2. Differential effect of HOE642 on two separate monovalent cation transporters in the human red cell membrane

    DEFF Research Database (Denmark)

    Bernhardt, Ingolf; Weiss, Erwin; Robinson, Hannah C

    2007-01-01

    Residual K(+) fluxes in red blood cells can be stimulated in conditions of low ionic strength. Previous studies have identified both the non-selective, voltage-dependent cation (NSVDC) channel and the K(+)(Na(+))/H(+) exchanger as candidate pathways mediating this effect, although it is possible...... blood cell apoptosis (eryptosis) and disease....

  3. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  4. Aluminium and hydrogen ions inhibit a mechanosensory calcium-selective cation channel

    Science.gov (United States)

    Ding, J. P.; Pickard, B. G.

    1993-01-01

    The tension-dependent activity of mechanosensory calcium-selective cation channels in excised plasmalemmal patches from onion bulb scale epidermis is modulated by pH in the physiologically meaningful range between 4.5 and 7.2. It is rapidly lowered by lowering pH and rapidly raised by raising pH. Channel activity is effectively inhibited by low levels of aluminium ions and activity can be partially restored by washing for a few minutes. We suggest that under normal conditions the sensitivity of the mechanosensory channels to pH of the wall free space plays important roles in regulation of plant activities such as growth. We further suggest that, when levels of acid and aluminium ions in the soil solution are high, they might inhibit similar sensory channels in cells of the root tip, thus contributing critically to the acid soil syndrome.

  5. Anoctamin 9/TMEM16J is a cation channel activated by cAMP/PKA signal.

    Science.gov (United States)

    Kim, Hyungsup; Kim, Hyesu; Lee, Jesun; Lee, Byeongjun; Kim, Hee-Ryang; Jung, Jooyoung; Lee, Mi-Ock; Oh, Uhtaek

    2018-05-01

    Anoctamins (ANOs) are multifunctional membrane proteins that consist of 10 homologs. ANO1 (TMEM16A) and ANO2 (TMEM16B) are anion channels activated by intracellular calcium that meditate numerous physiological functions. ANO6 is a scramblase that redistributes phospholipids across the cell membrane. The other homologs are not well characterized. We found ANO9/TMEM16J is a cation channel activated by a cAMP-dependent protein kinase A (PKA). Intracellular cAMP-activated robust currents in whole cells expressing ANO9, which were inhibited by a PKA blocker. A cholera toxin that persistently stimulated adenylate cyclase activated ANO9 as did the application of PKA. The cAMP-induced ANO9 currents were permeable to cations. The cAMP-dependent ANO9 currents were augmented by intracellular Ca 2+ . Ano9 transcripts were predominant in the intestines. Human intestinal SW480 cells expressed high levels of Ano9 transcripts and showed PKA inhibitor-reversible cAMP-dependent currents. We conclude that ANO9 is a cation channel activated by a cAMP/PKA pathway and could play a role in intestine function. Copyright © 2017. Published by Elsevier Ltd.

  6. Endolysosomal Cation Channels and Cancer—A Link with Great Potential

    Science.gov (United States)

    Grimm, Christian; Bartel, Karin; Vollmar, Angelika M.; Biel, Martin

    2018-01-01

    The endolysosomal system (ES) consists of lysosomes; early, late, and recycling endosomes; and autophagosomes. It is a key regulator not only of macromolecule degradation and recycling, plasma membrane repair, homeostasis, and lipid storage, but also of antigen presentation, immune defense, cell motility, cell death signaling, tumor growth, and cancer progression. In addition, it plays a critical role in autophagy, and the autophagy-lysosome pathway is intimately associated with the hallmarks of cancer, such as escaping cell death pathways, evading immune surveillance, and deregulating metabolism. The function of endolysosomes is critically dependent on both soluble and endolysosomal membrane proteins such as ion channels and transporters. Cation channels found in the ES include members of the TRP (transient receptor potential) channel superfamily, namely TRPML channels (mucolipins) as well as two-pore channels (TPCs). In recent studies, these channels have been found to play crucial roles in endolysosomal trafficking, lysosomal exocytosis, and autophagy. Mutation or loss of these channel proteins can impact multiple endolysosomal trafficking pathways. A role for TPCs in cancer cell migration and metastasis, linked to distinct defects in endolysosomal trafficking such as integrin trafficking, has been recently established. In this review, we give an overview on the function of lysosomes in cancer with a particular focus on the roles which TPCs and TRPML channels play in the ES and how this can affect cancer cells. PMID:29303993

  7. Endolysosomal Cation Channels and Cancer-A Link with Great Potential.

    Science.gov (United States)

    Grimm, Christian; Bartel, Karin; Vollmar, Angelika M; Biel, Martin

    2018-01-05

    The endolysosomal system (ES) consists of lysosomes; early, late, and recycling endosomes; and autophagosomes. It is a key regulator not only of macromolecule degradation and recycling, plasma membrane repair, homeostasis, and lipid storage, but also of antigen presentation, immune defense, cell motility, cell death signaling, tumor growth, and cancer progression. In addition, it plays a critical role in autophagy, and the autophagy-lysosome pathway is intimately associated with the hallmarks of cancer, such as escaping cell death pathways, evading immune surveillance, and deregulating metabolism. The function of endolysosomes is critically dependent on both soluble and endolysosomal membrane proteins such as ion channels and transporters. Cation channels found in the ES include members of the TRP (transient receptor potential) channel superfamily, namely TRPML channels (mucolipins) as well as two-pore channels (TPCs). In recent studies, these channels have been found to play crucial roles in endolysosomal trafficking, lysosomal exocytosis, and autophagy. Mutation or loss of these channel proteins can impact multiple endolysosomal trafficking pathways. A role for TPCs in cancer cell migration and metastasis, linked to distinct defects in endolysosomal trafficking such as integrin trafficking, has been recently established. In this review, we give an overview on the function of lysosomes in cancer with a particular focus on the roles which TPCs and TRPML channels play in the ES and how this can affect cancer cells.

  8. Diphtheria toxin-induced channels in Vero cells selective for monovalent cations

    International Nuclear Information System (INIS)

    Sandvig, K.; Olsnes, S.

    1988-01-01

    Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of 45 Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed

  9. Channels formed by botulinum, tetanus, and diphtheria toxins in planar lipid bilayers: relevance to translocation of proteins across membranes.

    OpenAIRE

    Hoch, D H; Romero-Mira, M; Ehrlich, B E; Finkelstein, A; DasGupta, B R; Simpson, L L

    1985-01-01

    The heavy chains of both botulinum neurotoxin type B and tetanus toxin form channels in planar bilayer membranes. These channels have pH-dependent and voltage-dependent properties that are remarkably similar to those previously described for diphtheria toxin. Selectivity experiments with anions and cations show that the channels formed by the heavy chains of all three toxins are large; thus, these channels could serve as "tunnel proteins" for translocation of active peptide fragments. These f...

  10. Cell swelling activates K+ and Cl- channels as well as nonselective, stretch-activated cation channels in ehrlich ascites tumor cells

    DEFF Research Database (Denmark)

    Christensen, Ove; Hoffmann, Else Kay

    1992-01-01

    Cell-attached patch-clamp recordings from Ehrlich ascites tumor cells reveal nonselective cation channels which are activated by mechanical deformation of the membrane. These channels are seen when suction is applied to the patch pipette or after osmotic cell swelling. The channel activation does...... system. In isolated insideout patches a Ca2+-dependent, inwardly rectifying K+ channel is demonstrated. The single-channel conductance recorded with symmetrical 150 mm K+ solutions is for inward current estimated at 40 pS and for outward current at 15 pS. Activation of the K+ channel takes place after...... by membrane stretch (suction). The time-averaged number of open K+ channels during regulatory volume decrease (RVD) can be estimated at 40 per cell. The number of open K+ channels following addition of Ca2+ plus ionophore A23187 was estimated at 250 per cell. Concurrent activation in cell-attached patches...

  11. Electron channeling X-ray microanalysis for cation configuration in irradiate magnesium alimate spinel

    International Nuclear Information System (INIS)

    Matsumura, S.; Soeda, T.; Zaluzec, N. J.; Kinoshita, C.

    1999-01-01

    High angular resolution electron channeling X-ray spectroscopy (HARECXS) was examined as a practical tool to locate lattice-ions in spinel crystals. The orientation dependent intensity distribution of emitted X-rays obtained by HARECXS is so sensitive to lattice-ion configuration in the illuminated areas that the occupation probabilities on specific positions in the crystal lattice can be determined accurately through comparison with the theoretical rocking curves. HARECXS measurements have revealed partially disordered cation arrangement in MgO·nAl 2 O 3 with n = 1.0 and 2.4. Most Al 3+ lattice-ions occupy the octahedral (VIII) sites, while Mg 2 lattice-ions reside on both the tetrahedral (IV) and the octahedral (VIII) sites. The structural vacancies are enriched in the IV-sites. Further evacuation of cations from the IV-sites to the VIII-sites is recognized in a disordering process induced by irradiation with 1 MeV Ne + ions up to 8.9 dpa at 870 K

  12. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  13. Single Nisoldipine-Sensitive Calcium Channels in Smooth Muscle Cells Isolated from Rabbit Mesenteric Artery

    Science.gov (United States)

    Worley, Jennings F.; Deitmer, Joachim W.; Nelson, Mark T.

    1986-08-01

    Single smooth muscle cells were enzymatically isolated from the rabbit mesenteric artery. At physiological levels of external Ca, these cells were relaxed and contracted on exposure to norepinephrine, caffeine, or high levels of potassium. The patch-clamp technique was used to measure unitary currents through single channels in the isolated cells. Single channels were selective for divalent cations and exhibited two conductance levels, 8 pS and 15 pS. Both types of channels were voltage-dependent, and channel activity occurred at potentials positive to -40 mV. The activity of both channel types was almost completely inhibited by 50 nM nisoldipine. These channels appear to be the pathways for voltage-dependent Ca influx in vascular smooth muscle and may be the targets of the clinically used dihydropyridines.

  14. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  15. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  16. Solubilization, partial purification, and reconstitution of glutamate- and N-methyl-D-aspartate-activated cation channels from brain synaptic membranes

    International Nuclear Information System (INIS)

    Ly, A.M.; Michaelis, E.K.

    1991-01-01

    L-Glutamate-activated cation channel proteins from rat brain synaptic membranes were solubilized, partially purified, and reconstituted into liposomes. Optimal conditions for solubilization and reconstitution included treatment of the membranes with nonionic detergents in the presence of neutral phospholipids plus glycerol. Quench-flow procedures were developed to characterize the rapid kinetics of ion flux induced by receptor agonists. [ 14 C]Methylamine, a cation that permeates through the open channel of both vertebrate and invertebrate glutamate receptors, was used to measure the activity of glutamate receptor-ion channel complexes in reconstituted liposomes. L-Glutamate caused an increase in the rate of [ 14 C]methylamine influx into liposomes reconstituted with either solubilized membrane proteins or partially purified glutamate-binding proteins. Of the major glutamate receptor agonists, only N-methyl-D-aspartate activated cation fluxes in liposomes reconstituted with glutamate-binding proteins. In liposomes reconstituted with glutamate-binding proteins, N-methyl-D-aspartate- or glutamate-induced influx of NA + led to a transient increase in the influx of the lipid-permeable anion probe S 14 CN - . These results indicate the functional reconstitution of N-methyl-D-aspartate-sensitive glutamate receptors and the role of the ∼69-kDa protein in the function of these ion channels

  17. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  18. Stochastic nanoroughness modulates neuron-astrocyte interactions and function via mechanosensing cation channels.

    Science.gov (United States)

    Blumenthal, Nils R; Hermanson, Ola; Heimrich, Bernd; Shastri, V Prasad

    2014-11-11

    Extracellular soluble signals are known to play a critical role in maintaining neuronal function and homeostasis in the CNS. However, the CNS is also composed of extracellular matrix macromolecules and glia support cells, and the contribution of the physical attributes of these components in maintenance and regulation of neuronal function is not well understood. Because these components possess well-defined topography, we theorize a role for topography in neuronal development and we demonstrate that survival and function of hippocampal neurons and differentiation of telencephalic neural stem cells is modulated by nanoroughness. At roughnesses corresponding to that of healthy astrocytes, hippocampal neurons dissociated and survived independent from astrocytes and showed superior functional traits (increased polarity and calcium flux). Furthermore, telencephalic neural stem cells differentiated into neurons even under exogenous signals that favor astrocytic differentiation. The decoupling of neurons from astrocytes seemed to be triggered by changes to astrocyte apical-surface topography in response to nanoroughness. Blocking signaling through mechanosensing cation channels using GsMTx4 negated the ability of neurons to sense the nanoroughness and promoted decoupling of neurons from astrocytes, thus providing direct evidence for the role of nanotopography in neuron-astrocyte interactions. We extrapolate the role of topography to neurodegenerative conditions and show that regions of amyloid plaque buildup in brain tissue of Alzheimer's patients are accompanied by detrimental changes in tissue roughness. These findings suggest a role for astrocyte and ECM-induced topographical changes in neuronal pathologies and provide new insights for developing therapeutic targets and engineering of neural biomaterials.

  19. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  20. Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel.

    Science.gov (United States)

    Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J

    2017-04-20

    Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

  1. Spontaneous and CRH-Induced Excitability and Calcium Signaling in Mice Corticotrophs Involves Sodium, Calcium, and Cation-Conducting Channels

    Czech Academy of Sciences Publication Activity Database

    Zemková, Hana; Tomič, M.; Kučka, M.; Aguilera, G.; Stojilkovic, S. S.

    2016-01-01

    Roč. 157, č. 4 (2016), s. 1576-1589 ISSN 0013-7227 R&D Projects: GA ČR(CZ) GBP304/12/G069; GA MŠk(CZ) LQ1604; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : action potential * background sodium conductance * bursting activity * cation -conducting channels * cytosolic calcium concentration * resting membrane potential Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 4.286, year: 2016

  2. El Tor hemolysin of Vibrio cholerae O1 forms channels in planar lipid bilayer membranes.

    Science.gov (United States)

    Ikigai, H; Ono, T; Iwata, M; Nakae, T; Shimamura, T

    1997-05-15

    We investigated the channel formation by El Tor hemolysin (molecular mass, 65 kDa) of Vibrio cholerae O1 biotype El Tor in planar lipid bilayers. The El Tor hemolysin channel exhibited asymmetric and hyperbolic membrane current with increasing membrane potential, meaning that the channel is voltage dependent. The zero-current membrane potential measured in KCI solution showed that permeability ratio PK+/PCl- was 0.16, indicating that the channel is 6-fold more anion selective over cation. The hemolysin channel frequently flickered in the presence of divalent cations, suggesting that the channel spontaneously opens and closes. These data imply that the El Tor hemolysin damages target cells by the formation of transmembrane channels and, consequently, is the cause of osmotic cytolysis.

  3. Electron-molecular cation reactive collisions: from channel mixing to competitive processes

    International Nuclear Information System (INIS)

    Motapon, O; Tamo, F O Waffeu; Backodissa, D; Chakrabarti, K; Mezei, J. Zs; Lique, F; Schneider, I F; Tudorache, D; Bultel, A; Tchang-Brillet, L; Dulieu, O; Tennyson, J; Wolf, A; Urbain, X

    2011-01-01

    The competition between dissociative recombination, vibrational excitation, and dissociative excitation of molecular cations in electron-impact collisions is discussed within the formalism of the Multichannel Quantum Defect Theory. Illustrative results are given for the HD + /HD and CO + /CO systems.

  4. The anti-proliferative effect of cation channel blockers in T lymphocytes depends on the strength of mitogenic stimulation.

    Science.gov (United States)

    Petho, Zoltan; Balajthy, Andras; Bartok, Adam; Bene, Krisztian; Somodi, Sandor; Szilagyi, Orsolya; Rajnavolgyi, Eva; Panyi, Gyorgy; Varga, Zoltan

    2016-03-01

    Ion channels are crucially important for the activation and proliferation of T lymphocytes, and thus, for the function of the immune system. Previous studies on the effects of channel blockers on T cell proliferation reported variable effectiveness due to differing experimental systems. Therefore our aim was to investigate how the strength of the mitogenic stimulation influences the efficiency of cation channel blockers in inhibiting activation, cytokine secretion and proliferation of T cells under standardized conditions. Human peripheral blood lymphocytes were activated via monoclonal antibodies targeting the TCR-CD3 complex and the co-stimulator CD28. We applied the blockers of Kv1.3 (Anuroctoxin), KCa3.1 (TRAM-34) and CRAC (2-Apb) channels of T cells either alone or in combination with rapamycin, the inhibitor of the mammalian target of rapamycin (mTOR). Five days after the stimulation ELISA and flow cytometric measurements were performed to determine IL-10 and IFN-γ secretion, cellular viability and proliferation. Our results showed that ion channel blockers and rapamycin inhibit IL-10 and IFN-γ secretion and cell division in a dose-dependent manner. Simultaneous application of the blockers for each channel along with rapamycin was the most effective, indicating synergy among the various activation pathways. Upon increasing the extent of mitogenic stimulation the anti-proliferative effect of the ion channel blockers diminished. This phenomenon may be important in understanding the fine-tuning of T cell activation. Copyright © 2016 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  5. Triple-channel portable capillary electrophoresis instrument with individual background electrolytes for the concurrent separations of anionic and cationic species

    Energy Technology Data Exchange (ETDEWEB)

    Mai, Thanh Duc; Le, Minh Duc [Centre for Environmental Technology and Sustainable Development (CETASD), Hanoi University of Science, Nguyen Trai Street 334, Hanoi (Viet Nam); Sáiz, Jorge [Department of Analytical Chemistry, Physical Chemistry and Chemical Engineering, University of Alcalá, Ctra. Madrid-Barcelona Km 33.6, Alcalá de Henares, Madrid (Spain); Duong, Hong Anh [Centre for Environmental Technology and Sustainable Development (CETASD), Hanoi University of Science, Nguyen Trai Street 334, Hanoi (Viet Nam); Koenka, Israel Joel [University of Basel, Department of Chemistry, Spitalstrasse 51, 4056 Basel (Switzerland); Pham, Hung Viet, E-mail: phamhungviet@hus.edu.vn [Centre for Environmental Technology and Sustainable Development (CETASD), Hanoi University of Science, Nguyen Trai Street 334, Hanoi (Viet Nam); Hauser, Peter C., E-mail: Peter.Hauser@unibas.ch [University of Basel, Department of Chemistry, Spitalstrasse 51, 4056 Basel (Switzerland)

    2016-03-10

    The portable capillary electrophoresis instrument is automated and features three independent channels with different background electrolytes to allow the concurrent optimized determination of three different categories of charged analytes. The fluidic system is based on a miniature manifold which is based on mechanically milled channels for injection of samples and buffers. The planar manifold pattern was designed to minimize the number of electronic valves required for each channel. The system utilizes pneumatic pressurization to transport solutions at the grounded as well as the high voltage side of the separation capillaries. The instrument has a compact design, with all components arranged in a briefcase with dimensions of 45 (w) × 35 (d) × 15 cm (h) and a weight of about 15 kg. It can operate continuously for 8 h in the battery-powered mode if only one electrophoresis channel is in use, or for about 2.5 h in the case of simultaneous employment of all three channels. The different operations, i.e. capillary flushing, rinsing of the interfaces at both capillary ends, sample injection and electrophoretic separation, are activated automatically with a control program featuring a graphical user interface. For demonstration, the system was employed successfully for the concurrent separation of different inorganic cations and anions, organic preservatives, additives and artificial sweeteners in various beverage and food matrices. - Highlights: • The use of parallel channels allows the concurrent separation of different classes of analytes. • Separate background electrolytes allow individual optimization. • The instrument is compact and field portable.

  6. Triple-channel portable capillary electrophoresis instrument with individual background electrolytes for the concurrent separations of anionic and cationic species

    International Nuclear Information System (INIS)

    Mai, Thanh Duc; Le, Minh Duc; Sáiz, Jorge; Duong, Hong Anh; Koenka, Israel Joel; Pham, Hung Viet; Hauser, Peter C.

    2016-01-01

    The portable capillary electrophoresis instrument is automated and features three independent channels with different background electrolytes to allow the concurrent optimized determination of three different categories of charged analytes. The fluidic system is based on a miniature manifold which is based on mechanically milled channels for injection of samples and buffers. The planar manifold pattern was designed to minimize the number of electronic valves required for each channel. The system utilizes pneumatic pressurization to transport solutions at the grounded as well as the high voltage side of the separation capillaries. The instrument has a compact design, with all components arranged in a briefcase with dimensions of 45 (w) × 35 (d) × 15 cm (h) and a weight of about 15 kg. It can operate continuously for 8 h in the battery-powered mode if only one electrophoresis channel is in use, or for about 2.5 h in the case of simultaneous employment of all three channels. The different operations, i.e. capillary flushing, rinsing of the interfaces at both capillary ends, sample injection and electrophoretic separation, are activated automatically with a control program featuring a graphical user interface. For demonstration, the system was employed successfully for the concurrent separation of different inorganic cations and anions, organic preservatives, additives and artificial sweeteners in various beverage and food matrices. - Highlights: • The use of parallel channels allows the concurrent separation of different classes of analytes. • Separate background electrolytes allow individual optimization. • The instrument is compact and field portable.

  7. Channels Formed by Botulinum, Tetanus, and Diphtheria Toxins in Planar Lipid Bilayers: Relevance to Translocation of Proteins across Membranes

    Science.gov (United States)

    Hoch, David H.; Romero-Mira, Miryam; Ehrlich, Barbara E.; Finkelstein, Alan; Dasgupta, Bibhuti R.; Simpson, Lance L.

    1985-03-01

    The heavy chains of both botulinum neurotoxin type B and tetanus toxin form channels in planar bilayer membranes. These channels have pH-dependent and voltage-dependent properties that are remarkably similar to those previously described for diphtheria toxin. Selectivity experiments with anions and cations show that the channels formed by the heavy chains of all three toxins are large; thus, these channels could serve as ``tunnel proteins'' for translocation of active peptide fragments. These findings support the hypothesis that the active fragments of botulinum neurotoxin and tetanus toxin, like that of diphtheria toxin, are translocated across the membranes of acidic vesicles.

  8. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  9. Metabolism regulates the spontaneous firing of substantia nigra pars reticulata neurons via KATP and nonselective cation channels.

    Science.gov (United States)

    Lutas, Andrew; Birnbaumer, Lutz; Yellen, Gary

    2014-12-03

    Neurons use glucose to fuel glycolysis and provide substrates for mitochondrial respiration, but neurons can also use alternative fuels that bypass glycolysis and feed directly into mitochondria. To determine whether neuronal pacemaking depends on active glucose metabolism, we switched the metabolic fuel from glucose to alternative fuels, lactate or β-hydroxybutyrate, while monitoring the spontaneous firing of GABAergic neurons in mouse substantia nigra pars reticulata (SNr) brain slices. We found that alternative fuels, in the absence of glucose, sustained SNr spontaneous firing at basal rates, but glycolysis may still be supported by glycogen in the absence of glucose. To prevent any glycogen-fueled glycolysis, we directly inhibited glycolysis using either 2-deoxyglucose or iodoacetic acid. Inhibiting glycolysis in the presence of alternative fuels lowered SNr firing to a slower sustained firing rate. Surprisingly, we found that the decrease in SNr firing was not mediated by ATP-sensitive potassium (KATP) channel activity, but if we lowered the perfusion flow rate or omitted the alternative fuel, KATP channels were activated and could silence SNr firing. The KATP-independent slowing of SNr firing that occurred with glycolytic inhibition in the presence of alternative fuels was consistent with a decrease in a nonselective cationic conductance. Although mitochondrial metabolism alone can prevent severe energy deprivation and KATP channel activation in SNr neurons, active glucose metabolism appears important for keeping open a class of ion channels that is crucial for the high spontaneous firing rate of SNr neurons. Copyright © 2014 the authors 0270-6474/14/3416336-12$15.00/0.

  10. Emission channeling studies on transition-metal doped GaN and ZnO: Cation versus anion substitution

    CERN Document Server

    AUTHOR|(CDS)2070176; Wahl, Ulrich; Martins Correia, Joao; Amorim, Lígia; Silva, Daniel; Decoster, Stefan; Castro Ribeiro Da Silva, Manuel; Temst, Kristiaan; Vantomme, André

    2014-01-01

    The magnetic and electric properties of impurities in semiconductors are strongly dependent on the lattice sites which they occupy. While the majority site can often be predicted based on chemical similarities with the host elements and is usually simple to confirm experimentally, minority sites are far more complicated to predict, detect and identify. We have carried out extensive beta− emission channeling studies on the lattice location of transition metal impurities in wide-gap dilute magnetic semiconductors, namely Co and Mn in GaN and ZnO, making use of radioactive 61Co and 56Mn implanted at the ISOLDE facility at CERN. In addition to the majority occupation of cation (Ga, Zn) sites, we located significant fractions (of the order of 20%) of the Co and Mn impurities in anion (N, O) sites, which are virtually unaffected by thermal annealing up to 900 °C. Here, we present the beta− emission channeling experiments on 61Co-implanted GaN. We discuss these results in the context of our recent reports of mi...

  11. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  12. Histamine facilitates GABAergic transmission in the rat entorhinal cortex: Roles of H1 and H2 receptors, Na+ -permeable cation channels, and inward rectifier K+ channels.

    Science.gov (United States)

    Cilz, Nicholas I; Lei, Saobo

    2017-05-01

    In the brain, histamine (HA) serves as a neuromodulator and a neurotransmitter released from the tuberomammillary nucleus (TMN). HA is involved in wakefulness, thermoregulation, energy homeostasis, nociception, and learning and memory. The medial entorhinal cortex (MEC) receives inputs from the TMN and expresses HA receptors (H 1 , H 2 , and H 3 ). We investigated the effects of HA on GABAergic transmission in the MEC and found that HA significantly increased the frequency of spontaneous inhibitory postsynaptic currents (sIPSCs) with an EC 50 of 1.3 µM, but failed to significantly alter sIPSC amplitude. HA-induced increases in sIPSC frequency were sensitive to tetrodotoxin (TTX), required extracellular Ca 2+ , and persisted when GDP-β-S, a G-protein inactivator, was applied postsynaptically via the recording pipettes, indicating that HA increased GABA release by facilitating the excitability of GABAergic interneurons in the MEC. Recordings from local MEC interneurons revealed that HA significantly increased their excitability as determined by membrane depolarization, generation of an inward current at -65 mV, and augmentation of action potential firing frequency. Both H 1 and H 2 receptors were involved in HA-induced increases in sIPSCs and interneuron excitability. Immunohistochemical staining showed that both H 1 and H 2 receptors are expressed on GABAergic interneurons in the MEC. HA-induced depolarization of interneurons involved a mixed ionic mechanism including activation of a Na + -permeable cation channel and inhibition of a cesium-sensitive inward rectifier K + channel, although HA also inhibited the delayed rectifier K + channels. Our results may provide a cellular mechanism, at least partially, to explain the roles of HA in the brain. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. The Drosophila Gr28bD product is a non-specific cation channel that can be used as a novel thermogenetic tool.

    Science.gov (United States)

    Mishra, Aditi; Salari, Autoosa; Berigan, Benton R; Miguel, Kayla C; Amirshenava, Marzie; Robinson, Abbey; Zars, Benjamin C; Lin, Jenna L; Milescu, Lorin S; Milescu, Mirela; Zars, Troy

    2018-01-17

    Extrinsic control of single neurons and neuronal populations is a powerful approach for understanding how neural circuits function. Adding new thermogenetic tools to existing optogenetic and other forms of intervention will increase the complexity of questions that can be addressed. A good candidate for developing new thermogenetic tools is the Drosophila gustatory receptor family, which has been implicated in high-temperature avoidance behavior. We examined the five members of the Gr28b gene cluster for temperature-dependent properties via three approaches: biophysical characterization in Xenopus oocytes, functional calcium imaging in Drosophila motor neurons, and behavioral assays in adult Drosophila. Our results show that Gr28bD expression in Xenopus oocytes produces a non-specific cationic current that is activated by elevated temperatures. This current is non-inactivating and non-voltage dependent. When expressed in Drosophila motor neurons, Gr28bD can be used to change the firing pattern of individual cells in a temperature-dependent fashion. Finally, we show that pan-neuronal or motor neuron expression of Gr28bD can be used to alter fruit fly behavior with elevated temperatures. Together, these results validate the potential of the Gr28bD gene as a founding member of a new class of thermogenetic tools.

  14. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  15. Trigonellae Semen Enhances Sperm Motility and the Expression of the Cation Sperm Channel Proteins in Mouse Testes

    Directory of Open Access Journals (Sweden)

    Do Rim Kim

    2015-01-01

    Full Text Available Genetic defects during spermatogenesis can lead to a reduction in sperm motility and cause male infertility. The cation channels of sperm (CatSper play a role in the regulation of hyperactivated sperm motility in mouse testes. The effect of Trigonellae Semen (TS on the male reproductive system and CatSper protein in mouse testes during spermatogenesis was examined. C57BL/c mice were divided into the following five groups: normal, cyclophosphamide- (CP- only treated (control group, and three groups treated with varying concentrations of TS with CP (100, 500, and 1000 mg/kg TS and 100 mg/kg CP. Real-time PCR, western blot analysis, and a testosterone immunoassay were performed to assess CatSper protein levels in the five groups. Additionally, sperm cell counts and motility were examined. Results indicate that sperm motility and sperm counts increased in the TS treated groups in a dose-dependent manner (p<0.01. CatSper levels were also significantly higher in the TS treated groups compared to that of the control group (p<0.001. Therefore, TS treatment could enhance sperm function by promoting spermatogenesis and the expression of CatSper proteins in mouse testes.

  16. Molecular Docking Analysis of Ginger Active Compound on Transient Receptor Potential Cation Channel Subfamily V Member 1 (TRPV1

    Directory of Open Access Journals (Sweden)

    Fifteen Aprila Fajrin

    2018-02-01

    Full Text Available Ginger had been reported to ameliorate painful diabetic neuropathy (PDN in an animal model. Gingerol and shogaol were active compounds of ginger that potentially act on transient receptor potential cation channel subfamily V member 1 (TRPV1, a key receptor in PDN. This study aims to predict the binding of gingerol and shogaol to TRPV1 using an in silico model. The ligands of the docking study were 3 chemical compounds of each gingerol and shogaol, i.e. 6-shogaol, 8-shogaol, 10-shogaol, 6-gingerol, 8 gingerol and 10-gingerol. Capsaicin, a TRPV1 agonist, was used as a native ligand. The TRPV1 structure was taken from Protein Data Bank (ID 3J9J. The docking analysis was performed using Autodock Vina. The result showed that among the ginger active compounds, 6-shogaol had the strongest binding energy (-7.10 kcal/mol to TRPV1. The 6-shogaol lacked the potential hydrogen bond to Ile265 of TRPV1 protein, which capsacin had. However, it's binding energy towards TRPV1 was not significantly different compared to capsaicin. Therefore, 6-shogaol had potential to be developed as a treatment for PDN.

  17. Modulation of Kir4.1 and Kir4.1-Kir5.1 channels by extracellular cations

    DEFF Research Database (Denmark)

    Søe, Rikke; Andreasen, Mogens; Klærke, Dan Arne

    2009-01-01

    This work demonstrates that extracellular Na(+) modulates the cloned inwardly rectifying K(+) channels Kir4.1 and Kir4.1-Kir5.1. Whole-cell patch clamp studies on astrocytes have previously indicated that inward potassium currents are regulated by external Na(+). We expressed Kir4.1 and Kir4.1-Kir5.......1 in Xenopus oocytes to disclose if Kir4.1 and/or Kir4.1-Kir5.1 at the molecular level are responsible for the observed effect of [Na(+)](o) and to investigate the regulatory mechanism of external cations further. Our results showed that Na(+) has a biphasic modulatory effect on both Kir4.1 and Kir4.1-Kir5.......1 currents. Depending on the Na(+)-concentration and applied voltage, the inward Kir4.1/Kir4.1-Kir5.1 currents are either enhanced or reduced by extracellular Na(+). The Na(+) activation was voltage-independent, whereas the Na(+)-induced reduction of the Kir4.1 and Kir4.1-Kir5.1 currents was both...

  18. Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

    Directory of Open Access Journals (Sweden)

    RAMÓN LATORRE

    2006-01-01

    Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

  19. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  20. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  1. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  2. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  3. Transient receptor potential melastatin subfamily member 2 cation channel regulates detrimental immune cell invasion in ischemic stroke.

    Science.gov (United States)

    Gelderblom, Mathias; Melzer, Nico; Schattling, Benjamin; Göb, Eva; Hicking, Gordon; Arunachalam, Priyadharshini; Bittner, Stefan; Ufer, Friederike; Herrmann, Alexander M; Bernreuther, Christian; Glatzel, Markus; Gerloff, Christian; Kleinschnitz, Christoph; Meuth, Sven G; Friese, Manuel A; Magnus, Tim

    2014-11-01

    Brain injury during stroke results in oxidative stress and the release of factors that include extracellular Ca(2+), hydrogen peroxide, adenosine diphosphate ribose, and nicotinic acid adenine dinucleotide phosphate. These alterations of the extracellular milieu change the activity of transient receptor potential melastatin subfamily member 2 (TRPM2), a nonselective cation channel expressed in the central nervous system and the immune system. Our goal was to evaluate the contribution of TRPM2 to the tissue damage after stroke. In accordance with current quality guidelines, we independently characterized Trpm2 in a murine ischemic stroke model in 2 different laboratories. Gene deficiency of Trpm2 resulted in significantly improved neurological outcome and decreased infarct size. Besides an already known moderate neuroprotective effect of Trpm2 deficiency in vitro, ischemic brain invasion by neutrophils and macrophages was particularly reduced in Trpm2-deficient mice. Bone marrow chimeric mice revealed that Trpm2 deficiency in the peripheral immune system is responsible for the protective phenotype. Furthermore, experiments with mixed bone marrow chimeras demonstrated that Trpm2 is essential for the migration of neutrophils and, to a lesser extent, also of macrophages into ischemic hemispheres. Notably, the pharmacological TRPM2 inhibitor, N-(p-amylcinnamoyl)anthranilic acid, was equally protective in the stroke model. Although a neuroprotective effect of TRPM2 in vitro is well known, we can show for the first time that the detrimental role of TRPM2 in stroke primarily depends on its role in activating peripheral immune cells. Targeting TRPM2 systemically represents a promising therapeutic approach for ischemic stroke. © 2014 American Heart Association, Inc.

  4. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  5. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  6. Animal Ca2+ release-activated Ca2+ (CRAC channels appear to be homologous to and derived from the ubiquitous cation diffusion facilitators

    Directory of Open Access Journals (Sweden)

    Tamang Dorjee G

    2010-06-01

    Full Text Available Abstract Background Antigen stimulation of immune cells triggers Ca2+ entry through Ca2+ release-activated Ca2+ (CRAC channels, promoting an immune response to pathogens. Defects in a CRAC (Orai channel in humans gives rise to the hereditary Severe Combined Immune Deficiency (SCID syndrome. We here report results that define the evolutionary relationship of the CRAC channel proteins of animals, and the ubiquitous Cation Diffusion Facilitator (CDF carrier proteins. Findings CDF antiporters derived from a primordial 2 transmembrane spanner (TMS hairpin structure by intragenic triplication to yield 6 TMS proteins. Four programs (IC/GAP, GGSEARCH, HMMER and SAM were evaluated for identifying sequence similarity and establishing homology using statistical means. Overall, the order of sensitivity (similarity detection was IC/GAP = GGSEARCH > HMMER > SAM, but the use of all four programs was superior to the use of any two or three of them. Members of the CDF family appeared to be homologous to members of the 4 TMS Orai channel proteins. Conclusions CRAC channels derived from CDF carriers by loss of the first two TMSs of the latter. Based on statistical analyses with multiple programs, TMSs 3-6 in CDF carriers are homologous to TMSs 1-4 in CRAC channels, and the former was the precursor of the latter. This is an unusual example of how a functionally and structurally more complex protein may have predated a simpler one.

  7. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  8. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  9. Transient receptor potential cation channel, subfamily C, member 5 (TRPC5) is a cold-transducer in the peripheral nervous system.

    Science.gov (United States)

    Zimmermann, Katharina; Lennerz, Jochen K; Hein, Alexander; Link, Andrea S; Kaczmarek, J Stefan; Delling, Markus; Uysal, Serdar; Pfeifer, John D; Riccio, Antonio; Clapham, David E

    2011-11-01

    Detection and adaptation to cold temperature is crucial to survival. Cold sensing in the innocuous range of cold (>10-15 °C) in the mammalian peripheral nervous system is thought to rely primarily on transient receptor potential (TRP) ion channels, most notably the menthol receptor, TRPM8. Here we report that TRP cation channel, subfamily C member 5 (TRPC5), but not TRPC1/TRPC5 heteromeric channels, are highly cold sensitive in the temperature range 37-25 °C. We found that TRPC5 is present in mouse and human sensory neurons of dorsal root ganglia, a substantial number of peripheral nerves including intraepithelial endings, and in the dorsal lamina of the spinal cord that receives sensory input from the skin, consistent with a potential TRPC5 function as an innocuous cold transducer in nociceptive and thermosensory nerve endings. Although deletion of TRPC5 in 129S1/SvImJ mice resulted in no temperature-sensitive behavioral changes, TRPM8 and/or other menthol-sensitive channels appear to underpin a much larger component of noxious cold sensing after TRPC5 deletion and a shift in mechanosensitive C-fiber subtypes. These findings demonstrate that highly cold-sensitive TRPC5 channels are a molecular component for detection and regional adaptation to cold temperatures in the peripheral nervous system that is distinct from noxious cold sensing.

  10. The Kinetics and the Permeation Properties of Piezo Channels.

    Science.gov (United States)

    Gnanasambandam, R; Gottlieb, P A; Sachs, F

    2017-01-01

    Piezo channels are eukaryotic, cation-selective mechanosensitive channels (MSCs), which show rapid activation and voltage-dependent inactivation. The kinetics of these channels are largely consistent across multiple cell types and different stimulation paradigms with some minor variability. No accessory subunits that associate with Piezo channels have been reported. They are homotrimers and each ∼300kD monomer has an N-terminal propeller blade-like mechanosensing module, which can confer mechanosensing capabilities on ASIC-1 (the trimeric non-MSC, acid-sensing ion channel-1) and a C-terminal pore module, which influences conductance, selectivity, and channel inactivation. Repeated stimulation can cause domain fracture and diffusion of these channels leading to synchronous loss of inactivation. The reconstituted channels spontaneously open only in asymmetric bilayers but lack inactivation. Mutations that cause hereditary xerocytosis alter PIEZO1 kinetics. The kinetics of the wild-type PIEZO1 and alterations thereof in mutants (M2225R, R2456K, and DhPIEZO1) are summarized in the form of a quantitative model and hosted online. The pore is permeable to alkali ions although Li + permeates poorly. Divalent cations, notably Ca 2+ , traverse the channel and inhibit the flux of monovalents. The large monovalent organic cations such as tetramethyl ammonium and tetraethyl ammonium can traverse the channel, but slowly, suggesting a pore diameter of ∼8Å, and the estimated in-plane area change upon opening is around 6-20nm 2 . Ruthenium red can enter the channel only from the extracellular side and seems to bind in a pocket close to residue 2496. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. The transient receptor potential, TRP4, cation channel is a novel member of the family of calmodulin binding proteins.

    OpenAIRE

    Trost, C; Bergs, C; Himmerkus, N; Flockerzi, V

    2001-01-01

    The mammalian gene products, transient receptor potential (trp)1 to trp7, are related to the Drosophila TRP and TRP-like ion channels, and are candidate proteins underlying agonist-activated Ca(2+)-permeable ion channels. Recently, the TRP4 protein has been shown to be part of native store-operated Ca(2+)-permeable channels. These channels, most likely, are composed of other proteins in addition to TRP4. In the present paper we report the direct interaction of TRP4 and calmodulin (CaM) by: (1...

  12. The atypical cation-conduction and gating properties of ELIC underscore the marked functional versatility of the pentameric ligand-gated ion-channel fold

    Science.gov (United States)

    Gonzalez-Gutierrez, Giovanni

    2015-01-01

    The superfamily of pentameric ligand-gated ion channels (pLGICs) is unique among ionotropic receptors in that the same overall structure has evolved to generate multiple members with different combinations of agonist specificities and permeant-ion charge selectivities. However, aside from these differences, pLGICs have been typically regarded as having several invariant functional properties. These include pore blockade by extracellular quaternary-ammonium cations in the micromolar-to-millimolar concentration range (in the case of the cation-selective members), and a gain-of-function phenotype, which manifests as a slower deactivation time course, as a result of mutations that reduce the hydrophobicity of the transmembrane pore lining. Here, we tested this notion on three distantly related cation-selective members of the pLGIC superfamily: the mouse muscle nicotinic acetylcholine receptor (nAChR), and the bacterial GLIC and ELIC channels. Remarkably, we found that, whereas low millimolar concentrations of TMA+ and TEA+ block the nAChR and GLIC, neither of these two quaternary-ammonium cations blocks ELIC at such concentrations; instead, both carry measurable inward currents when present as the only cations on the extracellular side. Also, we found that, whereas lidocaine binding speeds up the current-decay time courses of the nAChR and GLIC in the presence of saturating concentrations of agonists, the binding of lidocaine to ELIC slows this time course down. Furthermore, whereas mutations that reduce the hydrophobicity of the side chains at position 9′ of the M2 α-helices greatly slowed the deactivation time course of the nAChR and GLIC, these mutations had little effect—or even sped up deactivation—when engineered in ELIC. Our data indicate that caution should be exercised when generalizing results obtained with ELIC to the rest of the pLGICs, but more intriguingly, they hint at the possibility that ELIC is a representative of a novel branch of the

  13. Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.

    Science.gov (United States)

    Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C

    2010-10-01

    Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.

  14. Polymeric microchip for the simultaneous determination of anions and cations by hydrodynamic injection using a dual-channel sequential injection microchip electrophoresis system.

    Science.gov (United States)

    Gaudry, Adam J; Nai, Yi Heng; Guijt, Rosanne M; Breadmore, Michael C

    2014-04-01

    A dual-channel sequential injection microchip capillary electrophoresis system with pressure-driven injection is demonstrated for simultaneous separations of anions and cations from a single sample. The poly(methyl methacrylate) (PMMA) microchips feature integral in-plane contactless conductivity detection electrodes. A novel, hydrodynamic "split-injection" method utilizes background electrolyte (BGE) sheathing to gate the sample flows, while control over the injection volume is achieved by balancing hydrodynamic resistances using external hydrodynamic resistors. Injection is realized by a unique flow-through interface, allowing for automated, continuous sampling for sequential injection analysis by microchip electrophoresis. The developed system was very robust, with individual microchips used for up to 2000 analyses with lifetimes limited by irreversible blockages of the microchannels. The unique dual-channel geometry was demonstrated by the simultaneous separation of three cations and three anions in individual microchannels in under 40 s with limits of detection (LODs) ranging from 1.5 to 24 μM. From a series of 100 sequential injections the %RSDs were determined for every fifth run, resulting in %RSDs for migration times that ranged from 0.3 to 0.7 (n = 20) and 2.3 to 4.5 for peak area (n = 20). This system offers low LODs and a high degree of reproducibility and robustness while the hydrodynamic injection eliminates electrokinetic bias during injection, making it attractive for a wide range of rapid, sensitive, and quantitative online analytical applications.

  15. A Lys-Trp cation-π interaction mediates the dimerization and function of the chloride intracellular channel protein 1 transmembrane domain.

    Science.gov (United States)

    Peter, Bradley; Polyansky, Anton A; Fanucchi, Sylvia; Dirr, Heini W

    2014-01-14

    Chloride intracellular channel protein 1 (CLIC1) is a dual-state protein that can exist either as a soluble monomer or in an integral membrane form. The oligomerization of the transmembrane domain (TMD) remains speculative despite it being implicated in pore formation. The extent to which electrostatic and van der Waals interactions drive folding and association of the dimorphic TMD is unknown and is complicated by the requirement of interactions favorable in both aqueous and membrane environments. Here we report a putative Lys37-Trp35 cation-π interaction and show that it stabilizes the dimeric form of the CLIC1 TMD in membranes. A synthetic 30-mer peptide comprising a K37M TMD mutant was examined in 2,2,2-trifluoroethanol, sodium dodecyl sulfate micelles, and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine liposomes using far-ultraviolet (UV) circular dichroism, fluorescence, and UV absorbance spectroscopy. Our data suggest that Lys37 is not implicated in the folding, stability, or membrane insertion of the TMD peptide. However, removal of this residue impairs the formation of dimers and higher-order oligomers. This is accompanied by a 30-fold loss of chloride influx activity, suggesting that dimerization modulates the rate of chloride conductance. We propose that, within membranes, individual TMD helices associate via a Lys37-mediated cation-π interaction to form active dimers. The latter findings are also supported by results of modeling a putative TMD dimer conformation in which Lys37 and Trp35 form cation-π pairs at the dimer interface. Dimeric helix bundles may then associate to form fully active ion channels. Thus, within a membrane-like environment, aromatic interactions involving a polar lysine side chain provide a thermodynamic driving force for helix-helix association.

  16. Potential role of melastatin-related transient receptor potential cation channel subfamily M gene expression in the pathogenesis of urinary bladder cancer.

    Science.gov (United States)

    Ceylan, Gülay Güleç; Önalan, Ebru Etem; Kuloğlu, Tuncay; Aydoğ, Gülten; Keleş, İbrahim; Tonyali, Şenol; Ceylan, Cavit

    2016-12-01

    Urinary bladder cancer is one of the most common malignancies of the urinary tract. Ion channels and calcium homeostasis are involved in almost all basic cellular mechanisms. The transient receptor potential cation channel subfamily M (TRPM) takes its name from the melastatin protein, which is classified as potential tumor suppressor. To the best of our knowledge, there have been no previous studies in the literature investigating the role of these ion channels in bladder cancer. The present study aimed to determine whether bladder cancer is associated with mRNA expression levels of TRPM ion channel genes, and whether there is the potential to conduct further studies to establish novel treatment modalities. The present study included a total of 47 subjects, of whom 40 were bladder cancer patients and 7 were controls. Following the histopathological evaluation for bladder carcinoma, the mRNA and protein expression of TRPM were examined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and immunohistochemistry in tumor and normal tissues, in order to determine whether there is a difference in the expression of these channels in tumor and normal tissues. Immunoreactivity for TRPM2, TRPM4, TRPM7 and TRPM8 was observed in epithelial bladder cells in the two groups. RT-qPCR revealed a significant increase in TRPM7 expression in bladder cancer tissue compared to the controls (healthy bladder tissue), whereas no differences in TRPM2 or TRPM4 expression levels were observed. There were significant reductions in the expression levels of TRPM5 and TRPM8 in bladder cancer tissues. In the present study, the effects of TRP ion channels on the formation of bladder cancer was investigated. This study is instructive for TRPM2, TRPM4, TRPM5, TRPM7 and TRPM8 and their therapeutic role in bladder cancer. The results support the fact that these gens can be novel targets and can also be tested for during the treatment of bladder cancer.

  17. The cyclic nucleotide gated cation channel AtCNGC10 traffics from the ER via Golgi vesicles to the plasma membrane of Arabidopsis root and leaf cells

    Directory of Open Access Journals (Sweden)

    Andres Marilou A

    2007-09-01

    Full Text Available Abstract Background The cyclic nucleotide-gated ion channels (CNGCs maintain cation homeostasis essential for a wide range of physiological processes in plant cells. However, the precise subcellular locations and trafficking of these membrane proteins are poorly understood. This is further complicated by a general deficiency of information about targeting pathways of membrane proteins in plants. To investigate CNGC trafficking and localization, we have measured Atcngc5 and Atcngc10 expression in roots and leaves, analyzed AtCNGC10-GFP fusions transiently expressed in protoplasts, and conducted immunofluorescence labeling of protoplasts and immunoelectron microscopic analysis of high pressure frozen leaves and roots. Results AtCNGC10 mRNA and protein levels were 2.5-fold higher in roots than leaves, while AtCNGC5 mRNA and protein levels were nearly equal in these tissues. The AtCNGC10-EGFP fusion was targeted to the plasma membrane in leaf protoplasts, and lightly labeled several intracellular structures. Immunofluorescence microscopy with affinity purified CNGC-specific antisera indicated that AtCNGC5 and AtCNGC10 are present in the plasma membrane of protoplasts. Immunoelectron microscopy demonstrated that AtCNGC10 was associated with the plasma membrane of mesophyll, palisade parenchyma and epidermal cells of leaves, and the meristem, columella and cap cells of roots. AtCNCG10 was also observed in the endoplasmic reticulum and Golgi cisternae and vesicles of 50–150 nm in size. Patch clamp assays of an AtCNGC10-GFP fusion expressed in HEK293 cells measured significant cation currents. Conclusion AtCNGC5 and AtCNGC10 are plasma membrane proteins. We postulate that AtCNGC10 traffics from the endoplasmic reticulum via the Golgi apparatus and associated vesicles to the plasma membrane. The presence of the cation channel, AtCNGC10, in root cap meristem cells, cell plate, and gravity-sensing columella cells, combined with the previously reported

  18. Divalent cations as modulators of neuronal excitability: Emphasis on copper and zinc

    Directory of Open Access Journals (Sweden)

    RICARDO DELGADO

    2006-01-01

    Full Text Available Based on indirect evidence, a role for synaptically released copper and zinc as modulators of neuronal activity has been proposed. To test this proposal directly, we studied the effect of copper, zinc, and other divalent cations on voltage-dependent currents in dissociated toad olfactory neurons and on their firing rate induced by small depolarizing currents. Divalent cations in the nanomolar range sped up the activation kinetics and increased the amplitude of the inward sodium current. In the micromolar range, they caused a dose dependent inhibition of the inward Na+ and Ca2+ currents (I Na and I Ca and reduced de amplitude of the Ca2+-dependent K+ outward current (I Ca-K. On the other hand, the firing rate of olfactory neurons increased when exposed to nanomolar concentration of divalent cations and decreased when exposed to micromolar concentrations. This biphasic effect of divalent cations on neuronal excitability may be explained by the interaction of these ions with high and low affinity sites in voltage-gated channels. Our results support the idea that these ions are normal modulators of neuronal excitability

  19. A new pH-sensitive rectifying potassium channel in mitochondria from the embryonic rat hippocampus.

    Science.gov (United States)

    Kajma, Anna; Szewczyk, Adam

    2012-10-01

    Patch-clamp single-channel studies on mitochondria isolated from embryonic rat hippocampus revealed the presence of two different potassium ion channels: a large-conductance (288±4pS) calcium-activated potassium channel and second potassium channel with outwardly rectifying activity under symmetric conditions (150/150mM KCl). At positive voltages, this channel displayed a conductance of 67.84pS and a strong voltage dependence at holding potentials from -80mV to +80mV. The open probability was higher at positive than at negative voltages. Patch-clamp studies at the mitoplast-attached mode showed that the channel was not sensitive to activators and inhibitors of mitochondrial potassium channels but was regulated by pH. Moreover, we demonstrated that the channel activity was not affected by the application of lidocaine, an inhibitor of two-pore domain potassium channels, or by tertiapin, an inhibitor of inwardly rectifying potassium channels. In summary, based on the single-channel recordings, we characterised for the first time mitochondrial pH-sensitive ion channel that is selective for cations, permeable to potassium ions, displays voltage sensitivity and does not correspond to any previously described potassium ion channels in the inner mitochondrial membrane. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Substance P Activates Ca2+-Permeable Nonselective Cation Channels through a Phosphatidylcholine-Specific Phospholipase C Signaling Pathway in nNOS-Expressing GABAergic Neurons in Visual Cortex.

    Science.gov (United States)

    Endo, Toshiaki; Yanagawa, Yuchio; Komatsu, Yukio

    2016-02-01

    To understand the functions of the neocortex, it is essential to characterize the properties of neurons constituting cortical circuits. Here, we focused on a distinct group of GABAergic neurons that are defined by a specific colocalization of intense labeling for both neuronal nitric oxide synthase (nNOS) and substance P (SP) receptor [neurokinin 1 (NK1) receptors]. We investigated the mechanisms of the SP actions on these neurons in visual cortical slices obtained from young glutamate decarboxylase 67-green fluorescent protein knock-in mice. Bath application of SP induced a nonselective cation current leading to depolarization that was inhibited by the NK1 antagonists in nNOS-immunopositive neurons. Ruthenium red and La(3+), transient receptor potential (TRP) channel blockers, suppressed the SP-induced current. The SP-induced current was mediated by G proteins and suppressed by D609, an inhibitor of phosphatidylcholine-specific phospholipase C (PC-PLC), but not by inhibitors of phosphatidylinositol-specific PLC, adenylate cyclase or Src tyrosine kinases. Ca(2+) imaging experiments under voltage clamp showed that SP induced a rise in intracellular Ca(2+) that was abolished by removal of extracellular Ca(2+) but not by depletion of intracellular Ca(2+) stores. These results suggest that SP regulates nNOS neurons by activating TRP-like Ca(2+)-permeable nonselective cation channels through a PC-PLC-dependent signaling pathway. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  2. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  3. Pharmacological dissection of K(v)7.1 channels in systemic and pulmonary arteries

    DEFF Research Database (Denmark)

    Chadha, Preet S; Zunke, Friederike; Davis, Alison J

    2012-01-01

    The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature.......The aim of this study was to characterize the functional impact of KCNQ1-encoded voltage-dependent potassium channels (K(v)7.1) in the vasculature....

  4. Molecular properties of mammalian proteins that interact with cGMP: protein kinases, cation channels, phosphodiesterases, and multi-drug anion transporters.

    Science.gov (United States)

    Francis, Sharron H; Blount, Mitsi A; Zoraghi, Roya; Corbin, Jackie D

    2005-09-01

    Cyclic GMP is a critical second messenger signaling molecule in many mammalian cell types. It is synthesized by a family of guanylyl cyclases that is activated in response to stimuli from hormones such as natriuretic peptides, members of the guanylin family, and chemical stimuli including nitric oxide and carbon monoxide. The resulting elevation of cGMP modulates myriad physiological processes. Three major groups of cellular proteins bind cGMP specifically at allosteric sites; interaction of cGMP with these sites modulates the activities and functions of other domains within these protein groups to bring about physiological effects. These proteins include the cyclic nucleotide (cN)-dependent protein kinases, cN-gated cation channels, and cGMP-binding phosphodiesterases (PDE). Cyclic GMP also interacts with the catalytic sites of many cN PDEs and with some members of the multi-drug anion transporter family (MRPs) which can extrude nucleotides from cells. The allosteric cN-binding sites in the kinases and the cN-gated channels are evolutionarily and biochemically related, whereas the allosteric cGMP-binding sites in PDEs (also known as GAF domains), the catalytic sites of PDEs , and the ligand-binding sites in the MRPs are evolutionarily and biochemically distinct from each other and from those in the kinase and channel families. The sites that interact with cGMP within each of these groups of proteins have unique properties that provide for cGMP binding. Within a given cell, cGMP can potentially interact with members of all these groups of proteins if they are present. The relative abundance and affinities of these various cGMP-binding sites in conjunction with their subcellular compartmentation, proximity to cyclases and PDEs, and post-translational modification contribute importantly in determining the impact of these respective proteins to cGMP signaling within a particular cell.

  5. Actinide cation-cation complexes

    International Nuclear Information System (INIS)

    Stoyer, N.J.; Seaborg, G.T.

    1994-12-01

    The +5 oxidation state of U, Np, Pu, and Am is a linear dioxo cation (AnO 2 + ) with a formal charge of +1. These cations form complexes with a variety of other cations, including actinide cations. Other oxidation states of actinides do not form these cation-cation complexes with any cation other than AnO 2 + ; therefore, cation-cation complexes indicate something unique about AnO 2 + cations compared to actinide cations in general. The first cation-cation complex, NpO 2 + ·UO 2 2+ , was reported by Sullivan, Hindman, and Zielen in 1961. Of the four actinides that form AnO 2 + species, the cation-cation complexes of NpO 2 + have been studied most extensively while the other actinides have not. The only PuO 2 + cation-cation complexes that have been studied are with Fe 3+ and Cr 3+ and neither one has had its equilibrium constant measured. Actinides have small molar absorptivities and cation-cation complexes have small equilibrium constants; therefore, to overcome these obstacles a sensitive technique is required. Spectroscopic techniques are used most often to study cation-cation complexes. Laser-Induced Photacoustic Spectroscopy equilibrium constants for the complexes NpO 2 + ·UO 2 2+ , NpO 2 + ·Th 4+ , PuO 2 + ·UO 2 2+ , and PuO 2 + ·Th 4+ at an ionic strength of 6 M using LIPAS are 2.4 ± 0.2, 1.8 ± 0.9, 2.2 ± 1.5, and ∼0.8 M -1

  6. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  7. Changes in cationic selectivity of the nicotinic channel at the rat ganglionic synapse: a role for chloride ions?

    Science.gov (United States)

    Sacchi, Oscar; Rossi, Maria Lisa; Canella, Rita; Fesce, Riccardo

    2011-02-25

    The permeability of the nicotinic channel (nAChR) at the ganglionic synapse has been examined, in the intact rat superior cervical ganglion in vitro, by fitting the Goldman current equation to the synaptic current (EPSC) I-V relationship. Subsynaptic nAChRs, activated by neurally-released acetylcholine (ACh), were thus analyzed in an intact environment as natively expressed by the mature sympathetic neuron. Postsynaptic neuron hyperpolarization (from -40 to -90 mV) resulted in a change of the synaptic potassium/sodium permeability ratio (P(K)/P(Na)) from 1.40 to 0.92, corresponding to a reversible shift of the apparent acetylcholine equilibrium potential, E(ACh), by about +10 mV. The effect was accompanied by a decrease of the peak synaptic conductance (g(syn)) and of the EPSC decay time constant. Reduction of [Cl(-)](o) to 18 mM resulted in a change of P(K)/P(Na) from 1.57 (control) to 2.26, associated with a reversible shift of E(ACh) by about -10 mV. Application of 200 nM αBgTx evoked P(K)/P(Na) and g(syn) modifications similar to those observed in reduced [Cl(-)](o). The two treatments were overlapping and complementary, as if the same site/mechanism were involved. The difference current before and after chloride reduction or toxin application exhibited a strongly positive equilibrium potential, which could not be explained by the block of a calcium component of the EPSC. Observations under current-clamp conditions suggest that the driving force modification of the EPSC due to P(K)/P(Na) changes represent an additional powerful integrative mechanism of neuron behavior. A possible role for chloride ions is suggested: the nAChR selectivity was actually reduced by increased chloride gradient (membrane hyperpolarization), while it was increased, moving towards a channel preferentially permeable for potassium, when the chloride gradient was reduced.

  8. Changes in cationic selectivity of the nicotinic channel at the rat ganglionic synapse: a role for chloride ions?

    Directory of Open Access Journals (Sweden)

    Oscar Sacchi

    Full Text Available The permeability of the nicotinic channel (nAChR at the ganglionic synapse has been examined, in the intact rat superior cervical ganglion in vitro, by fitting the Goldman current equation to the synaptic current (EPSC I-V relationship. Subsynaptic nAChRs, activated by neurally-released acetylcholine (ACh, were thus analyzed in an intact environment as natively expressed by the mature sympathetic neuron. Postsynaptic neuron hyperpolarization (from -40 to -90 mV resulted in a change of the synaptic potassium/sodium permeability ratio (P(K/P(Na from 1.40 to 0.92, corresponding to a reversible shift of the apparent acetylcholine equilibrium potential, E(ACh, by about +10 mV. The effect was accompanied by a decrease of the peak synaptic conductance (g(syn and of the EPSC decay time constant. Reduction of [Cl(-](o to 18 mM resulted in a change of P(K/P(Na from 1.57 (control to 2.26, associated with a reversible shift of E(ACh by about -10 mV. Application of 200 nM αBgTx evoked P(K/P(Na and g(syn modifications similar to those observed in reduced [Cl(-](o. The two treatments were overlapping and complementary, as if the same site/mechanism were involved. The difference current before and after chloride reduction or toxin application exhibited a strongly positive equilibrium potential, which could not be explained by the block of a calcium component of the EPSC. Observations under current-clamp conditions suggest that the driving force modification of the EPSC due to P(K/P(Na changes represent an additional powerful integrative mechanism of neuron behavior. A possible role for chloride ions is suggested: the nAChR selectivity was actually reduced by increased chloride gradient (membrane hyperpolarization, while it was increased, moving towards a channel preferentially permeable for potassium, when the chloride gradient was reduced.

  9. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. The non-selective cation-permeable channel TRPC3 is a tetrahedron with a cap on the large cytoplasmic end

    International Nuclear Information System (INIS)

    Mio, Kazuhiro; Ogura, Toshihiko; Hara, Yuji; Mori, Yasuo; Sato, Chikara

    2005-01-01

    TRPC3 plays important roles in neuronal differentiation and immune cell maturation by mediating the cationic current in response to phospholipase C activation, Ca 2+ depletion, and diacylglycerol stimulation. Here, we purified the TRPC3 channel using a glycosylated tetramer and observed the structure using electron microscopy. Negatively stained specimens demonstrate homogeneous protein particles containing an internal cavity-like structure. These particle images were picked up by automated pick-up programs, aligned, and classified by the growing neural gas network method. Similarly oriented projections were averaged to decrease the signal-to-noise ratio. The averaged images progress from the top view to the side views, which are representative of their raw images. The top view confirmed the hypothesis of a four-domain structure, and the side view demonstrates a large cytoplasmic domain with a capped structure at the bottom, which is near a predicted locus of ion release. The total image of the protein is a blunt-edged trapezoid of 200 x 200 x 235 A. This large dimension of TRPC3 is also supported by the Stokes radius (92 A) obtained from gel filtration chromatography

  11. Microwave-assisted grafting polymerization modification of nylon 6 capillary-channeled polymer fibers for enhanced weak cation exchange protein separations

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liuwei; Marcus, R. Kenneth, E-mail: marcusr@clemson.edu

    2017-02-15

    A weak cation exchange liquid chromatography stationary phase (nylon-COOH) was prepared by grafting polyacrylic acid on to native nylon 6 capillary-channeled polymer (C-CP) fibers via a microwave-assisted radical polymerization. To the best of our knowledge, this is the first study of applying microwave-assisted grafting polymerization to affect nylon material for protein separation. The C-CP fiber surfaces were characterized by attenuated total reflection (ATR) infrared spectroscopy and scanning electron microscope (SEM). The anticipated carbonyl peak at 1722.9 cm{sup −1} was found on the nylon-COOH fibers, but was not found on the native fiber, indicating the presence of the polyacrylic acid on nylon fibers after grafting. The nylon-COOH phase showed a ∼12× increase in lysozyme dynamic binding capacity (∼12 mg mL{sup −1}) when compared to the native fiber phase (∼1 mg mL{sup −1}). The loading capacity of the nylon-COOH phase is nearly independent of the lysozyme loading concentration (0.05–1 mg mL{sup −1}) and the mobile phase linear velocity (7.3–73 mm s{sup −1}). The reproducibility of the lysozyme recovery from the nylon-COOH (RSD = 0.3%, n = 10) and the batch-to-batch variability in the functionalization (RSD = 3%, n = 5) were also investigated, revealing very high levels of consistency. Fast baseline separations of myoglobin, α-chymotrypsinogen A, cytochrome c and lysozyme were achieved using the nylon-COOH column. It was found that a 5× increase in the mobile phase linear velocity (7.3-to-36.5 mm s{sup −1}) had little effect on the separation resolution. The microwave-assisted grafting polymerization has great potential as a generalized surface modification methodology across the applications of C-CP fibers. - Highlights: • A microwave-assisted grafting method to attach acrylic acid is described for the first time for chromatographic phases. • A high-density, weak cation exchange surface is created on a nylon

  12. Intragastric Dai-Kenchu-To, a Japanese herbal medicine, stimulates colonic motility via transient receptor potential cation channel subfamily V member 1 in dogs.

    Science.gov (United States)

    Kikuchi, Daisuke; Shibata, Chikashi; Imoto, Hirofumi; Naitoh, Takeshi; Miura, Koh; Unno, Michiaki

    2013-08-01

    Japanese herbal medicine, also known as Kampo, is used for various diseases in Japan. One of those medicines, Dai-Kenchu-To (DKT), is considered clinically effective for adhesive bowel obstruction and chronic constipation. Although scientific evidence of DKT to improve adhesive bowel obstruction was shown in several previous reports, mechanism of DKT to improve constipation remains unknown. Our aim was to study the effect of intragastric DKT on colonic motility and defecation, and the involvement of various receptors in DKT-induced colonic contractions. Five beagle dogs were instructed with serosal strain-gauge force transducers to measure circular muscle activity at the proximal, middle, and distal colon. Dogs are suitable for a present study to administer the drugs repeatedly to the same individual and look at its effect on colonic motility. We studied the effects of DKT (2.5 or 5 g) administered into the stomach on colonic motility. Muscarinic receptor antagonist atropine, nicotinic receptor antagonist hexamthonium, or 5-hydroxytryptamine-3 receptor antagonist ondansetron was injected intravenously 10 min before DKT administration. Capsazepine, an antagonist to transient receptor potential cation channel subfamily V member 1 (TRPV1), was administered into the stomach 5 min before DKT administration. Intragastric DKT (2.5 or 5 g) induced colonic contractions within 10 min after administration but did not induce defecation. Pretreatment with atropine, hexamthonium, ondansetron, or capsazepine inhibited DKT-induced colonic contractions. These results indicate that orally administered DKT stimulates colonic motility via TRPV1, muscarinic, nicotinic, and 5-hydroxytryptamine-3 receptors, thereby providing scientific support for the efficacy of oral DKT in chronic constipation.

  13. Absence of the ER Cation Channel TMEM38B/TRIC-B Disrupts Intracellular Calcium Homeostasis and Dysregulates Collagen Synthesis in Recessive Osteogenesis Imperfecta.

    Directory of Open Access Journals (Sweden)

    Wayne A Cabral

    2016-07-01

    Full Text Available Recessive osteogenesis imperfecta (OI is caused by defects in proteins involved in post-translational interactions with type I collagen. Recently, a novel form of moderately severe OI caused by null mutations in TMEM38B was identified. TMEM38B encodes the ER membrane monovalent cation channel, TRIC-B, proposed to counterbalance IP3R-mediated Ca2+ release from intracellular stores. The molecular mechanisms by which TMEM38B mutations cause OI are unknown. We identified 3 probands with recessive defects in TMEM38B. TRIC-B protein is undetectable in proband fibroblasts and osteoblasts, although reduced TMEM38B transcripts are present. TRIC-B deficiency causes impaired release of ER luminal Ca2+, associated with deficient store-operated calcium entry, although SERCA and IP3R have normal stability. Notably, steady state ER Ca2+ is unchanged in TRIC-B deficiency, supporting a role for TRIC-B in the kinetics of ER calcium depletion and recovery. The disturbed Ca2+ flux causes ER stress and increased BiP, and dysregulates synthesis of proband type I collagen at multiple steps. Collagen helical lysine hydroxylation is reduced, while telopeptide hydroxylation is increased, despite increased LH1 and decreased Ca2+-dependent FKBP65, respectively. Although PDI levels are maintained, procollagen chain assembly is delayed in proband cells. The resulting misfolded collagen is substantially retained in TRIC-B null cells, consistent with a 50-70% reduction in secreted collagen. Lower-stability forms of collagen that elude proteasomal degradation are not incorporated into extracellular matrix, which contains only normal stability collagen, resulting in matrix insufficiency. These data support a role for TRIC-B in intracellular Ca2+ homeostasis, and demonstrate that absence of TMEM38B causes OI by dysregulation of calcium flux kinetics in the ER, impacting multiple collagen-specific chaperones and modifying enzymes.

  14. Absence of the ER Cation Channel TMEM38B/TRIC-B Disrupts Intracellular Calcium Homeostasis and Dysregulates Collagen Synthesis in Recessive Osteogenesis Imperfecta

    Science.gov (United States)

    Cabral, Wayne A.; Ishikawa, Masaki; Garten, Matthias; Makareeva, Elena N.; Sargent, Brandi M.; Weis, MaryAnn; Barnes, Aileen M.; Webb, Emma A.; Shaw, Nicholas J.; Ala-Kokko, Leena; Lacbawan, Felicitas L.; Högler, Wolfgang; Leikin, Sergey; Blank, Paul S.; Zimmerberg, Joshua; Eyre, David R.; Yamada, Yoshihiko; Marini, Joan C.

    2016-01-01

    Recessive osteogenesis imperfecta (OI) is caused by defects in proteins involved in post-translational interactions with type I collagen. Recently, a novel form of moderately severe OI caused by null mutations in TMEM38B was identified. TMEM38B encodes the ER membrane monovalent cation channel, TRIC-B, proposed to counterbalance IP3R-mediated Ca2+ release from intracellular stores. The molecular mechanisms by which TMEM38B mutations cause OI are unknown. We identified 3 probands with recessive defects in TMEM38B. TRIC-B protein is undetectable in proband fibroblasts and osteoblasts, although reduced TMEM38B transcripts are present. TRIC-B deficiency causes impaired release of ER luminal Ca2+, associated with deficient store-operated calcium entry, although SERCA and IP3R have normal stability. Notably, steady state ER Ca2+ is unchanged in TRIC-B deficiency, supporting a role for TRIC-B in the kinetics of ER calcium depletion and recovery. The disturbed Ca2+ flux causes ER stress and increased BiP, and dysregulates synthesis of proband type I collagen at multiple steps. Collagen helical lysine hydroxylation is reduced, while telopeptide hydroxylation is increased, despite increased LH1 and decreased Ca2+-dependent FKBP65, respectively. Although PDI levels are maintained, procollagen chain assembly is delayed in proband cells. The resulting misfolded collagen is substantially retained in TRIC-B null cells, consistent with a 50–70% reduction in secreted collagen. Lower-stability forms of collagen that elude proteasomal degradation are not incorporated into extracellular matrix, which contains only normal stability collagen, resulting in matrix insufficiency. These data support a role for TRIC-B in intracellular Ca2+ homeostasis, and demonstrate that absence of TMEM38B causes OI by dysregulation of calcium flux kinetics in the ER, impacting multiple collagen-specific chaperones and modifying enzymes. PMID:27441836

  15. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  16. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  17. On the mechanism of TBA block of the TRPV1 channel.

    Science.gov (United States)

    Oseguera, Andrés Jara; Islas, León D; García-Villegas, Refugio; Rosenbaum, Tamara

    2007-06-01

    The transient receptor potential vanilloid 1 (TRPV1) channel is a nonselective cation channel activated by capsaicin and responsible for thermosensation. To date, little is known about the gating characteristics of these channels. Here we used tetrabutylammonium (TBA) to determine whether this molecule behaves as an ion conduction blocker in TRPV1 channels and to gain insight into the nature of the activation gate of this protein. TBA belongs to a family of classic potassium channel blockers that have been widely used as tools for determining the localization of the activation gate and the properties of the pore of several ion channels. We found TBA to be a voltage-dependent pore blocker and that the properties of block are consistent with an open-state blocker, with the TBA molecule binding to multiple open states, each with different blocker affinities. Kinetics of channel closure and burst-length analysis in the presence of blocker are consistent with a state-dependent blocking mechanism, with TBA interfering with closing of an activation gate. This activation gate may be located cytoplasmically with respect to the binding site of TBA ions, similar to what has been observed in potassium channels. We propose an allosteric model for TRPV1 activation and block by TBA, which explains our experimental data.

  18. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  19. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  20. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  1. [Effects of transient receptor potential melastatin 8 cation channels on inflammatory reaction induced by cold temperatures in human airway epithelial cells].

    Science.gov (United States)

    Li, Min-chao; Perelman, Juliy M; Kolosov, Victor P; Zhou, Xiang-dong

    2011-10-01

    To explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) in cold-induced production of inflammatory factors in airway epithelial cells and related signal transduction mechanism. The 16HBE human airway epithelial cells were stimulated with cold temperature (18°C). In intervention experiments, cells were pretreated with TRPM8 channel antagonist BCTC, protein kinase C (PKC) specific inhibitor calphostin C and transfected with TRPM8 shRNA or control shRNA respectively, and thereafter cold stimulation was applied. Cells were divided into 6 groups: a control group (incubated at 37°C), a cold stimulation group, a cold stimulation + BCTC group, a cold stimulation + TRPM8 shRNA group, a cold stimulation + control shRNA group, a cold stimulation + calphostin C group. Western blot was performed to show the extent of knockdown in TRPM8 protein expression in the TRPM8 shRNA transfected cells. Dynamics of relative concentration of intracellular Ca(2+) in the former 5 groups were measured by calcium imaging techniques. Images were taken at one frame per 10 seconds. The levels of interleukin (IL)-6, IL-8, tumor necrosis factor (TNF)-α mRNA and protein were detected by real-time PCR and ELISA respectively. The highest relative concentration of intracellular calcium in cold stimulation group (2.36 ± 0.24) was higher than that of control group (1.01 ± 0.02) (t = 12.52, P cold stimulation group (t = 6.69 and 9.12, all P cold stimulation group[0.66 ± 0.16, 0.77 ± 0.15, 0.73 ± 0.09 and (92 ± 13) ng/L, (125 ± 22) ng/L, (88 ± 12) ng/L ] were significantly higher than those in control group [0.37 ± 0.08, 0.32 ± 0.07, 0.48 ± 0.10 and (52 ± 8) ng/L, (50 ± 9) ng/L, (61 ± 8) ng/L] (t = 3.20 - 6.26, all P cold stimulation + BCTC group [0.42 ± 0.09, 0.52 ± 0.13, 0.52 ± 0.12 and (72 ± 8) ng/L, (92 ± 14) ng/L, (68 ± 11) ng/L], cold stimulation + TRPM8 shRNA group [0.41 ± 0.10, 0.49 ± 0.08, 0.50 ± 0.08 and (60 ± 12) ng/L, (89 ± 14) ng

  2. A Tour de Force: The Discovery, Properties, and Function of Piezo Channels.

    Science.gov (United States)

    Gottlieb, P A

    2017-01-01

    Mechanical transducers appear throughout cell biology and are used to convert mechanical stress into chemical or electrical signals that allow the cell to respond to environmental changes. In the past six years, a eukaryotic mechanical channel family with two members, Piezo1 and Piezo2, has been identified. Piezo1 was shown to be a cation-selective channel that does not require ancillary proteins for activity. Mouse Piezo1 is large, with over 2500 amino acids, and is not homologous to other ion channels. Both piezo channels have rapid voltage-dependent inactivation with a reversal potential near 0mV. The CryoEm structure of Piezo1 at 4.8Å shows trimer stoichiometry. Since the discovery of the piezo channels, their roles in the physiological response of cells have started to emerge. Significant progress has been made in understanding the intrinsic properties of the channels and how these properties are modulated by cytoskeletal elements. Specific diseases, such as hereditary xerocytosis affecting red blood cells, have mutations in Piezo1 that alter the cell's response to force, typically slowing inactivation and introducing a latency for activation. A number of physiological functions for piezo channels have been identified. These range from sensing the stiffness of surrounding substrate, to the response to light touch, to serotonin release from the gut. This review provides a general overview of the properties and roles of Piezo1 and Piezo2 in eukaryotic mechanotransduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  4. Subunit Stoichiometry of Human Muscle Chloride Channels

    OpenAIRE

    Fahlke, Christoph; Knittle, Timothy; Gurnett, Christina A.; Campbell, Kevin P.; George, Alfred L.

    1997-01-01

    Voltage-gated Cl? channels belonging to the ClC family appear to function as homomultimers, but the number of subunits needed to form a functional channel is controversial. To determine subunit stoichiometry, we constructed dimeric human skeletal muscle Cl? channels in which one subunit was tagged by a mutation (D136G) that causes profound changes in voltage-dependent gating. Sucrose-density gradient centrifugation experiments indicate that both monomeric and dimeric hClC-1 channels in their ...

  5. Impact of Dendrimer Terminal Group Chemistry on Blockage of the Anthrax Toxin Channel: A Single Molecule Study.

    Science.gov (United States)

    Yamini, Goli; Kalu, Nnanya; Nestorovich, Ekaterina M

    2016-11-15

    Nearly all the cationic molecules tested so far have been shown to reversibly block K⁺ current through the cation-selective PA 63 channels of anthrax toxin in a wide nM-mM range of effective concentrations. A significant increase in channel-blocking activity of the cationic compounds was achieved when multiple copies of positively charged ligands were covalently linked to multivalent scaffolds, such as cyclodextrins and dendrimers. Even though multivalent binding can be strong when the individual bonds are relatively weak, for drug discovery purposes we often strive to design multivalent compounds with high individual functional group affinity toward the respective binding site on a multivalent target. Keeping this requirement in mind, here we perform a single-channel/single-molecule study to investigate kinetic parameters of anthrax toxin PA 63 channel blockage by second-generation (G2) poly(amido amine) (PAMAM) dendrimers functionalized with different surface ligands, including G2-NH₂, G2-OH, G2-succinamate, and G2-COONa. We found that the previously reported difference in IC 50 values of the G2-OH/PA 63 and G2-NH₂/PA 63 binding was determined by both on- and off-rates of the reversible dendrimer/channel binding reaction. In 1 M KCl, we observed a decrease of about three folds in k o n and a decrease of only about ten times in t r e s with G2-OH compared to G2-NH₂. At the same time for both blockers, k o n and t r e s increased dramatically with transmembrane voltage increase. PAMAM dendrimers functionalized with negatively charged succinamate, but not carboxyl surface groups, still had some residual activity in inhibiting the anthrax toxin channels. At 100 mV, the on-rate of the G2-succinamate binding was comparable with that of G2-OH but showed weaker voltage dependence when compared to G2-OH and G2-NH₂. The residence time of G2-succinamate in the channel exhibited opposite voltage dependence compared to G2-OH and G2-NH₂, increasing with the cis

  6. Synthetic cation-selective nanotube: permeant cations chaperoned by anions.

    Science.gov (United States)

    Hilder, Tamsyn A; Gordon, Dan; Chung, Shin-Ho

    2011-01-28

    The ability to design ion-selective, synthetic nanotubes which mimic biological ion channels may have significant implications for the future treatment of bacteria, diseases, and as ultrasensitive biosensors. We present the design of a synthetic nanotube made from carbon atoms that selectively allows monovalent cations to move across and rejects all anions. The cation-selective nanotube mimics some of the salient properties of biological ion channels. Before practical nanodevices are successfully fabricated it is vital that proof-of-concept computational studies are performed. With this in mind we use molecular and stochastic dynamics simulations to characterize the dynamics of ion permeation across a single-walled (10, 10), 36 Å long, carbon nanotube terminated with carboxylic acid with an effective radius of 5.08 Å. Although cations encounter a high energy barrier of 7 kT, its height is drastically reduced by a chloride ion in the nanotube. The presence of a chloride ion near the pore entrance thus enables a cation to enter the pore and, once in the pore, it is chaperoned by the resident counterion across the narrow pore. The moment the chaperoned cation transits the pore, the counterion moves back to the entrance to ferry another ion. The synthetic nanotube has a high sodium conductance of 124 pS and shows linear current-voltage and current-concentration profiles. The cation-anion selectivity ratio ranges from 8 to 25, depending on the ionic concentrations in the reservoirs.

  7. Channel formation by the binding component of Clostridium botulinum C2 toxin: glutamate 307 of C2II affects channel properties in vitro and pH-dependent C2I translocation in vivo.

    Science.gov (United States)

    Blöcker, Dagmar; Bachmeyer, Christoph; Benz, Roland; Aktories, Klaus; Barth, Holger

    2003-05-13

    The binding component (C2II) of the binary Clostridium botulinum C2 toxin mediates transport of the actin ADP-ribosylating enzyme component (C2I) into the cytosol of target cells. C2II (80 kDa) is activated by trypsin cleavage, and proteolytically activated C2II (60 kDa) oligomerizes to heptamers in solution. Activated C2II forms channels in lipid bilayer membranes which are highly cation selective and voltage-gated. A role for this channel in C2I translocation across the cell membrane into the cytosol is discussed. Amino acid residues 303-331 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which likely facilitates membrane insertion and channel formation by creating two antiparallel beta-strands. Some of the residues are in strategic positions within the putative C2II channel, in particular, glutamate 307 (E307) localized in its center and glycine 316 (G316) localized on the trans side of the membrane. Here, single-lysine substitutions of these amino acids and the double mutant E307K/G316K of C2II were analyzed in vivo and in artificial lipid bilayer experiments. The pH dependence of C2I transport across cellular membranes was altered, and a pH of properties of C2II were substantially changed by the mutations, as evidenced by reduced cation selectivity. Interestingly, the voltage dependence of wild-type C2II was completely lost for the E307K mutant, which means that E307 is responsible for voltage gating. Chloroquine blocked the E307K mutant channel and intoxication of Vero cells by mutant C2II and C2I, indicating that chloroquine binding does not involve E307. Overall, the voltage gating and cation selectivity of the C2II channel do not play an important role in translocation of C2I into the cytosol.

  8. Ion channel activity of membrane vesicles released from sea urchin sperm during the acrosome reaction

    International Nuclear Information System (INIS)

    Schulz, Joseph R.; Vega-Beltran, Jose L. de la; Beltran, Carmen; Vacquier, Victor D.; Darszon, Alberto

    2004-01-01

    The sperm acrosome reaction (AR) involves ion channel activation. In sea urchin sperm, the AR requires Ca 2+ and Na + influx and K + and H + efflux. During the AR, the plasma membrane fuses with the acrosomal vesicle membrane forming hybrid membrane vesicles that are released from sperm into the medium. This paper reports the isolation and preliminary characterization of these acrosome reaction vesicles (ARVs), using synaptosome-associated protein of 25 kDa (SNAP-25) as a marker. Isolated ARVs have a unique protein composition. The exocytosis regulatory proteins vesicle-associated membrane protein and SNAP-25 are inside ARVs, as judged by protease protection experiments, and membrane associated based on Triton X-114 partitioning. ARVs fused with planar bilayers display three main types of single channel activity. The most frequently recorded channel is cationic, weakly voltage dependent and has a low open probability that increases with negative potentials. This channel is activated by cAMP, blocked by Ba 2+ , and has a PK + /PNa + selectivity of 4.5. ARVs represent a novel membrane preparation suitable to deepen our understanding of ion channel activity in the AR and during fertilization

  9. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  10. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  11. Cryo-EM structure of the cytoplasmic domain of murine transient receptor potential cation channel subfamily C member 6 (TRPC6).

    Science.gov (United States)

    Azumaya, Caleigh M; Sierra-Valdez, Francisco; Cordero-Morales, Julio F; Nakagawa, Terunaga

    2018-05-11

    The kidney maintains the internal milieu by regulating the retention and excretion of proteins, ions, and small molecules. The glomerular podocyte forms the slit diaphragm of the ultrafiltration filter, whose damage leads to progressive kidney failure and focal segmental glomerulosclerosis (FSGS). The canonical transient receptor potential 6 (TRPC6) ion channel is expressed in the podocyte and mutations in its cytoplasmic domain cause FSGS in humans. In vitro evaluation of disease-causing mutations in TRPC6 has revealed that these genetic alterations result in abnormal ion channel gating. However, the mechanism whereby the cytoplasmic domain modulates TRPC6 function is largely unknown. Here we report a cryoEM structure of the cytoplasmic domain of murine TRPC6 at 3.8Å resolution. The cytoplasmic fold of TRPC6 is characterized by an inverted dome-like chamber pierced by four radial horizontal helices that converge into a vertical coiled-coil at the central axis. Unlike in other TRP channels, TRPC6 displays a unique domain swap that occurs at the junction of the horizontal helices and coiled-coil. Multiple FSGS mutations converge at the buried interface between the vertical coiled-coil and the ankyrin repeats, which form the dome, suggesting these regions are critical for allosteric gating modulation. This functionally critical interface is a potential target for drug design. Importantly, dysfunction in other family members leads to learning deficits (TRPC1/4/5) and ataxia (TRPC3). Our data provide a structural framework for the mechanistic investigation of the TRPC family. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  13. Functional analysis of Kv1.2 and paddle chimera Kv channels in planar lipid bilayers

    Science.gov (United States)

    Tao, Xiao; MacKinnon, Roderick

    2010-01-01

    Summary Voltage-dependent K+ channels play key roles in shaping electrical signaling in both excitable as well as non-excitable cells. These channels open and close in response to the voltage changes across the cell membrane. Many studies have been carried out in order to understand the voltage sensing mechanism. Our laboratory recently determined the atomic structures of a mammalian voltage-dependent K+ channel Kv1.2 and a mutant of Kv1.2 named the ‘paddle-chimera’ channel, in which the voltage sensor paddle was transferred from Kv2.1 to Kv1.2. These two structures provide atomic descriptions of voltage-dependent channels with unprecedented clarity. Until now the functional integrity of these two channels biosynthesized in yeast cells have not been assessed. Here we report the electrophysiological and pharmacological properties of Kv1.2 and the paddle chimera channels in planar lipid bilayers. We demonstrate that Pichia yeast produce ‘normally functioning’ mammalian voltage-dependent K+ channels with qualitatively similar features to the Shaker K+ channel in the absence of the N-terminal inactivation gate, and that the paddle chimera mutant channel functions as well as Kv1.2. We find, however, that in several respects the Kv1.2 channel exhibits functional properties that are distinct from Kv1.2 channels reported in the literature. PMID:18638484

  14. Transient receptor potential channels in essential hypertension

    DEFF Research Database (Denmark)

    Liu, Daoyan; Scholze, Alexandra; Zhu, Zhiming

    2006-01-01

    The role of nonselective cation channels of the transient receptor potential channel (TRPC) family in essential hypertension has not yet been investigated.......The role of nonselective cation channels of the transient receptor potential channel (TRPC) family in essential hypertension has not yet been investigated....

  15. Establishment of human sperm-specific voltage-dependent anion channel 3 recombinant vector for the production of a male contraceptive vaccine

    Directory of Open Access Journals (Sweden)

    Asmarinah Asmarinah

    2012-05-01

    Full Text Available Background: The aim of this study was to construct a recombinant vector of human sperm specific VDAC3 gene for production of VDAC3 antibody, which is potential as male contraception vaccine.Methods: Target fragment sequence of VDAC3 gene was obtained through amplification of human sperm VDAC3 cDNA with primers covering exon 5 to exon 8. Its PCR product in size of 435 bp was cloned to the pET101/D-TOPO expression vector (5753 bp. E. coli bacteria were transformed with this vector. Cloning of VDAC3 fragment gene to the vector was confirmed by the using of XbaI restriction enzyme and PCR colony method with primers covering exons 5-8 of the human VDAC3 gene.Results: Alignment analysis of amplified fragment covering exon 5 to exon 8 of VDAC3 gene showed 94% homology to human VDAC3 gene from databank. After cloning to the expression vector and transformation to E. coli competent cells, twelve colonies could grow in culture media. Gel electrophoresis of sliced VDAC3 recombinant vector showed a single band in the size of 6181 bp in 8 colonies. After application of PCR colony and amplicon sequencing, the result showed a single band in the size of 435 bp and fragment sequence with 94% identity to human VDAC3 gene.Conclusion: The construction of human sperm specific VDAC3 gene recombinant vector was established in this study. In the future, this recombinant vector will be used to produce VDAC3 antibody for the development of a male contraception vaccine. (Med J Indones. 2012;21:61-5Keywords: Contraception, recombinant vector, sperm, VDAC3

  16. Single-channel kinetics of BK (Slo1 channels

    Directory of Open Access Journals (Sweden)

    Yanyan eGeng

    2015-01-01

    Full Text Available Single-channel kinetics has proven a powerful tool to reveal information about the gating mechanisms that control the opening and closing of ion channels. This introductory review focuses on the gating of large conductance Ca2+- and voltage-activated K+ (BK or Slo1 channels at the single-channel level. It starts with single-channel current records and progresses to presentation and analysis of single-channel data and the development of gating mechanisms in terms of discrete state Markov (DSM models. The DSM models are formulated in terms of the tetrameric modular structure of BK channels, consisting of a central transmembrane pore-gate domain (PGD attached to four surrounding transmembrane voltage sensing domains (VSD and a large intracellular cytosolic domain (CTD, also referred to as the gating ring. The modular structure and data analysis shows that the Ca2+ and voltage dependent gating considered separately can each be approximated by 10-state two-tiered models with 5 closed states on the upper tier and 5 open states on the lower tier. The modular structure and joint Ca2+ and voltage dependent gating are consistent with a 50 state two-tiered model with 25 closed states on the upper tier and 25 open states on the lower tier. Adding an additional tier of brief closed (flicker states to the 10-state or 50-state models improved the description of the gating. For fixed experimental conditions a channel would gate in only a subset of the potential number of states. The detected number of states and the correlations between adjacent interval durations are consistent with the tiered models. The examined models can account for the single-channel kinetics and the bursting behavior of gating. Ca2+ and voltage activate BK channels by predominantly increasing the effective opening rate of the channel with a smaller decrease in the effective closing rate. Ca2+ and depolarization thus activate by mainly destabilizing the closed states.

  17. Ion channels in plants.

    Science.gov (United States)

    Hedrich, Rainer

    2012-10-01

    Since the first recordings of single potassium channel activities in the plasma membrane of guard cells more than 25 years ago, patch-clamp studies discovered a variety of ion channels in all cell types and plant species under inspection. Their properties differed in a cell type- and cell membrane-dependent manner. Guard cells, for which the existence of plant potassium channels was initially documented, advanced to a versatile model system for studying plant ion channel structure, function, and physiology. Interestingly, one of the first identified potassium-channel genes encoding the Shaker-type channel KAT1 was shown to be highly expressed in guard cells. KAT1-type channels from Arabidopsis thaliana and its homologs from other species were found to encode the K(+)-selective inward rectifiers that had already been recorded in early patch-clamp studies with guard cells. Within the genome era, additional Arabidopsis Shaker-type channels appeared. All nine members of the Arabidopsis Shaker family are localized at the plasma membrane, where they either operate as inward rectifiers, outward rectifiers, weak voltage-dependent channels, or electrically silent, but modulatory subunits. The vacuole membrane, in contrast, harbors a set of two-pore K(+) channels. Just very recently, two plant anion channel families of the SLAC/SLAH and ALMT/QUAC type were identified. SLAC1/SLAH3 and QUAC1 are expressed in guard cells and mediate Slow- and Rapid-type anion currents, respectively, that are involved in volume and turgor regulation. Anion channels in guard cells and other plant cells are key targets within often complex signaling networks. Here, the present knowledge is reviewed for the plant ion channel biology. Special emphasis is drawn to the molecular mechanisms of channel regulation, in the context of model systems and in the light of evolution.

  18. Corynebacterium jeikeium jk0268 constitutes for the 40 amino acid long PorACj, which forms a homooligomeric and anion-selective cell wall channel.

    Directory of Open Access Journals (Sweden)

    Narges Abdali

    Full Text Available Corynebacterium jeikeium, a resident of human skin, is often associated with multidrug resistant nosocomial infections in immunodepressed patients. C. jeikeium K411 belongs to mycolic acid-containing actinomycetes, the mycolata and contains a channel-forming protein as judged from reconstitution experiments with artificial lipid bilayer experiments. The channel-forming protein was present in detergent treated cell walls and in extracts of whole cells using organic solvents. A gene coding for a 40 amino acid long polypeptide possibly responsible for the pore-forming activity was identified in the known genome of C. jeikeium by its similar chromosomal localization to known porH and porA genes of other Corynebacterium strains. The gene jk0268 was expressed in a porin deficient Corynebacterium glutamicum strain. For purification temporarily histidine-tailed or with a GST-tag at the N-terminus, the homogeneous protein caused channel-forming activity with an average conductance of 1.25 nS in 1M KCl identical to the channels formed by the detergent extracts. Zero-current membrane potential measurements of the voltage dependent channel implied selectivity for anions. This preference is according to single-channel analysis caused by some excess of cationic charges located in the channel lumen formed by oligomeric alpha-helical wheels. The channel has a suggested diameter of 1.4 nm as judged from the permeability of different sized hydrated anions using the Renkin correction factor. Surprisingly, the genome of C. jeikeium contained only one gene coding for a cell wall channel of the PorA/PorH type found in other Corynebacterium species. The possible evolutionary relationship between the heterooligomeric channels formed by certain Corynebacterium strains and the homooligomeric pore of C. jeikeium is discussed.

  19. Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors.

    Science.gov (United States)

    Mälkiä, Annika; Madrid, Rodolfo; Meseguer, Victor; de la Peña, Elvira; Valero, María; Belmonte, Carlos; Viana, Félix

    2007-05-15

    TRPM8, a member of the melastatin subfamily of transient receptor potential (TRP) cation channels, is activated by voltage, low temperatures and cooling compounds. These properties and its restricted expression to small sensory neurons have made it the ion channel with the most advocated role in cold transduction. Recent work suggests that activation of TRPM8 by cold and menthol takes place through shifts in its voltage-activation curve, which cause the channel to open at physiological membrane potentials. By contrast, little is known about the actions of inhibitors on the function of TRPM8. We investigated the chemical and thermal modulation of TRPM8 in transfected HEK293 cells and in cold-sensitive primary sensory neurons. We show that cold-evoked TRPM8 responses are effectively suppressed by inhibitor compounds SKF96365, 4-(3-chloro-pyridin-2-yl)-piperazine-1-carboxylic acid (4-tert-butyl-phenyl)-amide (BCTC) and 1,10-phenanthroline. These antagonists exert their effect by shifting the voltage dependence of TRPM8 activation towards more positive potentials. An opposite shift towards more negative potentials is achieved by the agonist menthol. Functionally, the bidirectional shift in channel gating translates into a change in the apparent temperature threshold of TRPM8-expressing cells. Accordingly, in the presence of the antagonist compounds, the apparent response-threshold temperature of TRPM8 is displaced towards colder temperatures, whereas menthol sensitizes the response, shifting the threshold in the opposite direction. Co-application of agonists and antagonists produces predictable cancellation of these effects, suggesting the convergence on a common molecular process. The potential for half maximal activation of TRPM8 activation by cold was approximately 140 mV more negative in native channels compared to recombinant channels, with a much higher open probability at negative membrane potentials in the former. In functional terms, this difference translates

  20. Upregulated Expression of Transient Receptor Potential Cation Channel Subfamily V Receptors in Mucosae of Patients with Oral Squamous Cell Carcinoma and Patients with a History of Alcohol Consumption or Smoking.

    Science.gov (United States)

    Sakakibara, Akiko; Sakakibara, Shunsuke; Kusumoto, Junya; Takeda, Daisuke; Hasegawa, Takumi; Akashi, Masaya; Minamikawa, Tsutomu; Hashikawa, Kazunobu; Terashi, Hiroto; Komori, Takahide

    2017-01-01

    Transient receptor potential cation channel (subfamily V, members 1-4) (TRPV1-4) are expressed in skin and neurons and activated by external stimuli in normal mucosae of all oral cavity sites. The oral cavity is exposed to various stimuli, including temperature, mechanical stimuli, chemical substances, and changes in pH, and, notably, the risk factors for oncogenic transformation in oral squamous epithelium are the same as the external stimuli received by TRPV1-4 receptors. Hence, we examined the relationship between oral squamous cell carcinoma (SCC) and TRPV1-4 expression. Oral SCC patients (n = 37) who underwent surgical resection were included in this study. We investigated the expression of TRPV1-4 by immunohistochemical staining and quantification of TRPV1-4 mRNA in human oral mucosa. In addition, we compared the TRPV1-4 levels in mucosa from patients with SCC to those in normal oral mucosa. The receptors were expressed in oral mucosa at all sites (tongue, buccal mucosa, gingiva, and oral floor) and the expression was stronger in epithelia from patients with SCC than in normal epithelia. Furthermore, alcohol consumption and tobacco use were strongly associated with the occurrence of oral cancer and were found to have a remarkable influence on TRPV1-4 receptor expression in normal oral mucosa. In particular, patients with a history of alcohol consumption demonstrated significantly higher expression levels. Various external stimuli may influence the behavior of cancer cells. Overexpression of TRPV1-4 is likely to be a factor in enhanced sensitivity to external stimuli. These findings could contribute to the establishment of novel strategies for cancer therapy or prevention.

  1. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  2. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  3. C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

    Science.gov (United States)

    Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

    2013-09-01

    Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

  4. Evidence for the functional involvement of members of the TRP channel family in the uptake of Na(+) and NH4 (+) by the ruminal epithelium.

    Science.gov (United States)

    Rosendahl, Julia; Braun, Hannah S; Schrapers, Katharina T; Martens, Holger; Stumpff, Friederike

    2016-08-01

    Large quantities of protein are degraded in the fermentative parts of the gut to ammonia, which is absorbed, detoxified to urea, and excreted, leading to formation of nitrogenous compounds such as N2O that are associated with global warming. In ruminants, channel-mediated uptake of NH4 (+) from the rumen predominates. The molecular identity of these channels remains to be clarified. Ruminal cells and epithelia from cows and sheep were investigated using patch clamp, Ussing chamber, microelectrode techniques, and qPCR. In patch clamp experiments, bovine ruminal epithelial cells expressed a conductance for NH4 (+) that could be blocked in a voltage-dependent manner by divalent cations. In the native epithelium, NH4 (+) depolarized the apical potential, acidified the cytosol and induced a rise in short-circuit current (I sc) that persisted after the removal of Na(+), was blocked by verapamil, enhanced by the removal of divalent cations, and was sensitive to certain transient receptor potential (TRP) channel modulators. Menthol or thymol stimulated the I sc in Na(+) or NH4 (+) containing solutions in a dose-dependent manner and modulated transepithelial Ca(2+) fluxes. On the level of messenger RNA (mRNA), ovine and bovine ruminal epithelium expressed TRPA1, TRPV3, TRPV4, TRPM6, and TRPM7, with any expression of TRPV6 marginal. No bands were detected for TRPV1, TRPV5, or TRPM8. Functional and molecular biological data suggest that the transport of NH4 (+), Na(+), and Ca(2+) across the rumen involves TRP channels, with TRPV3 and TRPA1 emerging as prime candidate genes. TRP channels may also contribute to the transport of NH4 (+) across other epithelia.

  5. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    Science.gov (United States)

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  6. Anion channels: master switches of stress responses.

    Science.gov (United States)

    Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar

    2012-04-01

    During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. TRP channels in kidney disease.

    NARCIS (Netherlands)

    Hsu, Y.J.; Hoenderop, J.G.J.; Bindels, R.J.M.

    2007-01-01

    Mammalian TRP channel proteins form six-transmembrane cation-permeable channels that may be grouped into six subfamilies on the basis of amino acid sequence homology (TRPC, TRPV, TRPM, TRPA, TRPP, and TRPML). Recent studies of TRP channels indicate that they are involved in numerous fundamental cell

  8. Two new octahedral/pyramidal frameworks containing both cation channels and lone-pair channels: syntheses and structures of Ba2MnIIMn2III(SeO3)6 and PbFe2(SeO3)4

    International Nuclear Information System (INIS)

    Johnston, Magnus G.; Harrison, William T.A.

    2004-01-01

    The hydrothermal syntheses, single crystal structures, and some properties of Ba 2 Mn II Mn 2 III (SeO 3 ) 6 and PbFe 2 (SeO 3 ) 4 are reported. These related phases contain three-dimensional frameworks of vertex (FeO 6 ) and vertex/edge linked (MnO 6 ) octahedra and SeO 3 pyramids. In each case, the MO 6 /SeO 3 framework encloses two types of 8 ring channels, one of which encapsulates the extra-framework cations and one of which provides space for the Se IV lone pairs. Crystal data: Ba 2 Mn 3 (SeO 3 ) 6 , M r =1201.22, monoclinic, P2 1 /c (No. 14), a=5.4717 (3)A, b=9.0636 (4)A, c=17.6586 (9)A, β=94.519 (1) o , V=873.03 (8)A 3 , Z=2, R(F)=0.031, wR(F 2 )=0.070; PbFe 2 (SeO 3 ) 4 , M r =826.73, triclinic, P1-bar (No. 2), a=5.2318 (5)A, b=6.7925 (6)A, c=7.6445 (7)A, α=94.300 (2) o , β=90.613 (2) o , γ=95.224 (2) o , V=269.73 (4)A 3 , Z=1, R(F)=0.051, wR(F 2 )=0.131

  9. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  10. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  11. Isomerization of propargyl cation to cyclopropenyl cation ...

    Indian Academy of Sciences (India)

    step) for isomeri- zation of the linear propargyl cation to ..... C3, C4 and C5. The ZPE corrections in each case are derived from the. B3LYP calculations. ..... the converse of which gives the relative capacity of the. LPD's to stabilize TS6 with respect ...

  12. MITOCHONDRIAL BKCa CHANNEL

    Directory of Open Access Journals (Sweden)

    Enrique eBalderas

    2015-03-01

    Full Text Available Since its discovery in a glioma cell line 15 years ago, mitochondrial BKCa channel (mitoBKCa has been studied in brain cells and cardiomyocytes sharing general biophysical properties such as high K+ conductance (~300 pS, voltage-dependency and Ca2+-sensitivity. Main advances in deciphering the molecular composition of mitoBKCa have included establishing that it is encoded by the Kcnma1 gene, that a C-terminal splice insert confers mitoBKCa ability to be targeted to cardiac mitochondria, and evidence for its potential coassembly with β subunits. Notoriously, β1 subunit directly interacts with cytochrome c oxidase and mitoBKCa can be modulated by substrates of the respiratory chain. mitoBKCa channel has a central role in protecting the heart from ischemia, where pharmacological activation of the channel impacts the generation of reactive oxygen species and mitochondrial Ca2+ preventing cell death likely by impeding uncontrolled opening of the mitochondrial transition pore. Supporting this view, inhibition of mitoBKCa with Iberiotoxin, enhances cytochrome c release from glioma mitochondria. Many tantalizing questions remain. Some of them are: how is mitoBKCa coupled to the respiratory chain? Does mitoBKCa play non-conduction roles in mitochondria physiology? Which are the functional partners of mitoBKCa? What are the roles of mitoBKCa in other cell types? Answers to these questions are essential to define the impact of mitoBKCa channel in mitochondria biology and disease.

  13. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  14. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  15. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  16. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  17. TRP channels: an overview

    DEFF Research Database (Denmark)

    Pedersen, Stine Falsig; Owsianik, Grzegorz; Nilius, Bernd

    2005-01-01

    The TRP ("transient receptor potential") family of ion channels now comprises more than 30 cation channels, most of which are permeable for Ca2+, and some also for Mg2+. On the basis of sequence homology, the TRP family can be divided in seven main subfamilies: the TRPC ('Canonical') family......, the TRPV ('Vanilloid') family, the TRPM ('Melastatin') family, the TRPP ('Polycystin') family, the TRPML ('Mucolipin') family, the TRPA ('Ankyrin') family, and the TRPN ('NOMPC') family. The cloning and characterization of members of this cation channel family has exploded during recent years, leading...... to a plethora of data on the roles of TRPs in a variety of tissues and species, including mammals, insects, and yeast. The present review summarizes the most pertinent recent evidence regarding the structural and functional properties of TRP channels, focusing on the regulation and physiology of mammalian TRPs....

  18. PIP2 mediates functional coupling and pharmacology of neuronal KCNQ channels

    DEFF Research Database (Denmark)

    Kim, Robin Y; Pless, Stephan A; Kurata, Harley T

    2017-01-01

    Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation. To elucid......Retigabine (RTG) is a first-in-class antiepileptic drug that suppresses neuronal excitability through the activation of voltage-gated KCNQ2-5 potassium channels. Retigabine binds to the pore-forming domain, causing a hyperpolarizing shift in the voltage dependence of channel activation....... These findings reveal an important role for PIP2 in coupling retigabine binding to altered VSD function. We identify a polybasic motif in the proximal C terminus of retigabine-sensitive KCNQ channels that contributes to VSD-pore coupling via PIP2, and thereby influences the unique gating effects of retigabine....

  19. Molecular basis of inhibition of acid sensing ion channel 1A by diminazene.

    Directory of Open Access Journals (Sweden)

    Aram J Krauson

    Full Text Available Acid-sensing ion channels (ASICs are trimeric proton-gated cation permeable ion channels expressed primarily in neurons. Here we employed site-directed mutagenesis and electrophysiology to investigate the mechanism of inhibition of ASIC1a by diminazene. This compound inhibits mouse ASIC1a with a half-maximal inhibitory concentration (IC50 of 2.4 μM. At first, we examined whether neutralizing mutations of Glu79 and Glu416 alter diminazene block. These residues form a hexagonal array in the lower palm domain that was previously shown to contribute to pore opening in response to extracellular acidification. Significantly, single Gln substitutions at positions 79 and 416 in ASIC1a reduced diminazene apparent affinity by 6-7 fold. This result suggests that diminazene inhibits ASIC1a in part by limiting conformational rearrangement in the lower palm domain. Because diminazene is charged at physiological pHs, we assessed whether it inhibits ASIC1a by blocking the ion channel pore. Consistent with the notion that diminazene binds to a site within the membrane electric field, diminazene block showed a strong dependence with the membrane potential. Moreover, a Gly to Ala mutation at position 438, in the ion conduction pathway of ASIC1a, increased diminazene IC50 by one order of magnitude and eliminated the voltage dependence of block. Taken together, our results indicate that the inhibition of ASIC1a by diminazene involves both allosteric modulation and blocking of ion flow through the conduction pathway. Our findings provide a foundation for the development of more selective and potent ASIC pore blockers.

  20. Cation Exchange Water Softeners

    Science.gov (United States)

    WaterSense released a notice of intent to develop a specification for cation exchange water softeners. The program has made the decision not to move forward with a spec at this time, but is making this information available.

  1. Regulation of sodium channel function by bilayer elasticity: the importance of hydrophobic coupling. Effects of Micelle-forming amphiphiles and cholesterol

    DEFF Research Database (Denmark)

    Lundbæk, Jens August; Birn, Pia; Hansen, Anker J

    2004-01-01

    , Triton X-100, and reduced Triton X-100) that make lipid bilayers less "stiff", as measured using gA channels, shift the voltage dependence of sodium channel inactivation toward more hyperpolarized potentials. At low amphiphile concentration, the magnitude of the shift is linearly correlated to the change...

  2. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  3. Inactivation of Mechanically Activated Piezo1 Ion Channels Is Determined by the C-Terminal Extracellular Domain and the Inner Pore Helix

    Directory of Open Access Journals (Sweden)

    Jason Wu

    2017-11-01

    Full Text Available Piezo proteins form mechanically activated ion channels that are responsible for our sense of light touch, proprioception, and vascular blood flow. Upon activation by mechanical stimuli, Piezo channels rapidly inactivate in a voltage-dependent manner through an unknown mechanism. Inactivation of Piezo channels is physiologically important, as it modulates overall mechanical sensitivity, gives rise to frequency filtering of repetitive mechanical stimuli, and is itself the target of numerous human disease-related channelopathies that are not well understood mechanistically. Here, we identify the globular C-terminal extracellular domain as a structure that is sufficient to confer the time course of inactivation and a single positively charged lysine residue at the adjacent inner pore helix as being required for its voltage dependence. Our results are consistent with a mechanism for inactivation that is mediated through voltage-dependent conformations of the inner pore helix and allosteric coupling with the C-terminal extracellular domain.

  4. Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

    Directory of Open Access Journals (Sweden)

    Aldo A Rodríguez Menchaca

    2012-09-01

    Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

  5. Cation radicals of xanthophylls.

    Science.gov (United States)

    Galinato, Mary Grace I; Niedzwiedzki, Dariusz; Deal, Cailin; Birge, Robert R; Frank, Harry A

    2007-10-01

    Carotenes and xanthophylls are well known to act as electron donors in redox processes. This ability is thought to be associated with the inhibition of oxidative reactions in reaction centers and light-harvesting pigment-protein complexes of photosystem II (PSII). In this work, cation radicals of neoxanthin, violaxanthin, lutein, zeaxanthin, beta-cryptoxanthin, beta-carotene, and lycopene were generated in solution using ferric chloride as an oxidant and then studied by absorption spectroscopy. The investigation provides a view toward understanding the molecular features that determine the spectral properties of cation radicals of carotenoids. The absorption spectral data reveal a shift to longer wavelength with increasing pi-chain length. However, zeaxanthin and beta-cryptoxanthin exhibit cation radical spectra blue-shifted compared to that of beta-carotene, despite all of these molecules having 11 conjugated carbon-carbon double bonds. CIS molecular orbital theory quantum computations interpret this effect as due to the hydroxyl groups in the terminal rings selectively stabilizing the highest occupied molecular orbitals of preferentially populated s-trans-isomers. The data are expected to be useful in the analysis of spectral results from PSII pigment-protein complexes seeking to understand the role of carotene and xanthophyll cation radicals in regulating excited state energy flow, in protecting PSII reaction centers against photoinhibition, and in dissipating excess light energy absorbed by photosynthetic organisms but not used for photosynthesis.

  6. Identifi cation of Sectarianism

    Directory of Open Access Journals (Sweden)

    Martinovich Vladimir

    2016-03-01

    Full Text Available «New religious movements and society» is traditionally one of the most sophisticated topics in the area of new religions studies. Its problem field is so huge that up to now by far not all important research themes where even touched by scientists from all over the world. The problem of the process of the identification of sectarianism by diff erent societal institutions is one of such untouched themes that is taken as the main subject of this article. This process by itself is an inseparable part of the every societal deliberate reaction to the very existence of unconventional religiosity, its unstructured and mainly structured types. The focal point of the article is step-by-step analysis of the general structure elements of the process of the identification of sectarianism without any reference to the specific time and place of its flow. Special attention is paid to the analysis of the subjects of the identification of sectarianism, to the criteria for religious groups to be qualified as new religious movements, and to the specific features of the process of documents filtration. The causes of selective perception of sectarianism are disclosed. Some main consequences and unpredictable outcomes of the process of the identification of sectarianism are described.

  7. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  8. Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-01

    Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

  9. Calcium channel blockers ameliorate iron overload-associated hepatic fibrosis by altering iron transport and stellate cell apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ying [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Department of Pathology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Chinese Medicine Research on Cardio-Cerebrovascular Disease, Shijiazhuang 050200, Hebei (China); Zhao, Xin [Department of Hepatobiliary Surgery, The Third Hospital of Hebei Medical University, Shijiazhuang 050051, Hebei (China); Chang, Yanzhong [Laboratory of Molecular Iron Metabolism, College of Life Science, Hebei Normal University, Shijiazhuang 050024, Hebei (China); Zhang, Yuanyuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Xi [Department of Pharmacy, The Forth Hospital of Hebei Medical University, Shijiazhuang 050011, Hebei (China); Zhang, Xuan [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Liu, Zhenyi; Guo, Hui [Department of Medicinal Chemistry, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Wang, Na [Department of Physiology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Gao, Yonggang [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Zhang, Jianping, E-mail: zhangjianping14@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Chu, Li, E-mail: chuli0614@126.com [Department of Pharmacology, Hebei University of Chinese Medicine, Shijiazhuang 050200, Hebei (China); Hebei Key Laboratory of Integrative Medicine on Liver-Kidney Patterns, Shijiazhuang 050200, Hebei (China)

    2016-06-15

    Liver fibrosis is the principal cause of morbidity and mortality in patients with iron overload. Calcium channel blockers (CCBs) can antagonize divalent cation entry into renal and myocardial cells and inhibit fibrogenic gene expression. We investigated the potential of CCBs to resolve iron overload-associated hepatic fibrosis. Kunming mice were assigned to nine groups (n = 8 per group): control, iron overload, deferoxamine, high and low dose verapamil, high and low dose nimodipine, and high and low dose diltiazem. Iron deposition and hepatic fibrosis were measured in mouse livers. Expression levels of molecules associated with transmembrane iron transport were determined by molecular biology approaches. In vitro HSC-T6 cells were randomized into nine groups (the same groups as the mice). Changes in proliferation, apoptosis, and metalloproteinase expression in cells were detected to assess the anti-fibrotic effects of CCBs during iron overload conditions. We found that CCBs reduced hepatic iron content, intracellular iron deposition, the number of hepatic fibrotic areas, collagen expression levels, and hydroxyproline content. CCBs rescued abnormal expression of α1C protein in L-type voltage-dependent calcium channel (LVDCC) and down-regulated divalent metal transporter-1 (DMT-1) expression in mouse livers. In iron-overloaded HSC-T6 cells, CCBs reduced iron deposition, inhibited proliferation, induced apoptosis, and elevated expression of matrix metalloproteinase-13 (MMP-13) and tissue inhibitor of metalloproteinase-1 (TIMP-1). CCBs are potential therapeutic agents that can be used to address hepatic fibrosis during iron overload. They resolve hepatic fibrosis probably correlated with regulating transmembrane iron transport and inhibiting HSC growth. - Highlights: • Calcium channel blockers (CCBs) reduced hepatic iron content. • CCBs decreased hepatic fibrotic areas and collagen expression levels. • CCBs resolve fibrosis by regulating iron transport and

  10. ‘Sleepy’ inward rectifier channels in guinea-pig cardiomyocytes are activated only during strong hyperpolarization

    Science.gov (United States)

    Liu, Gong Xin; Daut, Jürgen

    2002-01-01

    K+ channels of isolated guinea-pig cardiomyocytes were studied using the patch-clamp technique. At transmembrane potentials between −120 and −220 mV we observed inward currents through an apparently novel channel. The novel channel was strongly rectifying, no outward currents could be recorded. Between −200 and −160 mV it had a slope conductance of 42.8 ± 3.0 pS (s.d.; n = 96). The open probability (Po) showed a sigmoid voltage dependence and reached a maximum of 0.93 at −200 mV, half-maximal activation was approximately −150 mV. The voltage dependence of Po was not affected by application of 50 μm isoproterenol. The open-time distribution could be described by a single exponential function, the mean open time ranged between 73.5 ms at −220 mV and 1.4 ms at −160 mV. At least two exponential components were required to fit the closed time distribution. Experiments with different external Na+, K+ and Cl− concentrations suggested that the novel channel is K+ selective. Extracellular Ba2+ ions gave rise to a voltage-dependent reduction in Po by inducing long closed states; Cs+ markedly reduced mean open time at −200 mV. In cell-attached recordings the novel channel frequently converted to a classical inward rectifier channel, and vice versa. This conversion was not voltage dependent. After excision of the patch, the novel channel always converted to a classical inward rectifier channel within 0–3 min. This conversion was not affected by intracellular Mg2+, phosphatidylinositol (4,5)-bisphosphate or spermine. Taken together, our findings suggest that the novel K+ channel represents a different ‘mode’ of the classical inward rectifier channel in which opening occurs only at very negative potentials. PMID:11897847

  11. Photodissociation of spatially aligned acetaldehyde cations.

    Science.gov (United States)

    Lee, Suk Kyoung; Silva, Ruchira; Kim, Myung Hwa; Shen, Lei; Suits, Arthur G

    2007-07-26

    Photofragment translational energy and angular distributions are reported for the photodissociation of acetaldehyde cations in the wavelength range 354-363 nm obtained using the DC slice ion imaging technique. Vibrationally selected parent ions were produced by 2+1 resonance-enhanced multiphoton ionization (REMPI) via the 3sCH3CO+, and CH4+. The angular distributions reveal that all product channels have a predominantly parallel recoil anisotropy although the lower beta2 parameter of CH3CO+ indicates the concomitant presence of a perpendicular component. Furthermore, the distinct angular distribution of the CH3CO+ fragments shows a large value of the higher order Legendre polynomial term, providing evidence that acetaldehyde cations are spatially aligned during the ionization process.

  12. C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

    Science.gov (United States)

    Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

    2014-04-01

    Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages

  13. A negative charge in transmembrane segment 1 of domain II of the cockroach sodium channel is critical for channel gating and action of pyrethroid insecticides

    International Nuclear Information System (INIS)

    Du Yuzhe; Song Weizhong; Groome, James R.; Nomura, Yoshiko; Luo Ningguang; Dong Ke

    2010-01-01

    Voltage-gated sodium channels are the primary target of pyrethroids, an important class of synthetic insecticides. Pyrethroids bind to a distinct receptor site on sodium channels and prolong the open state by inhibiting channel deactivation and inactivation. Recent studies have begun to reveal sodium channel residues important for pyrethroid binding. However, how pyrethroid binding leads to inhibition of sodium channel deactivation and inactivation remains elusive. In this study, we show that a negatively charged aspartic acid residue at position 802 (D802) located in the extracellular end of transmembrane segment 1 of domain II (IIS1) is critical for both the action of pyrethroids and the voltage dependence of channel activation. Charge-reversing or -neutralizing substitutions (K, G, or A) of D802 shifted the voltage dependence of activation in the depolarizing direction and reduced channel sensitivity to deltamethrin, a pyrethroid insecticide. The charge-reversing mutation D802K also accelerated open-state deactivation, which may have counteracted the inhibition of sodium channel deactivation by deltamethrin. In contrast, the D802G substitution slowed open-state deactivation, suggesting an additional mechanism for neutralizing the action of deltamethrin. Importantly, Schild analysis showed that D802 is not involved in pyrethroid binding. Thus, we have identified a sodium channel residue that is critical for regulating the action of pyrethroids on the sodium channel without affecting the receptor site of pyrethroids.

  14. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

    Science.gov (United States)

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

    2017-08-29

    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  15. Is there a role for T-type Ca2+ channels in regulation of vasomotor tone in mesenteric arterioles?

    DEFF Research Database (Denmark)

    Jensen, Lars Jørn; Holstein-Rathlou, Niels-Henrik

    2009-01-01

    The largest peripheral blood pressure drop occurs in terminal arterioles (microm lumen diameter). L-type voltage-dependent Ca2+ channels (VDCCs) are considered the primary pathway for Ca2+ influx during physiologic activation of vascular smooth muscle cells (VSMC). Recent evidence suggests...... was predominantly expressed in endothelial cells. Voltage-dependent Ca2+ entry was inhibited by the new specific T-type blockers R(-)-efonidipine and NNC 55-0396. The effect of NNC 55-0396 persisted in depolarized arterioles, suggesting an unusually high activation threshold of mesenteric T-type channels. T...... that T-type VDCCs are expressed in renal afferent and efferent arterioles, mesenteric arterioles, and skeletal muscle arterioles. T-type channels are small-conductance, low voltage-activated, fast-inactivating channels. Thus, their role in supplying Ca2+ for contraction of VSMC has been disputed. However...

  16. The temperature dependence of the BK channel activity - kinetics, thermodynamics, and long-range correlations.

    Science.gov (United States)

    Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J

    2017-10-01

    Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The electrically silent Kv6.4 subunit confers hyperpolarized gating charge movement in Kv2.1/Kv6.4 heterotetrameric channels.

    Directory of Open Access Journals (Sweden)

    Elke Bocksteins

    Full Text Available The voltage-gated K(+ (Kv channel subunit Kv6.4 does not form functional homotetrameric channels but co-assembles with Kv2.1 to form functional Kv2.1/Kv6.4 heterotetrameric channels. Compared to Kv2.1 homotetramers, Kv6.4 exerts a ~40 mV hyperpolarizing shift in the voltage-dependence of Kv2.1/Kv6.4 channel inactivation, without a significant effect on activation gating. However, the underlying mechanism of this Kv6.4-induced modulation of Kv2.1 channel inactivation, and whether the Kv6.4 subunit participates in the voltage-dependent gating of heterotetrameric channels is not well understood. Here we report distinct gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels, compared to Kv2.1 homotetramers, as revealed by gating current recordings from mammalian cells expressing these channels. The gating charge movement of Kv2.1/Kv6.4 heterotetrameric channels displayed an extra component around the physiological K(+ equilibrium potential, characterized by a second sigmoidal relationship of the voltage-dependence of gating charge movement. This distinct gating charge displacement reflects movement of the Kv6.4 voltage-sensing domain and has a voltage-dependency that matches the hyperpolarizing shift in Kv2.1/Kv6.4 channel inactivation. These results provide a mechanistic basis for the modulation of Kv2.1 channel inactivation gating kinetics by silent Kv6.4 subunits.

  18. Lycopene depresses glutamate release through inhibition of voltage-dependent Ca2+ entry and protein kinase C in rat cerebrocortical nerve terminals.

    Science.gov (United States)

    Lu, Cheng-Wei; Hung, Chi-Feng; Jean, Wei-Horng; Lin, Tzu-Yu; Huang, Shu-Kuei; Wang, Su-Jane

    2018-05-01

    Lycopene is a natural dietary carotenoid that was reported to exhibit a neuroprotective profile. Considering that excitotoxicity and cell death induced by glutamate are involved in many brain disorders, the effect of lycopene on glutamate release in rat cerebrocortical nerve terminals and the possible mechanism involved in such effect was investigated. We observed here that lycopene inhibited 4-aminopyridine (4-AP)-evoked glutamate release and intrasynaptosomal Ca 2+ concentration elevation. The inhibitory effect of lycopene on 4-AP-evoked glutamate release was markedly reduced in the presence of the Ca v 2.2 (N-type) and Ca v 2.1 (P/Q-type) channel blocker ω-conotoxin MVIIC, but was insensitive to the intracellular Ca 2+ -release inhibitors dantrolene and CGP37157. Furthermore, in the presence of the protein kinase C inhibitors GF109203X and Go6976, the action of lycopene on evoked glutamate release was prevented. These results are the first to suggest that lycopene inhibits glutamate release from rat cortical synaptosomes by suppressing presynaptic Ca 2+ entry and protein kinase C activity.

  19. Electrochemical behavior of two and one electron redox systems adsorbed on to micro- and mesoporous silicate materials: Influence of the channels and the cationic environment of the host materials

    International Nuclear Information System (INIS)

    Senthil Kumar, K.; Natarajan, P.

    2009-01-01

    Electrochemical behavior of two electron redox system, phenosafranine (PS + ) adsorbed on to micro- and mesoporous materials is investigated by cyclic voltammetry and differential pulse voltammetry using modified micro- and mesoporous host electrodes. Two redox peaks were observed when phenosafranine is adsorbed on the surface of microporous materials zeolite-Y and ZSM-5. However, only a single redox peak was observed in the modified electrode with phenosafranine encapsulated into the mesoporous material MCM-41 and when adsorbed on the external surface of silica. The observed redox peaks for the modified electrodes with zeolite-Y and ZSM-5 host are suggested to be primarily due to consecutive two electron processes. The peak separation ΔE and peak potential of phenosafranine adsorbed on zeolite-Y and ZSM-5 were found to be influenced by the pH of the electrolyte solution. The variation of the peak current in the cyclic voltammogram and differential pulse voltammetry with scan rate shows that electrodic processes are controlled by the nature of the surface of the host material. The heterogeneous electron transfer rate constants for phenosafranine adsorbed on to micro- and mesoporous materials were calculated using the Laviron model. Higher rate constant observed for the dye encapsulated into the MCM-41 indicates that the one-dimensional channel of the mesoporous material provides a more facile micro-environment for phenosafranine for the electron transfer reaction as compared to the microporous silicate materials. The stability of the modified electrode surface was investigated by multisweep cyclic voltammetry.

  20. Evolutionary origins of mechanosensitive ion channels.

    Science.gov (United States)

    Martinac, Boris; Kloda, Anna

    2003-01-01

    According to the recent revision, the universal phylogenetic tree is composed of three domains: Eukarya (eukaryotes), Bacteria (eubacteria) and Archaea (archaebacteria). Mechanosensitive (MS) ion channels have been documented in cells belonging to all three domains suggesting their very early appearance during evolution of life on Earth. The channels show great diversity in conductance, selectivity and voltage dependence, while sharing the property of being gated by mechanical stimuli exerted on cell membranes. In prokaryotes, MS channels were first documented in Bacteria followed by their discovery in Archaea. The finding of MS channels in archaeal cells helped to recognize and establish the evolutionary relationship between bacterial and archaeal MS channels and to show that this relationship extends to eukaryotic Fungi (Schizosaccharomyces pombe) and Plants (Arabidopsis thaliana). Similar to their bacterial and archaeal homologues, MS channels in eukaryotic cell-walled Fungi and Plants may serve in protecting the cellular plasma membrane from excessive dilation and rupture that may occur during osmotic stress. This review summarizes briefly some of the recent developments in the MS channel research field that may ultimately lead to elucidation of the biophysical and evolutionary principles underlying the mechanosensory transduction in living cells.

  1. [Compared Markov with fractal models by using single-channel experimental and simulation data].

    Science.gov (United States)

    Lan, Tonghan; Wu, Hongxiu; Lin, Jiarui

    2006-10-01

    The gating mechanical kinetical of ion channels has been modeled as a Markov process. In these models it is assumed that the channel protein has a small number of discrete conformational states and kinetic rate constants connecting these states are constant, the transition rate constants among the states is independent both of time and of the previous channel activity. It is assumed in Liebovitch's fractal model that the channel exists in an infinite number of energy states, consequently, transitions from one conductance state to another would be governed by a continuum of rate constants. In this paper, a statistical comparison is presented of Markov and fractal models of ion channel gating, the analysis is based on single-channel data from ion channel voltage-dependence K+ single channel of neuron cell and simulation data from three-states Markov model.

  2. Sorption by cation exchange

    International Nuclear Information System (INIS)

    Bradbury, M.H.; Baeyens, B.

    1994-04-01

    A procedure for introducing exchange into geochemical/surface complexation codes is described. Beginning with selectivity coefficients, K c , defined in terms of equivalent fractional ion occupancies, a general expression for the molar based exchange code input parameters, K ex , is derived. In natural systems the uptake of nuclides onto complex sorbents often occurs by more than one mechanism. The incorporation of cation exchange and surface complexation into a geochemical code therefore enables sorption by both mechanisms to be calculated simultaneously. The code and model concepts are tested against sets of experimental data from widely different sorption studies. A proposal is made to set up a data base of selectivity coefficients. Such a data base would form part of a more general one consisting of sorption mechanism specific parameters to be used in conjunction with geochemical/sorption codes to model and predict sorption. (author) 6 figs., 6 tabs., 26 refs

  3. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Molecular and kinetic determinants of local anaesthetic action on sodium channels.

    Science.gov (United States)

    French, R J; Zamponi, G W; Sierralta, I E

    1998-11-23

    (1) Local anaesthetics (LA) rely for their clinical actions on state-dependent inhibition of voltage-dependent sodium channels. (2) Single, batrachoxin-modified sodium channels in planar lipid bilayers allow direct observation of drug-channel interactions. Two modes of inhibition of single-channel current are observed: fast block of the open channels and prolongation of a long-lived closed state, some of whose properties resemble those of the inactivated state of unmodified channels. (3) Analogues of different parts of the LA molecule separately mimic each blocking mode: amines--fast block, and water-soluble aromatics--closed state prolongation. (4) Interaction between a mu-conotoxin derivative and diethylammonium indicate an intrapore site of fast, open-state block. (5) Site-directed mutagenesis studies suggest that hydrophobic residues in transmembrane segment 6 of repeat domain 4 of sodium channels are critical for both LA binding and stabilization of the inactivated state.

  5. Differential Effects of TRPA and TRPV Channels on Behaviors of

    Directory of Open Access Journals (Sweden)

    Jennifer Thies

    2016-01-01

    Full Text Available TRPA and TRPV ion channels are members of the transient receptor potential (TRP cation channel superfamily, which mediates various sensory transductions. In Caenorhabditis elegans , the TRPV channels are known to affect chemosensation, while the TRPA-1 channel is associated with thermosensation and mechanosensation. We examined thermosensation, chemosensation, and osmosensation in strains lacking TRPA-1 or TRPV channels. We found that TRPV channel knockout worms exhibited similar behavioral deficits associated with thermotaxis as the TRPA-1 channel knockout, suggesting a dual role for TRPV channels. In contrast, chemosensation responses, assessed by both avoidance reversal behavior and NaCl osmosensation, were dependent on TRPV channels but seemed independent of TRPA-1 channel. Our findings suggest that, in addition to TRPA-1 channel, TRPV channels are necessary for thermotaxis and may activate, or modulate, the function of TRPA-1 channels. In contrast, TRPA-1 channels do not have a dual responsibility, as they have no functional role in odorant avoidance or osmosensation.

  6. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations.

    Science.gov (United States)

    Ratheal, Ian M; Virgin, Gail K; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-10-26

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na(+) ions for two extracellular K(+) ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na(+) or K(+); site III binds only Na(+)) are poorly understood. We studied cation selectivity by outward-facing sites (high K(+) affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium(+), methylguanidinium(+), and aminoguanidinium(+) produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K(+), and (ii) induction of pump-mediated, guanidinium-derivative-carried inward current at negative potentials without Na(+) and K(+). In contrast, formamidinium(+) and acetamidinium(+) induced K(+)-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K(+) congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li(+) induced Na(+)-like VDI, whereas all metals tested except Na(+) induced K(+)-like outward currents. Pump-mediated K(+)-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium(+) derivatives suggest that Na(+) binds to site III in a hydrated form and that the inward current observed without external Na(+) and K(+) represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites.

  7. Cationic polymers and porous materials

    KAUST Repository

    Han, Yu

    2017-04-27

    According to one or more embodiments, cationic polymers may be produced which include one or more monomers containing cations. Such cationic polymers may be utilized as structure directing agents to form mesoporous zeolites. The mesoporous zeolites may include micropores as well as mesopores, and may have a surface area of greater than 350 m2/g and a pore volume of greater than 0.3 cm3/g. Also described are core/shell zeolites, where at least the shell portion includes a mesoporous zeolite material.

  8. Cationic polymers and porous materials

    KAUST Repository

    Han, Yu; Tian, Qiwei; Dong, Xinglong; Liu, Zhaohui; Basset, Jean-Marie; Saih, Youssef; Sun, Miao; Xu, Wei; Shaikh, Sohel

    2017-01-01

    According to one or more embodiments, cationic polymers may be produced which include one or more monomers containing cations. Such cationic polymers may be utilized as structure directing agents to form mesoporous zeolites. The mesoporous zeolites may include micropores as well as mesopores, and may have a surface area of greater than 350 m2/g and a pore volume of greater than 0.3 cm3/g. Also described are core/shell zeolites, where at least the shell portion includes a mesoporous zeolite material.

  9. The cation-π interaction.

    Science.gov (United States)

    Dougherty, Dennis A

    2013-04-16

    The chemistry community now recognizes the cation-π interaction as a major force for molecular recognition, joining the hydrophobic effect, the hydrogen bond, and the ion pair in determining macromolecular structure and drug-receptor interactions. This Account provides the author's perspective on the intellectual origins and fundamental nature of the cation-π interaction. Early studies on cyclophanes established that water-soluble, cationic molecules would forego aqueous solvation to enter a hydrophobic cavity if that cavity was lined with π systems. Important gas phase studies established the fundamental nature of the cation-π interaction. The strength of the cation-π interaction (Li(+) binds to benzene with 38 kcal/mol of binding energy; NH4(+) with 19 kcal/mol) distinguishes it from the weaker polar-π interactions observed in the benzene dimer or water-benzene complexes. In addition to the substantial intrinsic strength of the cation-π interaction in gas phase studies, the cation-π interaction remains energetically significant in aqueous media and under biological conditions. Many studies have shown that cation-π interactions can enhance binding energies by 2-5 kcal/mol, making them competitive with hydrogen bonds and ion pairs in drug-receptor and protein-protein interactions. As with other noncovalent interactions involving aromatic systems, the cation-π interaction includes a substantial electrostatic component. The six (four) C(δ-)-H(δ+) bond dipoles of a molecule like benzene (ethylene) combine to produce a region of negative electrostatic potential on the face of the π system. Simple electrostatics facilitate a natural attraction of cations to the surface. The trend for (gas phase) binding energies is Li(+) > Na(+) > K(+) > Rb(+): as the ion gets larger the charge is dispersed over a larger sphere and binding interactions weaken, a classical electrostatic effect. On other hand, polarizability does not define these interactions. Cyclohexane is

  10. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    International Nuclear Information System (INIS)

    Long, Yan; Lin, Zuoxian; Xia, Menghang; Zheng, Wei; Li, Zhiyuan

    2013-01-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC 50 values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds

  11. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Long, Yan; Lin, Zuoxian [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China); Xia, Menghang; Zheng, Wei [National Center for Advancing Translational Sciences, National Institutes of Health, Bethesda, MD 20892 (United States); Li, Zhiyuan, E-mail: li_zhiyuan@gibh.ac.cn [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China)

    2013-03-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC{sub 50} values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds.

  12. Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

    Science.gov (United States)

    Carvalho-de-Souza, Joao L; Bezanilla, Francisco

    2018-02-05

    Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018

  13. Fusion Pore Diameter Regulation by Cations Modulating Local Membrane Anisotropy

    Directory of Open Access Journals (Sweden)

    Doron Kabaso

    2012-01-01

    Full Text Available The fusion pore is an aqueous channel that is formed upon the fusion of the vesicle membrane with the plasma membrane. Once the pore is open, it may close again (transient fusion or widen completely (full fusion to permit vesicle cargo discharge. While repetitive transient fusion pore openings of the vesicle with the plasma membrane have been observed in the absence of stimulation, their frequency can be further increased using a cAMP-increasing agent that drives the opening of nonspecific cation channels. Our model hypothesis is that the openings and closings of the fusion pore are driven by changes in the local concentration of cations in the connected vesicle. The proposed mechanism of fusion pore dynamics is considered as follows: when the fusion pore is closed or is extremely narrow, the accumulation of cations in the vesicle (increased cation concentration likely leads to lipid demixing at the fusion pore. This process may affect local membrane anisotropy, which reduces the spontaneous curvature and thus leads to the opening of the fusion pore. Based on the theory of membrane elasticity, we used a continuum model to explain the rhythmic opening and closing of the fusion pore.

  14. Simultaneous anionic and cationic redox

    Science.gov (United States)

    Jung, Sung-Kyun; Kang, Kisuk

    2017-12-01

    It is challenging to unlock anionic redox activity, accompanied by full utilization of available cationic redox process, to boost capacity of battery cathodes. Now, material design by tuning the metal-oxygen interaction is shown to be a promising solution.

  15. Computational study of cation substitutions in apatites

    International Nuclear Information System (INIS)

    Tamm, Toomas; Peld, Merike

    2006-01-01

    Density-functional theory plane-wave modeling of fluor- and hydroxyapatites has been performed, where one or two calcium ions per unit cell were replaced with cadmium or zinc cations. It was found that cadmium ions favor Ca(1) positions in fluorapatites and Ca(2) positions in hydroxyapatites, in agreement with experiment. A similar pattern is predicted for zinc substitutions. In the doubly substituted cases, where only hydroxyapatites were modeled, a preference for the substituting ions to be located in Ca(2) position was also observed. Displacement of the hydroxide ions from their symmetrical positions on the hexagonal axis can be used to explain the preferred configurations of substituting ions around the axis. -- Deformation of the hydroxide ion chain due to substitutions around the ion channel in substituted hydroxyapatites

  16. Cation disorder in Ga1212.

    Science.gov (United States)

    Greenwood, K B; Ko, D; Vander Griend, D A; Sarjeant, G M; Milgram, J W; Garrity, E S; DeLoach, D I; Poeppelmeier, K R; Salvador, P A; Mason, T O

    2000-07-24

    Substitution of calcium for strontium in LnSr2-xCaxCu2GaO7 (Ln = La, Pr, Nd, Gd, Ho, Er, Tm, and Yb) materials at ambient pressure and 975 degrees C results in complete substitution of calcium for strontium in the lanthanum and praseodymium systems and partial substitution in the other lanthanide systems. The calcium saturation level depends on the size of the Ln cation, and in all cases, a decrease in the lattice parameters with calcium concentration was observed until a common, lower bound, average A-cation size is reached. Site occupancies from X-ray and neutron diffraction experiments for LnSr2-xCaxCu2GaO7 (x = 0 and x = 2) confirm that the A-cations distribute between the two blocking-layer sites and the active-layer site based on size. A quantitative link between cation distribution and relative site-specific cation enthalpy for calcium, strontium, and lanthanum within the gallate structure is derived. The cation distribution in other similar materials can potentially be modeled.

  17. Liquid-solid extraction of cationic metals by cationic amphiphiles

    International Nuclear Information System (INIS)

    Muller, W.

    2010-01-01

    In the field of selective separation for recycling of spent nuclear fuel, liquid-liquid extraction processes are widely used (PUREX, DIAMEX..) in industrial scale. In order to guarantee a sustainable nuclear energy for the forthcoming generations, alternative reprocessing techniques are under development. One of them bases on the studies from Heckmann et al in the 80's and consists in selectively precipitating actinides from aqueous waste solutions by cationic surfactants (liquid-solid extraction). This technique has some interesting advantages over liquid-liquid extraction techniques, because several steps are omitted like stripping or solvent washing. Moreover, the amount of waste is decreased considerably, since no contaminated organic solvent is produced. In this thesis, we have carried out a physico-chemical study to understand the specific interactions between the metallic cations with the cationic surfactant. First, we have analysed the specific effect of the different counter-ions (Cl - , NO 3 - , C 2 O 4 2- ) and then the effect of alkaline cations on the structural properties of the surfactant aggregation in varying thermodynamical conditions. Finally, different multivalent cations (Cu 2+ , Zn 2+ , UO 2 2+ , Fe 3+ , Nd 3+ , Eu 3+ , Th 4+ ) were considered; we have concluded that depending on the anionic complex of these metals formed in acidic media, we can observe either an adsorption at the micellar interface or not. This adsorption has a large influence of the surfactant aggregation properties and determines the limits of the application in term of ionic strength, temperature and surfactant concentration. (author) [fr

  18. Inhibition of cardiac inward rectifier currents by cationic amphiphilic drugs.

    Science.gov (United States)

    van der Heyden, M A G; Stary-Weinzinger, A; Sanchez-Chapula, J A

    2013-09-01

    Cardiac inward rectifier channels belong to three different classes of the KIR channel protein family. The KIR2.x proteins generate the classical inward rectifier current, IK1, while KIR3 and KIR6 members are responsible for the acetylcholine responsive and ATP sensitive inward rectifier currents IKAch and IKATP, respectively. Aberrant function of these channels has been correlated with severe cardiac arrhythmias, indicating their significant contribution to normal cardiac electrophysiology. A common feature of inward rectifier channels is their dependence on the lipid phosphatidyl-4,5-bisphospate (PIP2) interaction for functional activity. Cationic amphiphilic drugs (CADs) are one of the largest classes of pharmaceutical compounds. Several widely used CADs have been associated with inward rectifier current disturbances, and recent evidence points to interference of the channel-PIP2 interaction as the underlying mechanism of action. Here, we will review how six of these well known drugs, used for treatment in various different conditions, interfere in cardiac inward rectifier functioning. In contrast, KIR channel inhibition by the anionic anesthetic thiopental is achieved by a different mechanism of channel-PIP2 interference. We will discuss the latest basic science insights of functional inward rectifier current characteristics, recently derived KIR channel structures and specific PIP2-receptor interactions at the molecular level and provide insight in how these drugs interfere in the structure-function relationships.

  19. The role of transient receptor potential channels in metabolic syndrome

    DEFF Research Database (Denmark)

    Liu, Daoyan; Zhu, Zhiming; Tepel, Martin

    2008-01-01

    Metabolic syndrome is correlated with increased cardiovascular risk and characterized by several factors, including visceral obesity, hypertension, insulin resistance, and dyslipidemia. Several members of a large family of nonselective cation entry channels, e.g., transient receptor potential (TRP...

  20. KIR channels tune electrical communication in cerebral arteries

    DEFF Research Database (Denmark)

    Sancho, Maria; Samson, Nina C; Hald, Bjorn O

    2017-01-01

    The conducted vasomotor response reflects electrical communication in the arterial wall and the distance signals spread is regulated by three factors including resident ion channels. This study defined the role of inward-rectifying K(+) channels (KIR) in governing electrical communication along...... hamster cerebral arteries. Focal KCl application induced a vasoconstriction that conducted robustly, indicative of electrical communication among cells. Inhibiting dominant K(+) conductances had no attenuating effect, the exception being Ba(2+) blockade of KIR Electrophysiology and Q-PCR analysis...... and the increased feedback arising from voltage-dependent-K(+) channels. In summary, this study shows that two KIR populations work collaboratively to govern electrical communication and the spread of vasomotor responses along cerebral arteries....

  1. A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

    Science.gov (United States)

    Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

    2016-02-25

    Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Homeostatic Presynaptic Plasticity Is Specifically Regulated by P/Q-type Ca2+ Channels at Mammalian Hippocampal Synapses

    OpenAIRE

    Jeans, Alexander F.; van Heusden, Fran C.; Al-Mubarak, Bashayer; Padamsey, Zahid; Emptage, Nigel J.

    2017-01-01

    Voltage-dependent Ca2+ channels (VGCC) represent the principal source of Ca2+ ions driving evoked neurotransmitter release at presynaptic boutons. In mammals, presynaptic Ca2+ influx is mediated mainly via P/Q-type and N-type VGCC, which differ in their properties. Changes in their relative contributions tune neurotransmission both during development and in Hebbian plasticity. However, whether this represents a functional motif also present in other forms of activity-dependent ...

  3. The pan-Kv7 (KCNQ) Channel Opener Retigabine Inhibits Striatal Excitability by Direct Action on Striatal Neurons In Vivo

    DEFF Research Database (Denmark)

    Hansen, Henrik H; Weikop, Pia; Mikkelsen, Maria D

    2017-01-01

    Central Kv7 (KCNQ) channels are voltage-dependent potassium channels composed of different combinations of four Kv7 subunits, being differently expressed in the brain. Notably, striatal dopaminergic neurotransmission is strongly suppressed by systemic administration of the pan-Kv7 channel opener ...... by acute systemic haloperidol administration in the rat. The relative mRNA levels of Kv7 subunits in the rat striatum were found to be Kv7.2 = Kv7.3 = Kv7.5 > >Kv7.4. These data suggest that intrastriatal Kv7 channels play a direct role in regulating striatal excitability in vivo....

  4. Mechanosensitive Piezo Channels in the Gastrointestinal Tract.

    Science.gov (United States)

    Alcaino, C; Farrugia, G; Beyder, A

    2017-01-01

    Sensation of mechanical forces is critical for normal function of the gastrointestinal (GI) tract and abnormalities in mechanosensation are linked to GI pathologies. In the GI tract there are several mechanosensitive cell types-epithelial enterochromaffin cells, intrinsic and extrinsic enteric neurons, smooth muscle cells and interstitial cells of Cajal. These cells use mechanosensitive ion channels that respond to mechanical forces by altering transmembrane ionic currents in a process called mechanoelectrical coupling. Several mechanosensitive ionic conductances have been identified in the mechanosensory GI cells, ranging from mechanosensitive voltage-gated sodium and calcium channels to the mechanogated ion channels, such as the two-pore domain potassium channels K2P (TREK-1) and nonselective cation channels from the transient receptor potential family. The recently discovered Piezo channels are increasingly recognized as significant contributors to cellular mechanosensitivity. Piezo1 and Piezo2 are nonselective cationic ion channels that are directly activated by mechanical forces and have well-defined biophysical and pharmacologic properties. The role of Piezo channels in the GI epithelium is currently under investigation and their role in the smooth muscle syncytium and enteric neurons is still not known. In this review, we outline the current state of knowledge on mechanosensitive ion channels in the GI tract, with a focus on the known and potential functions of the Piezo channels. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Physiology and pathophysiology of ClC-K/barttin channels.

    Science.gov (United States)

    Fahlke, Christoph; Fischer, Martin

    2010-01-01

    ClC-K channels form a subgroup of anion channels within the ClC family of anion transport proteins. They are expressed predominantly in the kidney and in the inner ear, and are necessary for NaCl resorption in the loop of Henle and for K+ secretion by the stria vascularis. Subcellular distribution as well as the function of these channels are tightly regulated by an accessory subunit, barttin. Barttin improves the stability of ClC-K channel protein, stimulates the exit from the endoplasmic reticulum and insertion into the plasma membrane and changes its function by modifying voltage-dependent gating processes. The importance of ClC-K/barttin channels is highlighted by several genetic diseases. Dysfunctions of ClC-K channels result in Bartter syndrome, an inherited human condition characterized by impaired urinary concentration. Mutations in the gene encoding barttin, BSND, affect the urinary concentration as well as the sensory function of the inner ear. Surprisingly, there is one BSND mutation that causes deafness without affecting renal function, indicating that kidney function tolerates a reduction of anion channel activity that is not sufficient to support normal signal transduction in inner hair cells. This review summarizes recent work on molecular mechanisms, physiology, and pathophysiology of ClC-K/barttin channels.

  6. Physiology and pathophysiology of ClC-K/barttin channels

    Directory of Open Access Journals (Sweden)

    Christoph eFahlke

    2010-11-01

    Full Text Available ClC-K channels form a subgroup of anion channels within the ClC family of anion transport proteins. They are expressed predominantly in the kidney and in the inner ear, and are necessary for NaCl resorption in the loop of Henle and for K+ secretion by the stria vascularis. Subcellular distribution as well as the function of these channels are tightly regulated by an accessory subunit, barttin. Barttin improves the stability of ClC-K channel protein, stimulates the exit from the endoplasmic reticulum and insertion into the plasma membrane and changes its function by modifying voltage-dependent gating processes. The importance of ClC-K/barttin channels is highlighted by several genetic diseases. Dysfunctions of ClC-K channels result in Bartter syndrome, an inherited human condition characterized by impaired urinary concentration. Mutations in the gene encoding barttin, BSND, affect the urinary concentration as well as the sensory function of the inner ear. Surprisingly, there is one BSND mutation that causes deafness without affecting renal function, indicating that kidney function tolerates a reduction of anion channel activity that is not sufficient to support normal signal transduction in inner hair cells. This review summarizes recent work on molecular mechanisms, physiology and pathophysiology of ClC-K/barttin channels.

  7. Modification of sodium and potassium channel kinetics by diethyl ether and studies on sodium channel inactivation in the crayfish giant axon membrane

    Energy Technology Data Exchange (ETDEWEB)

    Bean, Bruce Palmer [Univ. of Rochester, NY (United States)

    1979-01-01

    The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in the hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.

  8. Effects of the small molecule HERG activator NS1643 on Kv11.3 channels.

    Directory of Open Access Journals (Sweden)

    Arne Bilet

    Full Text Available NS1643 is one of the small molecule HERG (Kv11.1 channel activators and has also been found to increase erg2 (Kv11.2 currents. We now investigated whether NS1643 is also able to act as an activator of Kv11.3 (erg3 channels expressed in CHO cells. Activation of rat Kv11.3 current occurred in a dose-dependent manner and maximal current increasing effects were obtained with 10 µM NS1643. At this concentration, steady-state outward current increased by about 80% and the current increase was associated with a significant shift in the voltage dependence of activation to more negative potentials by about 15 mV. In addition, activation kinetics were accelerated, whereas deactivation was slowed. There was no significant effect on the kinetics of inactivation and recovery from inactivation. The strong current-activating agonistic effect of NS1643 did not result from a shift in the voltage dependence of Kv11.3 channel inactivation and was independent from external Na(+ or Ca(2+. At the higher concentration of 20 µM, NS1643 induced clearly less current increase. The left shift in the voltage dependence of activation reversed and the voltage sensitivity of activation dramatically decreased along with a slowing of Kv11.3 channel activation. These data show that, in comparison to other Kv11 family members, NS1643 exerts distinct effects on Kv11.3 channels with especially pronounced partial antagonistic effects at higher concentration.

  9. Free-energy relationships in ion channels activated by voltage and ligand

    Science.gov (United States)

    Chowdhury, Sandipan

    2013-01-01

    Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

  10. New double-cation borohydrides

    Energy Technology Data Exchange (ETDEWEB)

    Lindemann, Inge; Domenech Ferrer, Roger; Schultz, Ludwig; Gutfleisch, Oliver [IFW Dresden, Institute for Metallic Materials, P.O. Box 270016, 01171 Dresden (Germany); Filinchuk, Yaroslav [Swiss-Norwegian Beam Lines at ESRF, BP-220, 38043 Grenoble (France); Hagemann, Hans; Cerny, Radovan [Department of Physical Chemistry and Crystallography, University of Geneva, 1211 Geneva (Switzerland)

    2011-07-01

    Complex hydrides are under consideration for on-board hydrogen storage due to their high hydrogen density. However, up to now conventional borohydrides are either too stable or unstable for applications as in PEM fuel cells (60-120 C). Recently, double-cation borohydride systems have attracted great interest. The desorption temperature of the borohydrides decreases with increasing electronegativity of the cation. Consequently, it is possible to tailor a feasible on-board hydrogen storage material by the combination of appropriate cations. The stability was found to be intermediate between the single-cation borohydride systems. Two combinations were sucessfully synthesised by metathesis reaction via high energy ball milling. Al-Li-borohydride shows desorption at about 70 C combined with a very high hydrogen density (17.2 wt.%) and the Na-Al-borohydride (14.2 wt.%) decomposes around 90 C. Both desorption temperatures are in the target range for applications. The decomposition pathways were observed by in-situ-Raman spectroscopy, DSC (Differential Scanning Calorimetry), TG (Thermogravimetry) and thermal desorption measurements.

  11. Post-Translational Modifications of TRP Channels

    Directory of Open Access Journals (Sweden)

    Olaf Voolstra

    2014-04-01

    Full Text Available Transient receptor potential (TRP channels constitute an ancient family of cation channels that have been found in many eukaryotic organisms from yeast to human. TRP channels exert a multitude of physiological functions ranging from Ca2+ homeostasis in the kidney to pain reception and vision. These channels are activated by a wide range of stimuli and undergo covalent post-translational modifications that affect and modulate their subcellular targeting, their biophysical properties, or channel gating. These modifications include N-linked glycosylation, protein phosphorylation, and covalent attachment of chemicals that reversibly bind to specific cysteine residues. The latter modification represents an unusual activation mechanism of ligand-gated ion channels that is in contrast to the lock-and-key paradigm of receptor activation by its agonists. In this review, we summarize the post-translational modifications identified on TRP channels and, when available, explain their physiological role.

  12. Renin secretion from permeabilized juxtaglomerular cells requires a permeant cation

    DEFF Research Database (Denmark)

    Jensen, B L; Ellekvist, Peter; Skøtt, O

    1999-01-01

    The cytosolic concentration of chloride correlates directly with renin secretion from renal juxtaglomerular granular (JG) cells. In the present study, the mechanism by which chloride stimulates renin release was investigated in a preparation of permeabilized rat glomeruli with attached JG cells....... An isosmotic increase in the concentration of chloride by 129 mM stimulated renin release 16- to 20-fold. Substitution of K+ by the impermeant cation N-methyl-d-glucamine (NMDG) abolished this response, while substitution with Na+ caused marginal inhibition. Substitution with Cs+ had no effect. Addition...... of sucrose, which permeates the secretory granules poorly, also abolished the stimulation of renin secretion by KCl. The response to KCl was not affected by K+-channel antagonists or by agonists of K+ channels. Chloride channel blockers were also without effect on the secretory response to KCl. When the ATP...

  13. Molecular Mechanisms Underlying Renin-Angiotensin-Aldosterone System Mediated Regulation of BK Channels

    Directory of Open Access Journals (Sweden)

    Zhen-Ye Zhang

    2017-09-01

    Full Text Available Large-conductance calcium-activated potassium channels (BK channels belong to a family of Ca2+-sensitive voltage-dependent potassium channels and play a vital role in various physiological activities in the human body. The renin-angiotensin-aldosterone system is acknowledged as being vital in the body's hormone system and plays a fundamental role in the maintenance of water and electrolyte balance and blood pressure regulation. There is growing evidence that the renin-angiotensin-aldosterone system has profound influences on the expression and bioactivity of BK channels. In this review, we focus on the molecular mechanisms underlying the regulation of BK channels mediated by the renin-angiotensin-aldosterone system and its potential as a target for clinical drugs.

  14. Effects of the β1 auxiliary subunit on modification of Rat Na{sub v}1.6 sodium channels expressed in HEK293 cells by the pyrethroid insecticides tefluthrin and deltamethrin

    Energy Technology Data Exchange (ETDEWEB)

    He, Bingjun [College of Life Sciences, Nankai University, Tianjin 300071 (China); Soderlund, David M., E-mail: dms6@cornell.edu [Department of Entomology, Cornell University, Geneva, NY 14456 (United States)

    2016-01-15

    We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased in the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin

  15. Cationic nanoparticles induce nanoscale disruption in living cell plasma membranes.

    Science.gov (United States)

    Chen, Jiumei; Hessler, Jessica A; Putchakayala, Krishna; Panama, Brian K; Khan, Damian P; Hong, Seungpyo; Mullen, Douglas G; Dimaggio, Stassi C; Som, Abhigyan; Tew, Gregory N; Lopatin, Anatoli N; Baker, James R; Holl, Mark M Banaszak; Orr, Bradford G

    2009-08-13

    It has long been recognized that cationic nanoparticles induce cell membrane permeability. Recently, it has been found that cationic nanoparticles induce the formation and/or growth of nanoscale holes in supported lipid bilayers. In this paper, we show that noncytotoxic concentrations of cationic nanoparticles induce 30-2000 pA currents in 293A (human embryonic kidney) and KB (human epidermoid carcinoma) cells, consistent with a nanoscale defect such as a single hole or group of holes in the cell membrane ranging from 1 to 350 nm(2) in total area. Other forms of nanoscale defects, including the nanoparticle porating agents adsorbing onto or intercalating into the lipid bilayer, are also consistent; although the size of the defect must increase to account for any reduction in ion conduction, as compared to a water channel. An individual defect forming event takes 1-100 ms, while membrane resealing may occur over tens of seconds. Patch-clamp data provide direct evidence for the formation of nanoscale defects in living cell membranes. The cationic polymer data are compared and contrasted with patch-clamp data obtained for an amphiphilic phenylene ethynylene antimicrobial oligomer (AMO-3), a small molecule that is proposed to make well-defined 3.4 nm holes in lipid bilayers. Here, we observe data that are consistent with AMO-3 making approximately 3 nm holes in living cell membranes.

  16. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  17. Liquid-solid extraction of metallic cations by cationic amphiphiles

    International Nuclear Information System (INIS)

    Mueller, Wolfram; Sievers, Torsten K.; Zemb, Thomas; Diat, Olivier; Sievers, Torsten K.; Dejugnat, Christophe

    2012-01-01

    In the field of selective metal ion separation, liquid-liquid extraction is usually conducted through an emulsion mixing of hydrophobic complexants dispersed in an organic phase and acidic water containing the ionic species. Recently, it has been shown that amphiphilic complexants could influence strongly extraction efficiency by enhancing the interfacial interaction between the metal ion in the aqueous and the complexant in the organic phase. Moreover, these amphiphiles can also substitute the organic phase if an appropriate aliphatic chain is chosen. The dispersion of such amphiphilic complexants in an aqueous solution of salt mixtures is not only attractive for studying specific interactions but also to better the understanding of complex formation in aqueous solution of multivalent metal ions, such as lanthanides and actinides. This understanding is of potential interest for a broad range of industries including purification of rare earth metals and pollute treatment e.g. of fission byproducts. This principle can also be applied to liquid-solid extraction, where the final state of the separation is a solid phase containing the selectively extracted ions. Indeed, a novel solid-liquid extraction method exploits the selective precipitation of metal ions from an aqueous salt mixture using a cationic surfactant, below its Krafft point (temperature below which the long aliphatic chains of surfactant crystallize). This technique has been proven to be highly efficient for the separation of actinides and heavy metal using long chain ammonium or pyridinium amphiphiles. The most important point in this process is the recognition of cationic metal ions by cationic surfactants. By computing the free energy of the polar head group per micelle as a function of the different counter-anions, we have demonstrated for the first time that different interactions exist between the micellar surface and the ions. These interactions depend on the nature of the cation but also on

  18. Tripodal receptors for cation and anion sensors

    NARCIS (Netherlands)

    Kuswandi, Bambang; Nuriman, [Unknown; Verboom, Willem; Reinhoudt, David

    2006-01-01

    This review discusses different types of artificial tripodal receptors for the selectiverecognition and sensing of cations and anions. Examples on the relationship between structure andselectivity towards cations and anions are described. Furthermore, their applications as potentiometricion sensing

  19. Metaflumizone is a novel sodium channel blocker insecticide.

    Science.gov (United States)

    Salgado, V L; Hayashi, J H

    2007-12-15

    Metaflumizone is a novel semicarbazone insecticide, derived chemically from the pyrazoline sodium channel blocker insecticides (SCBIs) discovered at Philips-Duphar in the early 1970s, but with greatly improved mammalian safety. This paper describes studies confirming that the insecticidal action of metaflumizone is due to the state-dependent blockage of sodium channels. Larvae of the moth Spodoptera eridania injected with metaflumizone became paralyzed, concomitant with blockage of all nerve activity. Furthermore, tonic firing of abdominal stretch receptor organs from Spodoptera frugiperda was blocked by metaflumizone applied in the bath, consistent with the block of voltage-dependent sodium channels. Studies on native sodium channels, in primary-cultured neurons isolated from the CNS of the larvae of the moth Manduca sexta and on Para/TipE sodium channels heterologously expressed in Xenopus (African clawed frog) oocytes, confirmed that metaflumizone blocks sodium channels by binding selectively to the slow-inactivated state, which is characteristic of the SCBIs. The results confirm that metaflumizone is a novel sodium channel blocker insecticide.

  20. Vibrational Spectroscopy of Cation and Anion Channelrhodopsins

    Science.gov (United States)

    Yi, Adrian S.

    Optogenetics is a technique to control and monitor cell activity with light by expression of specific microbial rhodopsins. Cation channelrhodopsins (CCRs) and anion channelrhodopsins (ACRs) have been demonstrated to activate and silence cell activity, respectively. In this dissertation, the molecular mechanisms of two channelrhodopsins are studied: a CCR from Chlamydomonas augustae (CaChR1) and an ACR from Guillardia theta (GtACR1). The recently discovered GtACR1is especially interesting, as it achieves neural silencing with 1/1000th of the light intensity compared to previous microbial rhodopsin silencing ion pumps. Static and time-resolved resonance Raman, FTIR difference, and UV-visible spectroscopies were utilized in addition to various biochemical and genetic techniques to explore the molecular mechanisms of these channelrhodopsins. In CaChR1, Glu169 and Asp299 residues are located nearby the Schiff base (SB) similar to the homologous residues Asp85 and Asp212, which exist in an ionized state in unphotolyzed bacteriorhodopsin (BR) and play a key role in proton pumping. We observe significant changes in the protonation states of the SB, Glu169, and Asp299 of CaChR1 leading up to the open-channel P2 state, where all three groups exist in a charge neutral state. This unusual charge neutrality along with the position of these groups in the CaChR1 ion channel suggests that charge neutrality plays an important role in cation gating and selectivity in these low efficiency CCRs. Significant differences exist in the photocycle and protonation/hydrogen bonding states of key residues inGtACR1compared to BR and CaChR1. Resonance Raman studies reveal that in the unphotolyzed state of GtACR1, residues Glu68, Ser97 (BR Asp85 homolog), and Asp234 (BR Asp212 homolog) located near the SB exist in charge neutral states. Furthermore, upon K formation, these residues do not change their protonation states. At room temperature, a slow decay of the red-shifted K intermediate is

  1. Channel sialic acids limit hERG channel activity during the ventricular action potential.

    Science.gov (United States)

    Norring, Sarah A; Ednie, Andrew R; Schwetz, Tara A; Du, Dongping; Yang, Hui; Bennett, Eric S

    2013-02-01

    Activity of human ether-a-go-go-related gene (hERG) 1 voltage-gated K(+) channels is responsible for portions of phase 2 and phase 3 repolarization of the human ventricular action potential. Here, we questioned whether and how physiologically and pathophysiologically relevant changes in surface N-glycosylation modified hERG channel function. Voltage-dependent hERG channel gating and activity were evaluated as expressed in a set of Chinese hamster ovary (CHO) cell lines under conditions of full glycosylation, no sialylation, no complex N-glycans, and following enzymatic deglycosylation of surface N-glycans. For each condition of reduced glycosylation, hERG channel steady-state activation and inactivation relationships were shifted linearly by significant depolarizing ∼9 and ∼18 mV, respectively. The hERG window current increased significantly by 50-150%, and the peak shifted by a depolarizing ∼10 mV. There was no significant change in maximum hERG current density. Deglycosylated channels were significantly more active (20-80%) than glycosylated controls during phases 2 and 3 of action potential clamp protocols. Simulations of hERG current and ventricular action potentials corroborated experimental data and predicted reduced sialylation leads to a 50-70-ms decrease in action potential duration. The data describe a novel mechanism by which hERG channel gating is modulated through physiologically and pathophysiologically relevant changes in N-glycosylation; reduced channel sialylation increases hERG channel activity during the action potential, thereby increasing the rate of action potential repolarization.

  2. Cationic electrodepositable coating composition comprising lignin

    Science.gov (United States)

    Fenn, David; Bowman, Mark P; Zawacky, Steven R; Van Buskirk, Ellor J; Kamarchik, Peter

    2013-07-30

    A cationic electrodepositable coating composition is disclosed. The present invention in directed to a cationic electrodepositable coating composition comprising a lignin-containing cationic salt resin, that comprises (A) the reaction product of: lignin, an amine, and a carbonyl compound; (B) the reaction product of lignin, epichlorohydrin, and an amine; or (C) combinations thereof.

  3. Direct proton conductance through the TRPV1 pore and multimerization of TRPV channel subunits

    OpenAIRE

    Hellwig, Nicole Barbara

    2010-01-01

    TRPV1-induced intracellular acidification: The vanilloid receptor-related transient receptor potential channels (TRPV) belong to the superfamily of hexahelical cation channels and are integral components of thermosensation, pain perception and Ca2+-reabsorption in kidney and intestine. The vanilloid receptor (TRPV1), a poorly selective cation channel, is expressed in dorsal root ganglion (DRG) neurons and is regulated by diverse stimuli including capsaicin, endovanilloids and heat. Since a...

  4. Chloride channels as tools for developing selective insecticides.

    Science.gov (United States)

    Bloomquist, Jeffrey R

    2003-12-01

    Ligand-gated chloride channels underlie inhibition in excitable membranes and are proven target sites for insecticides. The gamma-aminobutyric acid (GABA(1)) receptor/chloride ionophore complex is the primary site of action for a number of currently used insecticides, such as lindane, endosulfan, and fipronil. These compounds act as antagonists by stabilizing nonconducting conformations of the chloride channel. Blockage of the GABA-gated chloride channel reduces neuronal inhibition, which leads to hyperexcitation of the central nervous system, convulsions, and death. We recently investigated the mode of action of the silphinenes, plant-derived natural compounds that structurally resemble picrotoxinin. These materials antagonize the action of GABA on insect neurons and block GABA-mediated chloride uptake into mouse brain synaptoneurosomes in a noncompetitive manner. In mammals, avermectins have a blocking action on the GABA-gated chloride channel consistent with a coarse tremor, whereas at longer times and higher concentrations, activation of the channel suppresses neuronal activity. Invertebrates display ataxia, paralysis, and death as the predominant signs of poisoning, with a glutamate-gated chloride channel playing a major role. Additional target sites for the avermectins or other chloride channel-directed compounds might include receptors gated by histamine, serotonin, or acetylcholine.The voltage-sensitive chloride channels form another large gene family of chloride channels. Voltage-dependent chloride channels are involved in a number of physiological processes including: maintenance of electrical excitability, chloride ion secretion and resorption, intravesicular acidification, and cell volume regulation. A subset of these channels is affected by convulsants and insecticides in mammals, although the role they play in acute lethality in insects is unclear. Given the wide range of functions that they mediate, these channels are also potential targets for

  5. Asymmetric cation-binding catalysis

    DEFF Research Database (Denmark)

    Oliveira, Maria Teresa; Lee, Jiwoong

    2017-01-01

    The employment of metal salts is quite limited in asymmetric catalysis, although it would provide an additional arsenal of safe and inexpensive reagents to create molecular functions with high optical purity. Cation chelation by polyethers increases the salts' solubility in conventional organic...... solvents, thus increasing their applicability in synthesis. The expansion of this concept to chiral polyethers led to the emergence of asymmetric cation-binding catalysis, where chiral counter anions are generated from metal salts, particularly using BINOL-based polyethers. Alkali metal salts, namely KF...... highly enantioselective silylation reactions in polyether-generated chiral environments, and leading to a record-high turnover in asymmetric organocatalysis. This can lead to further applications by the asymmetric use of other inorganic salts in various organic transformations....

  6. The effect of alkaline cations on the Intercalation of Carbon Dioxide in Sepiolite Minerals: a Molecular Dynamics Investigation.

    Science.gov (United States)

    Tavanti, Francesco; Muniz-Miranda, Francesco; Pedone, Alfonso

    2018-03-01

    The ability of the sepiolite mineral to intercalate CO2 molecules inside its channels in the presence of different alkaline cations (K+, Na+ and Li+) has been studied by classical Molecular Dynamics simulations. Starting from an alkaline-free sepiolite crystalline model we built three models with stoichiometry Mg320Si440Al40O1200(OH)160X+40•480H2O. On these models, we gradually replaced the water molecules present in the channels with carbon dioxide and determined the energy of this exchange reaction as well as the structural organization and dynamics of carbon dioxide in the channels. The adsorption energy shows that the Li-containing sepiolite mineral retains more carbon dioxide with respect to those with sodium and potassium cations in the channels. Moreover, the ordered patterns of CO2 molecules observed in the alkaline-free sepiolite mineral are in part destabilized by the presence of cations decreasing the adsorption capacity of this clay mineral.

  7. Pore size matters for potassium channel conductance

    Science.gov (United States)

    Moldenhauer, Hans; Pincuntureo, Matías

    2016-01-01

    Ion channels are membrane proteins that mediate efficient ion transport across the hydrophobic core of cell membranes, an unlikely process in their absence. K+ channels discriminate K+ over cations with similar radii with extraordinary selectivity and display a wide diversity of ion transport rates, covering differences of two orders of magnitude in unitary conductance. The pore domains of large- and small-conductance K+ channels share a general architectural design comprising a conserved narrow selectivity filter, which forms intimate interactions with permeant ions, flanked by two wider vestibules toward the internal and external openings. In large-conductance K+ channels, the inner vestibule is wide, whereas in small-conductance channels it is narrow. Here we raise the idea that the physical dimensions of the hydrophobic internal vestibule limit ion transport in K+ channels, accounting for their diversity in unitary conductance. PMID:27619418

  8. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  9. Inhibition of GluR Current in Microvilli of Sensory Neurons via Na+-Microdomain Coupling Among GluR, HCN Channel, and Na+/K+ Pump

    Directory of Open Access Journals (Sweden)

    Yasuhiro Kawasaki

    2018-04-01

    Full Text Available Glutamatergic dendritic EPSPs evoked in cortical pyramidal neurons are depressed by activation of hyperpolarization-activated cyclic nucleotide-gated (HCN channels expressed in dendritic spines. This depression has been attributed to shunting effects of HCN current (Ih on input resistance or Ih deactivation. Primary sensory neurons in the rat mesencephalic trigeminal nucleus (MTN have the somata covered by spine-like microvilli that express HCN channels. In rat MTN neurons, we demonstrated that Ih enhancement apparently diminished the glutamate receptor (GluR current (IGluR evoked by puff application of glutamate/AMPA and enhanced a transient outward current following IGluR (OT-IGluR. This suggests that some outward current opposes inward IGluR. The IGluR inhibition displayed a U-shaped voltage-dependence with a minimal inhibition around the resting membrane potential, suggesting that simple shunting effects or deactivation of Ih cannot explain the U-shaped voltage-dependence. Confocal imaging of Na+ revealed that GluR activation caused an accumulation of Na+ in the microvilli, which can cause a negative shift of the reversal potential for Ih (Eh. Taken together, it was suggested that IGluR evoked in MTN neurons is opposed by a transient decrease or increase in standing inward or outward Ih, respectively, both of which can be caused by negative shifts of Eh, as consistent with the U-shaped voltage-dependence of the IGluR inhibition and the OT-IGluR generation. An electron-microscopic immunohistochemical study revealed the colocalization of HCN channels and glutamatergic synapses in microvilli of MTN neurons, which would provide a morphological basis for the functional interaction between HCN and GluR channels. Mathematical modeling eliminated the possibilities of the involvements of Ih deactivation and/or shunting effect and supported the negative shift of Eh which causes the U-shaped voltage-dependent inhibition of IGluR.

  10. Dysfunctional Hyperpolarization-Activated Cyclic Nucleotide-gated Ion Channels in Cardiac Diseases

    Directory of Open Access Journals (Sweden)

    Xiaoqi Zhao

    Full Text Available Abstract Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are reverse voltage-dependent, and their activation depends on the hyperpolarization of the membrane and may be directly or indirectly regulated by the cyclic adenosine monophosphate (cAMP or other signal-transduction cascades. The distribution, quantity and activation states of HCN channels differ in tissues throughout the body. Evidence exhibits that HCN channels play critical roles in the generation and conduction of the electrical impulse and the physiopathological process of some cardiac diseases. They may constitute promising drug targets in the treatment of these cardiac diseases. Pharmacological treatment targeting HCN channels is of benefit to these cardiac conditions.

  11. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

    Science.gov (United States)

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

    2013-03-01

    The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

  12. Ion channeling

    International Nuclear Information System (INIS)

    Erramli, H.; Blondiaux, G.

    1994-01-01

    Channeling phenomenon was predicted, many years ago, by stark. The first channeling experiments were performed in 1963 by Davies and his coworkers. Parallely Robinson and Oen have investigated this process by simulating trajectories of ions in monocrystals. This technique has been combined with many methods like Rutherford Backscattering Spectrometry (R.B.S.), Particles Induced X-rays Emission (P.I.X.E) and online Nuclear Reaction (N.R.A.) to localize trace elements in the crystal or to determine crystalline quality. To use channeling for material characterization we need data about the stopping power of the incident particle in the channeled direction. The ratios of channeled to random stopping powers of silicon for irradiation in the direction have been investigated and compared to the available theoretical results. We describe few applications of ion channeling in the field of materials characterization. Special attention is given to ion channeling combined with Charged Particle Activation Analysis (C.P.A.A.) for studying the behaviour of oxygen atoms in Czochralski silicon lattices under the influence of internal gettering and in different gaseous atmospheres. Association between ion channeling and C.P.A.A was also utilised for studying the influence of the growing conditions on concentration and position of carbon atoms at trace levels in the MOVPE Ga sub (1-x) Al sub x lattice. 6 figs., 1 tab., 32 refs. (author)

  13. Mechanosensitive gating of Kv channels.

    Directory of Open Access Journals (Sweden)

    Catherine E Morris

    Full Text Available K-selective voltage-gated channels (Kv are multi-conformation bilayer-embedded proteins whose mechanosensitive (MS Popen(V implies that at least one conformational transition requires the restructuring of the channel-bilayer interface. Unlike Morris and colleagues, who attributed MS-Kv responses to a cooperative V-dependent closed-closed expansion↔compaction transition near the open state, Mackinnon and colleagues invoke expansion during a V-independent closed↔open transition. With increasing membrane tension, they suggest, the closed↔open equilibrium constant, L, can increase >100-fold, thereby taking steady-state Popen from 0→1; "exquisite sensitivity to small…mechanical perturbations", they state, makes a Kv "as much a mechanosensitive…as…a voltage-dependent channel". Devised to explain successive gK(V curves in excised patches where tension spontaneously increased until lysis, their L-based model falters in part because of an overlooked IK feature; with recovery from slow inactivation factored in, their g(V datasets are fully explained by the earlier model (a MS V-dependent closed-closed transition, invariant L≥4. An L-based MS-Kv predicts neither known Kv time courses nor the distinctive MS responses of Kv-ILT. It predicts Kv densities (hence gating charge per V-sensor several-fold different from established values. If opening depended on elevated tension (L-based model, standard gK(V operation would be compromised by animal cells' membrane flaccidity. A MS V-dependent transition is, by contrast, unproblematic on all counts. Since these issues bear directly on recent findings that mechanically-modulated Kv channels subtly tune pain-related excitability in peripheral mechanoreceptor neurons we undertook excitability modeling (evoked action potentials. Kvs with MS V-dependent closed-closed transitions produce nuanced mechanically-modulated excitability whereas an L-based MS-Kv yields extreme, possibly excessive

  14. Cation-Coupled Bicarbonate Transporters

    OpenAIRE

    Aalkjaer, Christian; Boedtkjer, Ebbe; Choi, Inyeong; Lee, Soojung

    2014-01-01

    Cation-coupled HCO3− transport was initially identified in the mid-1970s when pioneering studies showed that acid extrusion from cells is stimulated by CO2/HCO3− and associated with Na+ and Cl− movement. The first Na+-coupled bicarbonate transporter (NCBT) was expression-cloned in the late 1990s. There are currently five mammalian NCBTs in the SLC4-family: the electrogenic Na,HCO3-cotransporters NBCe1 and NBCe2 (SLC4A4 and SLC4A5 gene products); the electroneutral Na,HCO3-cotransporter NBCn1 ...

  15. Cation disorder in shocked orthopyroxene.

    Science.gov (United States)

    Dundon, R. W.; Hafner, S. S.

    1971-01-01

    The study of cation distributions over nonequivalent lattice sites in minerals may reveal information on the history of temperature and pressure in rocks. Chemically homogeneous orthopyroxene specimens were shocked under well-controlled conditions in the laboratory in order to provide a basis for the interpretation of more complex natural materials. As a result of the investigation it is concluded that the distribution of magnesium and iron over the M1 and M2 positions in Bamle enstatite shocked at 1 megabar is highly disordered. It corresponds to an equilibrium distribution of at least 1000 C.

  16. Cation coordination in oxychloride glasses

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J A [Energy Technology Division, Argonne National Laboratory, Argonne, IL (United States); Holland, D [Physics Department, Warwick University, Coventry (United Kingdom); Bland, J [Physics Department, University of Liverpool, PO Box 147, Liverpool (United Kingdom); Johnson, C E [Physics Department, Northern Illinois University, DeKalb, IL (United States); Thomas, M F [Physics Department, University of Liverpool, PO Box 147, Liverpool (United Kingdom)

    2003-02-19

    Glasses containing mixtures of cations and anions of nominal compositions [Sb{sub 2}O{sub 3}]{sub x} - [ZnCl{sub 2}]{sub 1-x} where x = 0.25, 0.50, 0.75, and 1.00, have been studied by means of neutron diffraction and Raman and Moessbauer spectroscopy. There is preferential bonding within the system with the absence of Sb-Cl bonds. Antimony is found to be threefold coordinated to oxygen, and zinc fourfold coordinated. The main contributing species are of the form [Sb(OSb){sub 2}(OZn)] and [Zn(ClZn){sub 2}(OSb){sub 2}].

  17. Cation coordination in oxychloride glasses

    International Nuclear Information System (INIS)

    Johnson, J A; Holland, D; Bland, J; Johnson, C E; Thomas, M F

    2003-01-01

    Glasses containing mixtures of cations and anions of nominal compositions [Sb 2 O 3 ] x - [ZnCl 2 ] 1-x where x = 0.25, 0.50, 0.75, and 1.00, have been studied by means of neutron diffraction and Raman and Moessbauer spectroscopy. There is preferential bonding within the system with the absence of Sb-Cl bonds. Antimony is found to be threefold coordinated to oxygen, and zinc fourfold coordinated. The main contributing species are of the form [Sb(OSb) 2 (OZn)] and [Zn(ClZn) 2 (OSb) 2

  18. Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain.

    Science.gov (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-23

    Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

  19. Divalent Metal Ion Transport across Large Biological Ion Channels and Their Effect on Conductance and Selectivity

    Directory of Open Access Journals (Sweden)

    Elena García-Giménez

    2012-01-01

    Full Text Available Electrophysiological characterization of large protein channels, usually displaying multi-ionic transport and weak ion selectivity, is commonly performed at physiological conditions (moderate gradients of KCl solutions at decimolar concentrations buffered at neutral pH. We extend here the characterization of the OmpF porin, a wide channel of the outer membrane of E. coli, by studying the effect of salts of divalent cations on the transport properties of the channel. The regulation of divalent cations concentration is essential in cell metabolism and understanding their effects is of key importance, not only in the channels specifically designed to control their passage but also in other multiionic channels. In particular, in porin channels like OmpF, divalent cations modulate the efficiency of molecules having antimicrobial activity. Taking advantage of the fact that the OmpF channel atomic structure has been resolved both in water and in MgCl2 aqueous solutions, we analyze the single channel conductance and the channel selectivity inversion aiming to separate the role of the electrolyte itself, and the counterion accumulation induced by the protein channel charges and other factors (binding, steric effects, etc. that being of minor importance in salts of monovalent cations become crucial in the case of divalent cations.

  20. The Free Tricoordinated Silyl Cation Problem

    Directory of Open Access Journals (Sweden)

    Čičak, H.

    2010-03-01

    Full Text Available As the importance and abundance of silicon in our environment is large, it has been thought that silicon might take the place of carbon in forming a host of similar compounds and silicon-based life. However, until today there is no experimental evidence for such a hypothesis and carbon is still unique among the elements in the vast number and variety of compounds it can form. Also, the corresponding derivatives of the two elements show considerable differences in their chemical properties.The essential debate concerning organosilicon chemistry relates to the existence of the free planar tricoordinated silyl cations in condensed phase (R3Si+, in analogy to carbocations (R3C+ which have been known and characterized as free species. Although silyl cations are thermodynamically more stable than their carbon analogs, they are very reactive due to their high inherent electrophilicity and the ability of hypervalent coordination. On the other hand, stabilization by inductive and hyperconjugative effects and larger steric effects of carbocations make them less sensitive to solvation or other environmental effects than silyl cations. Hence, observation of free silyl cations in the condensed phase proved extremely difficult and the actual problem is the question of the degree of the (remaining silyl cation character.The first free silyl cation, trimesitylsilyl cation, and in analogy with it tridurylsilyl cation, were synthesized by Lambert et al. Free silyl cations based on analogy to aromatic ions (homocyclopropenylium and tropylium have also been prepared. However, in these silyl cations the cationic character is reduced by internal π -conjugation. Čičak et al. prepared some silyl-cationic intermediates (Me3Si--CH≡CR+in solid state. With the help of quantum-mechanical calculations it was concluded that these adducts have much more silyl cation than carbocation character.

  1. Channel box

    International Nuclear Information System (INIS)

    Tanabe, Akira.

    1993-01-01

    In a channel box of a BWR type reactor, protruding pads are disposed in axial position on the lateral side of a channel box opposing to a control rod and facing the outer side portion of the control rod in a reactor core loaded state. In the initial loading stage of fuel assemblies, channel fasteners and spacer pads are abutted against each other in the upper portion between the channel boxes sandwiching the control rod therebetween. Further, in the lower portion, a gap as a channel for the movement of the control rod is ensured by the support of fuel support metals. If the channel box is bent toward the control rod along with reactor operation, the pads are abutted against each other to always ensure the gap through which the control rod can move easily. Further, when the pads are brought into contact with each other, the bending deformation of the channel box is corrected by urging to each other. Thus, the control rod can always be moved smoothly to attain reactor safety operation. (N.H.)

  2. Caffeine inhibits nonselective cationic currents in interstitial cells of Cajal from the murine jejunum.

    Science.gov (United States)

    Jin, Nan Ge; Koh, Sang Don; Sanders, Kenton M

    2009-10-01

    Interstitial cells of Cajal (ICC) discharge unitary potentials in gastrointestinal muscles that constitute the basis for pacemaker activity. Caffeine has been used to block unitary potentials, but the ionic conductance responsible for unitary potentials is controversial. We investigated currents in cultured ICC from murine jejunum that may underlie unitary potentials and studied the effects of caffeine. Networks of ICC generated slow wave events under current clamp, and these events were blocked by caffeine in a concentration-dependent manner. Single ICC generated spontaneous transient inward currents (STICs) under voltage clamp at -60 mV and noisy voltage fluctuations in current clamp. STICs were unaffected when the equilibrium potential for Cl- (ECl) was set to -60 mV (excluding Cl- currents) and reversed at 0 mV, demonstrating that a nonselective cationic conductance, and not a Cl- conductance, is responsible for STICs in ICC. Caffeine inhibited STICs in a concentration-dependent manner. Reduced intracellular Ca2+ and calmidazolium (CMZ; 1 microM) activated persistent inward, nonselective cation currents in ICC. Currents activated by CMZ and by dialysis of cells with 10 mM BAPTA were also inhibited by caffeine. Excised inside-out patches contained channels that exhibited spontaneous openings, and resulting currents reversed at 0 mV. Channel openings were increased by reducing Ca2+ concentration from 10(-6) M to 10(-8) M. CMZ (1 microM) also increased openings of nonselective cation channels. Spontaneous currents and channels activated by CMZ were inhibited by caffeine (5 mM). The findings demonstrate that the Ca2+-inhibited nonselective cation channels that generate STICs in ICC are blocked directly by caffeine. STICs are responsible for unitary potentials in intact muscles, and the block of these events by caffeine is consistent with the idea that a nonselective cation conductance underlies unitary potentials in ICC.

  3. Conductance of Ion Channels - Theory vs. Experiment

    Science.gov (United States)

    Pohorille, Andrew; Wilson, Michael; Mijajlovic, Milan

    2013-01-01

    . In addition, once the free energy profile becomes available the full current-voltage dependence can be readily obtained. For both channels we carried out calculations using both approaches. We also tested the main assumptions underlying the diffusive model, such as uncorrelated nature of individual crossing events and Fickian diffusion. The accuracy and consistency of different methods will be discussed. Finally we will discuss how comparisons between calculated and measured ionic conductance and selectivity of transport can be used for determining structural models of the channels.

  4. Surface channeling

    International Nuclear Information System (INIS)

    Sizmann, R.; Varelas, C.

    1976-01-01

    There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

  5. Pharmacological Conversion of a Cardiac Inward Rectifier into an Outward Rectifier Potassium Channel.

    Science.gov (United States)

    Moreno-Galindo, Eloy G; Sanchez-Chapula, Jose A; Tristani-Firouzi, Martin; Navarro-Polanco, Ricardo A

    2016-09-01

    Potassium (K(+)) channels are crucial for determining the shape, duration, and frequency of action-potential firing in excitable cells. Broadly speaking, K(+) channels can be classified based on whether their macroscopic current outwardly or inwardly rectifies, whereby rectification refers to a change in conductance with voltage. Outwardly rectifying K(+) channels conduct greater current at depolarized membrane potentials, whereas inward rectifier channels conduct greater current at hyperpolarized membrane potentials. Under most circumstances, outward currents through inwardly rectifying K(+) channels are reduced at more depolarized potentials. However, the acetylcholine-gated K(+) channel (KACh) conducts current that inwardly rectifies when activated by some ligands (such as acetylcholine), and yet conducts current that outwardly rectifies when activated by other ligands (for example, pilocarpine and choline). The perplexing and paradoxical behavior of KACh channels is due to the intrinsic voltage sensitivity of the receptor that activates KACh channels, the M2 muscarinic receptor (M2R). Emerging evidence reveals that the affinity of M2R for distinct ligands varies in a voltage-dependent and ligand-specific manner. These intrinsic receptor properties determine whether current conducted by KACh channels inwardly or outwardly rectifies. This review summarizes the most recent concepts regarding the intrinsic voltage sensitivity of muscarinic receptors and the consequences of this intriguing behavior on cardiac physiology and pharmacology of KACh channels. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  6. ADSORPTION METHOD FOR SEPARATING METAL CATIONS

    Science.gov (United States)

    Khym, J.X.

    1959-03-10

    The chromatographic separation of fission product cations is discussed. By use of this method a mixture of metal cations containing Zr, Cb, Ce, Y, Ba, and Sr may be separated from one another. Mentioned as preferred exchange adsorbents are resins containing free sulfonic acid groups. Various eluants, such as tartaric acid, HCl, and citric acid, used at various acidities, are employed to effect the selective elution and separation of the various fission product cations.

  7. Electronic spectra of astrophysically interesting cations

    Energy Technology Data Exchange (ETDEWEB)

    Maier, John P., E-mail: j.p.maier@unibas.ch; Rice, Corey A., E-mail: j.p.maier@unibas.ch; Mazzotti, Fabio J., E-mail: j.p.maier@unibas.ch; Johnson, Anatoly, E-mail: j.p.maier@unibas.ch [Department of Chemistry, University of Basel, Klingelbergstr. 80, CH-4056 Basel (Switzerland)

    2015-01-22

    The electronic spectra of polyacetylene cations were recorded at 20K in the laboratory in an ion trap instrument. These can then be compared with diffuse interstellar band (DIB) absorptions. Examination of recently published data shows that the attribution of a weak DIB at ∼506.9 nm to diacetylene cation is not justified. Study of the higher excited electronic states of polyacetylene cations shows that their widths can still be sufficiently narrow for consideration as DIB carriers.

  8. Spark Channels

    Energy Technology Data Exchange (ETDEWEB)

    Haydon, S. C. [Department of Physics, University of New England, Armidale, NSW (Australia)

    1968-04-15

    A brief summary is given of the principal methods used for initiating spark channels and the various highly time-resolved techniques developed recently for studies with nanosecond resolution. The importance of the percentage overvoltage in determining the early history and subsequent development of the various phases of the growth of the spark channel is discussed. An account is then given of the recent photographic, oscillographic and spectroscopic investigations of spark channels initiated by co-axial cable discharges of spark gaps at low [{approx} 1%] overvoltages. The phenomena observed in the development of the immediate post-breakdown phase, the diffuse glow structure, the growth of the luminous filament and the final formation of the spark channel in hydrogen are described. A brief account is also given of the salient features emerging from corresponding studies of highly overvolted spark gaps in which the spark channel develops from single avalanche conditions. The essential differences between the two types of channel formation are summarized and possible explanations of the general features are indicated. (author)

  9. Uranium isotope separation using styrene cation exchangers

    International Nuclear Information System (INIS)

    Kahovec, J.

    1980-01-01

    The separation of 235 U and 238 U isotopes is carried out either by simple isotope exchange in the system uranium-cation exchanger (sulphonated styrene divinylbenzene resin), or by combination of isotope exchange in a uranium-cation exchanger (Dowex 50, Amberlite IR-120) system and a chemical reaction. A review is presented of elution agents used, the degree of cation exchanger cross-linking, columns length, and 235 U enrichment. The results are described of the isotope effect study in a U(IV)-U(VI)-cation exchanger system conducted by Japanese and Romanian authors (isotope exchange kinetics, frontal analysis, reverse (indirect) frontal analysis). (H.S.)

  10. Cation-π interactions in structural biology

    OpenAIRE

    Gallivan, Justin P.; Dougherty, Dennis A.

    1999-01-01

    Cation-pi interactions in protein structures are identified and evaluated by using an energy-based criterion for selecting significant sidechain pairs. Cation-pi interactions are found to be common among structures in the Protein Data Bank, and it is clearly demonstrated that, when a cationic sidechain (Lys or Arg) is near an aromatic sidechain (Phe, Tyr, or Trp), the geometry is biased toward one that would experience a favorable cation-pi interaction. The sidechain of Arg is more likely tha...

  11. Simultaneous anion and cation mobility in polypyrrole

    DEFF Research Database (Denmark)

    Skaarup, Steen; Bay, Lasse; Vidanapathirana, K.

    2003-01-01

    and the expulsion of anions; a broad anodic peak centered at ca. - 0.5 V representing the expulsion of cations; and a second broad peak at +0.2 to +0.5 V corresponding to anions being inserted. Although the motion of cations is the most important, as expected, there is a significant anion contribution, thereby...... complicating reproducibility when employing PPy(DBS) polymers as actuators. When the cation is doubly charged, it enters the film less readily, and anions dominate the mobility. Using a large and bulky cation switches the mechanism to apparently total anion motion. The changes in area of the three peaks...

  12. ASIC3 channels in multimodal sensory perception.

    Science.gov (United States)

    Li, Wei-Guang; Xu, Tian-Le

    2011-01-19

    Acid-sensing ion channels (ASICs), which are members of the sodium-selective cation channels belonging to the epithelial sodium channel/degenerin (ENaC/DEG) family, act as membrane-bound receptors for extracellular protons as well as nonproton ligands. At least five ASIC subunits have been identified in mammalian neurons, which form both homotrimeric and heterotrimeric channels. The highly proton sensitive ASIC3 channels are predominantly distributed in peripheral sensory neurons, correlating with their roles in multimodal sensory perception, including nociception, mechanosensation, and chemosensation. Different from other ASIC subunit composing ion channels, ASIC3 channels can mediate a sustained window current in response to mild extracellular acidosis (pH 7.3-6.7), which often occurs accompanied by many sensory stimuli. Furthermore, recent evidence indicates that the sustained component of ASIC3 currents can be enhanced by nonproton ligands including the endogenous metabolite agmatine. In this review, we first summarize the growing body of evidence for the involvement of ASIC3 channels in multimodal sensory perception and then discuss the potential mechanisms underlying ASIC3 activation and mediation of sensory perception, with a special emphasis on its role in nociception. We conclude that ASIC3 activation and modulation by diverse sensory stimuli represent a new avenue for understanding the role of ASIC3 channels in sensory perception. Furthermore, the emerging implications of ASIC3 channels in multiple sensory dysfunctions including nociception allow the development of new pharmacotherapy.

  13. Simple Ion Channels: From Structure to Electrophysiology and Back

    Science.gov (United States)

    Pohorille, Andrzej

    2018-01-01

    A reliable way to establish whether our understanding of a channel is satisfactory is to reproduce its measured ionic conductance over a broad range of applied voltages in computer simulations. In molecular dynamics (MD), this can be done by way of applying an external electric field to the system and counting the number of ions that traverse the channel per unit time. Since this approach is computationally very expensive, we have developed a markedly more efficient alternative in which MD is combined with the electrodiffusion (ED) equation. In this approach, the assumptions of the ED equation can be rigorously tested, and the precision and consistency of the calculated conductance can be determined. We have demonstrated that the full current/voltage dependence and the underlying free energy profile for a simple channel can be reliably calculated from equilibrium or non-equilibrium MD simulations at a single voltage. To carry out MD simulations, a structural model of a channel has to be assumed, which is an important constraint, considering that high-resolution structures are available for only very few simple channels. If the comparison of calculated ionic conductance with electrophysiological data is satisfactory, it greatly increases our confidence that the structure and the function are described sufficiently accurately. We examined the validity of the ED for several channels embedded in phospholipid membranes - four naturally occurring channels: trichotoxin, alamethicin, p7 from hepatitis C virus (HCV) and Vpu from the HIV-1 virus, and a synthetic, hexameric channel, formed by a 21-residue peptide that contains only leucine and serine. All these channels mediate transport of potassium and chloride ions. It was found that the ED equation is satisfactory for these systems. In some of them experimental and calculated electrophysiological properties are in good agreement, whereas in others there are strong indications that the structural models are incorrect.

  14. Afrikaans Syllabification Patterns

    Directory of Open Access Journals (Sweden)

    Tilla Fick

    2010-01-01

    Full Text Available In contrast to English, automatic hyphenation by computer of Afrikaans words is a problem that still needs to be addressed, since errors are still often encountered in printed text. An initial step in this task is the ability to automatically syllabify words. Since new words are created continuously by joining words, it is necessary to develop an “intelligent” technique for syllabification. As a first phase of the research, we consider only the orthographic information of words, and disregard both syntactic and morphological information. This approach allows us to use machine-learning techniques such as artificial neural networks and decision trees that are known for their pattern recognition abilities. Both these techniques are trained with isolated patterns consisting of input patterns and corresponding outputs (or targets that indicate whether the input pattern should be split at a certain position, or not. In the process of compiling a list of syllabified words from which to generate training data for the  syllabification problem, irregular patterns were identified. The same letter patterns are split differently in different words and complete words that are spelled identically are split differently due to meaning. We also identified irregularities in and between  the different dictionaries that we used. We examined the influence range of letters that are involved in irregularities. For example, for their in agter-ente and vaste-rente we have to consider three letters to the left of r to be certain where the hyphen should be inserted. The influence range of the k in verstek-waarde and kleinste-kwadrate is four to the left and three to the right. In an analysis of letter patterns in Afrikaans words we found that the letter e has the highest frequency overall (16,2% of all letters in the word list. The frequency of words starting with s is the highest, while the frequency of words ending with e is the highest. It is important to

  15. The Molecular Basis for Altered Cation Permeability in Hereditary Stomatocytic Human Red Blood Cells

    Directory of Open Access Journals (Sweden)

    Joanna F. Flatt

    2018-04-01

    Full Text Available Normal human RBCs have a very low basal permeability (leak to cations, which is continuously corrected by the Na,K-ATPase. The leak is temperature-dependent, and this temperature dependence has been evaluated in the presence of inhibitors to exclude the activity of the Na,K-ATPase and NaK2Cl transporter. The severity of the RBC cation leak is altered in various conditions, most notably the hereditary stomatocytosis group of conditions. Pedigrees within this group have been classified into distinct phenotypes according to various factors, including the severity and temperature-dependence of the cation leak. As recent breakthroughs have provided more information regarding the molecular basis of hereditary stomatocytosis, it has become clear that these phenotypes elegantly segregate with distinct genetic backgrounds. The cryohydrocytosis phenotype, including South-east Asian Ovalocytosis, results from mutations in SLC4A1, and the very rare condition, stomatin-deficient cryohydrocytosis, is caused by mutations in SLC2A1. Mutations in RHAG cause the very leaky condition over-hydrated stomatocytosis, and mutations in ABCB6 result in familial pseudohyperkalemia. All of the above are large multi-spanning membrane proteins and the mutations may either modify the structure of these proteins, resulting in formation of a cation pore, or otherwise disrupt the membrane to allow unregulated cation movement across the membrane. More recently mutations have been found in two RBC cation channels, PIEZO1 and KCNN4, which result in dehydrated stomatocytosis. These mutations alter the activation and deactivation kinetics of these channels, leading to increased opening and allowing greater cation fluxes than in wild type.

  16. Identification of sodium channel isoforms that mediate action potential firing in lamina I/II spinal cord neurons

    Directory of Open Access Journals (Sweden)

    Smith Paula L

    2011-09-01

    Full Text Available Abstract Background Voltage-gated sodium channels play key roles in acute and chronic pain processing. The molecular, biophysical, and pharmacological properties of sodium channel currents have been extensively studied for peripheral nociceptors while the properties of sodium channel currents in dorsal horn spinal cord neurons remain incompletely understood. Thus far, investigations into the roles of sodium channel function in nociceptive signaling have primarily focused on recombinant channels or peripheral nociceptors. Here, we utilize recordings from lamina I/II neurons withdrawn from the surface of spinal cord slices to systematically determine the functional properties of sodium channels expressed within the superficial dorsal horn. Results Sodium channel currents within lamina I/II neurons exhibited relatively hyperpolarized voltage-dependent properties and fast kinetics of both inactivation and recovery from inactivation, enabling small changes in neuronal membrane potentials to have large effects on intrinsic excitability. By combining biophysical and pharmacological channel properties with quantitative real-time PCR results, we demonstrate that functional sodium channel currents within lamina I/II neurons are predominantly composed of the NaV1.2 and NaV1.3 isoforms. Conclusions Overall, lamina I/II neurons express a unique combination of functional sodium channels that are highly divergent from the sodium channel isoforms found within peripheral nociceptors, creating potentially complementary or distinct ion channel targets for future pain therapeutics.

  17. Cationic polymers and their therapeutic potential

    NARCIS (Netherlands)

    Samal, S.K.; Dash, M.; van Vlierberghe, S.; Kaplan, D.; Chiellini, E.; van Blitterswijk, Clemens; Moroni, Lorenzo; Dubruel, P.

    2012-01-01

    The last decade has witnessed enormous research focused on cationic polymers. Cationic polymers are the subject of intense research as non-viral gene delivery systems, due to their flexible properties, facile synthesis, robustness and proven gene delivery efficiency. Here, we review the most recent

  18. Tripodal Receptors for Cation and Anion Sensors

    Directory of Open Access Journals (Sweden)

    David N. Reinhoudt

    2006-08-01

    Full Text Available This review discusses different types of artificial tripodal receptors for the selectiverecognition and sensing of cations and anions. Examples on the relationship between structure andselectivity towards cations and anions are described. Furthermore, their applications as potentiometricion sensing are emphasised, along with their potential applications in optical sensors or optodes.

  19. Asymmetric Aminalization via Cation-Binding Catalysis

    DEFF Research Database (Denmark)

    Park, Sang Yeon; Liu, Yidong; Oh, Joong Suk

    2018-01-01

    Asymmetric cation-binding catalysis, in principle, can generate "chiral" anionic nucleophiles, where the counter cations are coordinated within chiral environments. Nitrogen-nucleophiles are intrinsically basic, therefore, its use as nucleophiles is often challenging and limiting the scope of the...

  20. Skeletal muscle Kv7 (KCNQ) channels in myoblast differentiation and proliferation

    International Nuclear Information System (INIS)

    Roura-Ferrer, Meritxell; Sole, Laura; Martinez-Marmol, Ramon; Villalonga, Nuria; Felipe, Antonio

    2008-01-01

    Voltage-dependent K + channels (Kv) are involved in myocyte proliferation and differentiation by triggering changes in membrane potential and regulating cell volume. Since Kv7 channels may participate in these events, the purpose of this study was to investigate whether skeletal muscle Kv7.1 and Kv7.5 were involved during proliferation and myogenesis. Here we report that, while myotube formation did not regulate Kv7 channels, Kv7.5 was up-regulated during cell cycle progression. Although, Kv7.1 mRNA also increased during the G 1 -phase, pharmacological evidence mainly involves Kv7.5 in myoblast growth. Our results indicate that the cell cycle-dependent expression of Kv7.5 is involved in skeletal muscle cell proliferation

  1. Inhibitory effect of calcium channel blockers on proliferation of human glioma cells in vitro

    International Nuclear Information System (INIS)

    Kunert-Radek, J.; Stepien, H.; Lyson, K.; Pawlikowski, M.; Radek, A.

    1989-01-01

    The effects of 2 specific calcium channel blockers, verapamil and nimodipine, on the proliferation of human glioma tumour cells were investigated in vitro. Tumour tissues for primary cell cultures were obtained bioptically from 3 patients with the histopathological diagnosis of glioblastoma. The [ 3 H]-thymidine incorporation into glioma tumour cells DNA was used as a sensitive index of the cell proliferation. It was found that varapamil (10 4 -10 5 M) and nimodipine (10 4 -10 6 M) significantly inhibited the [ 3 H]-thymidine uptake in a dose-related manner. The inhibitory effect of both calcium channel antagonists was reversed by stimultancous addition of calcium chloride (5x10 3 M). These results indicate that verapamil and nimodipine may exert an antiproliferative effect on glioma cells growth acting through a blokade of specific voltage-dependent calcium channels. (author)

  2. Structural and energetic study of cation-π-cation interactions in proteins.

    Science.gov (United States)

    Pinheiro, Silvana; Soteras, Ignacio; Gelpí, Josep Lluis; Dehez, François; Chipot, Christophe; Luque, F Javier; Curutchet, Carles

    2017-04-12

    Cation-π interactions of aromatic rings and positively charged groups are among the most important interactions in structural biology. The role and energetic characteristics of these interactions are well established. However, the occurrence of cation-π-cation interactions is an unexpected motif, which raises intriguing questions about its functional role in proteins. We present a statistical analysis of the occurrence, composition and geometrical preferences of cation-π-cation interactions identified in a set of non-redundant protein structures taken from the Protein Data Bank. Our results demonstrate that this structural motif is observed at a small, albeit non-negligible frequency in proteins, and suggest a preference to establish cation-π-cation motifs with Trp, followed by Tyr and Phe. Furthermore, we have found that cation-π-cation interactions tend to be highly conserved, which supports their structural or functional role. Finally, we have performed an energetic analysis of a representative subset of cation-π-cation complexes combining quantum-chemical and continuum solvation calculations. Our results point out that the protein environment can strongly screen the cation-cation repulsion, leading to an attractive interaction in 64% of the complexes analyzed. Together with the high degree of conservation observed, these results suggest a potential stabilizing role in the protein fold, as demonstrated recently for a miniature protein (Craven et al., J. Am. Chem. Soc. 2016, 138, 1543). From a computational point of view, the significant contribution of non-additive three-body terms challenges the suitability of standard additive force fields for describing cation-π-cation motifs in molecular simulations.

  3. MARKETING CHANNELS

    Directory of Open Access Journals (Sweden)

    Ljiljana Stošić Mihajlović

    2014-07-01

    Full Text Available Marketing channel is a set of entities and institutions, completion of distribution and marketing activities, attend the efficient and effective networking of producers and consumers. Marketing channels include the total flows of goods, money and information taking place between the institutions in the system of marketing, establishing a connection between them. The functions of the exchange, the physical supply and service activities, inherent in the system of marketing and trade. They represent paths which products and services are moving after the production, which will ultimately end up buying and eating by the user.

  4. Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions.

    Science.gov (United States)

    Kang, Bok Eum; Baker, Bradley J

    2016-04-04

    An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response.

  5. Exploring backbone-cation alkyl spacers for multi-cation side chain anion exchange membranes

    Science.gov (United States)

    Zhu, Liang; Yu, Xuedi; Hickner, Michael A.

    2018-01-01

    In order to systematically study how the arrangement of cations on the side chain and length of alkyl spacers between cations impact the performance of multi-cation AEMs for alkaline fuel cells, a series of polyphenylene oxide (PPO)-based AEMs with different cationic side chains were synthesized. This work resulted in samples with two or three cations in a side chain pendant to the PPO backbone. More importantly, the length of the spacer between cations varied from 3 methylene (-CH2-) (C3) groups to 8 methylene (C8) groups. The highest conductivity, up to 99 mS/cm in liquid water at room temperature, was observed for the triple-cation side chain AEM with pentyl (C5) or hexyl (C6) spacers. The multi-cation AEMs were found to have decreased water uptake and ionic conductivity when the spacer chains between cations were lengthened from pentyl (C5) or hexyl (C6) to octyl (C8) linking groups. The triple-cation membranes with pentyl (C5) or hexyl (C6) groups between cations showed greatest stability after immersion in 1 M NaOH at 80 °C for 500 h.

  6. Protein structure and ionic selectivity in calcium channels: Selectivity filter size, not shape, matters

    OpenAIRE

    Malasics, Attila; Gillespie, Dirk; Nonner, Wolfgang; Henderson, Douglas; Eisenberg, Bob; Boda, Dezső

    2009-01-01

    Calcium channels have highly charged selectivity filters (4 COO− groups) that attract cations in to balance this charge and minimize free energy, forcing the cations (Na+ and Ca2+) to compete for space in the filter. A reduced model was developed to better understand the mechanism of ion selectivity in calcium channels. The charge/space competition (CSC) mechanism implies that Ca2+ is more efficient in balancing the charge of the filter because it provides twice the charge as Na+ while occupy...

  7. Calcium homeostasis modulator (CALHM) ion channels.

    Science.gov (United States)

    Ma, Zhongming; Tanis, Jessica E; Taruno, Akiyuki; Foskett, J Kevin

    2016-03-01

    Calcium homeostasis modulator 1 (CALHM1), formerly known as FAM26C, was recently identified as a physiologically important plasma membrane ion channel. CALHM1 and its Caenorhabditis elegans homolog, CLHM-1, are regulated by membrane voltage and extracellular Ca(2+) concentration ([Ca(2+)]o). In the presence of physiological [Ca(2+)]o (∼1.5 mM), CALHM1 and CLHM-1 are closed at resting membrane potentials but can be opened by strong depolarizations. Reducing [Ca(2+)]o increases channel open probability, enabling channel activation at negative membrane potentials. Together, voltage and Ca(2+) o allosterically regulate CALHM channel gating. Through convergent evolution, CALHM has structural features that are reminiscent of connexins and pannexins/innexins/LRRC8 (volume-regulated anion channel (VRAC)) gene families, including four transmembrane helices with cytoplasmic amino and carboxyl termini. A CALHM1 channel is a hexamer of CALHM1 monomers with a functional pore diameter of ∼14 Å. CALHM channels discriminate poorly among cations and anions, with signaling molecules including Ca(2+) and ATP able to permeate through its pore. CALHM1 is expressed in the brain where it plays an important role in cortical neuron excitability induced by low [Ca(2+)]o and in type II taste bud cells in the tongue that sense sweet, bitter, and umami tastes where it functions as an essential ATP release channel to mediate nonsynaptic neurotransmitter release. CLHM-1 is expressed in C. elegans sensory neurons and body wall muscles, and its genetic deletion causes locomotion defects. Thus, CALHM is a voltage- and Ca(2+) o-gated ion channel, permeable to large cations and anions, that plays important roles in physiology.

  8. Kv1 channels and neural processing in vestibular calyx afferents

    Directory of Open Access Journals (Sweden)

    Frances L Meredith

    2015-06-01

    Full Text Available Potassium-selective ion channels are important for accurate transmission of signals from auditory and vestibular sensory end organs to their targets in the central nervous system. During different gravity conditions, astronauts experience altered input signals from the peripheral vestibular system resulting in sensorimotor dysfunction. Adaptation to altered sensory input occurs, but it is not explicitly known whether this involves synaptic modifications within the vestibular epithelia. Future investigations of such potential plasticity require a better understanding of the electrophysiological mechanisms underlying the known heterogeneity of afferent discharge under normal conditions. This study advances this understanding by examining the role of the Kv1 potassium channel family in mediating action potentials in specialized vestibular afferent calyx endings in the gerbil crista and utricle. Pharmacological agents selective for different sub-types of Kv1 channels were tested on membrane responses in whole cell recordings in the crista. Kv1 channels sensitive to α-dendrotoxin and dendrotoxin-K were found to prevail in the central regions, whereas K+ channels sensitive to margatoxin, which blocks Kv1.3 and 1.6 channels, were more prominent in peripheral regions. Margatoxin-sensitive currents showed voltage-dependent inactivation. Dendrotoxin-sensitive currents showed no inactivation and dampened excitability in calyces in central neuroepithelial regions. The differential distribution of Kv1 potassium channels in vestibular afferents supports their importance in accurately relaying gravitational and head movement signals through specialized lines to the central nervous system. Pharmacological modulation of specific groups of K+ channels could help alleviate vestibular dysfunction on earth and in space.

  9. Kv1 channels and neural processing in vestibular calyx afferents.

    Science.gov (United States)

    Meredith, Frances L; Kirk, Matthew E; Rennie, Katherine J

    2015-01-01

    Potassium-selective ion channels are important for accurate transmission of signals from auditory and vestibular sensory end organs to their targets in the central nervous system. During different gravity conditions, astronauts experience altered input signals from the peripheral vestibular system resulting in sensorimotor dysfunction. Adaptation to altered sensory input occurs, but it is not explicitly known whether this involves synaptic modifications within the vestibular epithelia. Future investigations of such potential plasticity require a better understanding of the electrophysiological mechanisms underlying the known heterogeneity of afferent discharge under normal conditions. This study advances this understanding by examining the role of the Kv1 potassium channel family in mediating action potentials in specialized vestibular afferent calyx endings in the gerbil crista and utricle. Pharmacological agents selective for different sub-types of Kv1 channels were tested on membrane responses in whole cell recordings in the crista. Kv1 channels sensitive to α-dendrotoxin and dendrotoxin-K were found to prevail in the central regions, whereas K(+) channels sensitive to margatoxin, which blocks Kv1.3 and 1.6 channels, were more prominent in peripheral regions. Margatoxin-sensitive currents showed voltage-dependent inactivation. Dendrotoxin-sensitive currents showed no inactivation and dampened excitability in calyces in central neuroepithelial regions. The differential distribution of Kv1 potassium channels in vestibular afferents supports their importance in accurately relaying gravitational and head movement signals through specialized lines to the central nervous system. Pharmacological modulation of specific groups of K(+) channels could help alleviate vestibular dysfunction on earth and in space.

  10. CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

    Directory of Open Access Journals (Sweden)

    Samuel eGoodchild

    2012-06-01

    Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

  11. Cation transport in isomeric pentanes

    International Nuclear Information System (INIS)

    Gyoergy, Istvan; Gee, Norman; Freeman, G.R.

    1985-01-01

    The cation mobility μsub(+) is measured in n-pentane, isopentane, neo-pentane, and mixtures of n- and neo-pentane over conditions from the normal liquid, through the critical fluid, to the low density gas. Most of the liquid data correlate with the reduced temperature T/Tsub(c). The T/Tsub(c) reflects free volume and viscosity changes. Comparison is made to neutral molecule diffusion. The transition from viscosity control of mobility in the liquid to density control in the dilute gas occurs over the reduced viscosity region 3 > eta/etasub(c) > 0.6, which corresponds to the reduced density region 1.9 > eta/etasub(c) > 0.5. In the saturated gas etaμsub(+) is similar in all pentanes, but iso- approximately> n- > neo-pentane. At constant density dμsub(+)/dT >= 0 for gases. The average gas nμsub(+) is similar in all pentanes, but iso- approximately> n- > neo-pentane. At constant density dμsub(+)/dT >= 0 for gases. The average momentum transfer cross sections in the n-/neo-pentane mixtures are similar to those in neo-pentane at low T but similar to those in n-pentane at high T. The present findings are combined with previous electron mobility data in addressing the effect of hydrocarbon molecular (external) shape on the electric breakdown strength of gases

  12. Cationic Bolaamphiphiles for Gene Delivery

    Science.gov (United States)

    Tan, Amelia Li Min; Lim, Alisa Xue Ling; Zhu, Yiting; Yang, Yi Yan; Khan, Majad

    2014-05-01

    Advances in medical research have shed light on the genetic cause of many human diseases. Gene therapy is a promising approach which can be used to deliver therapeutic genes to treat genetic diseases at its most fundamental level. In general, nonviral vectors are preferred due to reduced risk of immune response, but they are also commonly associated with low transfection efficiency and high cytotoxicity. In contrast to viral vectors, nonviral vectors do not have a natural mechanism to overcome extra- and intracellular barriers when delivering the therapeutic gene into cell. Hence, its design has been increasingly complex to meet challenges faced in targeting of, penetration of and expression in a specific host cell in achieving more satisfactory transfection efficiency. Flexibility in design of the vector is desirable, to enable a careful and controlled manipulation of its properties and functions. This can be met by the use of bolaamphiphile, a special class of lipid. Unlike conventional lipids, bolaamphiphiles can form asymmetric complexes with the therapeutic gene. The advantage of having an asymmetric complex lies in the different purposes served by the interior and exterior of the complex. More effective gene encapsulation within the interior of the complex can be achieved without triggering greater aggregation of serum proteins with the exterior, potentially overcoming one of the great hurdles faced by conventional single-head cationic lipids. In this review, we will look into the physiochemical considerations as well as the biological aspects of a bolaamphiphile-based gene delivery system.

  13. Stressor states and the cation crossroads.

    Science.gov (United States)

    Weber, Karl T; Bhattacharya, Syamal K; Newman, Kevin P; Soberman, Judith E; Ramanathan, Kodangudi B; McGee, Jesse E; Malik, Kafait U; Hickerson, William L

    2010-12-01

    Neurohormonal activation involving the hypothalamic-pituitary-adrenal axis and adrenergic nervous and renin-angiotensin-aldosterone systems is integral to stressor state-mediated homeostatic responses. The levels of effector hormones, depending upon the degree of stress, orchestrate the concordant appearance of hypokalemia, ionized hypocalcemia and hypomagnesemia, hypozincemia, and hyposelenemia. Seemingly contradictory to homeostatic responses wherein the constancy of extracellular fluid would be preserved, upregulation of cognate-binding proteins promotes coordinated translocation of cations to injured tissues, where they participate in wound healing. Associated catecholamine-mediated intracellular cation shifts regulate the equilibrium between pro-oxidants and antioxidant defenses, a critical determinant of cell survival. These acute and chronic stressor-induced iterations in extracellular and intracellular cations are collectively referred to as the cation crossroads. Intracellular cation shifts, particularly excessive accumulation of Ca2+, converge on mitochondria to induce oxidative stress and raise the opening potential of their inner membrane permeability transition pores (mPTPs). The ensuing loss of cationic homeostasis and adenosine triphosphate (ATP) production, together with osmotic swelling, leads to organellar degeneration and cellular necrosis. The overall impact of iterations in extracellular and intracellular cations and their influence on cardiac redox state, cardiomyocyte survival, and myocardial structure and function are addressed herein.

  14. Identification of an HV 1 voltage-gated proton channel in insects.

    Science.gov (United States)

    Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

    2016-04-01

    The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

  15. Properties of Single K+ and Cl− Channels in Asclepias tuberosa Protoplasts 1

    Science.gov (United States)

    Schauf, Charles L.; Wilson, Kathryn J.

    1987-01-01

    Potassium and chloride channels were characterized in Asclepias tuberosa suspension cell derived protoplasts by patch voltage-clamp. Whole-cell currents and single channels in excised patches had linear instantaneous current-voltage relations, reversing at the Nernst potentials for K+ and Cl−, respectively. Whole cell K+ currents activated exponentially during step depolarizations, while voltage-dependent Cl− channels were activated by hyperpolarizations. Single K+ channel conductance was 40 ± 5 pS with a mean open time of 4.5 milliseconds at 100 millivolts. Potassium channels were blocked by Cs+ and tetraethylammonium, but were insensitive to 4-aminopyridine. Chloride channels had a single-channel conductance of 100 ± 17 picosiemens, mean open time of 8.8 milliseconds, and were blocked by Zn2+ and ethacrynic acid. Whole-cell Cl− currents were inhibited by abscisic acid, and were unaffected by indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid. Since internal and external composition can be controlled, patch-clamped protoplasts are ideal systems for studying the role of ion channels in plant physiology and development. Images Fig. 5 PMID:16665712

  16. Cation distributions on rapidly solidified cobalt ferrite

    Science.gov (United States)

    De Guire, Mark R.; Kalonji, Gretchen; O'Handley, Robert C.

    1990-01-01

    The cation distributions in two rapidly solidified cobalt ferrites have been determined using Moessbauer spectroscopy at 4.2 K in an 8-T magnetic field. The samples were obtained by gas atomization of a Co0-Fe2O3-P2O5 melt. The degree of cation disorder in both cases was greater than is obtainable by cooling unmelted cobalt ferrite. The more rapidly cooled sample exhibited a smaller departure from the equilibrium cation distribution than did the more slowly cooled sample. This result is explained on the basis of two competing effects of rapid solidification: high cooling rate of the solid, and large undercooling.

  17. Radioimmunoassay of human eosinophil cationic protein

    International Nuclear Information System (INIS)

    Venge, P.; Roxin, L.E.; Olsson, I.

    1977-01-01

    A radioimmunosorbent assay has been developed which allows the detection in serum of a cationic protein derived from eosinophil granulocytes. In 34 healthy individuals the mean level was 31 μg/l. with a range of 5 to 55 μg/l. The serum concentration of 'eosinophil' cationic protein was correlated (P<0.001) to the number of eosinophil granulocytes in peripheral blood. Quantitiation of 'eosinophil' cationic protein in serum might be useful in the study of eosinophil granulocyte turnover and function in vivo. (author)

  18. Channel Power in Multi-Channel Environments

    NARCIS (Netherlands)

    M.G. Dekimpe (Marnik); B. Skiera (Bernd)

    2004-01-01

    textabstractIn the literature, little attention has been paid to instances where companies add an Internet channel to their direct channel portfolio. However, actively managing multiple sales channels requires knowing the customers’ channel preferences and the resulting channel power. Two key

  19. Cationic PAMAM dendrimers as pore-blocking binary toxin inhibitors.

    Science.gov (United States)

    Förstner, Philip; Bayer, Fabienne; Kalu, Nnanya; Felsen, Susanne; Förtsch, Christina; Aloufi, Abrar; Ng, David Y W; Weil, Tanja; Nestorovich, Ekaterina M; Barth, Holger

    2014-07-14

    Dendrimers are unique highly branched macromolecules with numerous groundbreaking biomedical applications under development. Here we identified poly(amido amine) (PAMAM) dendrimers as novel blockers for the pore-forming B components of the binary anthrax toxin (PA63) and Clostridium botulinum C2 toxin (C2IIa). These pores are essential for delivery of the enzymatic A components of the internalized toxins from endosomes into the cytosol of target cells. We demonstrate that at low μM concentrations cationic PAMAM dendrimers block PA63 and C2IIa to inhibit channel-mediated transport of the A components, thereby protecting HeLa and Vero cells from intoxication. By channel reconstitution and high-resolution current recording, we show that the PAMAM dendrimers obstruct transmembrane PA63 and C2IIa pores in planar lipid bilayers at nM concentrations. These findings suggest a new potential role for the PAMAM dendrimers as effective polyvalent channel-blocking inhibitors, which can protect human target cells from intoxication with binary toxins from pathogenic bacteria.

  20. Escitalopram block of hERG potassium channels.

    Science.gov (United States)

    Chae, Yun Ju; Jeon, Ji Hyun; Lee, Hong Joon; Kim, In-Beom; Choi, Jin-Sung; Sung, Ki-Wug; Hahn, Sang June

    2014-01-01

    Escitalopram, a selective serotonin reuptake inhibitor, is the pharmacologically active S-enantiomer of the racemic mixture of RS-citalopram and is widely used in the treatment of depression. The effects of escitalopram and citalopram on the human ether-a-go-go-related gene (hERG) channels expressed in human embryonic kidney cells were investigated using voltage-clamp and Western blot analyses. Both drugs blocked hERG currents in a concentration-dependent manner with an IC50 value of 2.6 μM for escitalopram and an IC50 value of 3.2 μM for citalopram. The blocking of hERG by escitalopram was voltage-dependent, with a steep increase across the voltage range of channel activation. However, voltage independence was observed over the full range of activation. The blocking by escitalopram was frequency dependent. A rapid application of escitalopram induced a rapid and reversible blocking of the tail current of hERG. The extent of the blocking by escitalopram during the depolarizing pulse was less than that during the repolarizing pulse, suggesting that escitalopram has a high affinity for the open state of the hERG channel, with a relatively lower affinity for the inactivated state. Both escitalopram and citalopram produced a reduction of hERG channel protein trafficking to the plasma membrane but did not affect the short-term internalization of the hERG channel. These results suggest that escitalopram blocked hERG currents at a supratherapeutic concentration and that it did so by preferentially binding to both the open and the inactivated states of the channels and by inhibiting the trafficking of hERG channel protein to the plasma membrane.

  1. Cationization of heparin for film applications

    Czech Academy of Sciences Publication Activity Database

    Šimkovic, I.; Mendichi, R.; Kelnar, Ivan; Filip, J.; Hricovíni, M.

    2015-01-01

    Roč. 115, 22 January (2015), s. 551-558 ISSN 0144-8617 Institutional support: RVO:61389013 Keywords : heparin * cationization * NMR Subject RIV: CD - Macromolecular Chemistry Impact factor: 4.219, year: 2015

  2. Test procedure for cation exchange chromatography

    International Nuclear Information System (INIS)

    Cooper, T.D.

    1994-01-01

    The purpose of this test plan is to demonstrate the synthesis of inorganic antimonate ion exchangers and compare their performance against the standard organic cation exchangers. Of particular interest is the degradation rate of both inorganic and organic cation exchangers. This degradation rate will be tracked by determining the ion exchange capacity and thermal stability as a function of time, radiation dose, and chemical reaction

  3. Cycloaliphatic epoxide resins for cationic UV - cure

    International Nuclear Information System (INIS)

    Verschueren, K.; Balwant Kaur

    1999-01-01

    This paper introduces the cyclo - aliphatic epoxide resins used for the various applications of radiation curing and their comparison with acrylate chemistry. Radiation curable coatings and inks are pre - dominantly based on acrylate chemistry but over the last few years, cationic chemistry has emerged successfully with the unique properties inherent with cyclo - aliphatic epoxide ring structures. Wide variety of cationic resins and diluents, the formulation techniques to achieve the desired properties greatly contributes to the advancement of UV - curing technology

  4. Chemical reactivity of cation-exchanged zeolites

    OpenAIRE

    Pidko, E.A.

    2008-01-01

    Zeolites modified with metal cations have been extensively studied during the last two decades because of their wide application in different technologically important fields such as catalysis, adsorption and gas separation. Contrary to the well-understood mechanisms of chemical reactions catalyzed by Brønsted acid sites in the hydrogen forms of zeolites, the nature of chemical reactivity, and related, the structure of the metal-containing ions in cation-exchanged zeolites remains the subject...

  5. Restructuring of a peat in interaction with multivalent cations: effect of cation type and aging time.

    Science.gov (United States)

    Kunhi Mouvenchery, Yamuna; Jaeger, Alexander; Aquino, Adelia J A; Tunega, Daniel; Diehl, Dörte; Bertmer, Marko; Schaumann, Gabriele Ellen

    2013-01-01

    It is assumed to be common knowledge that multivalent cations cross-link soil organic matter (SOM) molecules via cation bridges (CaB). The concept has not been explicitly demonstrated in solid SOM by targeted experiments, yet. Therefore, the requirements for and characteristics of CaB remain unidentified. In this study, a combined experimental and molecular modeling approach was adopted to investigate the interaction of cations on a peat OM from physicochemical perspective. Before treatment with salt solutions of Al(3+), Ca(2+) or Na(+), respectively, the original exchangeable cations were removed using cation exchange resin. Cation treatment was conducted at two different values of pH prior to adjusting pH to 4.1. Cation sorption is slower (>2 h) than deprotonation of functional groups (cation addition and decreased with increasing cation valency. Sorption coefficients were similar for all cations and at both pH. This contradicts the general expectations for electrostatic interactions, suggesting that not only the interaction chemistry but also spatial distribution of functional groups in OM determines binding of cations in this peat. The reaction of contact angle, matrix rigidity due to water molecule bridges (WaMB) and molecular mobility of water (NMR analysis) suggested that cross-linking via CaB has low relevance in this peat. This unexpected finding is probably due to the low cation exchange capacity, resulting in low abundance of charged functionalities. Molecular modeling demonstrates that large average distances between functionalities (∼3 nm in this peat) cannot be bridged by CaB-WaMB associations. However, aging strongly increased matrix rigidity, suggesting successive increase of WaMB size to connect functionalities and thus increasing degree of cross-linking by CaB-WaMB associations. Results thus demonstrated that the physicochemical structure of OM is decisive for CaB and aging-induced structural reorganisation can enhance cross-link formation.

  6. Formation of radical cations of diaryloxadiazoles

    International Nuclear Information System (INIS)

    Helmstreit, W.

    1988-01-01

    The nature of the formation of the radical cation of the 2,5-bis-(p-diethylaminophenyl)-1,3,4-oxadiazole (PC) in liquid n-butyl chloride and acetonitrile has been investigated by observing excited state fluorescence and transient absorption using nanosecond pulse radiolysis and laser flash photolysis. The formation of solute oxonium ions has also been observed. At concentrations -4 mol dm -3 the growth time at which the transient absorption of the radical cation reaches the maximum follows the rise time of the electron pulse ( 2 laser yields the solute radical cation in an acetonitrile solution of 2 x 10 -4 mol dm -3 PC via an electronically excited state. Here, the generation time was smaller than 5 ns. The yield of the cation is increased by addition of CCl 4 . A reaction mechanism is proposed that explains the fast cation formation in terms of an exciplex formed by interaction between an electronically excited state of diaryloxadiazole and the ground state of the solvent. This exciplex yields the solute radical cation. (author)

  7. Luminescent sulfides of monovalent and trivalent cations

    International Nuclear Information System (INIS)

    1975-01-01

    The invention discloses a family of luminescent materials or phosphors having a rhombohedral crystal structure and consisting essentially of a mixed host sulfide of at least one monovalent host cation and at least one trivalent host cation, and containing, for each mole of phosphor, 0.0005 to 0.05 mole of at least one activating cation. The monovalent host cations may be Na, K or Rb and Cs. The trivalent host cations may be Gd, La, Lu, Sc and Y. The activating cations may be one or more of trivalent As, Bi, Ce, Dy, Er, Pr, Sb, Sm, Tb and Tm; divalent Lu, Mn, Pb and Sn; and monovalent Ag, Cu and Tl. The novel phosphors may be used in devices to convert electron-beam, ultraviolet or x-ray energy to light in the visible spectrum. Such energy conversion can be employed for example in fluoroscopic screens, and in viewing screens of cathode-ray tubes and other electron tubes

  8. Multi-signalling cation sensing behaviour of a bis(pyridin-2-yl methyl)aniline based hetarylazo dye

    International Nuclear Information System (INIS)

    Kaur, Paramjit; Sareen, Divya; Kaur, Mandeep; Singh, Kamaljit

    2013-01-01

    Graphical abstract: The chromogenic and electrochemical behaviour of bis(pyridine-2-yl methyl)aniline based hetarylazo dye gets perturbed in the presence of cations, most effective being Cu 2+ . The conversion of ICT to ICT/MLCT is witnessed by TD-DFT calculations. -- Highlights: •Cation sensing of hetarylazo dye based upon visual, absorption and electrochemical changes is described. •Sensing mechanism is based upon perturbation in intramolecular charge-transfer upon interaction with cations. •Sensing protocol is supported by 1 H NMR studies as well as theoretical calculations. •Hetarylazo dye acts as a multichannel sensor. •Response of the dye towards various cations has also been explored in acidic pH window. -- Abstract: We investigated the cation sensing behaviour of a bis(pyridin-2-yl methyl)aniline appended hetarylazo dye via chromogenic and electrochemical transduction channels. The binding pocket constituting both the pyridyl as well as aniline nitrogen atoms acts as recognition site for the cations and consequent perturbation in the intramolecular charge-transfer prevailing in the dye results in the chromogenic response manifested in the form of hypsochromic shift in the intramolecular charge-transfer band and the attendant naked-eye color changes. The dye exhibits significant changes in its electrochemical behaviour in the presence of cations. The experimental results are also rationalized by time-dependent density functional theory (TD-DFT) calculations

  9. Divalent cation shrinks DNA but inhibits its compaction with trivalent cation.

    Science.gov (United States)

    Tongu, Chika; Kenmotsu, Takahiro; Yoshikawa, Yuko; Zinchenko, Anatoly; Chen, Ning; Yoshikawa, Kenichi

    2016-05-28

    Our observation reveals the effects of divalent and trivalent cations on the higher-order structure of giant DNA (T4 DNA 166 kbp) by fluorescence microscopy. It was found that divalent cations, Mg(2+) and Ca(2+), inhibit DNA compaction induced by a trivalent cation, spermidine (SPD(3+)). On the other hand, in the absence of SPD(3+), divalent cations cause the shrinkage of DNA. As the control experiment, we have confirmed the minimum effect of monovalent cation, Na(+) on the DNA higher-order structure. We interpret the competition between 2+ and 3+ cations in terms of the change in the translational entropy of the counterions. For the compaction with SPD(3+), we consider the increase in translational entropy due to the ion-exchange of the intrinsic monovalent cations condensing on a highly charged polyelectrolyte, double-stranded DNA, by the 3+ cations. In contrast, the presence of 2+ cation decreases the gain of entropy contribution by the ion-exchange between monovalent and 3+ ions.

  10. β1 subunit stabilises sodium channel Nav1.7 against mechanical stress.

    Science.gov (United States)

    Körner, Jannis; Meents, Jannis; Machtens, Jan-Philipp; Lampert, Angelika

    2018-06-01

    The voltage-gated sodium channel Nav1.7 is a key player in neuronal excitability and pain signalling. In addition to voltage sensing, the channel is also modulated by mechanical stress. Using whole-cell patch-clamp experiments, we discovered that the sodium channel subunit β1 is able to prevent the impact of mechanical stress on Nav1.7. An intramolecular disulfide bond of β1 was identified to be essential for stabilisation of inactivation, but not activation, against mechanical stress using molecular dynamics simulations, homology modelling and site-directed mutagenesis. Our results highlight the role of segment 6 of domain IV in fast inactivation. We present a candidate mechanism for sodium channel stabilisation against mechanical stress, ensuring reliable channel functionality in living systems. Voltage-gated sodium channels are key players in neuronal excitability and pain signalling. Precise gating of these channels is crucial as even small functional alterations can lead to pathological phenotypes such as pain or heart failure. Mechanical stress has been shown to affect sodium channel activation and inactivation. This suggests that stabilising components are necessary to ensure precise channel gating in living organisms. Here, we show that mechanical shear stress affects voltage dependence of activation and fast inactivation of the Nav1.7 channel. Co-expression of the β1 subunit, however, protects both gating modes of Nav1.7 against mechanical shear stress. Using molecular dynamics simulation, homology modelling and site-directed mutagenesis, we identify an intramolecular disulfide bond of β1 (Cys21-Cys43) which is partially involved in this process: the β1-C43A mutant prevents mechanical modulation of voltage dependence of activation, but not of fast inactivation. Our data emphasise the unique role of segment 6 of domain IV for sodium channel fast inactivation and confirm previous reports that the intracellular process of fast inactivation can be

  11. The Voltage-Sensing Domain of Kv7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants

    Science.gov (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

    2010-01-01

    Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499

  12. The voltage-sensing domain of kv7.2 channels as a molecular target for epilepsy-causing mutations and anticonvulsants

    Directory of Open Access Journals (Sweden)

    Francesco eMiceli

    2011-02-01

    Full Text Available Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically-determined channelopathies affecting heart rhythm (arrhythmias, neuronal excitability (epilepsy, pain or skeletal muscle contraction (periodic paralysis. Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function.In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2-5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically-determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

  13. The Voltage-Sensing Domain of K(v)7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants.

    Science.gov (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

    2011-01-01

    Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

  14. Slick (Kcnt2 Sodium-Activated Potassium Channels Limit Peptidergic Nociceptor Excitability and Hyperalgesia

    Directory of Open Access Journals (Sweden)

    Danielle L Tomasello

    2017-09-01

    Full Text Available The Slick (Kcnt2 sodium-activated potassium (K Na channel is a rapidly gating and weakly voltage-dependent and sodium-dependent potassium channel with no clearly defined physiological function. Within the dorsal root ganglia (DRGs, we show Slick channels are exclusively expressed in small-sized and medium-sized calcitonin gene–related peptide (CGRP-containing DRG neurons, and a pool of channels are localized to large dense-core vesicles (LDCV-containing CGRP. We stimulated DRG neurons for CGRP release and found Slick channels contained within CGRP-positive LDCV translocated to the neuronal membrane. Behavioral studies in Slick knockout (KO mice indicated increased basal heat detection and exacerbated thermal hyperalgesia compared with wild-type littermate controls during neuropathic and chronic inflammatory pain. Electrophysiologic recordings of DRG neurons from Slick KO mice revealed that Slick channels contribute to outward current, propensity to fire action potentials (APs, and to AP properties. Our data suggest that Slick channels restrain the excitability of CGRP-containing neurons, diminishing pain behavior after inflammation and injury.

  15. Accelerators for forming cationic technetium complexes useful as radiodiagnostic images

    International Nuclear Information System (INIS)

    Tweedle, M.F.

    1985-01-01

    This invention relates to compositions for making cationic radiodiagnostic agents and, in particular, to accelerator compounds for labelling such cationic radiodiagnostic agents, kits for preparing such 99m Tc-labelled cationic radiodiagnostic agents with technetium, and methods for labelling such cationic radiodiagnostic agents with technetium

  16. Diclofenac distinguishes among homomeric and heteromeric potassium channels composed of KCNQ4 and KCNQ5 subunits.

    Science.gov (United States)

    Brueggemann, Lioubov I; Mackie, Alexander R; Martin, Jody L; Cribbs, Leanne L; Byron, Kenneth L

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V(0.5) values: -31, -44, and -38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels.

  17. Decreased expression of Kv7 channels in Hirchsprung's disease.

    Science.gov (United States)

    O'Donnell, Anne-Marie; Coyle, David; Puri, Prem

    2017-07-01

    Voltage-dependent K + channels (Kv channels) participate in electrical rhythmicity and smooth muscle responses and are regulated by excitatory and inhibitory neurotransmitters. Kv channels also participate in the interstitial cell of Cajal (ICC) and smooth muscle cell (SMC) responses to neural inputs. The Kv family consists of 12 subfamilies, Kv1-Kv12, with five members of the Kv7 family identified to date: Kv7.1-Kv7.5. A recent study identified the potassium channel Kv7.5 as having a role in the excitability of ICC-IM in the mouse colon. We therefore designed this study to test the hypothesis that Kv7 channels are present in the normal human colon and are reduced in Hirschprung's disease (HSCR). HSCR tissue specimens were collected at the time of pull-through surgery (n=10), while normal control tissue specimens were obtained at the time of colostomy closure in patients with imperforate anus (n=10). Kv7.3-Kv7.5 immunohistochemistry was performed and visualized using confocal microscopy to assess their distribution. Western blot analysis was undertaken to determine Kv7.3-Kv7.5 protein quantification. Kv7.3 and Kv7.4-immunoreactivity was co-localized with neuron and ICC markers, while Kv7.5 was found to be expressed on both ICCs and SMCs. Western blot analysis revealed similar levels of Kv7.3 and Kv7.5 expression in the normal colon and HSCR colon, while Kv7.4 proteins were found to be markedly decreased in ganglionic specimens and decreased further in aganglionic specimens. A deficiency of Kv7.4 channels in the ganglionic and aganglionic bowel may place a role in colonic dysmotility in HSCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Channelling and electromagnetic radiation of channelling particles

    International Nuclear Information System (INIS)

    Kalashnikov, N.

    1983-01-01

    A brief description is presented of the channelling of charged particles between atoms in the crystal lattice. The specificities are discussed of the transverse motion of channelling particles as are the origin and properties of quasi-characteristic radiation of channelling particles which accompany transfers from one band of permissible energies of the transverse motion of channelling particles to the other. (B.S.)

  19. [3H]PN200-110 and [3H]ryanodine binding and reconstitution of ion channel activity with skeletal muscle membranes

    International Nuclear Information System (INIS)

    Hamilton, S.L.; Alvarez, R.M.; Fill, M.; Hawkes, M.J.; Brush, K.L.; Schilling, W.P.; Stefani, E.

    1989-01-01

    Skeletal muscle membranes derived either from the tubular (T) network or from the sarcoplasmic reticulum (SR) were characterized with respect to the binding of the dihydropyridine, [ 3 H]PN200-110, and the alkaloid, [ 3 H]ryanodine; polypeptide composition; and ion channel activity. Conditions for optimizing the binding of these radioligands are discussed. A bilayer pulsing technique is described and is used to examine the channels present in these membranes. Fusion of T-tubule membranes into bilayers revealed the presence of chloride channels and dihydropyridine-sensitive calcium channels with three distinct conductances. The dihydropyridine-sensitive channels were further characterized with respect to their voltage dependence. Pulsing experiments indicated that two different populations of dihydropyridine-sensitive channels existed. Fusion of heavy SR vesicles revealed three different ion channels; the putative calcium release channel, a potassium channel, and a chloride channel. Thus, this fractionation procedure provides T-tubules and SR membranes which, with radioligand binding and single channel recording techniques, provide a useful tool to study the characteristics of skeletal muscle ion channels and their possible role in excitation-contraction coupling

  20. Gas phase chemistry of N-benzylbenzamides with silver(I) cations: characterization of benzylsilver cation.

    Science.gov (United States)

    Sun, Hezhi; Jin, Zhe; Quan, Hong; Sun, Cuirong; Pan, Yuanjiang

    2015-03-07

    The benzylsilver cation which emerges from the collisional dissociation of silver(I)-N-benzylbenzamide complexes was characterized by deuterium-labeling experiments, theoretical calculations, breakdown curves and substituent effects. The nucleophilic attack of the carbonyl oxygen on an α-hydrogen results in the generation of the benzylsilver cation, which is competitive to the AgH loss with the α-hydrogen.

  1. Single Ih channels in pyramidal neuron dendrites: properties, distribution, and impact on action potential output

    NARCIS (Netherlands)

    Kole, Maarten H. P.; Hallermann, Stefan; Stuart, Greg J.

    2006-01-01

    The hyperpolarization-activated cation current (Ih) plays an important role in regulating neuronal excitability, yet its native single-channel properties in the brain are essentially unknown. Here we use variance-mean analysis to study the properties of single Ih channels in the apical dendrites of

  2. Divalent Cations Regulate the Ion Conductance Properties of Diverse Classes of Aquaporins

    Directory of Open Access Journals (Sweden)

    Mohamad Kourghi

    2017-11-01

    Full Text Available Aquaporins (AQPs are known to facilitate water and solute fluxes across barrier membranes. An increasing number of AQPs are being found to serve as ion channels. Ion and water permeability of selected plant and animal AQPs (plant Arabidopsis thaliana AtPIP2;1, AtPIP2;2, AtPIP2;7, human Homo sapiens HsAQP1, rat Rattus norvegicus RnAQP4, RnAQP5, and fly Drosophila melanogaster DmBIB were expressed in Xenopus oocytes and examined in chelator-buffered salines to evaluate the effects of divalent cations (Ca2+, Mg2+, Ba2+ and Cd2+ on ionic conductances. AtPIP2;1, AtPIP2;2, HsAQP1 and DmBIB expressing oocytes had ionic conductances, and showed differential sensitivity to block by external Ca2+. The order of potency of inhibition by Ca2+ was AtPIP2;2 > AtPIP2;1 > DmBIB > HsAQP1. Blockage of the AQP cation channels by Ba2+ and Cd2+ caused voltage-sensitive outward rectification. The channels with the highest sensitivity to Ca2+ (AtPIP2;1 and AtPIP2;2 showed a distinctive relief of the Ca2+ block by co-application of excess Ba2+, suggesting that divalent ions act at the same site. Recognizing the regulatory role of divalent cations may enable the discovery of other classes of AQP ion channels, and facilitate the development of tools for modulating AQP ion channels. Modulators of AQPs have potential value for diverse applications including improving salinity tolerance in plants, controlling vector-borne diseases, and intervening in serious clinical conditions involving AQPs, such as cancer metastasis, cardiovascular or renal dysfunction.

  3. Zebrafish CaV2.1 Calcium Channels Are Tailored for Fast Synchronous Neuromuscular Transmission

    Science.gov (United States)

    Naranjo, David; Wen, Hua; Brehm, Paul

    2015-01-01

    The CaV2.2 (N-type) and CaV2.1 (P/Q-type) voltage-dependent calcium channels are prevalent throughout the nervous system where they mediate synaptic transmission, but the basis for the selective presence at individual synapses still remains an open question. The CaV2.1 channels have been proposed to respond more effectively to brief action potentials (APs), an idea supported by computational modeling. However, the side-by-side comparison of CaV2.1 and CaV2.2 kinetics in intact neurons failed to reveal differences. As an alternative means for direct functional comparison we expressed zebrafish CaV2.1 and CaV2.2 α-subunits, along with their accessory subunits, in HEK293 cells. HEK cells lack calcium currents, thereby circumventing the need for pharmacological inhibition of mixed calcium channel isoforms present in neurons. HEK cells also have a simplified morphology compared to neurons, which improves voltage control. Our measurements revealed faster kinetics and shallower voltage-dependence of activation and deactivation for CaV2.1. Additionally, recordings of calcium current in response to a command waveform based on the motorneuron AP show, directly, more effective activation of CaV2.1. Analysis of calcium currents associated with the AP waveform indicate an approximately fourfold greater open probability (PO) for CaV2.1. The efficient activation of CaV2.1 channels during APs may contribute to the highly reliable transmission at zebrafish neuromuscular junctions. PMID:25650925

  4. Dual regulation of the native ClC-K2 chloride channel in the distal nephron by voltage and pH.

    Science.gov (United States)

    Pinelli, Laurent; Nissant, Antoine; Edwards, Aurélie; Lourdel, Stéphane; Teulon, Jacques; Paulais, Marc

    2016-09-01

    ClC-K2, a member of the ClC family of Cl(-) channels and transporters, forms the major basolateral Cl(-) conductance in distal nephron epithelial cells and therefore plays a central role in renal Cl(-) absorption. However, its regulation remains largely unknown because of the fact that recombinant ClC-K2 has not yet been studied at the single-channel level. In the present study, we investigate the effects of voltage, pH, Cl(-), and Ca(2+) on native ClC-K2 in the basolateral membrane of intercalated cells from the mouse connecting tubule. The ∼10-pS channel shows a steep voltage dependence such that channel activity increases with membrane depolarization. Intracellular pH (pHi) and extracellular pH (pHo) differentially modulate the voltage dependence curve: alkaline pHi flattens the curve by causing an increase in activity at negative voltages, whereas alkaline pHo shifts the curve toward negative voltages. In addition, pHi, pHo, and extracellular Ca(2+) strongly increase activity, mainly because of an increase in the number of active channels with a comparatively minor effect on channel open probability. Furthermore, voltage alters both the number of active channels and their open probability, whereas intracellular Cl(-) has little influence. We propose that changes in the number of active channels correspond to them entering or leaving an inactivated state, whereas modulation of open probability corresponds to common gating by these channels. We suggest that pH, through the combined effects of pHi and pHo on ClC-K2, might be a key regulator of NaCl absorption and Cl(-)/HCO3 (-) exchange in type B intercalated cells. © 2016 Pinelli et al.

  5. Channel Modeling

    Science.gov (United States)

    Schmitz, Arne; Schinnenburg, Marc; Gross, James; Aguiar, Ana

    For any communication system the Signal-to-Interference-plus-Noise-Ratio of the link is a fundamental metric. Recall (cf. Chapter 9) that the SINR is defined as the ratio between the received power of the signal of interest and the sum of all "disturbing" power sources (i.e. interference and noise). From information theory it is known that a higher SINR increases the maximum possible error-free transmission rate (referred to as Shannon capacity [417] of any communication system and vice versa). Conversely, the higher the SINR, the lower will be the bit error rate in practical systems. While one aspect of the SINR is the sum of all distracting power sources, another issue is the received power. This depends on the transmitted power, the used antennas, possibly on signal processing techniques and ultimately on the channel gain between transmitter and receiver.

  6. Effect of Divalent Cations on RED Performance and Cation Exchange Membrane Selection to Enhance Power Densities.

    Science.gov (United States)

    Rijnaarts, Timon; Huerta, Elisa; van Baak, Willem; Nijmeijer, Kitty

    2017-11-07

    Reverse electrodialysis (RED) is a membrane-based renewable energy technology that can harvest energy from salinity gradients. The anticipated feed streams are natural river and seawater, both of which contain not only monovalent ions but also divalent ions. However, RED using feed streams containing divalent ions experiences lower power densities because of both uphill transport and increased membrane resistance. In this study, we investigate the effects of divalent cations (Mg 2+ and Ca 2+ ) on RED and demonstrate the mitigation of those effects using both novel and existing commercial cation exchange membranes (CEMs). Monovalent-selective Neosepta CMS is known to block divalent cations transport and can therefore mitigate reductions in stack voltage. The new multivalent-permeable Fuji T1 is able to transport divalent cations without a major increase in resistance. Both strategies significantly improve power densities compared to standard-grade CEMs when performing RED using streams containing divalent cations.

  7. Channeling experiment

    International Nuclear Information System (INIS)

    Abelin, H.; Birgersson, L.; Widen, H.; Aagren, T.; Moreno, L.; Neretnieks, I.

    1990-07-01

    Channeling of water flow and tracer transport in real fractures in a granite body at Stripa have been investigated experimentally. The experimental site was located 360 m below the ground level. Two kinds of experiments were performed. In the single hole experiments, 20 cm diameter holes were drilled about 2.5 m into the rock in the plane of the fracture. Specially designed packers were used to inject water into the fracture in 5 cm intervals all along the fracture trace in the hole. The variation of the injection flowrates along the fracture were used to determine the transmissivity variations in the fracture plane. Detailed photographs were taken from inside the hole and the visual fracture aperture was compared with the injection flowrates in the same locations. Geostatistical methods were used to evaluate the results. Five holes were measured in great detail. In addition 7 holes were drilled and scanned by simpler packer systems. A double hole experiment was performed where two parallel holes were drilled in the same fracture plane at nearly 2 m distance. Pressure pulse tests were made between the holes in both directions. Tracers were injected in 5 locations in one hole and monitored for in many locations in the other hole. The single hole experiment and the double hole experiment show that most of the fracture planes are tight but that there are open sections which form connected channels over distances of at least 2 meters. It was also found in the double hole experiment that the investigated fracture was intersected by at least one fracture between the two holes which diverted a large amount of the injected tracers to several distant locations at the tunnel wall. (authours)

  8. Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

    Science.gov (United States)

    Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

    2012-02-14

    Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

  9. Forging Colloidal Nanostructures via Cation Exchange Reactions.

    Science.gov (United States)

    De Trizio, Luca; Manna, Liberato

    2016-09-28

    Among the various postsynthesis treatments of colloidal nanocrystals that have been developed to date, transformations by cation exchange have recently emerged as an extremely versatile tool that has given access to a wide variety of materials and nanostructures. One notable example in this direction is represented by partial cation exchange, by which preformed nanocrystals can be either transformed to alloy nanocrystals or to various types of nanoheterostructures possessing core/shell, segmented, or striped architectures. In this review, we provide an up to date overview of the complex colloidal nanostructures that could be prepared so far by cation exchange. At the same time, the review gives an account of the fundamental thermodynamic and kinetic parameters governing these types of reactions, as they are currently understood, and outlines the main open issues and possible future developments in the field.

  10. Forging Colloidal Nanostructures via Cation Exchange Reactions

    Science.gov (United States)

    2016-01-01

    Among the various postsynthesis treatments of colloidal nanocrystals that have been developed to date, transformations by cation exchange have recently emerged as an extremely versatile tool that has given access to a wide variety of materials and nanostructures. One notable example in this direction is represented by partial cation exchange, by which preformed nanocrystals can be either transformed to alloy nanocrystals or to various types of nanoheterostructures possessing core/shell, segmented, or striped architectures. In this review, we provide an up to date overview of the complex colloidal nanostructures that could be prepared so far by cation exchange. At the same time, the review gives an account of the fundamental thermodynamic and kinetic parameters governing these types of reactions, as they are currently understood, and outlines the main open issues and possible future developments in the field. PMID:26891471

  11. Basally activated nonselective cation currents regulate the resting membrane potential in human and monkey colonic smooth muscle

    Science.gov (United States)

    Dwyer, Laura; Rhee, Poong-Lyul; Lowe, Vanessa; Zheng, Haifeng; Peri, Lauren; Ro, Seungil; Sanders, Kenton M.

    2011-01-01

    Resting membrane potential (RMP) plays an important role in determining the basal excitability of gastrointestinal smooth muscle. The RMP in colonic muscles is significantly less negative than the equilibrium potential of K+, suggesting that it is regulated not only by K+ conductances but by inward conductances such as Na+ and/or Ca2+. We investigated the contribution of nonselective cation channels (NSCC) to the RMP in human and monkey colonic smooth muscle cells (SMC) using voltage- and current-clamp techniques. Qualitative reverse transcriptase-polymerase chain reaction was performed to examine potential molecular candidates for these channels among the transient receptor potential (TRP) channel superfamily. Spontaneous transient inward currents and holding currents were recorded in human and monkey SMC. Replacement of extracellular Na+ with equimolar tetraethylammonium or Ca2+ with Mn2+ inhibited basally activated nonselective cation currents. Trivalent cations inhibited these channels. Under current clamp, replacement of extracellular Na+ with N-methyl-d-glucamine or addition of trivalent cations caused hyperpolarization. Three unitary conductances of NSCC were observed in human and monkey colonic SMC. Molecular candidates for basally active NSCC were TRPC1, C3, C4, C7, M2, M4, M6, M7, V1, and V2 in human and monkey SMC. Comparison of the biophysical properties of these TRP channels with basally active NSCC (bINSCC) suggests that TRPM4 and specific TRPC heteromultimer combinations may underlie the three single-channel conductances of bINSCC. In conclusion, these findings suggest that basally activated NSCC contribute to the RMP in human and monkey colonic SMC and therefore may play an important role in determining basal excitability of colonic smooth muscle. PMID:21566016

  12. Channel properties of Nax expressed in neurons.

    Directory of Open Access Journals (Sweden)

    Masahito Matsumoto

    Full Text Available Nax is a sodium-concentration ([Na+]-sensitive Na channel with a gating threshold of ~150 mM for extracellular [Na+] ([Na+]o in vitro. We previously reported that Nax was preferentially expressed in the glial cells of sensory circumventricular organs including the subfornical organ, and was involved in [Na+] sensing for the control of salt-intake behavior. Although Nax was also suggested to be expressed in the neurons of some brain regions including the amygdala and cerebral cortex, the channel properties of Nax have not yet been adequately characterized in neurons. We herein verified that Nax was expressed in neurons in the lateral amygdala of mice using an antibody that was newly generated against mouse Nax. To investigate the channel properties of Nax expressed in neurons, we established an inducible cell line of Nax using the mouse neuroblastoma cell line, Neuro-2a, which is endogenously devoid of the expression of Nax. Functional analyses of this cell line revealed that the [Na+]-sensitivity of Nax in neuronal cells was similar to that expressed in glial cells. The cation selectivity sequence of the Nax channel in cations was revealed to be Na+ ≈ Li+ > Rb+ > Cs+ for the first time. Furthermore, we demonstrated that Nax bound to postsynaptic density protein 95 (PSD95 through its PSD95/Disc-large/ZO-1 (PDZ-binding motif at the C-terminus in neurons. The interaction between Nax and PSD95 may be involved in promoting the surface expression of Nax channels because the depletion of endogenous PSD95 resulted in a decrease in Nax at the plasma membrane. These results indicated, for the first time, that Nax functions as a [Na+]-sensitive Na channel in neurons as well as in glial cells.

  13. Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

    Science.gov (United States)

    Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

    2018-01-01

    Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use

  14. Cortisone Dissociates the Shaker Family K Channels from their Beta Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Y.; Weng, J; Kabaleeswaran, V; Li, H; Cao, Y; Bholse, R; Zhou, M

    2008-01-01

    The Shaker family voltage-dependent potassium channels (Kv1) are expressed in a wide variety of cells and are essential for cellular excitability. In humans, loss-of-function mutations of Kv1 channels lead to hyperexcitability and are directly linked to episodic ataxia and atrial fibrillation. All Kv1 channels assemble with {Beta} subunits (Kv{Beta}s), and certain Kv{Beta}s, for example Kv{Beta}1, have an N-terminal segment that closes the channel by the N-type inactivation mechanism. In principle, dissociation of Kv{Beta}1, although never reported, should eliminate inactivation and thus potentiate Kv1 current. We found that cortisone increases rat Kv1 channel activity by binding to Kv{Beta}1. A crystal structure of the K{Beta}v-cortisone complex was solved to 1.82-{angstrom}resolution and revealed novel cortisone binding sites. Further studies demonstrated that cortisone promotes dissociation of Kv{Beta}. The new mode of channel modulation may be explored by native or synthetic ligands to fine-tune cellular excitability.

  15. Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family

    Science.gov (United States)

    2013-01-01

    Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829

  16. History-dependent dynamics in a generic model of ion channels - an analytic study

    Directory of Open Access Journals (Sweden)

    Daniel Soudry

    2010-04-01

    Full Text Available Recent experiments have demonstrated that the timescale of adaptation of single neurons and ion channel populations to stimuli slows down as the length of stimulation increases; in fact, no upper bound on temporal time-scales seems to exist in such systems. Furthermore, patch clamp experiments on single ion channels have hinted at the existence of large, mostly unobservable, inactivation state spaces within a single ion channel. This raises the question of the relation between this multitude of inactivation states and the observed behavior. In this work we propose a minimal model for ion channel dynamics which does not assume any specific structure of the inactivation state space. The model is simple enough to render an analytical study possible. This leads to a clear and concise explanation of the experimentally observed exponential history-dependent relaxation in sodium channels in a voltage clamp setting, and shows that their recovery rate from slow inactivation must be voltage dependent. Furthermore, we predict that history-dependent relaxation cannot be created by overly sparse spiking activity. While the model was created with ion channel populations in mind, its simplicity and genericalness render it a good starting point for modeling similar effects in other systems, and for scaling up to higher levels such as single neurons which are also known to exhibit multiple time scales.

  17. Induction of divalent cation permeability by heterologous expression of a voltage sensor domain.

    Science.gov (United States)

    Arima, Hiroki; Tsutsui, Hidekazu; Sakamoto, Ayako; Yoshida, Manabu; Okamura, Yasushi

    2018-01-06

    The voltage sensor domain (VSD) is a protein domain that confers sensitivity to membrane potential in voltage-gated ion channels as well as the voltage-sensing phosphatase. Although VSDs have long been considered to function as regulatory units acting on adjacent effectors, recent studies have revealed the existence of direct ion permeation paths in some mutated VSDs and in the voltage-gated proton channel. In this study, we show that calcium currents are evoked upon membrane hyperpolarization in cells expressing a VSD derived from an ascidian voltage-gated ion channel superfamily. Unlike the previously reported omega-pore in the Shaker K + channel and rNav1.4, mutations are not required. From electrophysiological experiments in heterologous expression systems, we found that the conductance is directly mediated by the VSD itself and is carried by both monovalent and divalent cations. This is the first report of divalent cation permeation through a VSD-like structure. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Dissociation of protonated N-(3-phenyl-2H-chromen-2-ylidene)-benzenesulfonamide in the gas phase: cyclization via sulfonyl cation transfer.

    Science.gov (United States)

    Wang, Shanshan; Dong, Cheng; Yu, Lian; Guo, Cheng; Jiang, Kezhi

    2016-01-15

    In the tandem mass spectrometry of protonated N-(3-phenyl-2H-chromen-2-ylidene)benzenesulfonamides, the precursor ions have been observed to undergo gas-phase dissociation via two competing channels: (a) the predominant channel involves migration of the sulfonyl cation to the phenyl C atom and the subsequent loss of benzenesulfinic acid along with cyclization reaction, and (b) the minor one involves dissociation of the precursor ion to give an ion/neutral complex of [sulfonyl cation/imine], followed by decomposition to afford sulfonyl cation or the INC-mediated electron transfer to give an imine radical cation. The proposed reaction channels have been supported by theoretical calculations and D-labeling experiments. The gas-phase cyclization reaction originating from the N- to C-sulfonyl cation transfer has been first reported to the best of our knowledge. For the substituted sulfonamides, the presence of electron-donating groups (R(2) -) at the C-ring effectively facilitates the reaction channel of cyclization reaction, whereas that of electron-withdrawing groups inhibits this pathway. Copyright © 2015 John Wiley & Sons, Ltd.

  19. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford

    2016-05-01

    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  20. TRP channel proteins and signal transduction.

    Science.gov (United States)

    Minke, Baruch; Cook, Boaz

    2002-04-01

    TRP channel proteins constitute a large and diverse family of proteins that are expressed in many tissues and cell types. This family was designated TRP because of a spontaneously occurring Drosophila mutant lacking TRP that responded to a continuous light with a transient receptor potential (hence TRP). In addition to responses to light, TRPs mediate responses to nerve growth factor, pheromones, olfaction, mechanical, chemical, temperature, pH, osmolarity, vasorelaxation of blood vessels, and metabolic stress. Furthermore, mutations in several members of TRP-related channel proteins are responsible for several diseases, such as several tumors and neurodegenerative disorders. TRP-related channel proteins are found in a variety of organisms, tissues, and cell types, including nonexcitable, smooth muscle, and neuronal cells. The large functional diversity of TRPs is also reflected in their diverse permeability to ions, although, in general, they are classified as nonselective cationic channels. The molecular domains that are conserved in all members of the TRP family constitute parts of the transmembrane domains and in most members also the ankyrin-like repeats at the NH2 terminal of the protein and a "TRP domain" at the COOH terminal, which is a highly conserved 25-amino acid stretch with still unknown function. All of the above features suggest that members of the TRP family are "special assignment" channels, which are recruited to diverse signaling pathways. The channels' roles and characteristics such as gating mechanism, regulation, and permeability are determined by evolution according to the specific functional requirements.

  1. A novel potassium channel in photosynthetic cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Manuela Zanetti

    Full Text Available Elucidation of the structure-function relationship of a small number of prokaryotic ion channels characterized so far greatly contributed to our knowledge on basic mechanisms of ion conduction. We identified a new potassium channel (SynK in the genome of the cyanobacterium Synechocystis sp. PCC6803, a photosynthetic model organism. SynK, when expressed in a K(+-uptake-system deficient E. coli strain, was able to recover growth of these organisms. The protein functions as a potassium selective ion channel when expressed in Chinese hamster ovary cells. The location of SynK in cyanobacteria in both thylakoid and plasmamembranes was revealed by immunogold electron microscopy and Western blotting of isolated membrane fractions. SynK seems to be conserved during evolution, giving rise to a TPK (two-pore K(+ channel family member which is shown here to be located in the thylakoid membrane of Arabidopsis. Our work characterizes a novel cyanobacterial potassium channel and indicates the molecular nature of the first higher plant thylakoid cation channel, opening the way to functional studies.

  2. Elementary properties of CaV1.3 Ca(2+) channels expressed in mouse cochlear inner hair cells.

    Science.gov (United States)

    Zampini, Valeria; Johnson, Stuart L; Franz, Christoph; Lawrence, Neil D; Münkner, Stefan; Engel, Jutta; Knipper, Marlies; Magistretti, Jacopo; Masetto, Sergio; Marcotti, Walter

    2010-01-01

    Mammalian cochlear inner hair cells (IHCs) are specialized to process developmental signals during immature stages and sound stimuli in adult animals. These signals are conveyed onto auditory afferent nerve fibres. Neurotransmitter release at IHC ribbon synapses is controlled by L-type Ca(V)1.3 Ca(2+) channels, the biophysics of which are still unknown in native mammalian cells. We have investigated the localization and elementary properties of Ca(2+) channels in immature mouse IHCs under near-physiological recording conditions. Ca(V)1.3 Ca(2+) channels at the cell pre-synaptic site co-localize with about half of the total number of ribbons present in immature IHCs. These channels activated at about 70 mV, showed a relatively short first latency and weak inactivation, which would allow IHCs to generate and accurately encode spontaneous Ca(2+) action potential activity characteristic of these immature cells. The Ca(V)1.3 Ca(2+) channels showed a very low open probability (about 0.15 at 20 mV: near the peak of an action potential). Comparison of elementary and macroscopic Ca(2+) currents indicated that very few Ca(2+) channels are associated with each docked vesicle at IHC ribbon synapses. Finally, we found that the open probability of Ca(2+) channels, but not their opening time, was voltage dependent. This finding provides a possible correlation between presynaptic Ca(2+) channel properties and the characteristic frequency/amplitude of EPSCs in auditory afferent fibres.

  3. Restructuring of a peat in interaction with multivalent cations: effect of cation type and aging time.

    Directory of Open Access Journals (Sweden)

    Yamuna Kunhi Mouvenchery

    Full Text Available It is assumed to be common knowledge that multivalent cations cross-link soil organic matter (SOM molecules via cation bridges (CaB. The concept has not been explicitly demonstrated in solid SOM by targeted experiments, yet. Therefore, the requirements for and characteristics of CaB remain unidentified. In this study, a combined experimental and molecular modeling approach was adopted to investigate the interaction of cations on a peat OM from physicochemical perspective. Before treatment with salt solutions of Al(3+, Ca(2+ or Na(+, respectively, the original exchangeable cations were removed using cation exchange resin. Cation treatment was conducted at two different values of pH prior to adjusting pH to 4.1. Cation sorption is slower (>>2 h than deprotonation of functional groups (<2 h and was described by a Langmuir model. The maximum uptake increased with pH of cation addition and decreased with increasing cation valency. Sorption coefficients were similar for all cations and at both pH. This contradicts the general expectations for electrostatic interactions, suggesting that not only the interaction chemistry but also spatial distribution of functional groups in OM determines binding of cations in this peat. The reaction of contact angle, matrix rigidity due to water molecule bridges (WaMB and molecular mobility of water (NMR analysis suggested that cross-linking via CaB has low relevance in this peat. This unexpected finding is probably due to the low cation exchange capacity, resulting in low abundance of charged functionalities. Molecular modeling demonstrates that large average distances between functionalities (∼3 nm in this peat cannot be bridged by CaB-WaMB associations. However, aging strongly increased matrix rigidity, suggesting successive increase of WaMB size to connect functionalities and thus increasing degree of cross-linking by CaB-WaMB associations. Results thus demonstrated that the physicochemical structure of OM is

  4. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  5. Adsorption of cationic amylopectin on microcrystalline cellulose.

    NARCIS (Netherlands)

    Steeg, van de H.G.M.; Keizer, de A.; Cohen Stuart, M.A.; Bijsterbosch, B.H.

    1993-01-01

    The effects of electrolyte concentration and pH on the adsorption of cationic amylopectin on microcrystalline cellulose were investigated. The adsorbed amount in the pseudo-plateau of the isotherm showed a maximum as a function of the electrolyte concentration. We compared the data with a recent

  6. Alkynylcarbenium ions and related unsaturated cations

    Energy Technology Data Exchange (ETDEWEB)

    Lukyanov, Sergey M; Koblik, Alla V; Muradyan, Lyudmila A [Institute of Physical and Organic Chemistry, Rostov State University, Rostov-on-Don (Russian Federation)

    1998-10-31

    Published data on carbenium ions containing carbon-carbon triple bonds both directly conjugated with the carbenium centre and separated from it are surveyed and described systematically. Ammonium, diazonium, iminium, phosphonium and iodonium cations containing alkynyl groups, which can be regarded as heteroanalogues of alkynylcarbenium ions, are also considered. The bibliography includes 283 references.

  7. Alkynylcarbenium ions and related unsaturated cations

    International Nuclear Information System (INIS)

    Lukyanov, Sergey M; Koblik, Alla V; Muradyan, Lyudmila A

    1998-01-01

    Published data on carbenium ions containing carbon-carbon triple bonds both directly conjugated with the carbenium centre and separated from it are surveyed and described systematically. Ammonium, diazonium, iminium, phosphonium and iodonium cations containing alkynyl groups, which can be regarded as heteroanalogues of alkynylcarbenium ions, are also considered. The bibliography includes 283 references

  8. Effect of cations on the hydrated proton.

    Science.gov (United States)

    Ottosson, Niklas; Hunger, Johannes; Bakker, Huib J

    2014-09-17

    We report on a strong nonadditive effect of protons and other cations on the structural dynamics of liquid water, which is revealed using dielectric relaxation spectroscopy in the frequency range of 1-50 GHz. For pure acid solutions, protons are known to have a strong structuring effect on water, leading to a pronounced decrease of the dielectric response. We observe that this structuring is reduced when protons are cosolvated with salts. This reduction is exclusively observed for combinations of protons with other ions; for all studied solutions of cosolvated salts, the effect on the structural dynamics of water is observed to be purely additive, even up to high concentrations. We derive an empirical model that quantitatively describes the nonadditive effect of cosolvated protons and cations. We argue that the effect can be explained from the special character of the proton in water and that Coulomb fields exerted by other cations, in particular doubly charged cations like Mg(2+)aq and Ca(2+)aq, induce a localization of the H(+)aq hydration structures.

  9. Mixed cation effect in sodium aluminosilicate glasses

    DEFF Research Database (Denmark)

    Kjeldsen, Jonas; Smedskjær, Morten Mattrup; Mauro, John C.

    , network structure, and the resistances associated with the deformation processes in mixed cation glasses by partially substituting magnesium for calcium and calcium for lithium in sodium aluminosilicate glasses. We use Raman and 27Al NMR spectroscopies to obtain insights into the structural...

  10. Cationic flotation of some lithium ores

    International Nuclear Information System (INIS)

    Valadao, G.E.S.; Peres, A.E.C.; Silva, H.C. da

    1984-01-01

    The cationic flotation of some lithium ores (spodumene, amblygonite, petalite, lepidolite) is studied by the measure of zeta potential and micro-flotation tests in Hallimond tube. The effect of some modifier agents (corn starch, meta sodium silicate) on the lithium flotation is studied. (M.A.C.) [pt

  11. Letter: OCCO*+, NNCO*+ and NNNN*+ radical cations.

    Science.gov (United States)

    Flammang, R; Srinivas, R; Nguyen, M T; Gerbaux, P

    2007-01-01

    Chemical ionization of a mixture of nitrogen and carbon monoxide produces three stable isobaric species at m/z 56: OCCO, OCNN and NNNN radical cations. Separated at increased resolution, these ions are readily identified by collisional activation. Neutralization-reionization experiments performed on two different mass spectrometers have not allowed the detection of any recovery signals for the corresponding neutrals.

  12. Al cation induces aggregation of serum proteins.

    Science.gov (United States)

    Chanphai, P; Kreplak, L; Tajmir-Riahi, H A

    2017-07-15

    Al cation is known to induce protein fibrillation and causes several neurodegenerative disorders. We report the spectroscopic, thermodynamic analysis and AFM imaging for the Al cation binding process with human serum albumin (HSA), bovine serum albumin (BSA) and milk beta-lactoglobulin (b-LG) in aqueous solution at physiological pH. Hydrophobicity played a major role in Al-protein interactions with more hydrophobic b-LG forming stronger Al-protein complexes. Thermodynamic parameters ΔS, ΔH and ΔG showed Al-protein bindings occur via hydrophobic and H-bonding contacts for b-LG, while van der Waals and H-bonding interactions prevail in HSA and BSA adducts. AFM clearly indicated that aluminum cations are able to force BSA and b-LG into larger or more robust aggregates than HSA, with HSA 4±0.2 (SE, n=801) proteins per aggregate, for BSA 17±2 (SE, n=148), and for b-LG 12±3 (SE, n=151). Thioflavin T test showed no major protein fibrillation in the presence of Al cation. Al complexation induced major alterations of protein conformations with the order of perturbations b-LG>BSA>HSA. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Chemical reactivity of cation-exchanged zeolites

    NARCIS (Netherlands)

    Pidko, E.A.

    2008-01-01

    Zeolites modified with metal cations have been extensively studied during the last two decades because of their wide application in different technologically important fields such as catalysis, adsorption and gas separation. Contrary to the well-understood mechanisms of chemical reactions catalyzed

  14. Selective crystallization of cations with crown ethers

    International Nuclear Information System (INIS)

    Heffels, Dennis Egidius

    2014-01-01

    The aim of this work was to study the selectivity and preferences of the incorporation of differently sized cations in the cavities of various crown ethers and the characterization of the resulting compounds. The coordination preferences of crown ethers with different cavities have long been known, and the impact of other effects on the structure formation have increasingly become the focus of attention. In this work a comparative overview of the coordination preferences depending on various factors was undertaken. The focus was mainly on the variation of the cavity of the crown ether in the presence of differently sized cations. In addition, the effects of the solvent and differently coordinating anions have been investigated. Within the framework of this work, basic coordination preferences could be detected with rare earth nitrates, which are affected particularly by the choice of the solvent. The formation of different types of structures could be controlled by varying the conditions such that the incorporation of the cation in the cavity of the crown ether was influenced and the formation of a particular type of structure can be influenced partly by the choice of solvent. In this case no direct preferences for the incorporation into the cavity of the crown ether in relation to the cation size were observed for rare earth cations. However, the coordination of the crown ether leads in each case - for lanthanides - to rather high coordination numbers. A total of five new rare earth complexes and two structural variants could be observed with crown ethers. In the study of the selectivity of the incorporation into the cavity, known structures were also reproduced and further structures were characterized but the crystal structures not entirely solved. With the use of monovalent cations such as potassium, lithium or silver a total of nine new compounds could be synthesized, while no clear preferences for the incorporation of certain cations were detected. The

  15. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits

    Science.gov (United States)

    Torres, Yolima P.; Granados, Sara T.; Latorre, Ramón

    2014-01-01

    Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca2+ concentration, the large conductance voltage- and Ca2+-activated K+ channel (BK) is unique among the superfamily of K+ channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K+ channels) and a large C terminus composed of two regulators of K+ conductance domains (RCK domains), where the Ca2+-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca2+ sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above. PMID:25346693

  16. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits

    Directory of Open Access Journals (Sweden)

    Yolima P. Torres

    2014-10-01

    Full Text Available Coded by a single gene (Slo1, KCM and activated by depolarizing potentials and by a rise in intracellular Ca2+ concentration, the large conductance voltage- and Ca+2-activated K+ channel (BK is unique among the superfamily of K+ channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K+ channels and a large C terminus composed of two regulators of K+ conductance domains (RCK domains, where the Ca2+-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3 & β4 and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca+2 sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above.

  17. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits.

    Science.gov (United States)

    Torres, Yolima P; Granados, Sara T; Latorre, Ramón

    2014-01-01

    Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca(2+) concentration, the large conductance voltage- and Ca(2+)-activated K(+) channel (BK) is unique among the superfamily of K(+) channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K(+) channels) and a large C terminus composed of two regulators of K(+) conductance domains (RCK domains), where the Ca(2+)-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca(2+) sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above.

  18. Polyamines control of cation transport across plant membranes: implications for ion homeostasis and abiotic stress signaling.

    Science.gov (United States)

    Pottosin, Igor; Shabala, Sergey

    2014-01-01

    Polyamines are unique polycationic metabolites, controlling a variety of vital functions in plants, including growth and stress responses. Over the last two decades a bulk of data was accumulated providing explicit evidence that polyamines play an essential role in regulating plant membrane transport. The most straightforward example is a blockage of the two major vacuolar cation channels, namely slow (SV) and fast (FV) activating ones, by the micromolar concentrations of polyamines. This effect is direct and fully reversible, with a potency descending in a sequence Spm(4+) > Spd(3+) > Put(2+). On the contrary, effects of polyamines on the plasma membrane (PM) cation and K(+)-selective channels are hardly dependent on polyamine species, display a relatively low affinity, and are likely to be indirect. Polyamines also affect vacuolar and PM H(+) pumps and Ca(2+) pump of the PM. On the other hand, catabolization of polyamines generates H2O2 and other reactive oxygen species (ROS), including hydroxyl radicals. Export of polyamines to the apoplast and their oxidation there by available amine oxidases results in the induction of a novel ion conductance and confers Ca(2+) influx across the PM. This mechanism, initially established for plant responses to pathogen attack (including a hypersensitive response), has been recently shown to mediate plant responses to a variety of abiotic stresses. In this review we summarize the effects of polyamines and their catabolites on cation transport in plants and discuss the implications of these effects for ion homeostasis, signaling, and plant adaptive responses to environment.

  19. A rice tonoplastic calcium exchanger, OsCCX2 mediates Ca2+/cation transport in yeast

    Science.gov (United States)

    Yadav, Akhilesh K.; Shankar, Alka; Jha, Saroj K.; Kanwar, Poonam; Pandey, Amita; Pandey, Girdhar K.

    2015-01-01

    In plant cell, cations gradient in cellular compartments is maintained by synergistic action of various exchangers, pumps and channels. The Arabidopsis exchanger family members (AtCCX3 and AtCCX5) were previously studied and belong to CaCA (calcium cation exchangers) superfamily while none of the rice CCXs has been functionally characterized for their cation transport activities till date. Rice genome encode four CCXs and only OsCCX2 transcript showed differential expression under abiotic stresses and Ca2+ starvation conditions. The OsCCX2 localized to tonoplast and suppresses the Ca2+ sensitivity of K667 (low affinity Ca2+ uptake deficient) yeast mutant under excess CaCl2 conditions. In contrast to AtCCXs, OsCCX2 expressing K667 yeast cells show tolerance towards excess Na+, Li+, Fe2+, Zn2+ and Co2+ and suggest its ability to transport both mono as well as divalent cations in yeast. Additionally, in contrast to previously characterized AtCCXs, OsCCX2 is unable to complement yeast trk1trk2 double mutant suggesting inability to transport K+ in yeast system. These finding suggest that OsCCX2 having distinct metal transport properties than previously characterized plant CCXs. OsCCX2 can be used as potential candidate for enhancing the abiotic stress tolerance in plants as well as for phytoremediation of heavy metal polluted soil. PMID:26607171

  20. [Noncovalent cation-π interactions--their role in nature].

    Science.gov (United States)

    Fink, Krzysztof; Boratyński, Janusz

    2014-11-07

    Non-covalent interactions play an extremely important role in organisms. The main non-covalent interactions in nature are: ion-ion interactions, dipole-dipole interactions, hydrogen bonds, and van der Waals interactions. A new kind of intermolecular interactions--cation-π interactions--is gaining increasing attention. These interactions occur between a cation and a π system. The main contributors to cation-π interactions are electrostatic, polarization and, to a lesser extent, dispersion interactions. At first, cation-π interactions were studied in a gas phase, with metal cation-aromatic system complexes. The characteristics of these complexes are as follows: an increase of cation atomic number leads to a decrease of interaction energy, and an increase of cation charge leads to an increase of interaction energy. Aromatic amino acids bind with metal cations mainly through interactions with their main chain. Nevertheless, cation-π interaction with a hydrophobic side chain significantly enhances binding energy. In water solutions most cations preferentially interact with water molecules rather than aromatic systems. Cation-π interactions occur in environments with lower accessibility to a polar solvent. Cation-π interactions can have a stabilizing role on the secondary, tertiary and quaternary structure of proteins. These interactions play an important role in substrate or ligand binding sites in many proteins, which should be taken into consideration when the screening of effective inhibitors for these proteins is carried out. Cation-π interactions are abundant and play an important role in many biological processes.

  1. Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide.

    Science.gov (United States)

    Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício

    2015-02-01

    This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Structural implications of hERG K+ channel block by a high-affinity minimally structured blocker

    Science.gov (United States)

    Helliwell, Matthew V.; Zhang, Yihong; El Harchi, Aziza; Du, Chunyun; Hancox, Jules C.; Dempsey, Christopher E.

    2018-01-01

    Cardiac potassium channels encoded by human ether-à-go-go–related gene (hERG) are major targets for structurally diverse drugs associated with acquired long QT syndrome. This study characterized hERG channel inhibition by a minimally structured high-affinity hERG inhibitor, Cavalli-2, composed of three phenyl groups linked by polymethylene spacers around a central amino group, chosen to probe the spatial arrangement of side chain groups in the high-affinity drug-binding site of the hERG pore. hERG current (IhERG) recorded at physiological temperature from HEK293 cells was inhibited with an IC50 of 35.6 nm with time and voltage dependence characteristic of blockade contingent upon channel gating. Potency of Cavalli-2 action was markedly reduced for attenuated inactivation mutants located near (S620T; 54-fold) and remote from (N588K; 15-fold) the channel pore. The S6 Y652A and F656A mutations decreased inhibitory potency 17- and 75-fold, respectively, whereas T623A and S624A at the base of the selectivity filter also decreased potency (16- and 7-fold, respectively). The S5 helix F557L mutation decreased potency 10-fold, and both F557L and Y652A mutations eliminated voltage dependence of inhibition. Computational docking using the recent cryo-EM structure of an open channel hERG construct could only partially recapitulate experimental data, and the high dependence of Cavalli-2 block on Phe-656 is not readily explainable in that structure. A small clockwise rotation of the inner (S6) helix of the hERG pore from its configuration in the cryo-EM structure may be required to optimize Phe-656 side chain orientations compatible with high-affinity block. PMID:29545312

  3. Receptor model for the molecular basis of tissue selectivity of 1,4-dihydropyridine calcium channel drugs

    Science.gov (United States)

    Langs, David A.; Strong, Phyllis D.; Triggle, David J.

    1990-09-01

    Our analysis of the solid state conformations of nifedipine [dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinecarboxylate] and its 1,4-dihydropyridine (1,4-DHP) analogues produced a cartoon description of the important interactions between these drugs and their voltage-dependent calcium channel receptor. In the present study a molecular-level detailed model of the 1,4-DHP receptor binding site has been built from the published amino acid sequence of the 215-1 subunit of the voltage-dependent calcium channel isolated from rabbit skeletal muscle transverse tubule membranes. The voltage-sensing component of the channel described in this work differs from others reported for the homologous sodium channel in that it incorporates a water structure and a staggered, rather than eclipsed, hydrogen bonded S4 helix conformation. The major recognition surfaces of the receptor lie in helical grooves on the S4 or voltagesensing α-helix that is positioned in the center of the bundle of transmembrane helices that define each of the four calcium channel domains. Multiple binding clefts defined by Arg-X-X-Arg-P-X-X-S `reading frames' exist on the S4 strand. The tissue selectivity of nifedipine and its analogues may arise, in part, from conservative changes in the amino acid residues at the P and S positions of the reading frame that define the ester-binding regions of receptors from different tissues. The crystal structures of two tissue-selective nifedipine analogues, nimodipine [isopropyl (2-methoxyethyl) 1,4-dihydro-2,6- dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] and nitrendipine [ethyl methyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinecarboxylate] are reported. Nimodipine was observed to have an unusual ester side chain conformation that enhances the fit to the proposed ester-sensing region of the receptor.

  4. Activation of a Ca2+-dependent cation conductance with properties of TRPM2 by reactive oxygen species in lens epithelial cells.

    Science.gov (United States)

    Keckeis, Susanne; Wernecke, Laura; Salchow, Daniel J; Reichhart, Nadine; Strauß, Olaf

    2017-08-01

    Ion channels are crucial for maintenance of ion homeostasis and transparency of the lens. The lens epithelium is the metabolically and electrophysiologically active cell type providing nutrients, ions and water to the lens fiber cells. Ca 2+ -dependent non-selective ion channels seem to play an important role for ion homeostasis. The aim of the study was to identify and characterize Ca 2+ - and reactive oxygen species (ROS)-dependent non-selective cation channels in human lens epithelial cells. RT-PCR revealed gene expression of the Ca 2+ -activated non-selective cation channels TRPC3, TRPM2, TRPM4 and Ano6 in both primary lens epithelial cells and the cell line HLE-B3, whereas TRPM5 mRNA was only found in HLE-B3 cells. Using whole-cell patch-clamp technique, ionomycin evoked non-selective cation currents with linear current-voltage relationship in both cell types. The current was decreased by flufenamic acid (FFA), 2-APB, 9-phenanthrol and miconazole, but insensitive to DIDS, ruthenium red, and intracellularly applied spermine. H 2 O 2 evoked a comparable current, abolished by FFA. TRPM2 protein expression in HLE-B3 cells was confirmed by means of immunocytochemistry and western blot. In summary, we conclude that lens epithelial cells functionally express Ca 2+ - and H 2 O 2 -activated non-selective cation channels with properties of TRPM2. Copyright © 2017. Published by Elsevier Ltd.

  5. Ginseng gintonin activates the human cardiac delayed rectifier K+ channel: involvement of Ca2+/calmodulin binding sites.

    Science.gov (United States)

    Choi, Sun-Hye; Lee, Byung-Hwan; Kim, Hyeon-Joong; Jung, Seok-Won; Kim, Hyun-Sook; Shin, Ho-Chul; Lee, Jun-Hee; Kim, Hyoung-Chun; Rhim, Hyewhon; Hwang, Sung-Hee; Ha, Tal Soo; Kim, Hyun-Ji; Cho, Hana; Nah, Seung-Yeol

    2014-09-01

    Gintonin, a novel, ginseng-derived G protein-coupled lysophosphatidic acid (LPA) receptor ligand, elicits [Ca(2+)]i transients in neuronal and non-neuronal cells via pertussis toxin-sensitive and pertussis toxin-insensitive G proteins. The slowly activating delayed rectifier K(+) (I(Ks)) channel is a cardiac K(+) channel composed of KCNQ1 and KCNE1 subunits. The C terminus of the KCNQ1 channel protein has two calmodulin-binding sites that are involved in regulating I(Ks) channels. In this study, we investigated the molecular mechanisms of gintonin-mediated activation of human I(Ks) channel activity by expressing human I(Ks) channels in Xenopus oocytes. We found that gintonin enhances IKs channel currents in concentration- and voltage-dependent manners. The EC50 for the I(Ks) channel was 0.05 ± 0.01 μg/ml. Gintonin-mediated activation of the I(Ks) channels was blocked by an LPA1/3 receptor antagonist, an active phospholipase C inhibitor, an IP3 receptor antagonist, and the calcium chelator BAPTA. Gintonin-mediated activation of both the I(Ks) channel was also blocked by the calmodulin (CaM) blocker calmidazolium. Mutations in the KCNQ1 [Ca(2+)]i/CaM-binding IQ motif sites (S373P, W392R, or R539W)blocked the action of gintonin on I(Ks) channel. However, gintonin had no effect on hERG K(+) channel activity. These results show that gintonin-mediated enhancement of I(Ks) channel currents is achieved through binding of the [Ca(2+)]i/CaM complex to the C terminus of KCNQ1 subunit.

  6. Structure relationship of cationic lipids on gene transfection mediated by cationic liposomes.

    Science.gov (United States)

    Paecharoenchai, Orapan; Niyomtham, Nattisa; Apirakaramwong, Auayporn; Ngawhirunpat, Tanasait; Rojanarata, Theerasak; Yingyongnarongkul, Boon-ek; Opanasopit, Praneet

    2012-12-01

    The aim of this study was to investigate the transfection efficiency of cationic liposomes formulated with phosphatidylcholine (PC) and novel synthesized diethanolamine-based cationic lipids at a molar ratio of 5:1 in comparison with Lipofectamine™ 2000. Factors affecting transfection efficiency and cell viability, including the chemical structure of the cationic lipids, such as different amine head group (diamine and polyamine; and non-spermine and spermine) and acyl chain lengths (C14, C16, and C18) and the weight ratio of liposomes to DNA were evaluated on a human cervical carcinoma cell line (HeLa cells) using the pDNA encoding green fluorescent protein (pEGFP-C2). Characterizations of these lipoplexes in terms of size and charge measurement and agarose gel electrophoresis were performed. The results from this study revealed that almost no transfection was observed in the liposome formulations composed of cationic lipids with a non-spermine head group. In addition, the transfection efficiency of these cationic liposomes was in the following order: spermine-C14 > spermine-C16 > spermine-C18. The highest transfection efficiency was observed in the formulation of spermine-C14 liposomes at a weight ratio of 25; furthermore, this formulation was safe for use in vitro. In conclusion, cationic liposomes containing spermine head groups demonstrated promising potential as gene carriers.

  7. Fluconazole affects the alkali-metal-cation homeostasis and susceptibility to cationic toxic compounds of Candida glabrata.

    Science.gov (United States)

    Elicharova, Hana; Sychrova, Hana

    2014-08-01

    Candida glabrata is a salt-tolerant and fluconazole (FLC)-resistant yeast species. Here, we analyse the contribution of plasma-membrane alkali-metal-cation exporters, a cation/proton antiporter and a cation ATPase to cation homeostasis and the maintenance of membrane potential (ΔΨ). Using a series of single and double mutants lacking CNH1 and/or ENA1 genes we show that the inability to export potassium and toxic alkali-metal cations leads to a slight hyperpolarization of the plasma membrane of C. glabrata cells; this hyperpolarization drives more cations into the cells and affects cation homeostasis. Surprisingly, a much higher hyperpolarization of C. glabrata plasma membrane was produced by incubating cells with subinhibitory concentrations of FLC. FLC treatment resulted in a substantially increased sensitivity of cells to various cationic drugs and toxic cations that are driven into the cell by negative-inside plasma-membrane potential. The effect of the combination of FLC plus cationic drug treatment was enhanced by the malfunction of alkali-metal-cation transporters that contribute to the regulation of membrane potential and cation homeostasis. In summary, we show that the combination of subinhibitory concentrations of FLC and cationic drugs strongly affects the growth of C. glabrata cells. © 2014 The Authors.

  8. Slack, Slick, and Sodium-Activated Potassium Channels

    Science.gov (United States)

    Kaczmarek, Leonard K.

    2013-01-01

    The Slack and Slick genes encode potassium channels that are very widely expressed in the central nervous system. These channels are activated by elevations in intracellular sodium, such as those that occur during trains of one or more action potentials, or following activation of nonselective cationic neurotransmitter receptors such as AMPA receptors. This review covers the cellular and molecular properties of Slack and Slick channels and compares them with findings on the properties of sodium-activated potassium currents (termed KNa currents) in native neurons. Human mutations in Slack channels produce extremely severe defects in learning and development, suggesting that KNa channels play a central role in neuronal plasticity and intellectual function. PMID:24319675

  9. (4 + 3) Cycloadditions of Nitrogen-Stabilized Oxyallyl Cations

    Science.gov (United States)

    Lohse, Andrew G.; Hsung, Richard P.

    2011-01-01

    The use of heteroatom-substituted oxyallyl cations in (4 + 3) cycloadditions has had a tremendous impact on the development of cycloaddition chemistry. Extensive efforts have been exerted toward investigating the effect of oxygen-, sulfur-, and halogen-substituents on the reactivity of oxyallyl cations. Most recently, the use of nitrogen-stabilized oxyallyl cations has gained prominence in the area of (4 + 3) cycloadditions. The following article will provide an overview of this concept utilizing nitrogen-stabilized oxyallyl cations. PMID:21384451

  10. Formation of the N-Iodopyridinium Cation in an Alkane Environment

    DEFF Research Database (Denmark)

    Spanget-Larsen, Jens

    2006-01-01

    -iodopyridinium cation (pyI+). This assignment is consistent with the observed polarization data. Ionic side reactions (py-I2 = pyI+ + I–, py-I2 + I2 = pyI+ + I3–, etc.) are easily observed in binary pyridine-iodine mictures and in polar solvents, but not so easily in non-polar media. We are thus surprised to see...... the apparent efficiency with which the pyI+ cation is formed in an apolar and aprotic medium like PE. With excess iodine, the peaks assigned to pyI+ dominate the observed mid-infrared spectrum. We suspect that a driving force for the ionic reaction is the formation of polyiodide anions in the channels...

  11. Properties and function of KCNQ1 K+ channels isolated from the rectal gland of Squalus acanthias.

    Science.gov (United States)

    Kerst, G; Beschorner, U; Unsöld, B; von Hahn, T; Schreiber, R; Greger, R; Gerlach, U; Lang, H J; Kunzelmann, K; Bleich, M

    2001-10-01

    KCNQ1 (KVLQT1) K+ channels play an important role during electrolyte secretion in airways and colon. KCNQ1 was cloned recently from NaCl-secreting shark rectal glands. Here we study the properties and regulation of the cloned sKVLQT1 expressed in Xenopus oocytes and Chinese hamster ovary (CHO) cells and compare the results with those obtained from in vitro perfused rectal gland tubules (RGT). The expression of sKCNQ1 induced voltage-dependent, delayed activated K+ currents, which were augmented by an increase in intracellular cAMP and Ca2+. The chromanol derivatives 293B and 526B potently inhibited sKCNQ1 expressed in oocytes and CHO cells, but had little effect on RGT electrolyte transport. Short-circuit currents in RGT were activated by alkalinization and were decreased by acidification. In CHO cells an alkaline pH activated and an acidic pH inhibited 293B-sensitive KCNQ1 currents. Noise analysis of the cell-attached basolateral membrane of RGT indicated the presence of low-conductance (<3 pS) K+ channels, in parallel with other K+ channels. sKCNQ1 generated similar small-conductance K+ channels upon expression in CHO cells and Xenopus oocytes. The results suggest the presence of low-conductance KCNQ1 K+ channels in RGT, which are probably regulated by changes in intracellular cAMP, Ca2+ and pH.

  12. KV7 Channels Regulate Firing during Synaptic Integration in GABAergic Striatal Neurons

    Directory of Open Access Journals (Sweden)

    M. Belén Pérez-Ramírez

    2015-01-01

    Full Text Available Striatal projection neurons (SPNs process motor and cognitive information. Their activity is affected by Parkinson’s disease, in which dopamine concentration is decreased and acetylcholine concentration is increased. Acetylcholine activates muscarinic receptors in SPNs. Its main source is the cholinergic interneuron that responds with a briefer latency than SPNs during a cortical command. Therefore, an important question is whether muscarinic G-protein coupled receptors and their signaling cascades are fast enough to intervene during synaptic responses to regulate synaptic integration and firing. One of the most known voltage dependent channels regulated by muscarinic receptors is the KV7/KCNQ channel. It is not known whether these channels regulate the integration of suprathreshold corticostriatal responses. Here, we study the impact of cholinergic muscarinic modulation on the synaptic response of SPNs by regulating KV7 channels. We found that KV7 channels regulate corticostriatal synaptic integration and that this modulation occurs in the dendritic/spines compartment. In contrast, it is negligible in the somatic compartment. This modulation occurs on sub- and suprathreshold responses and lasts during the whole duration of the responses, hundreds of milliseconds, greatly altering SPNs firing properties. This modulation affected the behavior of the striatal microcircuit.

  13. Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

    Science.gov (United States)

    Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

    2011-05-06

    Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

  14. Role of TRP channels in the cardiovascular system.

    Science.gov (United States)

    Yue, Zhichao; Xie, Jia; Yu, Albert S; Stock, Jonathan; Du, Jianyang; Yue, Lixia

    2015-02-01

    The transient receptor potential (TRP) superfamily consists of a large number of nonselective cation channels with variable degree of Ca(2+)-permeability. The 28 mammalian TRP channel proteins can be grouped into six subfamilies: canonical, vanilloid, melastatin, ankyrin, polycystic, and mucolipin TRPs. The majority of these TRP channels are expressed in different cell types including both excitable and nonexcitable cells of the cardiovascular system. Unlike voltage-gated ion channels, TRP channels do not have a typical voltage sensor, but instead can sense a variety of other stimuli including pressure, shear stress, mechanical stretch, oxidative stress, lipid environment alterations, hypertrophic signals, and inflammation products. By integrating multiple stimuli and transducing their activity to downstream cellular signal pathways via Ca(2+) entry and/or membrane depolarization, TRP channels play an essential role in regulating fundamental cell functions such as contraction, relaxation, proliferation, differentiation, and cell death. With the use of targeted deletion and transgenic mouse models, recent studies have revealed that TRP channels are involved in numerous cellular functions and play an important role in the pathophysiology of many diseases in the cardiovascular system. Moreover, several TRP channels are involved in inherited diseases of the cardiovascular system. This review presents an overview of current knowledge concerning the physiological functions of TRP channels in the cardiovascular system and their contributions to cardiovascular diseases. Ultimately, TRP channels may become potential therapeutic targets for cardiovascular diseases. Copyright © 2015 the American Physiological Society.

  15. Selective alkylation by photogenerated aryl and vinyl cation

    NARCIS (Netherlands)

    Slegt, Micha

    2006-01-01

    Seven para-substituted phenyl cations and the parent phenyl cation were prepared from iodonium salt precursors. Product studies revealed remarkable chemoselectivity and regioselectivity that could be related to the spin multiplicity of the cations. Also an universal method to fingerprint singlet and

  16. G-protein mediates voltage regulation of agonist binding to muscarinic receptors: effects on receptor-Na+ channel interaction

    International Nuclear Information System (INIS)

    Cohen-Armon, M.; Garty, H.; Sokolovsky, M.

    1988-01-01

    The authors previous experiments in membranes prepared from rat heart and brain led them to suggest that the binding of agonist to the muscarinic receptors and to the Na + channels is a coupled event mediated by guanine nucleotide binding protein(s) [G-protein(s)]. These in vitro findings prompted us to employ synaptoneurosomes from brain stem tissue to examine (i) the binding properties of [ 3 H] acetylcholine at resting potential and under depolarization conditions in the absence and presence of pertussis toxin; (ii) the binding of [ 3 H]batrachotoxin to Na + channel(s) in the presence of the muscarinic agonists; and (iii) muscarinically induced 22 Na + uptake in the presence and absence of tetrodotoxin, which blocks Na + channels. The findings indicate that agonist binding to muscarinic receptors is voltage dependent, that this process is mediated by G-protein(s), and that muscarinic agonists induce opening of Na + channels. The latter process persists even after pertussis toxin treatment, indicating that it is not likely to be mediated by pertussis toxin sensitive G-protein(s). The system with its three interacting components-receptor, G-protein, and Na + channel-is such that at resting potential the muscarinic receptor induces opening of Na + channels; this property may provide a possible physiological mechanism for the depolarization stimulus necessary for autoexcitation or repetitive firing in heart or brain tissues

  17. Discovery of talatisamine as a novel specific blocker for the delayed rectifier K+ channels in rat hippocampal neurons.

    Science.gov (United States)

    Song, M-K; Liu, H; Jiang, H-L; Yue, J-M; Hu, G-Y; Chen, H-Z

    2008-08-13

    Blocking specific K+ channels has been proposed as a promising strategy for the treatment of neurodegenerative diseases. Using a computational virtual screening approach and electrophysiological testing, we found four Aconitum alkaloids are potent blockers of the delayed rectifier K+ channel in rat hippocampal neurons. In the present study, we first tested the action of the four alkaloids on the voltage-gated K+, Na+ and Ca2+ currents in rat hippocampal neurons, and then identified that talatisamine is a specific blocker for the delayed rectifier K+ channel. External application of talatisamine reversibly inhibited the delayed rectifier K+ current (IK) with an IC50 value of 146.0+/-5.8 microM in a voltage-dependent manner, but exhibited very slight blocking effect on the voltage-gated Na+ and Ca2+ currents even at the high concentration of 1-3 mM. Moreover, talatisamine exerted a significant hyperpolarizing shift of the steady-state activation, but did not influence the steady state inactivation of IK and its recovery from inactivation, suggesting that talatisamine had no allosteric action on IK channel and was a pure blocker binding to the external pore entry of the channel. Our present study made the first discovery of potent and specific IK channel blocker from Aconitum alkaloids. It has been argued that suppressing K+ efflux by blocking IK channel may be favorable for Alzheimer's disease therapy. Talatisamine can therefore be considered as a leading compound worthy of further investigations.

  18. Radiation chemistry of aromatic dimer radical cations

    International Nuclear Information System (INIS)

    Okamoto, Kazumasa; Tagawa, Seiichi

    2009-01-01

    π-π Interactions of aromatic molecules are paid attention much in many fields, especially biology, chemistry, and applied physics, represented as protein, DNA, electron donor-accepter complexes, charge transfers, and self assembly molecules. Aromatic molecules including benzene rings are the simplest case to study the π-π interactions. To interpret the charge resonance (CR) structure in the dimer radical cations, spectroscopic and ESR methods have been carried out. The spectroscopic study on the dimer radical ion of molecules with two chromophores would be profitable to identify the electronic and configurational properties. In this article, dynamics of the dimer radical cation of benzenes, polystyrenes, and resist polymers is described on the basis of direct observation of CR band by the nanosecond pulse radiolysis and low temperature γ-radiolysis methods. (author)

  19. Electronic spectrum of 9-methylanthracenium radical cation

    Energy Technology Data Exchange (ETDEWEB)

    O’Connor, Gerard D.; Schmidt, Timothy W., E-mail: timothy.schmidt@unsw.edu.au [School of Chemistry, UNSW Sydney, New South Wales 2052 (Australia); Sanelli, Julian A.; Dryza, Vik; Bieske, Evan J. [School of Chemistry, The University of Melbourne, Victoria 3010 (Australia)

    2016-04-21

    The predissociation spectrum of the cold, argon-tagged, 9-methylanthracenium radical cation is reported from 8000 cm{sup −1} to 44 500 cm{sup −1}. The reported spectrum contains bands corresponding to at least eight electronic transitions ranging from the near infrared to the ultraviolet. These electronic transitions are assigned through comparison with ab initio energies and intensities. The infrared D{sub 1}←D{sub 0} transitions exhibit significant vibronic activity, which is assigned through comparison with TD-B3LYP excited state frequencies and intensities, as well as modelled vibronic interactions. Dissociation of 9-methylanthracenium is also observed at high visible-photon energies, resulting in the loss of either CH{sub 2} or CH{sub 3}. The relevance of these spectra, and the spectra of other polycyclic aromatic hydrocarbon radical cations, to the largely unassigned diffuse interstellar bands, is discussed.

  20. Mechanism of adsorption of cations onto rocks

    International Nuclear Information System (INIS)

    Kitamura, Akira; Yamamoto, Tadashi; Fujiwara, Kenso; Nishikawa, Sataro; Moriyama, Hirotake

    1999-01-01

    Adsorption behavior of cations onto granite was investigated. The distribution coefficient (K d ) of Sr 2+ and Ba 2+ onto granite was determined in the solution of which pH was ranged from 3.5 to 11.3 and ionic strength was set at 10 -2 and 10 -1 . The K d values were found to increase with increasing pH and with deceasing ionic strength. The obtained data were successfully analyzed by applying an electrical double layer model. The optimum parameter values of the double layer electrostatics and adsorption reactions were obtained, and the mechanism of adsorption of cations onto granite was discussed. Feldspar was found to play an important role in their adsorption. (author)

  1. Ionic Selectivity and Permeation Properties of Human PIEZO1 Channels.

    Directory of Open Access Journals (Sweden)

    Radhakrishnan Gnanasambandam

    Full Text Available Members of the eukaryotic PIEZO family (the human orthologs are noted hPIEZO1 and hPIEZO2 form cation-selective mechanically-gated channels. We characterized the selectivity of human PIEZO1 (hPIEZO1 for alkali ions: K+, Na+, Cs+ and Li+; organic cations: TMA and TEA, and divalents: Ba2+, Ca2+, Mg2+ and Mn2+. All monovalent ions permeated the channel. At a membrane potential of -100 mV, Cs+, Na+ and K+ had chord conductances in the range of 35-55 pS with the exception of Li+, which had a significantly lower conductance of ~ 23 pS. The divalents decreased the single-channel permeability of K+, presumably because the divalents permeated slowly and occupied the open channel for a significant fraction of the time. In cell-attached mode, 90 mM extracellular divalents had a conductance for inward currents carried by the divalents of: 25 pS for Ba2+ and 15 pS for Ca2+ at -80 mV and 10 pS for Mg2+ at -50 mV. The organic cations, TMA and TEA, permeated slowly and attenuated K+ currents much like the divalents. As expected, the channel K+ conductance increased with K+ concentration saturating at ~ 45 pS and the KD of K+ for the channel was 32 mM. Pure divalent ion currents were of lower amplitude than those with alkali ions and the channel opening rate was lower in the presence of divalents than in the presence of monovalents. Exposing cells to the actin disrupting reagent cytochalasin D increased the frequency of openings in cell-attached patches probably by reducing mechanoprotection.

  2. Regulation of Cation Balance in Saccharomyces cerevisiae

    Science.gov (United States)

    Cyert, Martha S.; Philpott, Caroline C.

    2013-01-01

    All living organisms require nutrient minerals for growth and have developed mechanisms to acquire, utilize, and store nutrient minerals effectively. In the aqueous cellular environment, these elements exist as charged ions that, together with protons and hydroxide ions, facilitate biochemical reactions and establish the electrochemical gradients across membranes that drive cellular processes such as transport and ATP synthesis. Metal ions serve as essential enzyme cofactors and perform both structural and signaling roles within cells. However, because these ions can also be toxic, cells have developed sophisticated homeostatic mechanisms to regulate their levels and avoid toxicity. Studies in Saccharomyces cerevisiae have characterized many of the gene products and processes responsible for acquiring, utilizing, storing, and regulating levels of these ions. Findings in this model organism have often allowed the corresponding machinery in humans to be identified and have provided insights into diseases that result from defects in ion homeostasis. This review summarizes our current understanding of how cation balance is achieved and modulated in baker’s yeast. Control of intracellular pH is discussed, as well as uptake, storage, and efflux mechanisms for the alkali metal cations, Na+ and K+, the divalent cations, Ca2+ and Mg2+, and the trace metal ions, Fe2+, Zn2+, Cu2+, and Mn2+. Signal transduction pathways that are regulated by pH and Ca2+ are reviewed, as well as the mechanisms that allow cells to maintain appropriate intracellular cation concentrations when challenged by extreme conditions, i.e., either limited availability or toxic levels in the environment. PMID:23463800

  3. Bupivacaine inhibits large conductance, voltage- and Ca2+- activated K+ channels in human umbilical artery smooth muscle cells

    Science.gov (United States)

    Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica

    2012-01-01

    Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134

  4. Diclofenac Distinguishes among Homomeric and Heteromeric Potassium Channels Composed of KCNQ4 and KCNQ5 SubunitsS⃞

    Science.gov (United States)

    Brueggemann, Lioubov I.; Mackie, Alexander R.; Martin, Jody L.; Cribbs, Leanne L.

    2011-01-01

    KCNQ4 and KCNQ5 potassium channel subunits are expressed in vascular smooth muscle cells, although it remains uncertain how these subunits assemble to form functional channels. Using patch-clamp techniques, we compared the electrophysiological characteristics and effects of diclofenac, a known KCNQ channel activator, on human KCNQ4 and KCNQ5 channels expressed individually or together in A7r5 rat aortic smooth muscle cells. The conductance curves of the overexpressed channels were fitted by a single Boltzmann function in each case (V0.5 values: −31, −44, and −38 mV for KCNQ4, KCNQ5, and KCNQ4/5, respectively). Diclofenac (100 μM) inhibited KCNQ5 channels, reducing maximum conductance by 53%, but increased maximum conductance of KCNQ4 channels by 38%. The opposite effects of diclofenac on KCNQ4 and KCNQ5 could not be attributed to the presence of a basic residue (lysine) in the voltage-sensing domain of KCNQ5, because mutation of this residue to neutral glycine (the residue present in KCNQ4) resulted in a more effective block of the channel. Differences in deactivation rates and distinct voltage-dependent effects of diclofenac on channel activation and deactivation observed with each of the subunit combinations (KCNQ4, KCNQ5, and KCNQ4/5) were used as diagnostic tools to evaluate native KCNQ currents in vascular smooth muscle cells. A7r5 cells express only KCNQ5 channels endogenously, and their responses to diclofenac closely resembled those of the overexpressed KCNQ5 currents. In contrast, mesenteric artery myocytes, which express both KCNQ4 and KCNQ5 channels, displayed whole-cell KCNQ currents with properties and diclofenac responses characteristic of overexpressed heteromeric KCNQ4/5 channels. PMID:20876743

  5. The function and molecular identity of inward rectifier channels in vestibular hair cells of the mouse inner ear

    Science.gov (United States)

    Levin, Michaela E.

    2012-01-01

    Inner ear hair cells respond to mechanical stimuli with graded receptor potentials. These graded responses are modulated by a host of voltage-dependent currents that flow across the basolateral membrane. Here, we examine the molecular identity and the function of a class of voltage-dependent ion channels that carries the potassium-selective inward rectifier current known as IK1. IK1 has been identified in vestibular hair cells of various species, but its molecular composition and functional contributions remain obscure. We used quantitative RT-PCR to show that the inward rectifier gene, Kir2.1, is highly expressed in mouse utricle between embryonic day 15 and adulthood. We confirmed Kir2.1 protein expression in hair cells by immunolocalization. To examine the molecular composition of IK1, we recorded voltage-dependent currents from type II hair cells in response to 50-ms steps from −124 to −54 in 10-mV increments. Wild-type cells had rapidly activating inward currents with reversal potentials close to the K+ equilibrium potential and a whole-cell conductance of 4.8 ± 1.5 nS (n = 46). In utricle hair cells from Kir2.1-deficient (Kir2.1−/−) mice, IK1 was absent at all stages examined. To identify the functional contribution of Kir2.1, we recorded membrane responses in current-clamp mode. Hair cells from Kir2.1−/− mice had significantly (P < 0.001) more depolarized resting potentials and larger, slower membrane responses than those of wild-type cells. These data suggest that Kir2.1 is required for IK1 in type II utricle hair cells and contributes to hyperpolarized resting potentials and fast, small amplitude receptor potentials in response to current inputs, such as those evoked by hair bundle deflections. PMID:22496522

  6. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  7. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    Science.gov (United States)

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  8. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  9. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes.

    Science.gov (United States)

    Karpuk, Nikolay; Burkovetskaya, Maria; Kielian, Tammy

    2012-07-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)(+) astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (G(i)) measurements spanning a membrane potential (V(m)) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive G(i) increments vs. V(m), respectively. A1 and A2 astrocytes displayed significantly different RMP, G(i), and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting G(i) was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation.

  10. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    DEFF Research Database (Denmark)

    Enríquez Denton, M; Wienecke, Jacob; Zhang, Mengliang

    2012-01-01

    time, the likely amplifying processes at work in respiratory motoneurones. In phrenic motoneurones, which control the most important respiratory muscle, the diaphragm, we found that the mechanism most favoured by investigations in other motoneurones, the activation of persistent inward currents via...

  11. Reducible cationic lipids for gene transfer.

    Science.gov (United States)

    Wetzer, B; Byk, G; Frederic, M; Airiau, M; Blanche, F; Pitard, B; Scherman, D

    2001-01-01

    One of the main challenges of gene therapy remains the increase of gene delivery into eukaryotic cells. We tested whether intracellular DNA release, an essential step for gene transfer, could be facilitated by using reducible cationic DNA-delivery vectors. For this purpose, plasmid DNA was complexed with cationic lipids bearing a disulphide bond. This reduction-sensitive linker is expected to be reduced and cleaved in the reducing milieu of the cytoplasm, thus potentially improving DNA release and consequently transfection. The DNA--disulphide-lipid complexation was monitored by ethidium bromide exclusion, and the size of complexes was determined by dynamic light scattering. It was found that the reduction kinetics of disulphide groups in DNA--lipid complexes depended on the position of the disulphide linker within the lipid molecule. Furthermore, the internal structure of DNA--lipid particles was examined by small-angle X-ray scattering before and after lipid reduction. DNA release from lipid complexes was observed after the reduction of disulphide bonds of several lipids. Cell-transfection experiments suggested that complexes formed with selected reducible lipids resulted in up to 1000-fold higher reporter-gene activity, when compared with their analogues without disulphide bonds. In conclusion, reduction-sensitive groups introduced into cationic lipid backbones potentially allow enhanced DNA release from DNA--lipid complexes after intracellular reduction and represent a tool for improved vectorization. PMID:11389682

  12. Tuning the ion selectivity of two-pore channels

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Jiangtao; Zeng, Weizhong; Jiang, Youxing (UTSMC)

    2017-01-17

    Organellar two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in plants and animals. Interestingly, plant and animal TPCs share high sequence similarity in the filter region, yet exhibit drastically different ion selectivity. Plant TPC1 functions as a nonselective cation channel on the vacuole membrane, whereas mammalian TPC channels have been shown to be endo/lysosomal Na+-selective or Ca2+-release channels. In this study, we performed systematic characterization of the ion selectivity of TPC1 from Arabidopsis thaliana (AtTPC1) and compared its selectivity with the selectivity of human TPC2 (HsTPC2). We demonstrate that AtTPC1 is selective for Ca2+ over Na+, but nonselective among monovalent cations (Li+, Na+, and K+). Our results also confirm that HsTPC2 is a Na+-selective channel activated by phosphatidylinositol 3,5-bisphosphate. Guided by our recent structure of AtTPC1, we converted AtTPC1 to a Na+-selective channel by mimicking the selectivity filter of HsTPC2 and identified key residues in the TPC filters that differentiate the selectivity between AtTPC1 and HsTPC2. Furthermore, the structure of the Na+-selective AtTPC1 mutant elucidates the structural basis for Na+ selectivity in mammalian TPCs.

  13. Citizens and service channels: channel choice and channel management implications

    NARCIS (Netherlands)

    Pieterson, Willem Jan

    2010-01-01

    The arrival of electronic channels in the 1990s has had a huge impact on governmental service delivery. The new channels have led to many new opportunities to improve public service delivery, not only in terms of citizen satisfaction, but also in cost reduction for governmental agencies. However,

  14. Cerebrovascular endothelin-1 hyper-reactivity is associated with transient receptor potential canonical channels 1 and 6 activation and delayed cerebral hypoperfusion after forebrain ischaemia in rats

    DEFF Research Database (Denmark)

    Johansson, S E; Andersen, X E D R; Hansen, R H

    2015-01-01

    . METHODS: Experimental forebrain ischaemia was induced in Wistar male rats by a two-vessel occlusion model, and the cerebral blood flow was measured by magnetic resonance imaging two days after reperfusion. In vitro vasoreactivity studies, immunofluorescence and quantitative PCR were performed on cerebral...... in the vascular smooth muscle cells was enhanced and correlated with decreased cerebral blood flow two days after forebrain ischaemia. Furthermore, under conditions when voltage-dependent calcium channels were inhibited, endothelin-1-induced cerebrovascular contraction was enhanced and this enhancement...... was presumably mediated by Ca(2+) influx via upregulated transient receptor potential canonical channels 1 and 6. CONCLUSIONS: Our data demonstrates that endothelin-1-mediated influx of extracellular Ca(2+) activates transient receptor potential canonical channels 1 and 6 in cerebral vascular smooth muscle cells...

  15. Anchoring cationic amphiphiles for nucleotide delivery: significance of DNA release from cationic liposomes for transfection.

    Science.gov (United States)

    Hirashima, Naohide; Minatani, Kazuhiro; Hattori, Yoshifumi; Ohwada, Tomohiko; Nakanishi, Mamoru

    2007-06-01

    We have designed and synthesized lithocholic acid-based cationic amphiphile molecules as components of cationic liposomes for gene transfection (lipofection). To study the relationship between the molecular structures of those amphiphilic molecules, particularly the extended hydrophobic appendant (anchor) at the 3-hydroxyl group, and transfection efficiency, we synthesized several lithocholic and isolithocholic acid derivatives, and examined their transfection efficiency. We also compared the physico-chemical properties of cationic liposomes prepared from these derivatives. We found that isolithocholic acid derivatives exhibit higher transfection efficiency than the corresponding lithocholic acid derivatives. This result indicates that the orientation and extension of hydrophobic regions influence the gene transfection process. Isolithocholic acid derivatives showed a high ability to encapsulate DNA in a compact liposome-DNA complex and to protect it from enzymatic degradation. Isolithocholic acid derivatives also facilitated the release of DNA from the liposome-DNA complex, which is a crucial step for DNA entry into the nucleus. Our results show that the transfection efficiency is directly influenced by the ability of the liposome complex to release DNA, rather than by the DNA-encapsulating ability. Molecular modeling revealed that isolithocholic acid derivatives take relatively extended conformations, while the lithocholic acid derivatives take folded structures. Thus, the efficiency of release of DNA from cationic liposomes in the cytoplasm, which contributes to high transfection efficiency, appears to be dependent upon the molecular shape of the cationic amphiphiles.

  16. Comparative analysis of cation/proton antiporter superfamily in plants.

    Science.gov (United States)

    Ye, Chu-Yu; Yang, Xiaohan; Xia, Xinli; Yin, Weilun

    2013-06-01

    The cation/proton antiporter superfamily is associated with the transport of monovalent cations across membranes. This superfamily was annotated in the Arabidopsis genome and some members were functionally characterized. In the present study, a systematic analysis of the cation/proton antiporter genes in diverse plant species was reported. We identified 240 cation/proton antiporters in alga, moss, and angiosperm. A phylogenetic tree was constructed showing these 240 members are separated into three families, i.e., Na(+)/H(+) exchangers, K(+) efflux antiporters, and cation/H(+) exchangers. Our analysis revealed that tandem and/or segmental duplications contribute to the expansion of cation/H(+) exchangers in the examined angiosperm species. Sliding window analysis of the nonsynonymous/synonymous substitution ratios showed some differences in the evolutionary fate of cation/proton antiporter paralogs. Furthermore, we identified over-represented motifs among these 240 proteins and found most motifs are family specific, demonstrating diverse evolution of the cation/proton antiporters among three families. In addition, we investigated the co-expressed genes of the cation/proton antiporters in Arabidopsis thaliana. The results showed some biological processes are enriched in the co-expressed genes, suggesting the cation/proton antiporters may be involved in these biological processes. Taken together, this study furthers our knowledge on cation/proton antiporters in plants. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. A metal-ion NMR investigation of the antibiotic facilitated transport of monovalent cations through the walls of phospholipid vesicles. II. Sulfur-33 NMR

    International Nuclear Information System (INIS)

    Buster, D.C.

    1988-01-01

    A technique has been developed to investigate the antibiotic facilitated transmembrane transport of monovalent cations using 23 Na and 7 Li Nuclear Magnetic Resonance spectroscopy. The initial portion of this thesis outlines the production and characterization of a model lipid system amenable to the NMR detection of cation transport. Large unilamellar vesicles (LUV) have been prepared from a 4:1 mixture of phosphatidylcholine and phosphatidylglycerol. The presence of the anionic chemical shift reagent dysprosium (III) tripolyphosphate, either inside or outside of the vesicles, allows for the spectroscopic separation of the NMR resonances arising from the inter- and extravesicular cation pools. The cation transporting properties of the channel-forming pentadecapeptide, gramicidin D, have been studied using the NMR technique

  18. Physical origin of selectivity in ionic channels of biological membranes.

    Science.gov (United States)

    Laio, A; Torre, V

    1999-01-01

    This paper shows that the selectivity properties of monovalent cation channels found in biological membranes can originate simply from geometrical properties of the inner core of the channel without any critical contribution from electrostatic interactions between the permeating ions and charged or polar groups. By using well-known techniques of statistical mechanics, such as the Langevin equations and Kramer theory of reaction rates, a theoretical equation is provided relating the permeability ratio PB/PA between ions A and B to simple physical properties, such as channel geometry, thermodynamics of ion hydration, and electrostatic interactions between the ion and charged (or polar) groups. Diffusive corrections and recrossing rates are also considered and evaluated. It is shown that the selectivity found in usual K+, gramicidin, Na+, cyclic nucleotide gated, and end plate channels can be explained also in the absence of any charged or polar group. If these groups are present, they significantly change the permeability ratio only if the ion at the selectivity filter is in van der Waals contact with them, otherwise these groups simply affect the channel conductance, lowering the free energy barrier of the same amount for the two ions, thus explaining why single channel conductance, as it is experimentally observed, can be very different in channels sharing the same selectivity sequence. The proposed theory also provides an estimate of channel minimum radius for K+, gramicidin, Na+, and cyclic nucleotide gated channels.

  19. MarkoLAB: A simulator to study ionic channel's stochastic behavior.

    Science.gov (United States)

    da Silva, Robson Rodrigues; Goroso, Daniel Gustavo; Bers, Donald M; Puglisi, José Luis

    2017-08-01

    Mathematical models of the cardiac cell have started to include markovian representations of the ionic channels instead of the traditional Hodgkin & Huxley formulations. There are many reasons for this: Markov models are not restricted to the idea of independent gates defining the channel, they allow more complex description with specific transitions between open, closed or inactivated states, and more importantly those states can be closely related to the underlying channel structure and conformational changes. We used the LabVIEW ® and MATLAB ® programs to implement the simulator MarkoLAB that allow a dynamical 3D representation of the markovian model of the channel. The Monte Carlo simulation was used to implement the stochastic transitions among states. The user can specify the voltage protocol by setting the holding potential, the step-to voltage and the duration of the stimuli. The most studied feature of a channel is the current flowing through it. This happens when the channel stays in the open state, but most of the time, as revealed by the low open probability values, the channel remains on the inactive or closed states. By focusing only when the channel enters or leaves the open state we are missing most of its activity. MarkoLAB proved to be quite useful to visualize the whole behavior of the channel and not only when the channel produces a current. Such dynamic representation provides more complete information about channel kinetics and will be a powerful tool to demonstrate the effect of gene mutations or drugs on the channel function. MarkoLAB provides an original way of visualizing the stochastic behavior of a channel. It clarifies concepts, such as recovery from inactivation, calcium- versus voltage-dependent inactivation, and tail currents. It is not restricted to ionic channels only but it can be extended to other transporters, such as exchangers and pumps. This program is intended as a didactical tool to illustrate the dynamical behavior of a

  20. Radical cations of quadricyclane and norbornadiene in polar ZSM-5 matrices: Radical cation photochemical transformations without photons

    International Nuclear Information System (INIS)

    Barnabas, M.V.; Trifunac, A.D.

    1994-01-01

    Radical cations of quadricyclane (Q) and norbornadiene (NBD) are produced by γ-radiolysis in zeolites. In polar ZSM-5, only one radical cation is initially observed below 100K. Increasing the temperature above 200K gives rise to the cyclopentadiene radical cation. Higher temperatures (>360K) give rise to the cyclopenten-4-yl radical. The observation of cyclopentadiene radical cation implies the occurrence of the reverse Diels-Alder reaction. This is a thermally forbidden, photochemically allowed, process, which is made possible by the interaction of the polar zeolite matrix sites with parent NBD and Q radical cations

  1. Zinc-dependent multi-conductance channel activity in mitochondria isolated from ischemic brain.

    Science.gov (United States)

    Bonanni, Laura; Chachar, Mushtaque; Jover-Mengual, Teresa; Li, Hongmei; Jones, Adrienne; Yokota, Hidenori; Ofengeim, Dimitry; Flannery, Richard J; Miyawaki, Takahiro; Cho, Chang-Hoon; Polster, Brian M; Pypaert, Marc; Hardwick, J Marie; Sensi, Stefano L; Zukin, R Suzanne; Jonas, Elizabeth A

    2006-06-21

    Transient global ischemia is a neuronal insult that induces delayed cell death. A hallmark event in the early post-ischemic period is enhanced permeability of mitochondrial membranes. The precise mechanisms by which mitochondrial function is disrupted are, as yet, unclear. Here we show that global ischemia promotes alterations in mitochondrial membrane contact points, a rise in intramitochondrial Zn2+, and activation of large, multi-conductance channels in mitochondrial outer membranes by 1 h after insult. Mitochondrial channel activity was associated with enhanced protease activity and proteolytic cleavage of BCL-xL to generate its pro-death counterpart, deltaN-BCL-xL. The findings implicate deltaN-BCL-xL in large, multi-conductance channel activity. Consistent with this, large channel activity was mimicked by introduction of recombinant deltaN-BCL-xL to control mitochondria and blocked by introduction of a functional BCL-xL antibody to post-ischemic mitochondria via the patch pipette. Channel activity was also inhibited by nicotinamide adenine dinucleotide, indicative of a role for the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane. In vivo administration of the membrane-impermeant Zn2+ chelator CaEDTA before ischemia or in vitro application of the membrane-permeant Zn2+ chelator tetrakis-(2-pyridylmethyl) ethylenediamine attenuated channel activity, suggesting a requirement for Zn2+. These findings reveal a novel mechanism by which ischemic insults disrupt the functional integrity of the outer mitochondrial membrane and implicate deltaN-BCL-xL and VDAC in the large, Zn2+-dependent mitochondrial channels observed in post-ischemic hippocampal mitochondria.

  2. A structural, functional, and computational analysis suggests pore flexibility as the base for the poor selectivity of CNG channels.

    Science.gov (United States)

    Napolitano, Luisa Maria Rosaria; Bisha, Ina; De March, Matteo; Marchesi, Arin; Arcangeletti, Manuel; Demitri, Nicola; Mazzolini, Monica; Rodriguez, Alex; Magistrato, Alessandra; Onesti, Silvia; Laio, Alessandro; Torre, Vincent

    2015-07-07

    Cyclic nucleotide-gated (CNG) ion channels, despite a significant homology with the highly selective K(+) channels, do not discriminate among monovalent alkali cations and are permeable also to several organic cations. We combined electrophysiology, molecular dynamics (MD) simulations, and X-ray crystallography to demonstrate that the pore of CNG channels is highly flexible. When a CNG mimic is crystallized in the presence of a variety of monovalent cations, including Na(+), Cs(+), and dimethylammonium (DMA(+)), the side chain of Glu66 in the selectivity filter shows multiple conformations and the diameter of the pore changes significantly. MD simulations indicate that Glu66 and the prolines in the outer vestibule undergo large fluctuations, which are modulated by the ionic species and the voltage. This flexibility underlies the coupling between gating and permeation and the poor ionic selectivity of CNG channels.

  3. Heteromeric Kv7.2/7.3 channels differentially regulate action potential initiation and conduction in neocortical myelinated axons.

    Science.gov (United States)

    Battefeld, Arne; Tran, Baouyen T; Gavrilis, Jason; Cooper, Edward C; Kole, Maarten H P

    2014-03-05

    Rapid energy-efficient signaling along vertebrate axons is achieved through intricate subcellular arrangements of voltage-gated ion channels and myelination. One recently appreciated example is the tight colocalization of K(v)7 potassium channels and voltage-gated sodium (Na(v)) channels in the axonal initial segment and nodes of Ranvier. The local biophysical properties of these K(v)7 channels and the functional impact of colocalization with Na(v) channels remain poorly understood. Here, we quantitatively examined K(v)7 channels in myelinated axons of rat neocortical pyramidal neurons using high-resolution confocal imaging and patch-clamp recording. K(v)7.2 and 7.3 immunoreactivity steeply increased within the distal two-thirds of the axon initial segment and was mirrored by the conductance density estimates, which increased from ~12 (proximal) to 150 pS μm(-2) (distal). The axonal initial segment and nodal M-currents were similar in voltage dependence and kinetics, carried by K(v)7.2/7.3 heterotetramers, 4% activated at the resting membrane potential and rapidly activated with single-exponential time constants (~15 ms at 28 mV). Experiments and computational modeling showed that while somatodendritic K(v)7 channels are strongly activated by the backpropagating action potential to attenuate the afterdepolarization and repetitive firing, axonal K(v)7 channels are minimally recruited by the forward-propagating action potential. Instead, in nodal domains K(v)7.2/7.3 channels were found to increase Na(v) channel availability and action potential amplitude by stabilizing the resting membrane potential. Thus, K(v)7 clustering near axonal Na(v) channels serves specific and context-dependent roles, both restraining initiation and enhancing conduction of the action potential.

  4. PRRT2 controls neuronal excitability by negatively modulating Na+ channel 1.2/1.6 activity.

    Science.gov (United States)

    Fruscione, Floriana; Valente, Pierluigi; Sterlini, Bruno; Romei, Alessandra; Baldassari, Simona; Fadda, Manuela; Prestigio, Cosimo; Giansante, Giorgia; Sartorelli, Jacopo; Rossi, Pia; Rubio, Alicia; Gambardella, Antonio; Nieus, Thierry; Broccoli, Vania; Fassio, Anna; Baldelli, Pietro; Corradi, Anna; Zara, Federico; Benfenati, Fabio

    2018-04-01

    See Lerche (doi:10.1093/brain/awy073) for a scientific commentary on this article.Proline-rich transmembrane protein 2 (PRRT2) is the causative gene for a heterogeneous group of familial paroxysmal neurological disorders that include seizures with onset in the first year of life (benign familial infantile seizures), paroxysmal kinesigenic dyskinesia or a combination of both. Most of the PRRT2 mutations are loss-of-function leading to haploinsufficiency and 80% of the patients carry the same frameshift mutation (c.649dupC; p.Arg217Profs*8), which leads to a premature stop codon. To model the disease and dissect the physiological role of PRRT2, we studied the phenotype of neurons differentiated from induced pluripotent stem cells from previously described heterozygous and homozygous siblings carrying the c.649dupC mutation. Single-cell patch-clamp experiments on induced pluripotent stem cell-derived neurons from homozygous patients showed increased Na+ currents that were fully rescued by expression of wild-type PRRT2. Closely similar electrophysiological features were observed in primary neurons obtained from the recently characterized PRRT2 knockout mouse. This phenotype was associated with an increased length of the axon initial segment and with markedly augmented spontaneous and evoked firing and bursting activities evaluated, at the network level, by multi-electrode array electrophysiology. Using HEK-293 cells stably expressing Nav channel subtypes, we demonstrated that the expression of PRRT2 decreases the membrane exposure and Na+ current of Nav1.2/Nav1.6, but not Nav1.1, channels. Moreover, PRRT2 directly interacted with Nav1.2/Nav1.6 channels and induced a negative shift in the voltage-dependence of inactivation and a slow-down in the recovery from inactivation. In addition, by co-immunoprecipitation assays, we showed that the PRRT2-Nav interaction also occurs in brain tissue. The study demonstrates that the lack of PRRT2 leads to a hyperactivity of voltage-dependent

  5. PRRT2 controls neuronal excitability by negatively modulating Na+ channel 1.2/1.6 activity

    Science.gov (United States)

    Fruscione, Floriana; Valente, Pierluigi; Sterlini, Bruno; Romei, Alessandra; Baldassari, Simona; Fadda, Manuela; Prestigio, Cosimo; Giansante, Giorgia; Sartorelli, Jacopo; Rossi, Pia; Rubio, Alicia; Gambardella, Antonio; Nieus, Thierry; Broccoli, Vania; Fassio, Anna; Baldelli, Pietro; Corradi, Anna; Zara, Federico

    2018-01-01

    Abstract See Lerche (doi:10.1093/brain/awy073) for a scientific commentary on this article. Proline-rich transmembrane protein 2 (PRRT2) is the causative gene for a heterogeneous group of familial paroxysmal neurological disorders that include seizures with onset in the first year of life (benign familial infantile seizures), paroxysmal kinesigenic dyskinesia or a combination of both. Most of the PRRT2 mutations are loss-of-function leading to haploinsufficiency and 80% of the patients carry the same frameshift mutation (c.649dupC; p.Arg217Profs*8), which leads to a premature stop codon. To model the disease and dissect the physiological role of PRRT2, we studied the phenotype of neurons differentiated from induced pluripotent stem cells from previously described heterozygous and homozygous siblings carrying the c.649dupC mutation. Single-cell patch-clamp experiments on induced pluripotent stem cell-derived neurons from homozygous patients showed increased Na+ currents that were fully rescued by expression of wild-type PRRT2. Closely similar electrophysiological features were observed in primary neurons obtained from the recently characterized PRRT2 knockout mouse. This phenotype was associated with an increased length of the axon initial segment and with markedly augmented spontaneous and evoked firing and bursting activities evaluated, at the network level, by multi-electrode array electrophysiology. Using HEK-293 cells stably expressing Nav channel subtypes, we demonstrated that the expression of PRRT2 decreases the membrane exposure and Na+ current of Nav1.2/Nav1.6, but not Nav1.1, channels. Moreover, PRRT2 directly interacted with Nav1.2/Nav1.6 channels and induced a negative shift in the voltage-dependence of inactivation and a slow-down in the recovery from inactivation. In addition, by co-immunoprecipitation assays, we showed that the PRRT2-Nav interaction also occurs in brain tissue. The study demonstrates that the lack of PRRT2 leads to a hyperactivity of

  6. Cationic niosomes an effective gene carrier composed of novel spermine-derivative cationic lipids: effect of central core structures.

    Science.gov (United States)

    Opanasopit, Praneet; Leksantikul, Lalita; Niyomtham, Nattisa; Rojanarata, Theerasak; Ngawhirunpat, Tanasait; Yingyongnarongkul, Boon-Ek

    2017-05-01

    Cationic niosomes formulated from Span 20, cholesterol (Chol) and novel spermine-based cationic lipids of multiple central core structures (di(oxyethyl)amino, di(oxyethyl)amino carboxy, 3-amino-1,2-dioxypropyl and 2-amino-1,3-dioxypropyl) were successfully prepared for improving transfection efficiency in vitro. The niosomes composed of spermine cationic lipid with central core structure of di(oxyethyl)amino revealed the highest gene transfection efficiency. To investigate the factors affecting gene transfection and cell viability including differences in the central core structures of cationic lipids, the composition of vesicles, molar ratio of cationic lipids in formulations and the weight ratio of niosomes to DNA. Cationic niosomes composed of nonionic surfactants (Span20), cholesterol and spermine-based cationic lipids of multiple central core structures were formulated. Gene transfection and cell viability were evaluated on a human cervical carcinoma cell line (HeLa cells) using pDNA encoding green fluorescent protein (pEGFP-C2). The morphology, size and charge were also characterized. High transfection efficiency was obtained from cationic niosomes composed of Span20:Chol:cationic lipid at the molar ratio of 2.5:2.5:0.5 mM. Cationic lipids with di(oxyethyl)amino as a central core structure exhibited highest transfection efficiency. In addition, there was also no serum effect on transfection efficiency. These novel cationic niosomes may constitute a good alternative carrier for gene transfection.

  7. Interactions of solutes and streambed sediment: 1. An experimental analysis of cation and anion transport in a mountain stream

    Science.gov (United States)

    Bencala, Kenneth E.; Kennedy, Vance C.; Zellweger, Gary W.; Jackman, Alan P.; Avanzino, Ronald J.

    1984-01-01

    An experimental injection was performed to study the transport of stream water solutes under conditions of significant interaction with streambed sediments in a mountain pool-and-riffle stream. Experiments were conducted in Little Lost Man Creek, Humboldt County, California, in a period of low flow duringwhich only a part of the bank-full channel held active surface flow. The injection of chloride and several trace cations lasted 20 days. In this report we discuss the results of the first 24 hours of the injection and survey the results of the first 10 days. Solute-streambed interactions of two types were observed. First, the physical transport of the conservative tracer, chloride, was affected by intergravel flow and stagnant watt, zones created by the bed relief. Second, the transport of the cations (strontium, potassium, and lithium) was appreciably modified by sorption onto streambed sediment. In the stream the readily observable consequence of the solute-streambed interactions was an attenuation of the dissolved concentration of each of the tracers. The attenuation in the stream channel occurred concurrently with the storage of tracers in the streambed via both physical and chemical processes. All tracers were subsequently present in shallow wells dug several meters from the wetted part of the channel. Sediment samples collected approximately 3 weeks after the start of the injection contained increased concentrations of the injected cations.

  8. Joint Single-Channel Speech Separation and Speaker Identification

    DEFF Research Database (Denmark)

    Mowlaee, Pejman; Saeidi, Rahim; Tan, Zheng-Hua

    2010-01-01

    In this paper, we propose a closed loop system to improve the performance of single-channel speech separation in a speaker independent scenario. The system is composed of two interconnected blocks: a separation block and a speaker identiſcation block. The improvement is accomplished by incorporat......In this paper, we propose a closed loop system to improve the performance of single-channel speech separation in a speaker independent scenario. The system is composed of two interconnected blocks: a separation block and a speaker identiſcation block. The improvement is accomplished...... enhances the quality of the separated output signals. To assess the improvements, the results are reported in terms of PESQ for both target and masked signals....

  9. Functional roles of the amino terminal domain in determining biophysical properties of Cx50 gap junction channels

    Directory of Open Access Journals (Sweden)

    Li eXin

    2013-12-01

    Full Text Available Communication through gap junction channels is essential for synchronized and coordinated cellular activities. The gap junction channel pore size, its switch control for opening/closing, and the modulations by chemicals can be different depending on the connexin subtypes that compose the channel. Recent structural and functional studies provide compelling evidence that the amino terminal (NT domains of several connexins line the pore of gap junction channels and play an important role in single channel conductance (γj and transjunctional voltage-dependent gating (Vj-gating. This article reviews recent studies conducted on a series of mutations/chimeras in the NT domain of connexin50 (Cx50. Functional examination of the gap junction channels formed by these mutants/chimeras shows the net charge number at the NT domain to be an important factor in γj and in Vj-gating. Furthermore, with an increase in the net negative charge at the NT domain, we observed an increase in the γj, as well as changes in the parameters of the Boltzmann fit of the normalized steady-state conductance and Vj relationship. Our data are consistent with a structural model where the NT domain of Cx50 lines the gap junction pore and plays an important role in sensing Vj and in the subsequent conformational changes leading to gating, as well as in limiting the rate of ion permeation.

  10. Propylparaben reduces the excitability of hippocampal neurons by blocking sodium channels.

    Science.gov (United States)

    Lara-Valderrábano, Leonardo; Rocha, Luisa; Galván, Emilio J

    2016-12-01

    Propylparaben (PPB) is an antimicrobial preservative widely used in food, cosmetics, and pharmaceutics. Virtual screening methodologies predicted anticonvulsant activity of PPB that was confirmed in vivo. Thus, we explored the effects of PPB on the excitability of hippocampal neurons by using standard patch clamp techniques. Bath perfusion of PPB reduced the fast-inactivating sodium current (I Na ) amplitude, causing a hyperpolarizing shift in the inactivation curve of the I Na, and markedly delayed the sodium channel recovery from the inactivation state. Also, PPB effectively suppressed the riluzole-sensitive, persistent sodium current (I NaP ). PPB perfusion also modified the action potential kinetics, and higher concentrations of PPB suppressed the spike activity. Nevertheless, the modulatory effects of PPB did not occur when PPB was internally applied by whole-cell dialysis. These results indicate that PPB reduces the excitability of CA1 pyramidal neurons by modulating voltage-dependent sodium channels. The mechanistic basis of this effect is a marked delay in the recovery from inactivation state of the voltage-sensitive sodium channels. Our results indicate that similar to local anesthetics and anticonvulsant drugs that act on sodium channels, PPB acts in a use-dependent manner. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  12. Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.

    Science.gov (United States)

    Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L

    2016-02-25

    Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Cation-Cation Complexes of Pentavalent Uranyl: From Disproportionation Intermediates to Stable Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mougel, Victor; Horeglad, Pawel; Nocton, Gregory; Pecaut, Jacques; Mazzanti, Marinella [CEA, INAC, SCIB, Laboratoire de Reconnaissance Ionique et Chimie de Coordination, CEA-Grenoble, 38054 GRENOBLE, Cedex 09 (France)

    2010-07-01

    Three new cation cation complexes of pentavalent uranyl, stable with respect to the disproportionation reaction, have been prepared from the reaction of the precursor [(UO{sub 2}py{sub 5})-(KI{sub 2}py{sub 2})]{sub n} (1) with the Schiff base ligands salen{sup 2-}, acacen{sup 2-}, and salophen{sup 2-} (H{sub 2}salen N, N'-ethylene-bis(salicylidene-imine), H{sub 2}acacen=-N, N'-ethylenebis(acetylacetone-imine), H{sub 2}salophen=N, N'-phenylene-bis(salicylidene-imine)). The preparation of stable complexes requires a careful choice of counter ions and reaction conditions. Notably the reaction of 1 with salophen{sup 2-} in pyridine leads to immediate disproportionation, but in the presence of [18]crown-6 ([18]C-6) a stable complex forms. The solid-state structure of the four tetra-nuclear complexes ([UO{sub 2}-(acacen)]{sub 4}[{mu}{sub 8}-]{sub 2}[K([18]C-6)(py)]{sub 2}) (3) and ([UO{sub 2}(acacen)](4)[{mu}{sub 8}-]).2[K([222])(py)] (4) ([UO{sub 2}(salophen)](4)[{mu}{sub 8}-K]{sub 2}[mu(5)-KI]{sub 2}[(K([18]C-6)]).2 [K([18]C-6)-(thf){sub 2}].2I (5), and ([UO{sub 2}(salen)(4)][{mu}{sub 8}-Rb]{sub 2}[Rb([18]C-6)]{sub 2}) (9) ([222] = [222]cryptand, py =pyridine), presenting a T-shaped cation cation interaction has been determined by X-ray crystallographic studies. NMR spectroscopic and UV/Vis studies show that the tetra-nuclear structure is maintained in pyridine solution for the salen and acacen complexes. Stable mononuclear complexes of pentavalent uranyl are also obtained by reduction of the hexavalent uranyl Schiff base complexes with cobaltocene in pyridine in the absence of coordinating cations. The reactivity of the complex [U{sup V}O{sub 2}(salen)(py)][Cp*{sub 2}Co] with different alkali ions demonstrates the crucial effect of coordinating cations on the stability of cation cation complexes. The nature of the cation plays a key role in the preparation of stable cation cation complexes. Stable tetra-nuclear complexes form in the presence of K

  14. Complexes of natural carbohydrates with metal cations

    International Nuclear Information System (INIS)

    Alekseev, Yurii E; Garnovskii, Alexander D; Zhdanov, Yu A

    1998-01-01

    Data on the interaction of natural carbohydrates (mono-, oligo-, and poly-saccharides, amino sugars, and natural organic acids of carbohydrate origin) with metal cations are surveyed and described systematically. The structural diversity of carbohydrate metal complexes, caused by some specific features of carbohydrates as ligands, is demonstrated. The influence of complex formation on the chemical properties of carbohydrates is discussed. It is shown that the formation of metal complexes plays an important role in the configurational and conformational analysis of carbohydrates. The practical significance of the coordination interaction in the series of carbohydrate ligands is demonstrated. The bibliography includes 571 references.

  15. Complex Macromolecular Architectures by Living Cationic Polymerization

    KAUST Repository

    Alghamdi, Reem D.

    2015-05-01

    Poly (vinyl ether)-based graft polymers have been synthesized by the combination of living cationic polymerization of vinyl ethers with other living or controlled/ living polymerization techniques (anionic and ATRP). The process involves the synthesis of well-defined homopolymers (PnBVE) and co/terpolymers [PnBVE-b-PCEVE-b-PSiDEGVE (ABC type) and PSiDEGVE-b-PnBVE-b-PSiDEGVE (CAC type)] by sequential living cationic polymerization of n-butyl vinyl ether (nBVE), 2-chloroethyl vinyl ether (CEVE) and tert-butyldimethylsilyl ethylene glycol vinyl ether (SiDEGVE), using mono-functional {[n-butoxyethyl acetate (nBEA)], [1-(2-chloroethoxy) ethyl acetate (CEEA)], [1-(2-(2-(t-butyldimethylsilyloxy)ethoxy) ethoxy) ethyl acetate (SiDEGEA)]} or di-functional [1,4-cyclohexanedimethanol di(1-ethyl acetate) (cHMDEA), (VEMOA)] initiators. The living cationic polymerizations of those monomers were conducted in hexane at -20 0C using Et3Al2Cl3 (catalyst) in the presence of 1 M AcOEt base.[1] The PCEVE segments of the synthesized block terpolymers were then used to react with living macroanions (PS-DPE-Li; poly styrene diphenyl ethylene lithium) to afford graft polymers. The quantitative desilylation of PSiDEGVE segments by n-Bu4N+F- in THF at 0 °C led to graft co- and terpolymers in which the polyalcohol is the outer block. These co-/terpolymers were subsequently subjected to “grafting-from” reactions by atom transfer radical polymerization (ATRP) of styrene to afford more complex macromolecular architectures. The base assisted living cationic polymerization of vinyl ethers were also used to synthesize well-defined α-hydroxyl polyvinylether (PnBVE-OH). The resulting polymers were then modified into an ATRP macro-initiator for the synthesis of well-defined block copolymers (PnBVE-b-PS). Bifunctional PnBVE with terminal malonate groups was also synthesized and used as a precursor for more complex architectures such as H-shaped block copolymer by “grafting-from” or

  16. Homogeneous cation exchange membrane by radiation grafting

    International Nuclear Information System (INIS)

    Kolhe, Shailesh M.; G, Agathian; Ashok Kumar

    2001-01-01

    Preparation of a strong cation exchange membrane by radiation grafting of styrene on to polyethylene (LDPE) film by mutual irradiation technique in the presence of air followed by sulfonation is described. The grafting has been carried out in the presence of air and without any additive. Low dose rate has been seen to facilitate the grafting. Further higher the grafting percentage more is the exchange capacity. The addition of a swelling agent during the sulfonation helped in achieving the high exchange capacity. The TGA-MASS analysis confirmed the grafting and the sulfonation. (author)

  17. The Importance of the Dissociation Rate in Ion Channel Blocking

    Directory of Open Access Journals (Sweden)

    Hugo Zeberg

    2018-02-01

    Full Text Available Understanding the relationships between the rates and dynamics of current wave forms under voltage clamp conditions is essential for understanding phenomena such as state-dependence and use-dependence, which are fundamental for the action of drugs used as anti-epileptics, anti-arrhythmics, and anesthetics. In the present study, we mathematically analyze models of blocking mechanisms. In previous experimental studies of potassium channels we have shown that the effect of local anesthetics can be explained by binding to channels in the open state. We therefore here examine models that describe the effect of a blocking drug that binds to a non-inactivating channel in its open state. Such binding induces an inactivation-like current decay at higher potential steps. The amplitude of the induced peak depends on voltage and concentration of blocking drug. In the present study, using analytical methods, we (i derive a criterion for the existence of a peak in the open probability time evolution for a model with an arbitrary number of closed states, (ii derive formula for the relative height of the peak amplitude, and (iii determine the voltage dependence of the relative peak height. Two findings are apparent: (1 the dissociation (unbinding rate constant is important for the existence of a peak in the current waveform, while the association (binding rate constant is not, and (2 for a peak to exist it suffices that the dissociation rate must be smaller than the absolute value of all eigenvalues to the kinetic matrix describing the model.

  18. Cl- channels of the gastric parietal cell that are active at low pH.

    Science.gov (United States)

    Cuppoletti, J; Baker, A M; Malinowska, D H

    1993-06-01

    HCl secretion across mammalian gastric parietal cell apical membrane may involve Cl- channels. H(+)-K(+)-ATPase-containing membranes isolated from gastric mucosa of histamine-stimulated rabbits were fused to planar lipid bilayers. Channels were recorded with symmetric 800 mM CsCl solutions, pH 7.4. A linear current-voltage (I-V) relationship was obtained, and conductance was 28 +/- 1 pS at 800 mM CsCl. Conductance was 6.9 +/- 2 pS at 150 mM CsCl. Reversal potential was +22 mV with a fivefold cis-trans CsCl concentration gradient, indicating that the channel was anion selective with a discrimination ratio of 6:1 for Cl- over Cs+. Anion selectivity of the channel was I- > Cl- > or = Br- > NO3-, and gluconate was impermeant. Channels obtained at pH 7.4 persisted when pH of medium bathing the trans side of the bilayer (pHtrans) was reduced to pH 3, without a change in conductance, linearity of I-V relationship, or ion selectivity. In contrast, asymmetric reduction of pH of medium bathing the cis side of the bilayer from 7.4 to 3 always resulted in loss of channel activity. At pH 7.4, open probability (Po) of the channel was voltage dependent, i.e., predominantly open at +80 mV but mainly closed at -80 mV. In contrast, with low pHtrans, channel Po at -80 mV was increased 3.5-fold. The Cl- channel was Ca2+ indifferent. In absence of ionophores, ion selectivity for support of H(+)-K(+)-ATPase activity and H+ transport was consistent with that exhibited by the channel and could be limited by substitution with NO3-, whereas maximal H(+)-K(+)-ATPase activity was indifferent to anion present, demonstrating that anion transport can be rate limiting. Cl- channels with similar characteristics (conductance, linear I-V relationship, and ion selectivity) were also present in H(+)-K(+)-ATPase-containing vesicles isolated from resting (cimetidine-treated) gastric mucosa, exhibiting at -80 mV a pH-independent approximately 3.5-fold lower Po than stimulated vesicle channels. At -80 m

  19. Molecular analysis of a thylakoid K+ channel

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-05-01

    The work undertaken during the prior granting period sought to use a novel probe to identify and clone plant ion (K) channels. It was also proposed that in vitro biochemical studies of cation transport across purified preparations of thylakoid membrane be employed to characterize a putative K channel in this membrane system. Over the last several years (including those of the previous grant period), an enormous data base of partially-sequenced mRNAs and numerous genomes (including those of plants) has evolved and provides a powerful alternative to this brute-force approach to identify and clone cDNAs ending physiologically important membrane proteins such as channels. The utility of searching genetic databases for relevant sequences, in addition to the difficulty of working with membrane proteins, led to changes in research focus during the prior granting period, and has resulted in the identification of a new class of plant ion channels, which will be the focus of research during the proposed new granting period.

  20. Ion Permeation and Mechanotransduction Mechanisms of Mechanosensitive Piezo Channels.

    Science.gov (United States)

    Zhao, Qiancheng; Wu, Kun; Geng, Jie; Chi, Shaopeng; Wang, Yanfeng; Zhi, Peng; Zhang, Mingmin; Xiao, Bailong

    2016-03-16

    Piezo proteins have been proposed as the long-sought-after mechanosensitive cation channels in mammals that play critical roles in various mechanotransduction processes. However, the molecular bases that underlie their ion permeation and mechanotransduction have remained functionally undefined. Here we report our finding of the miniature pore-forming module of Piezo1 that resembles the pore architecture of other trimeric channels and encodes the essential pore properties. We further identified specific residues within the pore module that determine unitary conductance, pore blockage and ion selectivity for divalent and monovalent cations and anions. The non-pore-containing region of Piezo1 confers mechanosensitivity to mechano-insensitive trimeric acid-sensing ion channels, demonstrating that Piezo1 channels possess intrinsic mechanotransduction modules separate from their pore modules. In conclusion, this is the first report on the bona fide pore module and mechanotransduction components of Piezo channels, which define their ion-conducting properties and gating by mechanical stimuli, respectively. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Structure and dynamics of cationic membrane peptides and proteins: Insights from solid-state NMR

    Science.gov (United States)

    Hong, Mei; Su, Yongchao

    2011-01-01

    Many membrane peptides and protein domains contain functionally important cationic Arg and Lys residues, whose insertion into the hydrophobic interior of the lipid bilayer encounters significant energy barriers. To understand how these cationic molecules overcome the free energy barrier to insert into the lipid membrane, we have used solid-state NMR spectroscopy to determine the membrane-bound topology of these peptides. A versatile array of solid-state NMR experiments now readily yields the conformation, dynamics, orientation, depth of insertion, and site-specific protein–lipid interactions of these molecules. We summarize key findings of several Arg-rich membrane peptides, including β-sheet antimicrobial peptides, unstructured cell-penetrating peptides, and the voltage-sensing helix of voltage-gated potassium channels. Our results indicate the central role of guanidinium-phosphate and guanidinium-water interactions in dictating the structural topology of these cationic molecules in the lipid membrane, which in turn account for the mechanisms of this functionally diverse class of membrane peptides. PMID:21344534

  2. USACE Navigation Channels 2012

    Data.gov (United States)

    California Natural Resource Agency — This dataset represents both San Francisco and Los Angeles District navigation channel lines. All San Francisco District channel lines were digitized from CAD files...

  3. Calcium channel blocker overdose

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/002580.htm Calcium-channel blocker overdose To use the sharing features on this page, please enable JavaScript. Calcium-channel blockers are a type of medicine used ...

  4. Cationic polymers in water treatment: Part 1: Treatability of water with cationic polymers

    Czech Academy of Sciences Publication Activity Database

    Polasek, P.; Mutl, Silvestr

    2002-01-01

    Roč. 28, č. 1 (2002), s. 69-82 ISSN 0378-4738 R&D Projects: GA AV ČR KSK2067107 Keywords : cationic polymers * treatability * water quality Subject RIV: BK - Fluid Dynamics Impact factor: 0.481, year: 2002

  5. Alkali Metal Cation versus Proton and Methyl Cation Affinities: Structure and Bonding Mechanism.

    Science.gov (United States)

    Boughlala, Zakaria; Fonseca Guerra, Célia; Bickelhaupt, F Matthias

    2016-06-01

    We have analyzed the structure and bonding of gas-phase Cl-X and [HCl-X](+) complexes for X(+)= H(+), CH3 (+), Li(+), and Na(+), using relativistic density functional theory (DFT). We wish to establish a quantitative trend in affinities of the anionic and neutral Lewis bases Cl(-) and HCl for the various cations. The Cl-X bond becomes longer and weaker along X(+) = H(+), CH3 (+), Li(+), and Na(+). Our main purpose is to understand the heterolytic bonding mechanism behind the intrinsic (i.e., in the absence of solvent) alkali metal cation affinities (AMCA) and how this compares with and differs from those of the proton affinity (PA) and methyl cation affinity (MCA). Our analyses are based on Kohn-Sham molecular orbital (KS-MO) theory in combination with a quantitative energy decomposition analysis (EDA) that pinpoints the importance of the different features in the bonding mechanism. Orbital overlap appears to play an important role in determining the trend in cation affinities.

  6. Cobalt 60 cation exchange with mexican clays

    International Nuclear Information System (INIS)

    Nava Galve, R.G.

    1993-01-01

    Mexican clays can be used to remove radioactive elements from contaminated aqueous solutions. Cation exchange experiments were performed with 60 Co radioactive solution. In the present work the effect of contact time on the sorption of Co 2+ was studied. The contact time in hydrated montmorillonite was from 5 to 120 minutes and in dehydrated montmorillonite 5 to 1400 minutes. The Co 2+ uptake value was, in hydrated montmorillonite, between 0.3 to 0.85 m eq/g and in dehydrated montmorillonite, between 0.6 to 1.40 m eq/g. The experiments were done in a pH 5.1 to 5.7 and normal conditions. XRD patterns were used to characterize the samples. The crystallinity was determined by X-ray Diffraction and it was maintained before and after the cation exchange. DTA thermo grams showed the temperatures of the lost humidity and crystallization water. Finally, was observed that dehydrated montmorillonite adsorb more cobalt than hydrated montmorillonite. (Author)

  7. Cationic antimicrobial peptides in penaeid shrimp.

    Science.gov (United States)

    Tassanakajon, Anchalee; Amparyup, Piti; Somboonwiwat, Kunlaya; Supungul, Premruethai

    2011-08-01

    Penaeid shrimp aquaculture has been consistently affected worldwide by devastating diseases that cause a severe loss in production. To fight a variety of harmful microbes in the surrounding environment, particularly at high densities (of which intensive farming represents an extreme example), shrimps have evolved and use a diverse array of antimicrobial peptides (AMPs) as part of an important first-line response of the host defense system. Cationic AMPs in penaeid shrimps composed of penaeidins, crustins, and anti-lipopolysaccharide factors are comprised of multiple classes or isoforms and possess antibacterial and antifungal activities against different strains of bacteria and fungi. Shrimp AMPs are primarily expressed in circulating hemocytes, which is the main site of the immune response, and hemocytes expressing AMPs probably migrate to infection sites to fight against pathogen invasion. Indeed, most AMPs are produced as early as the nauplii developmental stage to protect shrimp larvae from infections. In this review, we discuss the sequence diversity, expression, gene structure, and antimicrobial activities of cationic AMPs in penaeid shrimps. The information available on antimicrobial activities indicates that these shrimp AMPs have potential therapeutic applications in the control of disease problems in aquaculture.

  8. Cationic Antimicrobial Polymers and Their Assemblies

    Science.gov (United States)

    Carmona-Ribeiro, Ana Maria; de Melo Carrasco, Letícia Dias

    2013-01-01

    Cationic compounds are promising candidates for development of antimicrobial agents. Positive charges attached to surfaces, particles, polymers, peptides or bilayers have been used as antimicrobial agents by themselves or in sophisticated formulations. The main positively charged moieties in these natural or synthetic structures are quaternary ammonium groups, resulting in quaternary ammonium compounds (QACs). The advantage of amphiphilic cationic polymers when compared to small amphiphilic molecules is their enhanced microbicidal activity. Besides, many of these polymeric structures also show low toxicity to human cells; a major requirement for biomedical applications. Determination of the specific elements in polymers, which affect their antimicrobial activity, has been previously difficult due to broad molecular weight distributions and random sequences characteristic of radical polymerization. With the advances in polymerization control, selection of well defined polymers and structures are allowing greater insight into their structure-antimicrobial activity relationship. On the other hand, antimicrobial polymers grafted or self-assembled to inert or non inert vehicles can yield hybrid antimicrobial nanostructures or films, which can act as antimicrobials by themselves or deliver bioactive molecules for a variety of applications, such as wound dressing, photodynamic antimicrobial therapy, food packing and preservation and antifouling applications. PMID:23665898

  9. Cationic Antimicrobial Polymers and Their Assemblies

    Directory of Open Access Journals (Sweden)

    Ana Maria Carmona-Ribeiro

    2013-05-01

    Full Text Available Cationic compounds are promising candidates for development of antimicrobial agents. Positive charges attached to surfaces, particles, polymers, peptides or bilayers have been used as antimicrobial agents by themselves or in sophisticated formulations. The main positively charged moieties in these natural or synthetic structures are quaternary ammonium groups, resulting in quaternary ammonium compounds (QACs. The advantage of amphiphilic cationic polymers when compared to small amphiphilic molecules is their enhanced microbicidal activity. Besides, many of these polymeric structures also show low toxicity to human cells; a major requirement for biomedical applications. Determination of the specific elements in polymers, which affect their antimicrobial activity, has been previously difficult due to broad molecular weight distributions and random sequences characteristic of radical polymerization. With the advances in polymerization control, selection of well defined polymers and structures are allowing greater insight into their structure-antimicrobial activity relationship. On the other hand, antimicrobial polymers grafted or self-assembled to inert or non inert vehicles can yield hybrid antimicrobial nanostructures or films, which can act as antimicrobials by themselves or deliver bioactive molecules for a variety of applications, such as wound dressing, photodynamic antimicrobial therapy, food packing and preservation and antifouling applications.

  10. Basic exchangeable cations in Finnish mineral soils

    Directory of Open Access Journals (Sweden)

    Armi Kaila

    1972-09-01

    Full Text Available The content of exchangeable Ca, Mg, K and Na replaced by neutral ammonium acetate was determined in 470 samples of mineral soils from various parts of Finland, except from Lapland. The amount of all these cations tended to increase with an increase in the clay content, but variation within each textural class was large, and the ranges usually overlapped those of the other classes. The higher acidity of virgin surface soils was connected with a lower average degree of saturation by Ca as compared with the corresponding textural classes of cultivated soils. No significant difference in the respective contents of other cations was detected. The samples of various textural groups from deeper layers were usually poorer in exchangeable Ca and K than the corresponding groups of plough layer. The mean content of exchangeable Mg was equal or even higher in the samples from deeper layers than in the samples from plough layer, except in the group of sand soils. The percentage of Mg of the effective CEC increased, as an average, from 9 in the sand and fine sand soils of plough layer to 30 in the heavy clay soils; in the heavy clay soils from deeper layers its mean value was 38 ± 4 %. In the samples of plough layer, the mean ratio of Ca to Mg in sand and fine sand soils was about 9, in silt and loam soils about 6, in the coarser clay soils about 4, and in heavy clay about 2.

  11. The action of blocking agents applied to the inner face of Ca(2+)-activated K+ channels from human erythrocytes.

    Science.gov (United States)

    Dunn, P M

    1998-09-15

    The actions of clotrimazole and cetiedil, two drugs known to inhibit the Gardos channel, have been studied on single intermediate conductance calcium-activated potassium (IKCa) channels in inside out patches from human red blood cells, and compared with those of TEA and Ba2+ applied to the cytoplasmic face of the membrane. TEA produced a fast block which was observed as a reduction